EP0944724A1 - Use of a vector expressing dna polymerase beta as medicine - Google Patents

Use of a vector expressing dna polymerase beta as medicine

Info

Publication number
EP0944724A1
EP0944724A1 EP97951311A EP97951311A EP0944724A1 EP 0944724 A1 EP0944724 A1 EP 0944724A1 EP 97951311 A EP97951311 A EP 97951311A EP 97951311 A EP97951311 A EP 97951311A EP 0944724 A1 EP0944724 A1 EP 0944724A1
Authority
EP
European Patent Office
Prior art keywords
vector
dna polymerase
cell
thymidine
dna
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP97951311A
Other languages
German (de)
French (fr)
Inventor
Christophe Cazaux
Jean Gérard TIRABY
Pascal Fons
Jean-Sébastien HOFFMANN
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Centre National de la Recherche Scientifique CNRS
Original Assignee
Centre National de la Recherche Scientifique CNRS
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Centre National de la Recherche Scientifique CNRS filed Critical Centre National de la Recherche Scientifique CNRS
Publication of EP0944724A1 publication Critical patent/EP0944724A1/en
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
    • C12N9/1241—Nucleotidyltransferases (2.7.7)
    • C12N9/1252—DNA-directed DNA polymerase (2.7.7.7), i.e. DNA replicase
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/43—Enzymes; Proenzymes; Derivatives thereof
    • A61K38/45—Transferases (2)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A61P31/14—Antivirals for RNA viruses
    • A61P31/18—Antivirals for RNA viruses for HIV
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2799/00—Uses of viruses
    • C12N2799/02—Uses of viruses as vector
    • C12N2799/021—Uses of viruses as vector for the expression of a heterologous nucleic acid

Definitions

  • the present invention relates to the use of a vector expressing ⁇ DNA polymerase as DNA-drug in the context of molecular therapy for cancer and viral diseases such as AIDS.
  • Gene immunotherapy is the use of tumor-infiltrating lymphocytes (TIL), which are highly tumor-killing. When transformed, they carry interleukin genes (IL2, IL4, IL6, interferon ⁇ ) to the tumor which will locally activate the immune response, allowing both a limitation of side effects on the organism and an amplification of their anti-tumor effect.
  • TIL tumor-infiltrating lymphocytes
  • ganciclovir in the case of HSV-TK, 6-methoxypurine (ara-M) with VZV- into very toxic to the cell.
  • TK 5-fluorocytosine (5-FC) with CodA and 6-thioxanthine (6-TX) with GPT.
  • TK viral thymidine kinase
  • ACV acyclovir
  • GCV ganciclovir
  • BVDU bromovinyldoxyoxyidine
  • the present invention proposes to implement a suicide gene of a new type, the function of which consists in facilitating the incorporation of a nucleotide analogue into the DNA of the target cell after phosphorylation of the nucleoside prodrug, optionally by a suicide gene ". classic ".
  • DNA polymerase ⁇ The incorporation of nucleotides into DNA is naturally carried out in eukaryotic cells by DNA polymerases.
  • DNA polymerase ⁇ presents some peculiarities.
  • ⁇ DNA polymerase is a 39 kD polypeptide and is a highly conserved enzyme in higher eukaryotes (Kornberg et al, 1992). Its primary function would be the repair of damaged DNA (Sobol et al., 1996) but it also has a role in the replication of native DNA (Jenkins et al. 1992; Sweasy et al., 1992).
  • ⁇ DNA polymerase is expressed at a constant level during the cell cycle (Zmudzka et al, 1988) and the exposure of the cell to xenobiotic agents such as radiation induces its expression (Srivastava et al., 1995; Fornace et al , 1989). It is distinguished from other polymerases by its small size and its unfaithful nature during DNA replication, infidelity linked to the absence of associated corrective exonuclease activities (Kunkel et al., 1986).
  • DNA polymerase ⁇ incorporates ddCMP (dideoxycytidine triphosphorylated), an inhibitor of DNA synthesis, with an efficiency comparable to that observed for the incorporation of the natural antagonist dCMP or deoxycytidine monophosphate (Copeland et al. 1992). Very similar results have been published with AZT (Copeland et al, 1992; Parker et al, 1991). //; vivo, AZT-MP (mono-phosphorylated azidothymidine) is indeed incorporated into cellular DNA (Sommadossi et al., 1989) and it has been suggested that ⁇ DNA polymerase plays a role in this process (Parker and al., 1991).
  • ddCMP dideoxycytidine triphosphorylated
  • the subject of the present invention is in particular the use of a vector expressing DNA polymerase ⁇ or an analogue of DNA polymerase ⁇ in order to ensure integration into the DNA of a cell of nucleotide analogues with anti-viral or anti-tumor activity, for the manufacture of a medicament intended for the treatment of cancer or of a viral disease such as AIDS.
  • DNA polymerase ⁇ analog is meant any nucleotide sequence having at least 80% homology with the nucleotide sequence of mammalian DNA polymerase ⁇ and fulfilling the same functions.
  • the present invention therefore consists in inducing an intracellular overproduction of an enzyme normally weakly present in the cell, namely DNA polymerase ⁇ , in order to amplify its unfaithful and mutagenic character and thus force integration into the DNA of nucleotide analogs.
  • an enzyme normally weakly present in the cell namely DNA polymerase ⁇
  • the present invention also relates to an expression vector comprising a gene coding for DNA polymerase ⁇ or an analog of DNA polymerase ⁇ .
  • the vector is intended to express ⁇ DNA polymerase in tumor cells or cells infected with a virus such as the AIDS virus. It is therefore advantageous to place said gene under the control of an efficient expression system in the target cells.
  • the expression vector according to the present invention comprises a targeting sequence and / or tissue specific expression in which one wishes to be expressed DNA polymerase ⁇ (or an analog), such as tumors or tissues infected with viruses; as an example, we can cite stem cells haematopoietic agents for the eradication of CD4 + lymphocytes infected with the virus
  • the expression vector according to the present invention may be any commonly used vector for gene therapy and in particular a viral vector derived from a virus selected from adenovirus, adeno-associated viruses, retroviruses
  • HIV herpes viruses
  • poxviruses poxviruses
  • parvoviruses plasmoviruses
  • DNA polymerase ⁇ allows the incorporation of nucleotide analogs into DNA.
  • certain nucleoside analogs are known to exhibit anti-viral activity when they are phosphorylated, that is to say in the form of nucleotides. This is particularly the case for AZT and ddC. These nucleoside analogs are normally non-toxic to cells. However, after phosphorylation and in the presence of DNA polymerase ⁇
  • phosphorylation in question can in particular be carried out by thymidine and / or thymidilate kinases.
  • the use of a vector expressing ⁇ DNA polymerase (or analog) in accordance with the present invention can be potentiated by the expression, within the same target cells or tissues, of the thymidine and / or thymidilate kinase gene.
  • the cells in which the DNA polymerase ⁇ and thymidine and / or thymidilate kinase are expressed are therefore made more sensitive to nucleoside analogues such as AZT or ddC which, in situ, are phosphorylated before being incorporated in DNA.
  • the thymidine and / or thymidilate kinase gene can be inserted on the same vector as that expressing ⁇ DNA polymerase or on another vector.
  • the target cell will undergo a co-transfection to allow the expression of each of the genes concerned.
  • the gene coding for the thymidine and / or thymidilate kinase will be placed under the control of an efficient expression system in the target cells to be reached.
  • the present invention also relates to cells transformed with an expression vector in accordance with the invention comprising a gene coding for DNA polymerase ⁇ (or analog) and optionally also comprising a gene coding for thymidine and / or thymidilate kinase as well as cells transformed with an expression vector in accordance with the invention comprising the two above-mentioned genes.
  • the vectors in accordance with the present invention can be used as cloning vectors. Indeed, the insertion of a multisite Heur (polylinker) into the gene coding for DNA polymerase ⁇ (or an analog) without modifying the reading frame, itself inserted in a vector such as pUT-pol ⁇ or pZHTk ⁇ , makes it possible to clone a gene of interest. Recombinant cells transfected with this type of vector are easily selected since they have become resistant to nucleoside analogues such as AZT or ddC, following the inactivation of the DNA polymerase ⁇ gene (or analog).
  • a multisite Heur polylinker
  • a vector such as pUT-pol ⁇ or pZHTk ⁇
  • the subject of the present invention is a product containing an expression vector according to the invention comprising a gene coding for DNA polymerase ⁇ (or analog) and a gene coding for thymidine and / or thymidilate kinase or two vectors. of expression each comprising one of the genes in question and at least one anti-viral agent as a combination product for simultaneous, separate or spread over time use.
