EP0861328A2 - New strains of bacillus thuringiensis and pesticide composition containing them - Google Patents

New strains of bacillus thuringiensis and pesticide composition containing them

Info

Publication number
EP0861328A2
EP0861328A2 EP96937346A EP96937346A EP0861328A2 EP 0861328 A2 EP0861328 A2 EP 0861328A2 EP 96937346 A EP96937346 A EP 96937346A EP 96937346 A EP96937346 A EP 96937346A EP 0861328 A2 EP0861328 A2 EP 0861328A2
Authority
EP
European Patent Office
Prior art keywords
strain
gene
bacillus thuringiensis
sigk
protein
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP96937346A
Other languages
German (de)
French (fr)
Inventor
Alejandra Bravo
Didier Lereclus
Hervé AGAISSE
Sylvie Salamitou
Vincent Sanchis
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Institut Pasteur de Lille
Institut National de la Recherche Agronomique INRA
Original Assignee
Institut Pasteur de Lille
Institut National de la Recherche Agronomique INRA
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Institut Pasteur de Lille, Institut National de la Recherche Agronomique INRA filed Critical Institut Pasteur de Lille
Publication of EP0861328A2 publication Critical patent/EP0861328A2/en
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/32—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Bacillus (G)
    • C07K14/325—Bacillus thuringiensis crystal peptides, i.e. delta-endotoxins
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/20—Bacteria; Culture media therefor
    • C12N1/205—Bacterial isolates
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00—Microorganisms ; Processes using microorganisms
    • C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
    • C12R2001/07—Bacillus
    • C12R2001/075—Bacillus thuringiensis

Definitions

  • the present invention relates to new strains of Bacillus thuringiensis, to pesticidal compositions using them and to the use of these strains for the expression of proteins of interest.
  • Bacillus thuringiensis is a gram-positive bacterium that produces proteins with insecticidal properties, especially against the larvae of a large number of insects. These bacteria, possibly after inactivation, are used in pesticidal compositions intended to combat insects harmful to crops or vectors of diseases, in particular mosquitoes.
  • Bt serotype 3a 3b in particular is used against crop pests, and serotype H14 is used to destroy mosquito larvae.
  • the pesticidal proteins produced by Bacillus thuringiensis are called ⁇ -endotoxins and are produced abundantly during sporulation. They accumulate in the form of parasporal crystal inclusions, and can represent up to 25% of the dry weight of spore-forming cells.
  • Bacillus thuringiensis has been used as biopesiicides for almost 30 years under different trade names.
  • the use of Bacillus thuringiensis as a biological control agent has many advantages over chemical pesticides; indeed, it has a narrow and very specific host spectrum and it has no effect on insects which are not the targets and it has no adverse effect on vertebrates or on the environment.
  • crylIIA gene is different from the mode of expression of the other cry genes, in fact, this crylIIA gene is expressed from a promoter whose activation is independent of all the genes involved in the initiation of sporulation or factors involved in sporulation.
  • sporulation is dependent on the expression of two sigma factors called respectively sigma ( ⁇ ) 35 and sigma ( ⁇ ) 28; taking into account their great homology with the factors sigma ( ⁇ ) E and sigma ( ⁇ ) K in Bacillus subtilis, it is this last terminology which will be used below, just as the corresponding genes will be called sigE and sigK.
  • the present invention relates to a strain of Bacillus thuringiensis which expresses ⁇ E but does not sporulate or little or does not produce viable spores.
  • the present invention is based on the demonstration of the fact that a mutant of Bacillus thuringiensis which expresses sigE and which does not express sigK produces a quantity of toxins practically identical to the corresponding wild strain, but, on the other hand, does not sporulate does not or does not produce viable spores.
  • strains has two advantages: 1) avoiding the dissemination of spores in the environment during treatments with biopesticides; 2) increase the persistence of toxins in the environment due to their encapsulation.
  • the sigK- mutants can also be obtained by deleting all or part of the nucleotide sequence corresponding to that of the sigK gene with or without regulatory regions.
  • Gene interruption techniques are known, they essentially consist in introducing into a DNA sequence carrying the sigK gene any DNA sequence, the whole being introduced into the strain, there is homologous recombination , the sigK gene being replaced by the interrupted sigK gene.
  • the selection character allows at this time to select the mutants of interest.
  • strains intended for transformation strains of Bacillus thuringiensis having a very varied or very large production of toxins. Indeed, as has been indicated previously, the fact of interrupting the sigK gene only blocks sporulation but does not block the production of toxins.