  • the anti-viral agent is AZT or ddC.
  • FIG. 1 represents the construction of the vector pUT-pol ⁇ from the vector pUT 687.
  • Figure 2 represents the percentage of survival of d ⁇ .coli SC 18-12 cells transformed by the vector pUT-pol ⁇ at different temperatures, in the presence of AZT.
  • Figure 3 shows the construction of the vector pZHTk ⁇ from the vector pZEOSGO.
  • FIG. 4 illustrates the comparison, in percentage of survival, of the B16 cells transfected with the vector pUT-pol ⁇ or with a control vector pUT 526 ⁇ in the presence of ddC.
  • FIG. 5 illustrates the comparison, in percentage of survival, of the B16 cells transfected by the vector pUT-pol ⁇ or not by the vector pUT-pol ⁇ in the presence of AZT.
  • FIG. 6 illustrates the comparison, in percentage of survival, of the B16 cells transfected by a vector expressing the DNA polymerase ⁇ , by a vector expressing the thymidine and thymidilate kinase activities or by a vector expressing the two.
  • AZT Rhovir IV, zidovudine, Azidothymidine
  • Ganciclovir Cymevan
  • the competent cells are prepared according to the Kushner method.
  • 100 ⁇ l of competent cells are incubated with plasmid DNA (volume less than 10 ⁇ l, 10 to 50 ng for a plasmid ccc) 30 minutes in ice then 5 minutes at 42 ° C without shaking.
  • LB medium is then added at room temperature (qs 1 ml) and the cells are brought to 37 ° C (MC 1061) or 30 ° C (SC 18-12 heat-sensitive) with stirring (New Brunswick 300 rpm) for 1 h 30 min.
  • the phenotypic expression then spread on selective Amp media (LB + Ampicillin 100 ⁇ g / ml) for the vector pUT, or Zéo (LB + Zéocine 20 ⁇ g / ml) for the vector pTG.
  • DNA fragments from appropriate enzyme digests are separated by Sea Plate low melting point agarose gel electrophoresis
  • the plasmids are prepared according to the method of Birboim and Doly (Birboim & coll., 1979) by alkaline lysis of the bacteria from streaks on dishes or 25 ml cultures.
  • the plasmid DNA of the transformants is extracted and verified by restriction analysis. Standard PCR conditions:
  • the Polymerase Chain Reaction reaction is carried out in 500 ⁇ l microtubes containing 5 ⁇ l of Buffer, MgCl at 150 ⁇ M, mixture of the 4 dNTPs (250 ⁇ M each), 10 ng of template DNA and 500 ng of each primer oligonucleotide in a reaction volume of 100 ⁇ l, to which 2 to 3 drops of oil are added in order to avoid any evaporation.
  • 2.5 units of Tfl Polymerase enzyme (EPICENTRE) are added "Hot-Start”. Amplification is obtained following 25 cycles of denaturation (94 ° C, 1 min), hybridization (55 ° C, 1 min) and extension by polymerase (72 ° C, 1.5 min).
  • the primers used consist of two parts: a part which hybridizes with one end of the gene to be cloned and a non-hybridizing part which comprises a restriction site compatible with the cloning site in the expression vector.
  • Purification of the PCR product by electrophoresis in 0.7% agarose gel with low melting point Sea Plate (TEBU) and controlled by enzymatic digestion. The ends are cleaved and ligated inside the complementary sites of the expression plasmid (Biolabs and Boehringer enzymes).
  • the cDNA of the purified rat DNA Polymerase was generously donated by Dr. Wilson (Galveston, Texas, USA). The sequence of this gene was obtained by the European database EMBL.
  • a vector was constructed in which the cDNA of the rat polymerase gene was cloned after amplification by the PCR technique.
  • the plasmid pUT-Pol ⁇ results from the replacement of the thymidine kinase gene from E. coli (Ncol fragment - April) by ⁇ polymerase (Ncol fragment - Nhel) in fusion with the zeocin resistance gene in the plasmid pUT 687.
  • the ⁇ polymerase gene is placed under the control of two strong and tandem constitutive promoters, the bacterial promoter EM7 and the eukaryotic promoter of the TK gene. HSV with its enhancer, vector called "shuttle" usable in E. coli and in eukaryotic cells ( Figure 1).
  • 5 ′ primer Addition of 2 ⁇ A bases allowing the rat ⁇ polymerase gene to be introduced in the open reading phase. These 2 bases will create a GCA codon coding for an Alanine.
  • the Nco I site brings the ATG translation initiation site to construction.
  • 3 'primer loss of the unique Avr II restriction site of the plasmid during the Avr II / Nhe I ligation
  • the survival test makes it possible to demonstrate the sensitization of the strain to the drug by the DNA polymerase ⁇ .
  • E. coli B / R SC 18-12 bacteria are incubated overnight in
  • the plasmids of these bacteria were extracted, digested with Eco RI, and the electrophoretic profiles verified. With the probes used for cloning, we also carried out a control by PCR and the DNA polymerase ⁇ gene is well carried by the plasmids extracted from the bacteria studied.
  • Another bacterial strain MC 1061 was also transformed by the vector pUT-Pol ⁇ , in order to observe a modification of the AZT and Ganciclovir Inhibitory Minimum Concentration by ⁇ DNA polymerase
  • the experiment at 37 ° C shows a dose / response effect for AZT as expected.
  • the MIC drops with the strain SC 18-12 / pUT-Pol ⁇ by a factor of 3 at 30 ° C and by a factor of 30 to 37 ° C compared to the parental strain at 30 ° C. This confirms the functionality of our vector and shows that the "suicide" effect of ⁇ DNA polymerase in bacterial cells exists.
  • EXAMPLE 2 Animal cells CHO or B16 overexpressing Pol ⁇ become sensitive to ddC and AZT. Culture media:
  • BIOWHITTAKER HERAEUX oven at 37 ° C, C0 2 5%.
  • CHO Chinese Hamster Ovary cells (Line supplied by J.
  • Tessié-IBCG-Toulouse are cultivated in an ⁇ -MEM-HEPES medium without L-Glutamine, supplemented with fetal calf serum (S VF 10%), L-glutamine, penicillin / streptomycin (PS 50 ⁇ g / ml).
  • B16 murine melanoma cells (Line B 16b 16 provided by S. Cros-IPBS -Toulouse) are cultured in RPMI 1640 medium, supplemented with horse serum (SH 10%), penicillin / streptomycin (PS 50 ⁇ g / ml). Transfection of CHO / B16 cells:
  • the clones are recovered by scraping with the micropipette in 5 ⁇ l of medium, and deposited individually or in "Pool" in a box of one 35 mm diameter containing 2 ml of medium supplemented with Zeocin (100 or 10 ⁇ g / ml).
  • the confluent cells are detached with trypsin after rinsing with PBS (Phosphate Buffer Saline / Biowittaker) and taken up in 1 ml of appropriate medium with serum and antibiotics. 1 ml of supplemented medium is added to each well (plate
  • the MICs are read for the first time after 5 days for CHOs and 7 days for B16s; the medium is replaced by a drug-free medium and the true MIC is determined at 10 and 14 days respectively.
  • DNA polymerase ⁇ is a constitutive eukaryotic enzyme, called "house-keeping". Constitutive overexpression of this polymerase should not present too great a toxicity for the transfected cells.
  • Both cell types (CHO and B16) have been transformed by the vectors. In both cases the plasmid introduced will not be able to replicate and will have to integrate randomly into the cell genome. For these reasons, a pool of 5 CHO clones was also tested to obtain a global and precise confirmation on this type of cell.
  • the vector pUT-Pol ⁇ shows that the overexpression of DNA polymerase ⁇ alone, is certainly not toxic to the dividing cell, since we have obtained many clones. The most astonishing result is that this eukaryotic polymerase alone sensitizes very clearly to AZT (MIC of 10 to 30 ⁇ g / ml) eukaryotic cells CHO, with a factor greater than 30 for 3 clones out of 5.
  • pZEOSGO is derived from pZEOSVl (Cayla, VECT 2001).
  • FIG. 4 shows the toxicity of ddC on B16 cells transfected with pUT-pol ⁇ relative to cells transfected with a control vector pUT526 ⁇ not containing pol ⁇ but only the selection gene Sh. Cell survival was measured by staining cells treated with Giemsa in order to count those that survived the presence of drugs.
  • Murine melanoma cells transfected with pUT-pol ⁇ are sensitive to AZT. Experiments similar to the previous ones were carried out using AZT.
  • Figure 5 shows the toxic effect of AZT on cells transfected with pUT-pol ⁇ .
  • EXAMPLE 6 Murine melanoma cells expressing HSV TK :: Sh and Pol ⁇ are more sensitive to AZT than cells expressing HSV TK :: Sh or Pol ⁇ separately.
  • HSV TK Sh protein
  • TK thymidine
  • TTK thymidilate kinase
  • Figure 6 indicates that these cells are more sensitive to AZT than cells expressing Pol ⁇ :: Sh or HSV TK :: Sh separately.
  • Escherichia coli gpt genes combine selectability with chemosensitivity capable of mediating tumor eradication Hum Hene Ther, 4 589-95, 1993 6 Mullen, C. A, Kilstrup, M and Blaese, RM Transfer of the bacterial gene for cytosine deaminase to mammalian cells confers lethal sensitivity to 5-fluorocytosine. a negative selection System Proc Natl Acad Sci USA, 89 33-7, 1992
  • DNA polymerases ⁇ and ⁇ are able to inco ⁇ orate anti-HIV deoxynucleotides into DNA J Biol Chem, 267 21459-21464, 1992 17 Parker, W B, White, E L, Shaddix, S C, Ross, L J,