  • Bt any strain of Ba cillus th uringiensis.
  • the present invention relates more particularly to the Bacillus thuringiensis 407 SigK- strain (pHT410) as well as the recombinant Bacillus thuringiensis Kto SigK- strain (pHTF3-1C / A (b) -IRS-T- ⁇ ) deposited in the National Collection of Cultures of Microorganisms of the Institut Pasteur, respectively on October 26, 1995 under the number 1-1634 and on October 22, 1996 under the number 1-1776.
  • the proteins expressed by the strain may depend on the type of pesticidal activity sought, thus, Cryl is toxic for lepidoptera, Cryll against lepidoptera and diptera and CrylV against diptera.
  • Cryl is toxic for lepidoptera, Cryll against lepidoptera and diptera and CrylV against diptera.
  • the mutant strains as described according to the invention which are sigK- and which express, after chromosomal or plasmid integration, genes coding for proteins homologous or heterologous with respect to the Bt genome.
  • the recombinant acquires the crylC gene and does not retain foreign DNA.
  • toxin genes can thus be added, either into the bacterial chromosome by homologous recombination, or integrated into resident plasmids.
  • a strain of Bt kurstaki expressing both the crylAc gene under the control of its own promoter and the crylC gene under the control of the promoter of the crylIIA gene.
  • cry genes which can be used in these constructions, mention should be made of: cryl, cry II, cry IV and cyt.
  • Another mode of introduction of a gene to be expressed consists in using plasmids of gram positive bacteria comprising an origin of functional replication in Bt which is described, for example, in PCT patent application WO93 / 02199 concerning the plasmids pHT304 and pHT315.
  • the sigK * strains obtained according to the process according to the invention can be used, optionally after inactivation, in pesticidal compositions, in particular in insecticidal compositions intended to be used in order to destroy the larvae, in particular the insect larvae.
  • the pesticidal compositions will be prepared according to techniques themselves known, that is to say, if necessary, in admixture with an inert support or not ensuring optimum activity of the Bacillus toxins in question.
  • the inactivation of the strains which is essential for the exploitation of the sporulating strains in certain countries, is optional in the case of the sigK- mutants constructed in the context of the present invention. This inactivation can be carried out by any physical or chemical method, in particular by irradiation which ensures the non-viability of the strains.
  • the strains according to the invention do not contain viable spores, their inactivation is easier than in the case of sporulated strains.
  • the toxins being kept inside the bacteria, this makes it possible to increase the lifespan of the toxins in the environment (the toxin being released only during digestion of the bacteria by the larva ).
  • certain mutants according to the invention exhibited quite exceptional resistance, in this case it is necessary to provide for either the use of specific strains selected for their good digestibility in insects to treat, or even provide chemical treatments, surface-active agents for example, physical, ultrasonic or biological treatments, introduction of particular elements into the walls of the microorganism (by genetic recombination technique or others) in order to ensure a better digestibility or easier accessibility of the toxin when the microorganism has been ingested.
  • This new strain of Bt is capable of supplying one of the elements to a pesticidal composition, but also useful as a vector for expressing homologous or heterologous genes with respect to the Bt genome, said genes being cloned in the sigK- mutant of Bt, ie using a self-replicating plasmid, either by homologous recombination with respect to the genome of the bacteria.
  • the construction of the vector system capable of expressing, for example proteases, lipases, or any other type of protein, can be similar to that described in PCT patent application WO94 / 25612.
  • the invention also relates to a nucleotide sequence containing the SigE gene, not containing an active SigK gene and containing a sequence coding for a gene of interest.