Abstract

The invention concerns the use of a vector expressing DNA polymerase beta or a counterpart of polymerase beta for integrating in the DNA of a cell analogous nucleotides with antiviral or tumoricidal activity, for preparing a medicine for the treatment of cancer or of a viral disease such as AIDS.

Description

UTILISATION D'UN VECTEUR EXPRIMANT L'ADN POLYMERASE β USE OF A VECTOR EXPRESSING DNA POLYMERASE β
COMME MEDICAMENTAS A MEDICINE
La présente invention concerne l'utilisation d'un vecteur exprimant l'ADN polymerase β comme ADN-médicament dans le cadre de la thérapie moléculaire du cancer et de maladies virales telles que le SIDA.The present invention relates to the use of a vector expressing β DNA polymerase as DNA-drug in the context of molecular therapy for cancer and viral diseases such as AIDS.
Pour ces maladies, il existe essentiellement deux types de thérapies géniques qui sont l'immunothérapie et l'introduction de gènes "suicide" par des vecteurs viraux dans les cellules cibles. L'immunothérapie génique est l'utilisation de lymphocytes infiltrant les tumeurs (TIL), fortement tumoricides. Lorsqu'ils sont transformés, ils véhiculent vers la tumeur des gènes d'interleukines (IL2, IL4, IL6, interféron γ) qui activeront localement la réponse immunitaire, permettant à la fois une limitation des effets secondaires sur l'organisme et une amplification de leur effet antitumoral. L'approche visant à transférer un "ADN médicament" ou gène thérapeutique dans une cellule tumorale a déjà été proposée (Culver et al., 1994) dans le cadre de l'utilisation de gènes tels que le gène HSV tk de la thymidine kinase du virus de l'herpès humain HSV-1 (Moolten et al., 1990 ; Culver et al., 1992) ou VZV tk s'il s'agit du virus de la Varicelle (Huber et al., 1991), les gènes bactériens gpt codant la xanthine/guanine phosphorybosil-transférase (Mroz et al, 1993) ou codA codant la cytosine désaminase (Mullen et al., 1992). Les produits de ces gènes "suicide" convertissent en produits très toxiques pour la cellule des agents à l'origine non toxiques comme le ganciclovir (GCV) dans le cas de HSV-TK, la 6- méthoxypurine (ara-M) avec VZV-TK, la 5-fluorocytosine (5-FC) avec CodA et la 6-thioxanthine (6-TX) avec GPT.For these diseases, there are essentially two types of gene therapies which are immunotherapy and the introduction of "suicide" genes by viral vectors in the target cells. Gene immunotherapy is the use of tumor-infiltrating lymphocytes (TIL), which are highly tumor-killing. When transformed, they carry interleukin genes (IL2, IL4, IL6, interferon γ) to the tumor which will locally activate the immune response, allowing both a limitation of side effects on the organism and an amplification of their anti-tumor effect. The approach aimed at transferring a "drug DNA" or therapeutic gene into a tumor cell has already been proposed (Culver et al., 1994) in the context of the use of genes such as the HSV tk gene of thymidine kinase from human herpes virus HSV-1 (Moolten et al., 1990; Culver et al., 1992) or VZV tk if it is the chickenpox virus (Huber et al., 1991), the bacterial genes gpt encoding xanthine / guanine phosphorybosil transferase (Mroz et al, 1993) or codA encoding cytosine deaminase (Mullen et al., 1992). The products of these suicide genes convert non-toxic agents such as ganciclovir (GCV) in the case of HSV-TK, 6-methoxypurine (ara-M) with VZV- into very toxic to the cell. TK, 5-fluorocytosine (5-FC) with CodA and 6-thioxanthine (6-TX) with GPT.
Les gènes des thymidines kinases (TK) virales ont notamment été utilisés pour détruire plusieurs types de cellules cancéreuses (Moolten et al., 1990 ; Huber et al., 1991 ; Vile et al., 1993) rendant ces cellules sensibles à des analogues puriques ou pyrimidiques comme l'acyclovir (ACV), le ganciclovir (GCV) ou la bromovinyldésoxyuridine (BVDU). Ces analogues nucléosidiques sont transformés par les TK virales en formes diphosphorylées qui sont ensuite triphosphorylées par des enzymes cellulaires endogènes avant incorporation dans l'ADN tumoral par les ADN polymérases. L'incorporation de ces terminateurs de chaînes (absence de 3' OH) bloque la réplication de l'ADN et entraîne la mort cellulaire.The viral thymidine kinase (TK) genes have in particular been used to destroy several types of cancer cells (Moolten et al., 1990; Huber et al., 1991; Vile et al., 1993) making these cells sensitive to analogues purines or pyrimides such as acyclovir (ACV), ganciclovir (GCV) or bromovinyldoxyoxyidine (BVDU). These nucleoside analogues are transformed by viral TKs into diphosphorylated forms which are then triphosphorylated by endogenous cellular enzymes before incorporation into tumor DNA by DNA polymerases. The incorporation of these chain terminators (absence of 3 'OH) blocks DNA replication and causes cell death.
La présente invention propose de mettre en oeuvre un gène suicide d'un type nouveau dont la fonction consiste à faciliter l'incorporation d'un analogue nucléotidique dans l'ADN de la cellule cible après phosphorylation de la prodrogue nucléosidique éventuellement par un gène suicide "classique".The present invention proposes to implement a suicide gene of a new type, the function of which consists in facilitating the incorporation of a nucleotide analogue into the DNA of the target cell after phosphorylation of the nucleoside prodrug, optionally by a suicide gene ". classic ".
L'incorporation de nucleotides dans l'ADN est naturellement réalisée dans les cellules eucaryotes par les ADN polymérases. Parmi les ADN polymérases de mammifères, l'ADN polymerase β présente quelques particularités.The incorporation of nucleotides into DNA is naturally carried out in eukaryotic cells by DNA polymerases. Among the mammalian DNA polymerases, the DNA polymerase β presents some peculiarities.
L'ADN polymerase β est un polypeptide de 39 kD et est une enzyme hautement conservée chez les eucaryotes supérieurs (Kornberg et al, 1992). Sa fonction primaire serait la réparation de l'ADN endommagé (Sobol et al., 1996) mais elle a aussi un rôle dans la réplication de l'ADN natif (Jenkins et al. 1992 ; Sweasy et al., 1992). L'ADN polymerase β est exprimée à niveau constant au cours du cycle cellulaire (Zmudzka et al, 1988) et l'exposition de la cellule à des agents xénobiotiques comme les rayonnements induit son expression (Srivastava et al., 1995 ; Fornace et al, 1989). Elle se distingue des autres polymérases par sa petite taille et son caractère infidèle lors de la réplication de l'ADN, infidélité liée à l'absence d'activités exonucléasiques correctrices associées (Kunkel et al., 1986).Β DNA polymerase is a 39 kD polypeptide and is a highly conserved enzyme in higher eukaryotes (Kornberg et al, 1992). Its primary function would be the repair of damaged DNA (Sobol et al., 1996) but it also has a role in the replication of native DNA (Jenkins et al. 1992; Sweasy et al., 1992). Β DNA polymerase is expressed at a constant level during the cell cycle (Zmudzka et al, 1988) and the exposure of the cell to xenobiotic agents such as radiation induces its expression (Srivastava et al., 1995; Fornace et al , 1989). It is distinguished from other polymerases by its small size and its unfaithful nature during DNA replication, infidelity linked to the absence of associated corrective exonuclease activities (Kunkel et al., 1986).
In vitro il a été montré que l'ADN polymerase β incorpore le ddCMP (didésoxycytidine triphosphorylée), un inhibiteur de la synthèse de l'ADN, avec une efficacité comparable à celle observée pour l'incorporation de l'antagoniste naturel dCMP ou désoxycytidine monophosphate (Copeland et al. 1992). Des résultats très similaires ont été publiés avec l'AZT (Copeland et al , 1992 ; Parker et al, 1991). //; vivo, l'AZT-MP (azidothymidine mono-phosphorylé) est en effet incorporé dans l'ADN cellulaire (Sommadossi et al., 1989) et il a été suggéré que l'ADN polymerase β joue un rôle dans ce processus (Parker et al., 1991).In vitro it has been shown that DNA polymerase β incorporates ddCMP (dideoxycytidine triphosphorylated), an inhibitor of DNA synthesis, with an efficiency comparable to that observed for the incorporation of the natural antagonist dCMP or deoxycytidine monophosphate (Copeland et al. 1992). Very similar results have been published with AZT (Copeland et al, 1992; Parker et al, 1991). //; vivo, AZT-MP (mono-phosphorylated azidothymidine) is indeed incorporated into cellular DNA (Sommadossi et al., 1989) and it has been suggested that β DNA polymerase plays a role in this process (Parker and al., 1991).
Ainsi, la présente invention a notamment pour objet l'utilisation d'un vecteur exprimant l'ADN polymerase β ou un analogue de l'ADN polymerase β afin d'assurer l'intégration dans l'ADN d'une cellule d'analogues nucléotidiques à activité anti-virale ou anti-tumorale, pour la fabrication d'un médicament destiné au traitement du cancer ou d'une maladie virale telle que le SIDA.Thus, the subject of the present invention is in particular the use of a vector expressing DNA polymerase β or an analogue of DNA polymerase β in order to ensure integration into the DNA of a cell of nucleotide analogues with anti-viral or anti-tumor activity, for the manufacture of a medicament intended for the treatment of cancer or of a viral disease such as AIDS.
Par "analogue de l'ADN polymerase β", on entend toute séquence nucléotidique présentant une homologie d'au moins 80 % avec la séquence nucléotidique de l'ADN polymerase β de mammifère et remplissant les mêmes fonctions.By "DNA polymerase β analog" is meant any nucleotide sequence having at least 80% homology with the nucleotide sequence of mammalian DNA polymerase β and fulfilling the same functions.
La présente invention consiste donc à induire une surproduction intracellulaire d'une enzyme normalement faiblement présente dans la cellule, à savoir l'ADN polymerase β, afin d'amplifier son caractère infidèle et mutagène et ainsi forcer l'intégration dans l'ADN d'analogues nucléotidiques.The present invention therefore consists in inducing an intracellular overproduction of an enzyme normally weakly present in the cell, namely DNA polymerase β, in order to amplify its unfaithful and mutagenic character and thus force integration into the DNA of nucleotide analogs.
La présente invention a également pour objet un vecteur d'expression comprenant un gène codant pour l'ADN polymerase β ou un analogue de l'ADN polymerase β. Le vecteur est destiné à exprimer l'ADN polymerase β dans des cellules tumorales ou des cellules infectées par un virus tel que le virus du SIDA. Il est donc avantageux de placer ledit gène sous le contrôle d'un système d'expression efficace dans les cellules cibles.The present invention also relates to an expression vector comprising a gene coding for DNA polymerase β or an analog of DNA polymerase β. The vector is intended to express β DNA polymerase in tumor cells or cells infected with a virus such as the AIDS virus. It is therefore advantageous to place said gene under the control of an efficient expression system in the target cells.
Selon un mode de réalisation avantageux de la présente invention, le vecteur d'expression conforme à la présente invention comporte une séquence de ciblage et/ou d'expression spécifique de tissus dans lesquels on souhaite voir s'exprimer l'ADN polymerase β (ou un analogue), tels que les tumeurs ou les tissus infectés par les virus ; à titre d'exemple, on peut citer les cellules souches hématopoïétiques en vue de l'éradication des lymphocytes CD4+ infectés par le virusAccording to an advantageous embodiment of the present invention, the expression vector according to the present invention comprises a targeting sequence and / or tissue specific expression in which one wishes to be expressed DNA polymerase β (or an analog), such as tumors or tissues infected with viruses; as an example, we can cite stem cells haematopoietic agents for the eradication of CD4 + lymphocytes infected with the virus
HIV.HIV.
Le vecteur d'expression selon la présente invention peut être tout vecteur couramment utilisé en thérapie génique et particulièrement un vecteur viral dérivé d'un virus choisi parmi les adénovirus, les virus adéno-associés, les rétrovirusThe expression vector according to the present invention may be any commonly used vector for gene therapy and in particular a viral vector derived from a virus selected from adenovirus, adeno-associated viruses, retroviruses
(dont le HIV), les virus de l'herpès, les poxvirus, les parvovirus, les plasmovirus, les(including HIV), herpes viruses, poxviruses, parvoviruses, plasmoviruses,
Semliki Forest virus et les Sindbis virus.Semliki Forest virus and Sindbis virus.
Comme indiqué plus haut, l'ADN polymerase β permet l'incorporation d'analogues nucléotidique dans l'ADN. Or, certains analogues de nucléosides sont connus comme présentant une activité anti-virale quand ils sont phosphorylés, c'est-à-dire à l'état de nucleotides. C'est le cas notamment de l'AZT et de la ddC. Ces analogues de nucléosides sont normalement atoxiques pour les cellules. Cependant, après phosphorylation et en présence de l'ADN polymerase βAs indicated above, DNA polymerase β allows the incorporation of nucleotide analogs into DNA. However, certain nucleoside analogs are known to exhibit anti-viral activity when they are phosphorylated, that is to say in the form of nucleotides. This is particularly the case for AZT and ddC. These nucleoside analogs are normally non-toxic to cells. However, after phosphorylation and in the presence of DNA polymerase β
(ou analogue), ils sont incorporés dans l'ADN et en bloquent la réplication. La phosphorylation en question peut notamment être réalisée par des thymidine et/ou thymidilate kinases.(or the like), they are incorporated into DNA and block their replication. The phosphorylation in question can in particular be carried out by thymidine and / or thymidilate kinases.
Ainsi, selon un mode de réalisation particulièrement avantageux, l'utilisation d'un vecteur exprimant l'ADN polymerase β (ou analogue) conformément à la présente invention peut être potentialisée par l'expression, au sein des mêmes cellules ou tissus cibles, du gène de la thymidine et/ou thymidilate kinase. Les cellules au sein desquelles s'expriment l'ADN polymerase β et la thymidine et/ou la thymidilate kinase sont donc rendues plus sensibles aux analogues nucléosidiques tels que l'AZT ou la ddC qui, in situ, sont phosphorylés avant d'être incorporés dans l'ADN. Le gène de la thymidine et/ou thymidilate kinase peut être inséré sur le même vecteur que celui exprimant l'ADN polymerase β ou sur un autre vecteur.Thus, according to a particularly advantageous embodiment, the use of a vector expressing β DNA polymerase (or analog) in accordance with the present invention can be potentiated by the expression, within the same target cells or tissues, of the thymidine and / or thymidilate kinase gene. The cells in which the DNA polymerase β and thymidine and / or thymidilate kinase are expressed are therefore made more sensitive to nucleoside analogues such as AZT or ddC which, in situ, are phosphorylated before being incorporated in DNA. The thymidine and / or thymidilate kinase gene can be inserted on the same vector as that expressing β DNA polymerase or on another vector.
Dans ce dernier cas, la cellule cible subira une cotransfection pour permettre l'expression de chacun des gènes concernés. Dans tous les cas, le gène codant pour la thymidine et/ou thymidilate kinase sera placé sous le contrôle d'un système d'expression efficace dans les cellules cibles à atteindre.In the latter case, the target cell will undergo a co-transfection to allow the expression of each of the genes concerned. In all cases, the gene coding for the thymidine and / or thymidilate kinase will be placed under the control of an efficient expression system in the target cells to be reached.
La présente invention a également pour objet les cellules transformées par un vecteur d'expression conforme à l'invention comportant un gène codant pour l'ADN polymerase β (ou analogue) et éventuellement comportant également un gène codant pour la thymidine et/ou thymidilate kinase ainsi que les cellules transformées par un vecteur d'expression conforme à l'invention comportant les deux susdits gènes.The present invention also relates to cells transformed with an expression vector in accordance with the invention comprising a gene coding for DNA polymerase β (or analog) and optionally also comprising a gene coding for thymidine and / or thymidilate kinase as well as cells transformed with an expression vector in accordance with the invention comprising the two above-mentioned genes.
Par ailleurs, il est à souligner que les vecteurs conformes à la présente invention peuvent être utilisés comme vecteurs de clonage. En effet, l'insertion d'un Heur multisite (polylinker) dans le gène codant pour l'ADN polymerase β (ou un analogue) sans modifier le cadre de lecture, lui-même inséré dans un vecteur tel que pUT-pol β ou pZHTk β, permet de cloner un gène d'intérêt. Les cellules recombinantes transfectées par ce type de vecteur sont aisément sélectionnâmes puisque devenues résistantes aux analogues nucléosidiques tels que l'AZT ou la ddC, suite à l'inactivation du gène de l'ADN polymerase β (ou analogue).Furthermore, it should be emphasized that the vectors in accordance with the present invention can be used as cloning vectors. Indeed, the insertion of a multisite Heur (polylinker) into the gene coding for DNA polymerase β (or an analog) without modifying the reading frame, itself inserted in a vector such as pUT-pol β or pZHTk β, makes it possible to clone a gene of interest. Recombinant cells transfected with this type of vector are easily selected since they have become resistant to nucleoside analogues such as AZT or ddC, following the inactivation of the DNA polymerase β gene (or analog).
Enfin, la présente invention a pour objet un produit contenant un- vecteur d'expression selon l'invention comportant un gène codant pour l'ADN polymerase β (ou analogue) et un gène codant pour la thymidine et/ou thymidilate kinase ou deux vecteurs d'expression comportant chacun l'un des gènes en question et au moins un agent anti-viral comme produit de combinaison pour une utilisation simultanée, séparée ou étalée dans le temps. Préférentiellement, l'agent anti-viral est l'AZT ou la ddC.Finally, the subject of the present invention is a product containing an expression vector according to the invention comprising a gene coding for DNA polymerase β (or analog) and a gene coding for thymidine and / or thymidilate kinase or two vectors. of expression each comprising one of the genes in question and at least one anti-viral agent as a combination product for simultaneous, separate or spread over time use. Preferably, the anti-viral agent is AZT or ddC.
Il convient également de noter que la mise en oeuvre des vecteurs d'expression et/ou des cellules transformées par ces vecteurs d'expression, conformément à la présente invention dans le cadre du traitement de cancers ou de maladies virales telles que le SIDA, peut être associée à tout autre traitement classique tel que la chimiothérapie ou la radiothérapie. La Figure 1 représente la construction du vecteur pUT-pol β à partir du vecteur pUT 687.It should also be noted that the use of expression vectors and / or cells transformed by these expression vectors, in accordance with the present invention in the context of the treatment of cancers or viral diseases such as AIDS, can be combined with any other conventional treatment such as chemotherapy or radiotherapy. FIG. 1 represents the construction of the vector pUT-pol β from the vector pUT 687.
La Figure 2 représente le pourcentage de survie des cellules dΕ.coli SC 18-12 transformées par le vecteur pUT-pol β à différentes températures, en présence d'AZT.Figure 2 represents the percentage of survival of dΕ.coli SC 18-12 cells transformed by the vector pUT-pol β at different temperatures, in the presence of AZT.
La Figure 3 représente la construction du vecteur pZHTk β à partir du vecteur pZEOSGO.Figure 3 shows the construction of the vector pZHTk β from the vector pZEOSGO.
La Figure 4 illustre la comparaison, en pourcentage de survie, des cellules B16 transfectées par le vecteur pUT-pol β ou par un vecteur contrôle pUT 526 Δ en présence de ddC.FIG. 4 illustrates the comparison, in percentage of survival, of the B16 cells transfected with the vector pUT-pol β or with a control vector pUT 526 Δ in the presence of ddC.
La Figure 5 illustre la comparaison, en pourcentage de survie, des cellules B16 transfectées par le vecteur pUT-pol β ou non par le vecteur pUT-pol β en présence d'AZT.FIG. 5 illustrates the comparison, in percentage of survival, of the B16 cells transfected by the vector pUT-pol β or not by the vector pUT-pol β in the presence of AZT.
La Figure 6 illustre la comparaison, en pourcentage de survie, des cellules B16 transfectées par un vecteur exprimant l'ADN polymerase β, par un vecteur exprimant les activités thymidine et thymidilate kinases ou par un vecteur exprimant les deux.FIG. 6 illustrates the comparison, in percentage of survival, of the B16 cells transfected by a vector expressing the DNA polymerase β, by a vector expressing the thymidine and thymidilate kinase activities or by a vector expressing the two.
La présente invention ne se limite pas à la susdite description mais en englobe au contraire toutes les variantes ; de plus, elle sera mieux comprise à la lumière des exemples ci-dessous qui ne sont donnés qu'à titre purement illustratif.The present invention is not limited to the above description but on the contrary encompasses all variants thereof; moreover, it will be better understood in the light of the examples below which are given purely by way of illustration.
EXEMPLE 1EXAMPLE 1
Construction d'un vecteur plasmidique surexprimant l'ADN polymerase β. Matériel :Construction of a plasmid vector overexpressing DNA polymerase β. Material:
L'AZT (Retrovir IV, zidovudine, Azidothymidine) et le Ganciclovir (Cymevan) proviennent respectivement des laboratoires Wellcome, Paris et Syntex, Puteaux. S.A. La Zéocine est produite par la société CAYLA, Toulouse. Les informations concernant les souches bactériennes d'E. coli utilisées sont rassemblées dans le tableau suivant :AZT (Retrovir IV, zidovudine, Azidothymidine) and Ganciclovir (Cymevan) come from Wellcome, Paris and Syntex, Puteaux laboratories respectively. HER Zéocine is produced by the company CAYLA, Toulouse. Information about bacterial strains of E. coli used are gathered in the following table:
Milieux de cultures :Culture media:
Milieu complet LB (par litre) : tryptone 10 g, extrait de levure 5 g,LB complete medium (per liter): tryptone 10 g, yeast extract 5 g,
NaCl 10 g, agar 15 g, H 0 qsp 1 1.NaCl 10 g, agar 15 g, H 0 qs 1 1.
Milieu minimum M9CA (par litre) : Na2HP0 2H 0 8,5 g, KH2P04 Minimum medium M9CA (per liter): Na 2 HP0 2H 0 8.5 g, KH 2 P0 4
3 g, NaCl 0,5 g, NH4CI 1 g, glucose 0,4 %, hydrolysat de caséine 0,2 %, agar 1,5 g, H 0 qsp 1 1.3 g, NaCl 0.5 g, NH4Cl 1 g, glucose 0.4%, casein hydrolyzate 0.2%, agar 1.5 g, H 0 qs 1 1.
Milieu NA (par litre) : «Bacto Nutrient Agar» de Difco, Bacto BeefMedium NA (per liter): "Bacto Nutrient Agar" by Difco, Bacto Beef
Extract 3 g, Bacto Peptone 5 g, NaCl 10 g, agar 15 g, H20 qsp 1 1.Extract 3 g, Bacto Peptone 5 g, NaCl 10 g, agar 15 g, H 2 0 qs 1 1.
Transformation :Transformation:
Les cellules compétentes sont préparées d'après la méthode de Kushner.The competent cells are prepared according to the Kushner method.
25 ml de LB stérile sont ensemencés par la souche, et à DOÔQO = 0,4 centrifugés 15 minutes à 5 000 φm, à 4°C. Les cellules sont reprises dans 2,5ml de CaCl 0, 1 M /25 ml of sterile LB are inoculated with the strain, and at DOÔQO = 0.4 centrifuged for 15 minutes at 5,000 μm, at 4 ° C. The cells are taken up in 2.5 ml of 0.1 M CaCl