  • FIG. 1 represents the interruption of the chromosomal genes sigE and sigK of Bacillus thuringiensis; the plasmids pAB1 and pAB2 are integrated into the Bt chromosome by homologous recombination, the second homologous recombination event leads to the loss of the entire sequence of pRN5101; the arrows indicate the direction of transcription of the ApR, EmR and Km R genes which correspond to the genes conferring, respectively, resistance to ampicillin, erythromycin and kanamycin, the triangles represent, respectively, the origin of replication of pBR322 (oriEc) and the origin of replication of pE194ts (orits);
  • FIG. 2 shows the construction of plasmids for the analysis of transcription in Bacillus thuringiensis; pHT304-18Z is, as previously described (Agaisse and Lereclus 1994b); the arrows indicate the direction of transcription of ermC, bla and lacZ and the direction of functional replication in E. coli (oriEc); ori l030 is the origin of replication of the Bt plasmid pHT1030 (Lereclus and Arantes 1992); the broken arrows indicate the direction of transcription initiated from the psigE promoter, psigK, Bt I and Bt II, as previously indicated (Rong et al. 1986; Sandman et al. 1988; Wong et al. 1983); the HindIII-BamHI fragments carrying the promoter regions of the spoIID, cotA and cryLAa genes were cloned in pHT304-18Z;
  • - Figure 3 shows the expression of ⁇ -galactosidase in Bt under the control of the promoters of the spoIID and cotA genes; the cells are grown on SP medium at 30 ° C; time zero indicates the end of the exponential phase, t n is the number of hours before or after time zero; ⁇ is the ⁇ -galactosidase activity of the Bt strain carrying pHTspoIID; B is the ⁇ -galactosidase activity of the Bt strain carrying pHTcotA; the specific activity of ⁇ -galactosidase is determined at the times indicated in Spo + 407 (m), 407 SigE- (•) and 407 SigK- (O); - Figure 4 shows the expression of ⁇ -galactosidase directed under control of crylAa in Bt strains carrying pHTcryIA2, grown on SP medium at 30 ° C and the ⁇ -galactosidase activity being determined at the times indicated Spo + 407 (a), 407
  • FIG. 6 represents the recombination reaction between the two 1RS sites, catalyzed by the integrase Tnpl of the transposon Tn 4430 present in the strain Kto SigK-, the plasmid resulting from site-specific recombination is designated pHTF3-1C / A ( b) -IRS-T- ⁇ .
  • EXAMPLE 1 Material and methods Bacterial strains and media The Bt 407 strain (serotype H l) and its acristalliferous derivative
  • E. coli K-12 strain TG1 ( ⁇ (lac-proAB) supE thi hsd D5 (F'traD36 pro + proB + laclq lacZ ⁇ M 15)) is used for the cloning experiments (Gibson 1984).
  • the Bt strains are cultivated at 30 ° C. in Luria medium (LB) and in HCT medium (Lecadet et al. 1980) or in a nutritive sporulation medium (SP medium) (Lereclus et al. 1995).
  • E. coli strains are grown at 37 ° C in LB medium.
  • the antibiotic concentration for bacterial selection is as follows: ampicillin, 100 ⁇ g / ml (for E. coli); erythrom vein, 5 ⁇ g / ml (for Bt); kanamycin, 10 ⁇ g / ml for E. coli and 200 ⁇ g / ml for Bt.
  • the plasmid pRN5101 which was supplied by S. Gruss is a plasmid originating from thermosensitive replication in gram positive cells, it was constructed by insertion of pE194ts (Villafane et al. 1987) in the ClaI site of pBR322.
  • the Bluescript plasmid comes from the company Strata responsible and the constructions of the plasmids pHT304-18Z and pHT410 have already been described (Agaisse and Lereclus 1994b; Lereclus et al. 1989).
  • the oligonucleotides (CryIA-1 and CryIA-2) used for the PCR amplification of the 362 bp fragment containing the promoter region of the crylAa gene are described in Table 1.
  • the primer CryIA-1 has a 7 bp extension at the 5 'end containing the HindIII restriction site and the CryIA-2 primer contains an 8 bp extension with the BamHI restriction site. The two restriction sites are introduced to facilitate cloning in pHT304-18Z.
  • the 5 'and 3' regions of the corresponding genes are amplified by PCR using oligonucleotides with the appropriate restriction sites at the 5 'end (Table 1) and subcloned separately in pBS KS ⁇
  • the 5 'regions of the sigE and sigK genes are BamHI-Xbal restriction fragments of 857 and 61 1 bp respectively.
  • the 3 'regions are EcoRI-BamHI restriction fragments of 807 and 606 bp respectively.
  • the DNA fragments containing the 5 'and 3' regions of each of the genes are purified and ligated with a 1.5 kb Xbal-EcoRI fragment carrying the aphA3 gene of Enterococcus faecalis (KmR cassette) (Trieu-Cuot and Courvalin 1983) in the BamHI restriction site of the plasmid pRN5101.
  • the resulting heat-sensitive plasmids pAB1 and pAB2 carry a copy interrupted by a kanamycin resistance gene in the sigE and sigK genes respectively.
  • the plasmids pDG675 and pDG676 carrying respectively the promoter region of the spoIID and cotA genes of B. subtilis were supplied by Dr. P.