MOPS 10 mM / Glucose 0,5 % froid laissé 30 minutes à 0°C. lOOμl de cellules compétentes sont incubées avec l'ADN plasmidique (volume inférieur à lOμl, 10 à 50 ng pour un plasmide ccc) 30 minutes dans la glace puis 5 minutes à 42°C sans agitation. Du milieu LB est alors ajouté à température ambiante (qsp 1 ml) et les cellules sont mises à 37°C (MC 1061) ou à 30°C (SC 18-12 thermosensibles) sous agitation (New Brunswick 300 rpm) pendant lh30 pour l'expression phénotypique puis étalées sur milieux sélectifs Amp (LB + Ampicilline 100 μg/ml) pour le vecteur pUT, ou Zéo (LB + Zéocine 20μg/ml) pour le vecteur pTG.MOPS 10 mM / Glucose 0.5% cold, left for 30 minutes at 0 ° C. 100 μl of competent cells are incubated with plasmid DNA (volume less than 10 μl, 10 to 50 ng for a plasmid ccc) 30 minutes in ice then 5 minutes at 42 ° C without shaking. LB medium is then added at room temperature (qs 1 ml) and the cells are brought to 37 ° C (MC 1061) or 30 ° C (SC 18-12 heat-sensitive) with stirring (New Brunswick 300 rpm) for 1 h 30 min. the phenotypic expression then spread on selective Amp media (LB + Ampicillin 100 μg / ml) for the vector pUT, or Zéo (LB + Zéocine 20 μg / ml) for the vector pTG.
Clonage :Cloning:
Les fragments d'ADN issus des digestions enzymatiques appropriées sont séparés par électrophorèse en gel d'agarose à bas point de fusion Sea PlaqueDNA fragments from appropriate enzyme digests are separated by Sea Plate low melting point agarose gel electrophoresis
(FMC) à 0,7 % dans du tampon TAE (Tris-acétate 0,004 M / EDTA 0,001 M). Les bandes choisies sont découpées, liquéfiées dans du TE IX ajusté à 0,5 M NaCl et le tout est chauffé 10 minutes à 70°C. Les solutions d'ADN sont alors purifiées par extraction au phénol-CHISAM puis précipitées avec un volume d'isopropanol + 1 μl de glycogène. Les culots sont alors séchés et repris dans un volume minimum d'eau stérile (10 μl). Les fragments d'ADN requis sont mélangés et incubés dans un tampon de ligation (Tris-HCl 66 mM, Mg Cl2 5mM, Poly Ethylène Glycol 1 mM,(FMC) at 0.7% in TAE buffer (0.004 M Tris-acetate / 0.001 M EDTA). The selected strips are cut, liquefied in TE IX adjusted to 0.5 M NaCl and the whole is heated for 10 minutes at 70 ° C. The DNA solutions are then purified by extraction with phenol-CHISAM and then precipitated with a volume of isopropanol + 1 μl of glycogen. The pellets are then dried and taken up in a minimum volume of sterile water (10 μl). The required DNA fragments are mixed and incubated in a ligation buffer (66 mM Tris-HCl, 5 mM Mg Cl 2 , 1 mM Poly Ethylene Glycol,
ATP 1 mM, pH 7,5) avec une unité de ligase de phage T4 (20 μl final) à 16°C durant une nuit. Le produit de ligation est ensuite utilisé pour transformer la souche adéquate. La sélection adaptée est soit la résistance à l'ampicilline 100 g/ml, soit à la1 mM ATP, pH 7.5) with one unit of phage T4 ligase (20 μl final) at 16 ° C overnight. The ligation product is then used to transform the appropriate strain. The appropriate selection is either resistance to ampicillin 100 g / ml or to
Zéocine 20 μg/ml, en fonction du plasmide.Zeocin 20 μg / ml, depending on the plasmid.
Extraction de l'ADN plasmidique :Plasmid DNA extraction:
Les plasmides sont préparés selon la méthode de Birboim et Doly (Birboim & coll., 1979) par lyse alcaline des bactéries à partir de stries sur boîtes ou de cultures de 25 ml. L'ADN plasmidique des transformants est extrait et vérifié par analyse de restriction. Conditions standard de PCR :The plasmids are prepared according to the method of Birboim and Doly (Birboim & coll., 1979) by alkaline lysis of the bacteria from streaks on dishes or 25 ml cultures. The plasmid DNA of the transformants is extracted and verified by restriction analysis. Standard PCR conditions:
La réaction de Polymerase Chain Reaction se réalise dans des microtubes de 500 μl contenant 5 μl de Tampon, MgCl à 150 μM, mélange des 4 dNTP (250 μM chacun), 10 ng d'ADN matrice et 500 ng de chaque oligonucléotide amorce dans un volume réactionnel de 100 μl, sur lequel 2 à 3 gouttes d'huile sont ajoutées dans le but d'éviter toute évaporation. Après 7 minutes de prédénaturation à 95°C, 2,5 unités d'enzyme Tfl Polymerase (EPICENTRE) sont ajoutées «Hot-Start». L'amplification est obtenue à la suite de 25 cycles de dénaturation (94°C, 1 min), hybridation (55°C, 1 min) et extension par la polymerase (72°C, 1,5 min). Les amorces utilisées sont constituées de deux parties : une partie s'hybridant avec une extrémité du gène à cloner et une partie non hybridante qui comporte un site de restriction compatible avec le site de clonage dans le vecteur d'expression. Purification du produit de la PCR par électrophorèse en gel d'agarose 0,7 % à bas point de fusion Sea Plaque (TEBU) et contrôlé par digestion enzymatique. Les extrémités sont clivées et ligaturées à l'intérieur des sites complémentaires du plasmide d'expression (Enzymes Biolabs et Boehringer).The Polymerase Chain Reaction reaction is carried out in 500 μl microtubes containing 5 μl of Buffer, MgCl at 150 μM, mixture of the 4 dNTPs (250 μM each), 10 ng of template DNA and 500 ng of each primer oligonucleotide in a reaction volume of 100 μl, to which 2 to 3 drops of oil are added in order to avoid any evaporation. After 7 minutes of predenaturation at 95 ° C, 2.5 units of Tfl Polymerase enzyme (EPICENTRE) are added "Hot-Start". Amplification is obtained following 25 cycles of denaturation (94 ° C, 1 min), hybridization (55 ° C, 1 min) and extension by polymerase (72 ° C, 1.5 min). The primers used consist of two parts: a part which hybridizes with one end of the gene to be cloned and a non-hybridizing part which comprises a restriction site compatible with the cloning site in the expression vector. Purification of the PCR product by electrophoresis in 0.7% agarose gel with low melting point Sea Plate (TEBU) and controlled by enzymatic digestion. The ends are cleaved and ligated inside the complementary sites of the expression plasmid (Biolabs and Boehringer enzymes).
Gène de la Polymerase Bêta de rat :Rat Beta Polymerase Gene:
Le cDNA de l'ADN Polymerase de rat purifiée a généreusement été donné par le Dr. Wilson (Galveston, Texas, USA). La séquence de ce gène a été obtenue par la banque de donnée Européenne EMBL.The cDNA of the purified rat DNA Polymerase was generously donated by Dr. Wilson (Galveston, Texas, USA). The sequence of this gene was obtained by the European database EMBL.
Vecteur :Vector:
Un vecteur a été construit dans lequel le cDNA du gène de la polymerase de rat a été clone après amplification par la technique de PCR. pUT-Pol βA vector was constructed in which the cDNA of the rat polymerase gene was cloned after amplification by the PCR technique. PUT-Pol β
Le plasmide pUT-Pol β résulte du remplacement du gène de la thymidine kinase d'E. coli (fragment Ncol - Avril) par la polymerase β (fragment Ncol - Nhel) en fusion avec le gène de résistance à la Zéocine dans le plasmide pUT 687. Le gène de la polymerase β est placé sous le contrôle de deux promoteurs forts et constitutifs en tandem, le promoteur bactérien EM7 et le promoteur eucaryote du gène de la TK de HSV avec son enhancer, vecteur dit "navette" utilisable chez E. coli et en cellules eucaryotes (Figure 1).The plasmid pUT-Pol β results from the replacement of the thymidine kinase gene from E. coli (Ncol fragment - April) by β polymerase (Ncol fragment - Nhel) in fusion with the zeocin resistance gene in the plasmid pUT 687. The β polymerase gene is placed under the control of two strong and tandem constitutive promoters, the bacterial promoter EM7 and the eukaryotic promoter of the TK gene. HSV with its enhancer, vector called "shuttle" usable in E. coli and in eukaryotic cells (Figure 1).
Amorce 5' : Ajout de 2 bases ÇA permettant au gène de la polymerase β de rat d'être introduit en phase ouverte de lecture. Ces 2 bases vont créer un codon GCA codant pour une Alanine. Le site Nco I apporte à la construction le site d'initiation de la traduction ATG. Amorce 3' : perte du site unique de restriction Avr II du plasmide lors de la ligation Avr II / Nhe I.5 ′ primer: Addition of 2 ÇA bases allowing the rat β polymerase gene to be introduced in the open reading phase. These 2 bases will create a GCA codon coding for an Alanine. The Nco I site brings the ATG translation initiation site to construction. 3 'primer: loss of the unique Avr II restriction site of the plasmid during the Avr II / Nhe I ligation
Perte également du codon "Stop" du gène de la polymerase β pour permettre la fusion de ce gène avec le gène de résistance à la Zéocine, une contre sélection des clones à l'AZT va permettre de sélectionner les clones ayant perdu la thymidine kinase de E. coli. Also loss of the stop codon of the β polymerase gene to allow the fusion of this gene with the zeocin resistance gene, a counter selection of the clones with AZT will make it possible to select the clones having lost thymidine kinase from E. coli.
Résumé de la construction du vecteur pUT-pol βSummary of the construction of the vector pUT-pol β
Détermination de la CMI (Concentration Minimale Inhibitrice) :Determination of the MIC (Minimum Inhibitory Concentration):
Les cellules sont étalées sur milieu LB solide toute la nuit. Elles sont reprises dans 1 ml de milieu LB à 20 % glycérol final et stockées à - 70°C. 5 μl d'une suspension de 0,5 ml de milieu M9CA, sont inoculés avec une quantité estimée constante de cellules congelées prélevées à l'anse de platine de façon à obtenir une DOgoo = 0.1-0.2, et déposée sur du milieu M9CA contenant des concentrations croissantes de drogue. Après une nuit à 37°C, la concentration létale est notée pour les différentes souches.The cells are spread on solid LB medium overnight. They are taken up in 1 ml of LB medium at 20% final glycerol and stored at -70 ° C. 5 μl of a suspension of 0.5 ml of M9CA medium, are inoculated with a constant estimated quantity of frozen cells taken from the platinum loop so as to obtain a DOgoo = 0 . 1-0.2, and deposited on M9CA medium containing increasing concentrations of the drug. After one night at 37 ° C, the lethal concentration is noted for the different strains.
Tests de survie :Survival tests:
Le test de survie permet de mettre en évidence la sensibilisation de la souche à la drogue par l'ADN polymerase β. Les bactéries E. coli B/R SC 18-12 sont incubées durant la nuit dansThe survival test makes it possible to demonstrate the sensitization of the strain to the drug by the DNA polymerase β. E. coli B / R SC 18-12 bacteria are incubated overnight in
25 ml de milieu NA liquide avec ampicilline 35 μg/ml, à 30°C sous agitation (New Brunswick 300φm), diluées de façon à obtenir une DOÔOO = 0, 1-0,2 dans 20 ml de milieu NA, et replacées en culture dans les mêmes conditions que précédemment jusqu'à l'obtention d'une DOÔOO = 0,4, elles sont ensuite diluées 10^ fois dans du milieu M9CA liquide, 100 μl sont étalés sur des boîtes M9CA à différentes concentrations en drogue, mises à incuber 1 à 2 jours à 37°C ou à 30°C. Le nombre de colonies est compté sur chacune des boîtes, et le pourcentage de survie est déterminé par rapport à la valeur maximale de la boîte témoin sans drogue.25 ml of liquid NA medium with ampicillin 35 μg / ml, at 30 ° C with stirring (New Brunswick 300φm), diluted so as to obtain a DOOOO = 0.1-0.2 in 20 ml of NA medium, and replaced in culture under the same conditions as above until a DOOOO = 0.4 is obtained, they are then diluted 10 ^ times in liquid M9CA medium, 100 μl are spread on M9CA dishes at different drug concentrations, put incubate 1 to 2 days at 37 ° C or 30 ° C. The number of colonies is counted on each of the dishes, and the percentage of survival is determined relative to the maximum value of the drug-free control dish.
Parallèlement, la souche d'E. coli SC 18-12 mutante RecA polA12 a été transformée par le vecteur pUT-Pol β. L'ADN polymerase I est thermosensible à 37°C, mais fonctionne à 30°C. La surexpression de l'ADN polymerase β, à une température non permissive de 37°C, restaure la viabilité, comme attendu.At the same time, the strain of E. coli SC 18-12 mutant RecA polA12 was transformed by the vector pUT-Pol β. DNA polymerase I is heat sensitive at 37 ° C, but operates at 30 ° C. Overexpression of β DNA polymerase, at a non-permissive temperature of 37 ° C, restores viability, as expected.
Les plasmides de ces bactéries ont été extraits, digérés par Eco RI, et les profils électrophorétiques vérifiés. Avec les sondes utilisées pour le clonage, nous avons également effectué un contrôle par PCR et le gène de l'ADN polymerase β est bien porté par les plasmides extraits des bactéries étudiées.The plasmids of these bacteria were extracted, digested with Eco RI, and the electrophoretic profiles verified. With the probes used for cloning, we also carried out a control by PCR and the DNA polymerase β gene is well carried by the plasmids extracted from the bacteria studied.
Une autre souche bactérienne MC 1061 a également été transformée par le vecteur pUT-Pol β, dans le but d'observer une modification de la Concentration Minimale Inhibitrice à l'AZT et au Ganciclovir par l'ADN polymerase βAnother bacterial strain MC 1061 was also transformed by the vector pUT-Pol β, in order to observe a modification of the AZT and Ganciclovir Inhibitory Minimum Concentration by β DNA polymerase
1 - Souche MC 1061 / pUT-pol β1 - strain MC 1061 / pUT-pol β
• Vis-à-vis de l'AZT• Towards AZT
Les "spots" obtenus sur les boîtes pour les bactéries MC 1061-pUT- Pol β montrent que vis-à-vis de l'AZT, la valeur de la CMI passe de 0,03 μg/ml pour la souche témoin parentale à 0,001 μg/ml (facteur 30), sans la présence du gène suicide de thymidine kinase-HSVl L'AZT est toxique pour les bactériesThe "spots" obtained on the boxes for the MC 1061-pUT-Pol β bacteria show that with respect to AZT, the MIC value goes from 0.03 μg / ml for the parental control strain to 0.001 μg / ml (factor 30), without the presence of the thymidine kinase-HSVl suicide gene AZT is toxic to bacteria
Les résultats sont rassemblés dans le tableau 1 ci-dessousThe results are collated in Table 1 below
Tableau 1Table 1
Concentrations Minimales Inhibitrices (μg/ml)Minimum Inhibitory Concentrations (μg / ml)
2 - Souches SC 18-12 / pUT-pol β 2 - SC 18-12 strains / pUT-pol β
• Vis-à-vis de l'AZT (Figure 2) :• Towards the AZT (Figure 2):
L'expérience à 37°C montre un effet de dose/réponse pour l'AZT comme attendu. La CMI chute avec la souche SC 18-12/pUT-Pol β d'un facteur 3 à 30°C et d'un facteur 30 à 37°C par rapport à la souche parentale à 30°C. Ceci nous confirme la fonctionnalité de notre vecteur et montre que l'effet "suicide" de l'ADN polymerase β en cellules bactériennes existe.The experiment at 37 ° C shows a dose / response effect for AZT as expected. The MIC drops with the strain SC 18-12 / pUT-Pol β by a factor of 3 at 30 ° C and by a factor of 30 to 37 ° C compared to the parental strain at 30 ° C. This confirms the functionality of our vector and shows that the "suicide" effect of β DNA polymerase in bacterial cells exists.
EXEMPLE 2 Des cellules animales CHO ou B16 surexprimant Pol β deviennent sensibles à la ddC et à l'AZT. Milieux de cultures :EXAMPLE 2 Animal cells CHO or B16 overexpressing Pol β become sensitive to ddC and AZT. Culture media:
Le matériel provient de chez BIOWHITTAKER. Etuve HERAEUX à 37°C, C02 5 %. CHO : les cellules d'Ovaire d'hamster Chinois (Lignée fournie par J.The material comes from BIOWHITTAKER. HERAEUX oven at 37 ° C, C0 2 5%. CHO: Chinese Hamster Ovary cells (Line supplied by J.
Tessié-IBCG-Toulouse) sont cultivées dans un milieu α-MEM-HEPES sans L- Glutamine, supplémenté par du sérum foetal de veau (S VF 10 %), L-glutamine, pénicilline / streptomycine (PS 50 μg/ml).Tessié-IBCG-Toulouse) are cultivated in an α-MEM-HEPES medium without L-Glutamine, supplemented with fetal calf serum (S VF 10%), L-glutamine, penicillin / streptomycin (PS 50 μg / ml).
B16 : les cellules de mélanome murin (Lignée B 16b 16 fournie par S. Cros-I. P. B. S. -Toulouse) sont cultivées dans un milieu RPMI 1640, supplémenté par du sérum de cheval (SH 10 %), pénicilline / streptomycine (PS 50 μg/ml). Transfection des cellules CHO / B16 :B16: murine melanoma cells (Line B 16b 16 provided by S. Cros-IPBS -Toulouse) are cultured in RPMI 1640 medium, supplemented with horse serum (SH 10%), penicillin / streptomycin (PS 50 μg / ml). Transfection of CHO / B16 cells:
La technique utilisée pour les 2 types de cellules est identique ; seuls quelques paramètres sont différents. Un nombre de cellules à confluence (CHO = 2.105 / B 16 = 4.105) est passé dans 2 ml de milieu supplémenté. A 24 heures les cellules à subconfluence sont lavées au PBS, et placées dans 1 ml de milieu sans sérum contenant 10 μl de polybrène / /r/'c/. (1 -/-) et 10 μg d'ADN A 30 heures pour les CHO et à 40 heures pour les B16, les cellules subissent un choc DMSO (1 ml DMSO 30 % pendant 3-4 minutes), 2 rinçages avec du milieu sans sérum, incubation 72 heures, ajout de la sélection à la Zéocine (CHO 100 μg/ml ; B16 : lOμg/ml).The technique used for the 2 types of cells is identical; only a few parameters are different. A number of cells at confluence (CHO = 2.10 5 / B 16 = 4.10 5 ) is passed into 2 ml of supplemented medium. At 24 hours, the subconfluence cells are washed with PBS, and placed in 1 ml of serum-free medium containing 10 μl of polybrene / / r / ' c /. (1 - / -) and 10 μg of DNA AT 30 hours for CHO and at 40 hours for B16, the cells undergo DMSO shock (1 ml DMSO 30% for 3-4 minutes), 2 rinses with serum-free medium, incubation for 72 hours, addition of selection to zeocin (CHO 100 μg / ml; B16 : 10 μg / ml).
Récupération des clones :Clone recovery:
Environ 15 jours pour les CHO (3 à 4 semaines pour les B16) après lavage au PB S, les clones sont récupérés par grattage avec la micropipette dans 5 μl de milieu, et déposés individuellement ou en "Pool" dans une boîte d'un diamètre de 35 mm contenant 2 ml de milieu supplémenté avec Zéocine (100 ou 10 μg/ml).About 15 days for CHOs (3 to 4 weeks for B16) after washing with PB S, the clones are recovered by scraping with the micropipette in 5 μl of medium, and deposited individually or in "Pool" in a box of one 35 mm diameter containing 2 ml of medium supplemented with Zeocin (100 or 10 μg / ml).
Détermination de la CMI (Concentration Minimale Inhibitrice) :Determination of the MIC (Minimum Inhibitory Concentration):
Les cellules à confluence sont décollées par de la trypsine après rinçage au PBS (Phosphate Buffer Saline / Biowittaker) et reprises dans 1 ml de milieu approprié avec sérum et antibiotiques. On ajoute 1 ml de milieu supplémenté dans chaque puits (plaqueThe confluent cells are detached with trypsin after rinsing with PBS (Phosphate Buffer Saline / Biowittaker) and taken up in 1 ml of appropriate medium with serum and antibiotics. 1 ml of supplemented medium is added to each well (plate
Nunc à 24 puits), 2 000 cellules pour les CHO ou B16, et les différentes prodrogues de concentrations croissantes.Nunc at 24 wells), 2,000 cells for CHO or B16, and the various prodrugs of increasing concentrations.
On fait une première lecture des CMI après 5 jours pour les CHO et 7 jours pour les B16 ; le milieu est remplacé par un milieu sans drogue et l'on détermine à 10 et à 14 jours respectivement la véritable CMI.The MICs are read for the first time after 5 days for CHOs and 7 days for B16s; the medium is replaced by a drug-free medium and the true MIC is determined at 10 and 14 days respectively.
Etudes de toxicité de l'ADN polymerase β surexprimée en cellules eucaryotes CHO et B16 :Toxicity studies of β DNA polymerase overexpressed in CHO and B16 eukaryotic cells:
L'ADN polymerase β est une enzyme eucaryote constitutive, dite de «house-keeping» . Une surexpression constitutive de cette polymerase ne devrait pas présenter une toxicité trop importante pour les cellules transfectées. Les deux types cellulaires (CHO et B16) ont été transformés par les vecteurs. Dans les deux cas le plasmide introduit ne pourra pas se répliquer et devra s'intégrer aléatoirement dans le génome cellulaire. Pour ces raisons un pool de 5 clones de CHO a aussi été testé pour avoir une confirmation globale et précise sur ce type de cellule.DNA polymerase β is a constitutive eukaryotic enzyme, called "house-keeping". Constitutive overexpression of this polymerase should not present too great a toxicity for the transfected cells. Both cell types (CHO and B16) have been transformed by the vectors. In both cases the plasmid introduced will not be able to replicate and will have to integrate randomly into the cell genome. For these reasons, a pool of 5 CHO clones was also tested to obtain a global and precise confirmation on this type of cell.
Le vecteur pUT-Polβ, montre que la surexpression de l'ADN polymerase β seule, n'est certainement pas toxique pour la cellule en division, car nous avons obtenu beaucoup de clones. Le résultat le plus étonnant est que cette polymerase eucaryote seule sensibilise très nettement à l'AZT (CMI de 10 à 30 μg/ml) les cellules eucaryotes CHO, avec un facteur supérieur à 30 pour 3 clones sur 5.The vector pUT-Polβ, shows that the overexpression of DNA polymerase β alone, is certainly not toxic to the dividing cell, since we have obtained many clones. The most astonishing result is that this eukaryotic polymerase alone sensitizes very clearly to AZT (MIC of 10 to 30 μg / ml) eukaryotic cells CHO, with a factor greater than 30 for 3 clones out of 5.
Les résultats sont résumés dans le tableau 2 ci-dessous.The results are summarized in Table 2 below.
Tableau 2 Concentrations Minimales Inhibitrices pour les Cellules CHO fμg/ml :Table 2 Minimum Inhibitory Concentrations for CHO cells fμg / ml:
EXEMPLE 3EXAMPLE 3
Construction d'un vecteur d'expression portant à la fois polβ et le gène HSV tk de la thymidine kinase du virus de l'herpès humain HSV-1 qui code à la fois pour une activité thymidine kinase et une activité thymidilate kinase. Le plasmide pZHTkβ (Figure 3) a été construit en amplifiant par PCR un fragment de pUT-pol β contenant pol β grâce à l'utilisation des oligo-nucléotidesConstruction of an expression vector carrying both polβ and the HSV tk gene of thymidine kinase from human herpes virus HSV-1 which codes for both thymidine kinase activity and thymidilate kinase activity. The plasmid pZHTkβ (Figure 3) was constructed by amplifying by PCR a fragment of pUT-pol β containing pol β thanks to the use of oligo-nucleotides
5 ' TTCTCAGTGACCGGCGCCTAGT 3 ' 5 ' GGGAGCCCAAGGACAGGAGTGAATGATTCGAACTTT3 '5 'TTCTCAGTGACCGGCGCCTAGT 3' 5 'GGGAGCCCAAGGACAGGAGTGAATGATTCGAACTTT3'
Le fragment PCR après coupure BbrpI-BstBI a été inséré dans un vecteur pZEOSGO ouvert par Spel-BstBI puis traité par la polymerase de Klenow à l'extrémité Spel. pZEOSGO dérive de pZEOSVl (Cayla, VECT 2001).The PCR fragment after BbrpI-BstBI cleavage was inserted into a pZEOSGO vector opened with Spel-BstBI and then treated with Klenow polymerase at the Spel end. pZEOSGO is derived from pZEOSVl (Cayla, VECT 2001).
La fonctionnalité de la construction a été vérifiée en utilisant des souches bactériennes E. coli,The functionality of the construct was verified using E. coli bacterial strains,
1 - soit en transformant la souche SC 18-12 pour l'expression de pol β,1 - either by transforming the strain SC 18-12 for the expression of pol β,
2 - soit en transformant une souche SC 18-12 tk' déficiente pour l'activité thymidine kinase pour l'expression thymidine kinase de HSV TK. Le mutant tk- a été obtenu en étalant des bactéries SC 18-12 sur un milieu contenant de l 'AZT. Seules les cellules déficientes en activité TK poussent sur un tel milieu puisque l 'AZT n'est alors pas phosphorylé et n'est donc pas incorporable dans l'ADN,2 - either by transforming a strain SC 18-12 tk ′ deficient for the thymidine kinase activity for the thymidine kinase expression of HSV TK. The tk- mutant was obtained by spreading bacteria SC 18-12 on a medium containing AZT. Only cells deficient in TK activity grow on such a medium since AZT is then not phosphorylated and therefore cannot be incorporated into DNA,