  • pHTspoIID was constructed by subcloning the 300 bp HindIII-BamHI restriction fragment of pDG675 between the HindIII and BamHI restriction sites of pHT304-18Z.
  • pHTcotA was constructed as follows: the 400 bp of the EcoRI-BamHI fragment of pDG676 are first subcloned in pBS KS-, giving pKScotA. The HindIII-BamHI restriction fragment of pKScotA is then subcloned between the HindIII and BamHI restriction sites of pHT304-18Z, the resulting plasmid being designated under the name pHTcotA. Construction and transformation
  • Plasmid DNA is extracted from E. coli by the standard alkaline lysis method. Chromosomal DNA is extracted from Bt as previously described (Msadek et al. 1990). The restriction enzymes and T4 ligase are from New England Biolabs, beverly, MA. The DNA fragments are purified on agarose gel using the Prep-A-Gene kit (Bio-Rad Laboratories, Richmond, CA.). The oligonucleotide primers are synthesized by Genset (Paris, France) and the PCR amplification is carried out using the GeneAmp PCR 2400 System (Perkin-Bmer, Foster City, CA).
  • the DNA template used in the PCR amplification is either the crylAa gene already cloned from the Bt 407 strain (Lereclus et al. 1989) or the chromosomal DNA extracted from the 407 Cry strain.
  • the reaction conditions are as follows: an incubation of 5 min at 95 ° C, followed by 30 cycles of one min at 57 ° C for hybridization, one min at 72 ° C for extension and one min at 92 ° C for denaturation; at the end, a new incubation at 72 ° C for 10 min is carried out.
  • Taq polymerase comes from USB Laboratories (Cleveland, OH). The standard procedure is used for the transformation of E. coli and Bt strains are transformed by electroporation, as has already been described (Lereclus et al. 1989).
  • Protein analysis is carried out after culture of Bt strains and sonication, the analysis being carried out on 0.1% SDS - 12% PAGE Insecticide activity bioassays
  • the heat-sensitive plasmids pAB1 and pAB2 containing the copy of the gene interrupted by KmR of sigE and sigK respectively are introduced into the strain Bt 407 Cry- by electroporation.
  • the replacement of the sigE and sigK genes with the interrupted copy sigE :: Km and sigK :: Km is obtained by successive cultures of the transformants in the presence of kanamycin at a non-permissive temperature (40 ° C.) (see FIG. 1).
  • the Bt strains transformed by the plasmids pAB1 or pAB2 are both resistant to erythromycin and to kanamycin at 37 ° C.
  • the transformants in which the sigE or sigK gene has been exchanged for its interrupted copy are cultured at a non-permissive temperature, that is to say at which the replication of the plasmids has been blocked. They can be selected for their resistance to kanamycin.
  • the Spo- mutants (hereinafter 407-SigE- and 407-SigK- ) are resistant to kanamycin but sensitive to erythromycin.
  • the replacement of the Bt sigE and sigK genes by their interrupted copy is controlled by PCR analysis, the chromosomal DNA of the selected mutants is used as a template for PCR and the external sequences complementary to each gene are used as a primer in association with sigE oligonucleotides. -4 and sigK-4, respectively.
  • the size of the PCR products corresponds to genes interrupted by KmR.
  • the Bt SigE- and SigK- mutant strains are unable to sporulate. No heat-resistant spore is produced after 72 hours of growth at 30 ° C in HCT or SP medium. Using similar growth conditions, at least 90% of the sporulent wild strain cells after 24 or 48 hours. Examination of the cells by phase contrast microscopy indicates that the sigE mutant strain is blocked at an early sporulation stage (stage II), after the formation of the asymmetric septum dividing the mother cell and the spore compartment. The mutant strain sigK- is blocked in a later stage of sporulation (stage IV). A gray prespore placed at one of the poles of the cell can be seen inside the cells.
  • the plasmids pHTspoIID and pHTcotA (see Figure 2) pon the promoter regions of the spoIID and cotA genes of Bacillus subtilis fused with the lacZ gene are constructed to monitor the appearance and disappearance of the factors ⁇ E and ⁇ K during the sporulation of Bt.
  • SpoIID est transcribed by an RNA polymerase containing the factor ⁇ E (Lopez-Diaz et al. 1986; Rong et al. 1986). This gene is involved in the morphological development of stage II spores (Young and Mandelstam 1979).