3 - soit en transformant la souche TD205, mutant thermosensible pour l'activité thymidilate kinase, pour l'activité thymidilate kinase de HSV TK. Le tableau 3 ci-dessous montre que les sensibilités des souches utilisées à la zéocine, à l'AZT ou à une température non permissive sont annihilées après transformation par le plasmide portant le gène hybride HSVtk::Sh et le cDNA de pol β. 3 - or by transforming the strain TD205, thermosensitive mutant for the thymidilate kinase activity, for the thymidilate kinase activity of HSV TK. Table 3 below shows that the sensitivities of the strains used to zeocin, to AZT or at a non-permissive temperature are annihilated after transformation by the plasmid carrying the hybrid gene HSVtk :: Sh and the cDNA of pol β.
Tableau 3Table 3
EXEMPLE 4 Sensibilité des cellules de mélanomes murins transfectées par pUTpolβ au ddC.EXAMPLE 4 Sensitivity of Murine Melanoma Cells Transfected by pUTpolβ to ddC
Des cellules cancéreuses hautement métastasiques de mélanomes murins, les cellules B16, ont été transfectées par la méthode du DMSO/polybrène par le vecteur pUT-pol β. Des extraits de cellules recombinantes ont été réalisés puis analysés par Western blot contre des anticorps anti-polβ. Cette expérience a montré la surexpression de pol β dans les cellules transfectées.Highly metastatic cancer cells from murine melanomas, B16 cells, were transfected by the DMSO / polybrene method with the vector pUT-pol β. Extracts of recombinant cells were produced and then analyzed by Western blot against anti-polβ antibodies. This experiment showed the overexpression of pol β in the transfected cells.
Nous avons aussi montré lors de tests de réplication d'ADN que ces extraits permettaient une incoφoration in vitro de ddC triphosphorylée au sein du substrat nucléotidique riche en G :We have also shown during DNA replication tests that these extracts allow an in vitro incoφoration of triphosphorylated ddC within the nucleotide substrate rich in G:
3'CATACGAGAACCAACAT 5' 5' GGTGGTGGTGGGCGCCGGCGGTGTGAATTCGGCACTGGCCGTCGTATGCTCTTGGTTGTA 3' Ce résultat montre la spécificité de pol β dans l'incorporation de la ddC dans l'ADN, entraînant le bloquage de la réplication de ce dernier. La figure 4 montre la toxicité de la ddC sur des cellules B16 transfectées par pUT-pol β par rapport à des cellules transfectées par un vecteur contrôle pUT526Δ ne contenant pas polβ mais seulement le gène de sélection Sh. La survie cellulaire a été mesurée en colorant les cellules traitées au Giemsa afin de comptabiliser celles ayant survécu à la mise en présence des drogues.3'CATACGAGAACCAACAT 5 '5' GGTGGTGGTGGGCGCCGGCGGTGTGAATTCGGCACTGGCCGTCGTATGCTCTTGGTTGTA 3 'This result shows the specificity of pol β in the incorporation of ddC into DNA, resulting in the blocking of replication of the latter. FIG. 4 shows the toxicity of ddC on B16 cells transfected with pUT-pol β relative to cells transfected with a control vector pUT526Δ not containing polβ but only the selection gene Sh. Cell survival was measured by staining cells treated with Giemsa in order to count those that survived the presence of drugs.
EXEMPLE 5EXAMPLE 5
Des cellules de mélanomes murins transfectées par pUT-pol β sont sensibles à AZT. Des expériences similaires aux précédentes ont été menées en utilisant l'AZT.Murine melanoma cells transfected with pUT-pol β are sensitive to AZT. Experiments similar to the previous ones were carried out using AZT.
La figure 5 montre l'effet toxique de l'AZT sur des cellules transfectées par pUT-pol β. EXEMPLE 6 Des cellules de mélanomes murins exprimant HSV TK::Sh et Pol β sont plus sensibles à l'AZT que des cellules exprimant HSV TK::Sh ou Pol β séparément.Figure 5 shows the toxic effect of AZT on cells transfected with pUT-pol β. EXAMPLE 6 Murine melanoma cells expressing HSV TK :: Sh and Pol β are more sensitive to AZT than cells expressing HSV TK :: Sh or Pol β separately.
Des cellules B16 ont été transfectées avec le vecteur pZHTkβ coexprimant Pol β et une protéine HSV TK::Sh fusionnant, - HSV TK exprimant les activités thymidine (TK) et thymidilate kinases (TMK) du virus de l'herpès HSV-1, c'est-à-dire capable de mono- puis diphosphoryler la thymidine et aussi une large gamme d'analogues nucléosidiques, - la protéine Sh conférant la résistance à la zéocine. La figure 6 indique que ces cellules sont plus sensibles à l'AZT que des cellules exprimant Pol β::Sh ou HSV TK::Sh séparément. REFERENCES CITEESB16 cells were transfected with the vector pZHTkβ coexpressing Pol β and a fusing HSV TK :: Sh protein, - HSV TK expressing the thymidine (TK) and thymidilate kinase (TMK) activities of the herpes HSV-1 virus, c that is to say capable of mono- and then diphosphorylating thymidine and also a wide range of nucleoside analogs, - the Sh protein conferring resistance to zeocin. Figure 6 indicates that these cells are more sensitive to AZT than cells expressing Pol β :: Sh or HSV TK :: Sh separately. REFERENCES CITED
1. Culver, K. W., Van Gilder, J , Link, C. I, Carlstrom, T.,1. Culver, K. W., Van Gilder, J, Link, C. I, Carlstrom, T.,
Buroker, T., Yuh, W., Koch, K., Schabold, K., Doornbas, S. and Wetjen, B. Gène therapy for the treatment of malignant brain tumors with vivo tumor transduction with the herpès simplex thymidine kinase gene/ganciclovir System. Hum Gène Ther.,Buroker, T., Yuh, W., Koch, K., Schabold, K., Doornbas, S. and Wetjen, B. Gene therapy for the treatment of malignant brain tumors with vivo tumor transduction with the herpes simplex thymidine kinase gene / ganciclovir System. Hum Gen Ther.,
5 343-379, 1994.5 343-379, 1994.
2 Moolten, F. L. and Wells, J.M Curability of tumors bearing heφes thymidine kinase gènes transferred by retroviral vectors. J. Natl. Cancer Inst , 82 . 297-300, 19902 Moolten, F. L. and Wells, J. M Curability of tumors bearing heφes thymidine kinase genes transferred by retroviral vectors. J. Natl. Cancer Inst, 82. 297-300, 1990
3. Culver, K W., Ram, Z Wallbridge, S , Ishii, H., Oldfield, E H. and Blaese, R. M. In vivo gène transfer with retroviral vector-producer cells for treatment of expérimental brain tumors Science, 256 . 1550-1552, 19923. Culver, K W., Ram, Z Wallbridge, S, Ishii, H., Oldfield, E H. and Blaese, R. M. In vivo gene transfer with retroviral vector-producer cells for treatment of experimental brain tumors Science, 256. 1550-1552, 1992
4. Huber, B. E., Richards, C A. and Krenitsky, T. A. Retroviral- mediated gène therapy for the treatment of hepatocellular carcinoma an innovative approach for cancer therapy Proc Nat Acad Sci USA, 88 8039-8043, 19914. Huber, B. E., Richards, C A. and Krenitsky, T. A. Retroviral- mediated gene therapy for the treatment of hepatocellular carcinoma an innovative approach for cancer therapy Proc Nat Acad Sci USA, 88 8039-8043, 1991
5 Mroz, P. J and Moolten, F L Retrovirally transduced5 Mroz, P. J and Moolten, F L Retrovirally transduced
Escherichia coli gpt gènes combine selectability with chemosensitivity capable of mediating tumor eradication Hum Hene Ther, 4 589-95, 1993 6 Mullen, C. A , Kilstrup, M and Blaese, R. M. Transfer of the bacterial gène for cytosine deaminase to mammalian cells confers lethal sensitivity to 5-fluorocytosine . a négative sélection System Proc Natl Acad Sci USA, 89 33- 7, 1992Escherichia coli gpt genes combine selectability with chemosensitivity capable of mediating tumor eradication Hum Hene Ther, 4 589-95, 1993 6 Mullen, C. A, Kilstrup, M and Blaese, RM Transfer of the bacterial gene for cytosine deaminase to mammalian cells confers lethal sensitivity to 5-fluorocytosine. a negative selection System Proc Natl Acad Sci USA, 89 33-7, 1992
7. Vile, R. G and Hart, I A Use of tissue-specific expression of the herpès simplex virus thymidine kinase gène to inhibit growth of established murine melanomas following direct intratumoral injection of DNA Cancer Res 53 3860-3864, 19937. Vile, R. G and Hart, I A Use of tissue-specific expression of the herpes simplex virus thymidine kinase gene to inhibit growth of established murine melanomas following direct intratumoral injection of DNA Cancer Res 53 3860-3864, 1993
8 Kornberg, A and Baker, T Eukaryotic DNA polymérases In8 Kornberg, A and Baker, T Eukaryotic DNA polymerases In
DNA réplication, 2nd ed , pp 197-225 New York Freeman, W. H , 1992 9 Sobol, R W , Horton, J K , Kuhn, R , Gu, H , Singhal, R K ,DNA replication, 2nd ed, pp 197-225 New York Freeman, W. H, 1992 9 Sobol, RW, Horton, JK, Kuhn, R, Gu, H, Singhal, RK,
Prasad, R , Rajewsky, K and Wilson, S H Requirement of mammalian DNA polymerase-β in base-excision repair Nature, 379 183-186, 1996Prasad, R, Rajewsky, K and Wilson, S H Requirement of mammalian DNA polymerase-β in base-excision repair Nature, 379 183-186, 1996
10 Jenkins, T M , Saxena, J K , Kumar, A , Wilson, S H and Ackerman, E J DNA polymerase β and DNA synthesis in Xenopus oocytes and in a nuclear extract Science, 258 475-478, 199210 Jenkins, T M, Saxena, J K, Kumar, A, Wilson, S H and Ackerman, E J DNA polymerase β and DNA synthesis in Xenopus oocytes and in a nuclear extract Science, 258 475-478, 1992
11 Sweasy, J B and Loeb, L Mammalian DNA polymerase β can substitute for DNA polymerase I duπng DNA réplication in Eschenchia coli J Biol Chem , 267 1407-1410, 1992 12 Zmudzka, B Z , Fornace, A , Colhns, J and Wilson, S H11 Sweasy, J B and Loeb, L Mammalian DNA polymerase β can substitute for DNA polymerase I duπng DNA replication in Eschenchia coli J Biol Chem, 267 1407-1410, 1992 12 Zmudzka, B Z, Fornace, A, Colhns, J and Wilson, S H
Characteπsation of DNA polymerase β mRNA cell-cycle and growth response in cultured human cells Nucleic Acids Res , 16 9589-9596, 1988Characteπsation of DNA polymerase β mRNA cell-cycle and growth response in cultured human cells Nucleic Acids Res, 16 9589-9596, 1988
13 Snvastava, D K , Rawson, T Y Showalter, S D and Wilson, S H Phorbol ester abrogates up-regulation of DNA polymerase β by DNA- alkylating agents in Chinese Hamster Ovary cells J Biol Chem , 270 16402- 16408, 199513 Snvastava, D K, Rawson, T Y Showalter, S D and Wilson, S H Phorbol ester abrogates up-regulation of DNA polymerase β by DNA- alkylating agents in Chinese Hamster Ovary cells J Biol Chem, 270 16402- 16408, 1995
14 Fornace, A J , Zmudzka, B , Hollander, M C and Wilson, S H Induction of β-polymerase mRNA by DNA damaging agents in Chinese Hamster Ovary cells Mol Cell Biol 9 851-853, 1989 15 Kunkel, T A Frameshift mutagenesis by eucaryotic DNA polymérases in vitro J Biol Chem , 261 13581 -13587, 198614 Fornace, AJ, Zmudzka, B, Hollander, MC and Wilson, SH Induction of β-polymerase mRNA by DNA damaging agents in Chinese Hamster Ovary cells Mol Cell Biol 9 851-853, 1989 15 Kunkel, TA Frameshift mutagenesis by eukaryotic DNA polymerases in vitro J Biol Chem, 261 13581 -13587, 1986
16 Copeland, W C , Chen, M S and Wang, T S F Human16 Copeland, W C, Chen, M S and Wang, T S F Human
DNA polymérases α and β are able to incoφorate anti-HIV deoxynucleotides into DNA J Biol Chem , 267 21459-21464, 1992 17 Parker, W B , White, E L , Shaddix, S C , Ross, L J ,DNA polymerases α and β are able to incoφorate anti-HIV deoxynucleotides into DNA J Biol Chem, 267 21459-21464, 1992 17 Parker, W B, White, E L, Shaddix, S C, Ross, L J,
Buckheit, R W , Germany, J M Secπst, J A , Vince, R and Shannon, W M Mechanisms of inhibition of human îmmunodeficiency virus type I reverse transcπptase and human DNA polymérases α, β and γ by the 5'-tπphosphates of carbovir, 3'-azido-3'deoxythymidine, 2',3'-dideoxyguanosine, and 3'- deoxythymidine. J. Biol. Chem., 266 : 1754-1762, 1991.Buckheit, RW, Germany, JM Secπst, JA, Vince, R and Shannon, WM Mechanisms of inhibition of human îununodeficiency virus type I reverse transcπptase and human DNA polymerases α, β and γ by the 5'-tπphosphates of carbovir, 3'-azido-3'deoxythymidine, 2 ', 3'-dideoxyguanosine, and 3'- deoxythymidine. J. Biol. Chem., 266: 1754-1762, 1991.
18. Sommadossi, J. P., Cariisle, R. and Zhou, Z. Cellular pharmacology of 3'-azido-3'-deoxythymidine with évidence of incorporation into DNA of human bone marrow cells. Mol. Pharmacol., 36 : 9-14, 1989. 18. Sommadossi, J. P., Cariisle, R. and Zhou, Z. Cellular pharmacology of 3'-azido-3'-deoxythymidine with evidence of incorporation into DNA of human bone marrow cells. Mol. Pharmacol., 36: 9-14, 1989.