  • the cotA gene codes for a spore coat protein (Donavan et al. 1987) and its transcription depends on ⁇ K (Sandman et al.
  • the plasmids pHTspoIID and pHTcotA are introduced into Bt 407 Cry-Spo +, 407-SigE- and 407-SigK- by electroporation and the synthesis of ⁇ -galactosidase is followed during growth in SP medium (FIGS. 3A and 3B).
  • the Spo + strain the synthesis of ⁇ -galactosidase under the control of the spoIID promoter starts at t2 to reach a maximum of approximately 10,000 U / mg of proteins at t5 and then decreases.
  • a plasmid containing the transcriptional fusion crylAa'-lacZ was constructed.
  • a region containing the promoter region of the crylAa gene is amplified by PCR, as described, then cloned upstream of the gene lacZ reporter in pHT304-18Z.
  • the resulting plasmid designated under the name pHTcryIA2 (FIG. 2), is introduced into the Bt 407 Cry Spo +, 407 SigE and 407 SigK- strains by electroporation.
  • ⁇ -galactosidase in the Spo + 407 Cry- strain begins at t2 and presents two peaks, the first at t7 and the second tl 1 (FIG. 4).
  • t7 and tl 1 fusions correspond with the periods of maximum expression of ⁇ E and ⁇ K.
  • the expression of the synthesis of ⁇ -galactosidase directed by the promoter region of crylAa is severely reduced in the mutants 407-SigE- (FIG. 4).
  • a weak ⁇ -galactosidase activity is detected at t2 with a maximum of 200 U / mg of proteins at t10.
  • the ⁇ -galactosidase synthesis directed by the promoter region of crylAa starts at t2 and shows a maximum of 9000 U / mg of proteins at T7 in the mutant 407-sigK- (FIG. 4).
  • the second expression peak at a later sporulation time in the Spo + strain is not apparent in the mutant SigK-, which indicates a participation of the factor ⁇ K in the transcription of the crylAa gene during the late phase of sporulation.
  • EXAMPLE 4 Production of the CrylAa Toxin in the SigE and SigK Mutants of Bt
  • the plasmid pHT410 carrying the crylAa gene from the wild strain of Bt 407 (Lereclus et al. 1989) is introduced into the strains Bt 407 Cry-Spo +, 407-SigE and 407-SigK- by electroporation.
  • the transformants are cultured on HCT and SP medium at 30 ° C. and the production of crystal inclusions is examined by phase contrast microscopy and electron microscopy. After 48 hours of growth in HCT medium, the large bipyramidal crystals are observed in the transformants 407-Spo + and 407-SigK-. However, the crystals in the Spo + strain are released while those of the SigK- mutants remain encapsulated in the cell wall. Even after 72 hours of growth in HCT medium, there is no release of the crystal inclusions from the mutant SigK ". No crystal is observed in the 407-SigE strain carrying the plasmid pHT410.
  • the Bacillus thuringiensis strain not expressing, or very weakly, the sigma K protein, under the above experimental conditions, and deposited at the CNCM under No. 1- 1634, is constructed under the following conditions: Bacterial strain of which the sigK gene is interrupted by the aphA3 gene conferring resistance to kanamycin. The strain thus constructed is transformed by the plasmid pHT410 carrying the crylAa gene and the ermC gene, conferring resistance to erythromycin. This non-sporulating strain produces large amounts of CrylAa toxin during the stationary phase. EXAMPLE 5
  • the Kto strain is a natural spore-forming strain of B. thuringiensis; this strain synthesizes a l-endotoxin of the CrylA (c) type.
  • This ⁇ -endotoxin has insecticidal activity against the larvae of Ostrinia nubilalis (the European corn borer), a major pest of corn crops in the United States and Europe.
  • This ⁇ -endotoxin (and therefore the Kto strain) is very little active against other major pests belonging to the Noctuidae family such as Spodoptera littoralis, Spodoptera e.xigua or Mamestra brassicae (see Table 3).
  • CrylC / A the construction of which (plasmid PHT81) is described elsewhere by Sanchis et al. (1989) are active against S. littoralis but very little active against O. nubilalis (Table 3).
  • CrylC / A the construction of which (plasmid PHT81) is described elsewhere by Sanchis et al. (1989) are active against S. littoralis but very little active against O. nubilalis (Table 3).
  • cryl C gene or the cryl chimeric C / A gene (b) into the Kto strain.
  • thuringiensis already containing one or more other ⁇ -endotoxin genes does not result in an increase in the total production of ⁇ -endotoxins. Consequently, a recombinant strain containing different genes of the cryl type will have a broader spectrum of activity but will produce less of each of the ⁇ -endotoxins; it will therefore have less effectiveness with respect to each of the target insects than strains producing a single ⁇ -endotoxin specific for each of the target insects. This phenomenon can be explained by a titration effect of the sporulation sigma factors by the promoters of the various cryl genes present in the strain.
  • This recombinant strain produces both the toxins CrylA (c) and Cry l C and the amount of ⁇ -endotoxins produced is increased by a factor of 1.5 to 2 compared to the parental strain.
  • the increase in the total production of the two end-endotoxins CrylA (c) and Cry lC obtained in the Kto strain (pHTF3-lC-IRS- ⁇ ) probably results from the fact that the expression of the cryl C gene in this strain does not depend not specific sigma factors of sporulation; it therefore does not interfere with that of the sporulation-dependent crylA (c) gene.
  • the Kto SigK- strain which is a Spo- mutant of Bt, is cultured at 30 ° C. in HCT medium for 48 hours, it produces significant quantities of the l-endotoxin CrylA (c) which accumulates in the form of a crystalline inclusion which remains encapsulated in the cell which does not lyse.
  • the activity of the Kto SigK- strain vis-à-vis O. nubibalis is equivalent to that of the parental Kto strain, whether the Kto SigK- strain has been previously sonicated or not.
  • the Kto SigK- strain was then transformed with the plasmid pHTF3-1C / A (b) -IRS-T (see FIG. 5).
  • This plasmid derived from pBluescript II KS- carries two sequences comprising the internal resolution site (1RS) of the transposon Tn 4430_ (Lereclus et al., 1986). These two 1RS are located in direct orientation on either side of pBluescript II KS- and of a ret gene conferring resistance to tetracycline originating from Bacillus cereus.
  • pHTF3-1C / A (b) -IRS-T contains the coding part of the chimeric gene cryl C / A (b) under the control of the promoter p3 of crylIIA and the origin of replication of the plasmid pHT1030 from B. thuringiensis (Lereclus and Arantes, 1992).
  • the integrase Tnpl of the transposon Tn 4430 present in the strain Kto SigK- catalyzes a recombination reaction between the two 1RS sites and the DNA contained between these two sites is excised.
  • the two circular molecules resulting from the recombination only the one which carries the origin of replication of the plasmid pHT1030 and the chimeric gene cryl C / A (b) can replicate and the plasmid thus obtained, designated pHTF3-1 C / A (b ) -IRS-T- ⁇ , lost the DNA corresponding to pBluescript II KS- and to the ret gene (see FIG. 6).
  • the recombinant Kto SigK- strain (pHTF3-1C / A (b) - IRS-T- ⁇ ) produces both the CrylA (c) and CrylC / A (b) ⁇ -endotoxins in large quantities and therefore has the advantage to have a wider spectrum of activity than the parental Kto or Kto SigK- strain (Table 4).
  • such a strain has two other advantages: 1) The ⁇ -endotoxins Cry l A (c) and Cry l C / A (b) remain encapsulated in the cell. This could result in an increase in the persistence of toxins in the area of the treated crops, due to the physical protection that it could give them against degradation and UV radiation after spreading.
  • the mutant sigK- is a Spcr mutant blocked in stage IV of the sporulation process and therefore does not produce a viable spore; the use of such a mutant makes it possible to avoid the dissemination of spores in the environment during insecticide treatments.
  • Table 1 The mutant sigK- is a Spcr mutant blocked in stage IV of the sporulation process and therefore does not produce a viable spore; the use of such a mutant makes it possible to avoid the dissemination of spores in the environment during insecticide treatments.
  • Oligonucleotide sequences used as PCR primers were used as PCR primers.
  • Bp primer sequence has restriction on the 5 'end
  • a LD50 is the volume of preparation necessary to kill 50% of insect larvae t » ⁇ l of spore-crystal or cell-crystal solution used per ml of solution spilled on the leaves c the cells are partially broken by sonication of 1 min, the majority of crystal inclusions remain inside the cells d the cells are completely broken by sonication for 5 min, 95% of the crystals are released
  • the LC50 or lethal concentration 50, is the concentration of ⁇ -endotoxins which is necessary to kill 50% of the treated population after 5 days; the biological tests were carried out as described by Sanchis et al. 1996.