Claims

REVENDICATIONS
1/ Utilisation d'un vecteur exprimant l'ADN polymerase β ou un analogue de l'ADN polymerase β afin d'assurer l'intégration dans l'ADN d'une cellule d'analogues nucléotidiques à activité anti-virale ou anti-tumorale, pour la fabrication d'un médicament destiné au traitement du cancer ou d'une maladie virale telle que le SIDA.1 / Use of a vector expressing DNA polymerase β or an analogue of DNA polymerase β in order to ensure the integration into the DNA of a cell of nucleotide analogues with anti-viral or anti-tumor activity , for the manufacture of a medicament for the treatment of cancer or a viral disease such as AIDS.
2/ Utilisation d'un vecteur selon la revendication 1, caractérisée en ce que ledit vecteur comporte un gène codant pour l'ADN polymerase β ou pour un analogue de l'ADN polymerase β sous le contrôle d'un système d'expression efficace dans ladite cellule.2 / Use of a vector according to claim 1, characterized in that said vector comprises a gene coding for DNA polymerase β or for an analog of DNA polymerase β under the control of an efficient expression system in said cell.
3/ Utilisation d'un vecteur selon la revendication 2, caractérisée en ce que ledit vecteur comporte également un gène codant pour la thymidine et/ou thymidilate kinase sous le contrôle d'un système d'expression efficace dans ladite cellule.3 / Use of a vector according to claim 2, characterized in that said vector also comprises a gene coding for thymidine and / or thymidilate kinase under the control of an efficient expression system in said cell.
4/ Utilisation d'un vecteur la revendication 1 ou 2, en association avec un vecteur exprimant la thymidine et/ou thymidilate kinase.4 / Use of a vector claim 1 or 2, in combination with a vector expressing thymidine and / or thymidilate kinase.
5/ Utilisation d'un vecteur selon la revendication 4, caractérisée en ce que le vecteur exprimant la thymidine et/ou thymidilate kinase comporte un gène codant pour la thymidine et/ou thymidilate kinase sous le contrôle d'un système d'expression efficace dans ladite cellule.5 / Use of a vector according to claim 4, characterized in that the vector expressing thymidine and / or thymidilate kinase comprises a gene coding for thymidine and / or thymidilate kinase under the control of an efficient expression system in said cell.
6/ Vecteur d'expression comprenant un gène codant pour la polymerase β ou un analogue de la polymerase β sous le contrôle d'un système d'expression efficace dans une cellule cible. 11 Vecteur d'expression selon la revendication 6, caractérisé en ce qu'il s'agit d'un vecteur viral.6 / Expression vector comprising a gene coding for β polymerase or an analog of β polymerase under the control of an efficient expression system in a target cell. 11 Expression vector according to claim 6, characterized in that it is a viral vector.
8/ Vecteur d'expression selon la revendication 7, caractérisé en ce qu'il s'agit d'un vecteur viral dérivé d'un virus sélectionné parmi les adénovirus, les virus adéno-associés, les rétrovirus (dont le HIV), les virus de l'herpès, les poxvirus, les parvovirus, les plasmovirus, les Semliki Forest virus et les Sindbis virus.8 / Expression vector according to claim 7, characterized in that it is a viral vector derived from a virus selected from adenoviruses, adeno-associated viruses, retroviruses (including HIV), herpes viruses, poxviruses, parvoviruses, plasmoviruses, Semliki Forest viruses and Sindbis viruses.
9/ Vecteur d'expression selon l'une des revendications 6 à 8, caractérisé en ce qu'il comporte une séquence de ciblage et/ou d'expression spécifique de tissus.9 / Expression vector according to one of claims 6 to 8, characterized in that it comprises a targeting sequence and / or specific expression of tissues.
10/ Vecteur d'expression selon l'une des revendications 6 à 9, caractérisé en ce qu'il s'agit du vecteur viral pUT pol β ou du vecteur pZH tk pol β.10 / Expression vector according to one of claims 6 to 9, characterized in that it is the viral vector pUT pol β or the vector pZH tk pol β.
11/ Vecteur d'expression selon l'une des revendications 6 à 9, caractérisé en ce qu'il comporte en outre un gène codant pour la thymidine et/ou thymidilate kinase sous le contrôle d'un système d'expression efficace dans une cellule cible.11 / Expression vector according to one of claims 6 to 9, characterized in that it further comprises a gene coding for thymidine and / or thymidilate kinase under the control of an efficient expression system in a cell target.
12/ Cellule transformée par un vecteur d'expression selon l'une des revendications 6 à 11.12 / Cell transformed with an expression vector according to one of claims 6 to 11.
13/ Cellule transformée par un vecteur d'expression selon l'une des revendications 6 à 11, et par un vecteur d'expression comportant un gène codant pour la thymidine et/ou thymidilate kinase sous le contrôle d'un système d'expression efficace dans une cellule cible.13 / Cell transformed by an expression vector according to one of claims 6 to 11, and by an expression vector comprising a gene coding for thymidine and / or thymidilate kinase under the control of an efficient expression system in a target cell.
14/ Vecteur de clonage, caractérisé en ce qu'il comporte un gène codant pour l'ADN polymerase β ou un analogue de l'ADN polymerase β dans lequel a été inséré un lieur multisite.14 / Cloning vector, characterized in that it comprises a gene coding for DNA polymerase β or an analog of DNA polymerase β into which a multisite linker has been inserted.
15/ Produit contenant un vecteur d'expression selon l'une des revendications 6 à 1 1 et au moins un agent anti-viral comme produit de combinaison pour une utilisation simultanée, séparée ou étalée dans le temps.15 / Product containing an expression vector according to one of claims 6 to 1 1 and at least one anti-viral agent as combination product for simultaneous, separate or spread over time.
16/ Produit contenant un vecteur d'expression selon l'une des revendications 6 à 10, contenant en outre un vecteur d'expression comportant un gène codant pour la thymidine et/ou thymidilate kinase sous le contrôle d'un système d'expression efficace dans une cellule cible. 17/ Produit selon la revendication 15 ou 16, caractérisé en ce que l'agent anti-viral est l'AZT ou la ddC. 16 / Product containing an expression vector according to one of claims 6 to 10, further containing an expression vector comprising a gene coding for thymidine and / or thymidilate kinase under the control of an efficient expression system in a target cell. 17 / Product according to claim 15 or 16, characterized in that the anti-viral agent is AZT or ddC.
EP97951311A 1996-12-13 1997-12-11 Use of a vector expressing dna polymerase beta as medicine Withdrawn EP0944724A1 (en)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
FR9615343 1996-12-13
FR9615343A FR2757178B1 (en) 1996-12-13 1996-12-13 USE OF A VECTOR EXPRESSING DNA POLYMERASE BETA AS A MEDICAMENT
PCT/FR1997/002274 WO1998026077A1 (en) 1996-12-13 1997-12-11 USE OF A VECTOR EXPRESSING DNA POLYMERASE β AS MEDICINE

Publications (1)

Publication Number Publication Date
EP0944724A1 true EP0944724A1 (en) 1999-09-29

Family

ID=9498646

Family Applications (1)

Application Number Title Priority Date Filing Date
EP97951311A Withdrawn EP0944724A1 (en) 1996-12-13 1997-12-11 Use of a vector expressing dna polymerase beta as medicine

Country Status (5)

Country Link
US (1) US6475996B1 (en)
EP (1) EP0944724A1 (en)
JP (1) JP2001512962A (en)
FR (1) FR2757178B1 (en)
WO (1) WO1998026077A1 (en)

Families Citing this family (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
FR2816319B1 (en) * 2000-11-08 2004-09-03 Millegen USE OF DNA MUTAGEN POLYMERASE FOR THE CREATION OF RANDOM MUTATIONS
US20090291440A1 (en) * 2006-05-24 2009-11-26 Ken Hirano Method for synthesizing nucleic acid using dna polymerase beta and single molecule sequencing method
WO2009138094A1 (en) * 2008-05-14 2009-11-19 Sherif Salah Abdul Aziz Pharmaceutical compositions
EP3666287A1 (en) * 2013-12-31 2020-06-17 ProteoNic Biotechnology IP B.V. Construct and sequence for enhanced gene expression

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JPH0815429B2 (en) * 1986-12-03 1996-02-21 愛知県 DNA polymerase β gene, recombinant plasmid having the gene, and transformant transformed with the plasmid
US5166140A (en) * 1987-05-05 1992-11-24 City Of Hope Use of certain nucleoside analogs to attenuate cancer cell resistance to DNA damaging chemotherapy
US5614365A (en) * 1994-10-17 1997-03-25 President & Fellow Of Harvard College DNA polymerase having modified nucleotide binding site for DNA sequencing
WO1996021416A2 (en) * 1994-12-30 1996-07-18 Chiron Corporation Methods and compositions for treatment of solid tumors in vivo

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO9826077A1 *

Also Published As

Publication number Publication date
WO1998026077A1 (en) 1998-06-18
FR2757178B1 (en) 1999-03-05
JP2001512962A (en) 2001-08-28
FR2757178A1 (en) 1998-06-19
US6475996B1 (en) 2002-11-05

Similar Documents

Publication Publication Date Title
EP0998568B1 (en) Mutant having uracil phosphoribosyl transferase activity
FI113787B (en) Vector for expression of gene product in the cell
Arai et al. Cloning of a human homolog of the yeast OGG1 gene that is involved in the repair of oxidative DNA damage
AU720936B2 (en) Thymidine kinase variants, corresponding nucleic acid sequences and their use in gene therapy
KR20210091160A (en) Compositions and methods for immunotherapy
CN111712569A (en) Cpf 1-related methods and compositions for gene editing
JPH04504843A (en) Recombinant therapy for infections and hyperproliferative disorders
CN112040987A (en) Gene regulatory compositions and methods for improved immunotherapy
CN113396216A (en) Combinatorial gene targets for improved immunotherapy
KR20060040697A (en) Polypeptide having an improved cytosine deaminase activity
PT1814907E (en) Kit of parts designed for implementing an antitumoral or antiviral treatment in a mammal
KR101337210B1 (en) Thymidine kinase
US6800483B1 (en) Compositions and methods for sensitizing and inhibiting growth of human tumor cells
KR20230152689A (en) gene silencing
EP0944724A1 (en) Use of a vector expressing dna polymerase beta as medicine
CA2248629A1 (en) Enzymes combinations for destroying proliferative cells
JP2006504403A (en) Plant thymidine kinase and methods of use thereof
KR20230131178A (en) Gene editing using modified endonucleases
CN117062831A (en) Efficient TCR gene editing in T lymphocytes
FR2751988A1 (en) Nucleic acid encoding mutant thymidine kinase(s)
FR2744731A1 (en) Nucleic acid encoding mutant thymidine kinase(s)
KAI A THESIS SUBMITTED FOR THE DEGREE OF MASTER OF SCIENCE DEPARTMENT OF BIOLOGICAL SCIENCES NATIONAL UNIVERSITY OF SINGAPORE AND

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 19990712

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): DE FR GB IT

RTI1 Title (correction)

Free format text: USE OF A VECTOR EXPRESSING DNA POLYMERASE BETA AS MEDICINE

17Q First examination report despatched

Effective date: 20031119

GRAP Despatch of communication of intention to grant a patent

Free format text: ORIGINAL CODE: EPIDOSNIGR1

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20060328