  • the LC50 is the concentration which is necessary to kill 50% of the treated population in 5 days; the values in brackets represent the 95% confidence intervals; the biological tests were carried out as described by Sanchis et al. (1996 ).
  • spbA locus ensures the segregational stability of pHT1030, a novel type of Gram-positive replicon. Mol. Microbiol., 7: 35-46.
  • Lereclus D. Agaisse H., Gominet M., Chaufaux J. (1995) Overproduction of encapsulated insecticidal crystal proteins in a Bacillus thuringiensis spoOA mutant. Bio / Technology 13: 67-71.
  • Lereclus D. Arantes O., Chaufaux J., Lecadet MM (1989) Transformation and expression of a cloned ⁇ -endotoxin gene in Bacillus th uringiensis. FEMS Microbiol. Lett. 60: 211-218.
  • European patent application 0 192 319 European patent application 0 228 838.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Biotechnology (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Wood Science & Technology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Microbiology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Virology (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biophysics (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The present invention relates particularly to a strain of Bacillus thuringiensis characterized in that it expresses the gene sigma E ( sigma E) and does not sporulate at all or litte sporulates or does not produce any viable spores. The invention also relates to a pesticide composition containing said strain of Bacillus thuringiensis.

Description

NOUVELLES SOUCHES DE BACILLUS THURINGIENSIS ET COMPOSITION PESTICIDE LES CONTENANT NOVEL STRAINS OF BACILLUS THURINGIENSIS AND PESTICIDE COMPOSITION CONTAINING THEM
La présente invention concerne de nouvelles souches de Bacillus thuringiensis, des compositions pesticides les mettant en oeuvre ainsi que l'utilisation de ces souches pour l'expression de protéines d'intérêtThe present invention relates to new strains of Bacillus thuringiensis, to pesticidal compositions using them and to the use of these strains for the expression of proteins of interest.
Bacillus thuringiensis (Bt) est une bactérie gram positive qui produit des protéines ayant des propriétés insecticides, notamment à rencontre des larves d'un grand nombre d'insectes. Ces bactéries, éventuellement après une inactivation, sont utilisées dans des compositions pesticides destinées à lutter contre les insectes nuisibles aux cultures ou vecteurs de maladies, notamment les moustiques.Bacillus thuringiensis (Bt) is a gram-positive bacterium that produces proteins with insecticidal properties, especially against the larvae of a large number of insects. These bacteria, possibly after inactivation, are used in pesticidal compositions intended to combat insects harmful to crops or vectors of diseases, in particular mosquitoes.
Actuellement, Bt sérotype 3a 3b notamment est utilisé contre les ravageurs des cultures, et le sérotype H14 est utilisé pour détruire les larves de moustiques.Currently, Bt serotype 3a 3b in particular is used against crop pests, and serotype H14 is used to destroy mosquito larvae.
Les protéines à activité pesticide produites par Bacillus thuringiensis sont appelées δ-endotoxines et sont produites abondamment durant la sporulation. Elles s'accumulent sous forme d'inclusions cristallines parasporales, et peuvent représenter jusqu'à 25 % du poids sec des cellules sporulées.The pesticidal proteins produced by Bacillus thuringiensis are called δ-endotoxins and are produced abundantly during sporulation. They accumulate in the form of parasporal crystal inclusions, and can represent up to 25% of the dry weight of spore-forming cells.
De nombreux gènes de δ-endotoxines ont été clones, séquences et classifics en cinq groupes et en divers sous-groupes sur la base d'homologies de séquence et du spectre de toxicité. Les gènes correspondants sont dénommés gènes cry. Les formulations à base de Bacillus thuringiensis sont utilisées à titre de biopesiicides depuis près de 30 ans sous différentes appellations commerciales. L'utilisation de Bacillus thuringiensis comme agent de contrôle biologique présente de nombreux avantages par rapport aux pesticides chimiques ; en effet, il a un spectre d'hôte étroit et très spécifique et il est sans effet sur les insectes qui ne constituent pas les cibles et il est sans effet défavorable sur les vertébrés ou sur l'environnement.Many δ-endotoxin genes have been cloned, sequenced and classified into five groups and various subgroups based on sequence homologies and the spectrum of toxicity. The corresponding genes are called cry genes. Formulations based on Bacillus thuringiensis have been used as biopesiicides for almost 30 years under different trade names. The use of Bacillus thuringiensis as a biological control agent has many advantages over chemical pesticides; indeed, it has a narrow and very specific host spectrum and it has no effect on insects which are not the targets and it has no adverse effect on vertebrates or on the environment.
Toutefois, la faible persistance des ô-endotoxines dans l'environnemeni et la présence de spores dans les formulations représentent deux inconvénients pour la commercialisation des produits à base de Bacillus thuringiensis. Afin de résoudre ces deux problèmes, il a été proposé, dans la demande de brevet EP-192 319, d'encapsuler les toxines dans les membranes cellulaires, en particulier en utilisant des cellules de type Pseudomonas fluorescens exprimant la toxine CrylAc, ou bien, dans la demande de brevet PCT W094/25612, en exprimant la toxine CrylIIA dans un mutant non-sporulant affecté dans le gène spoOA. Cette dernière stratégie est possible car le mode d'expression du gène crylIIA est différent du mode d'expression des autres gènes cry, en effet, ce gène crylIIA est exprimé à partir d'un promoteur dont l'activation est indépendante de tous les gènes impliqués dans l'initiation de la sporulation ou des facteurs impliqués dans la sporulation.However, the low persistence of end-endotoxins in the environment and the presence of spores in the formulations represent two disadvantages for the marketing of products based on Bacillus thuringiensis. In order to solve these two problems, it has been proposed, in patent application EP-192 319, to encapsulate the toxins in the cell membranes, in particular by using cells of the Pseudomonas fluorescens type expressing the toxin CrylAc, or else, in the PCT patent application WO94 / 25612, by expressing the toxin CrylIIA in a non-sporulating mutant affected in the spoOA gene. This last strategy is possible because the mode of expression of the crylIIA gene is different from the mode of expression of the other cry genes, in fact, this crylIIA gene is expressed from a promoter whose activation is independent of all the genes involved in the initiation of sporulation or factors involved in sporulation.
Chez Bacillus thuringiensis, la sporulation est dépendante de l'expression de deux facteurs sigma dénommés respectivement sigma (σ)35 et sigma (σ)28 ; compte tenu de leur grande homologie avec les facteurs sigma (σ)E et sigma (σ)K chez Bacillus subtilis , c'est cette dernière terminologie qui sera utilisée ci-après, de même que les gènes correspondants seront dénommés sigE et sigK .In Bacillus thuringiensis, sporulation is dependent on the expression of two sigma factors called respectively sigma (σ) 35 and sigma (σ) 28; taking into account their great homology with the factors sigma (σ) E and sigma (σ) K in Bacillus subtilis, it is this last terminology which will be used below, just as the corresponding genes will be called sigE and sigK.
La présente invention concerne une souche de Bacillus thuringiensis qui exprime σE mais ne sporule pas ou peu ou ne produit pas de spores viables.The present invention relates to a strain of Bacillus thuringiensis which expresses σE but does not sporulate or little or does not produce viable spores.
La présente invention repose sur la mise en évidence du fait qu'un mutant de Bacillus thuringiensis qui exprime sigE et qui n'exprime pas sigK produit une quantité de toxines pratiquement identique à la souche sauvage correspondante, mais, d'autre part, ne sporule pas ou ne produit pas de spores viables.The present invention is based on the demonstration of the fact that a mutant of Bacillus thuringiensis which expresses sigE and which does not express sigK produces a quantity of toxins practically identical to the corresponding wild strain, but, on the other hand, does not sporulate does not or does not produce viable spores.
C'est en particulier le cas lorsque la souche est une souche sigK-.This is in particular the case when the strain is a sigK- strain.
La construction de telles souches présente deux intérêts : 1 ) éviter la dissémination de spores dans l'environnement lors de traitements avec des biopesticides ; 2) augmenter la persistance des toxines dans l'environnement en raison de leur encapsulation.The construction of such strains has two advantages: 1) avoiding the dissemination of spores in the environment during treatments with biopesticides; 2) increase the persistence of toxins in the environment due to their encapsulation.
Des essais ont montré qu'une souche de Bt n'exprimant pas le gène sigma K (sigK-) était capable d'accumuler une quantité de toxines équivalente à la souche d'origine en ne produisant pas de spores. Hle était capable de produire la quasi totalité des toxines codées par les gènes cry ou les gènes apparentés dont l'expression est dépendante de la production de la protéine σE.Tests have shown that a strain of Bt which does not express the sigma K gene (sigK-) is capable of accumulating an amount of toxins equivalent to the original strain by not producing spores. It was able to produce almost all of the toxins encoded by the cry genes or related genes whose expression is dependent on the production of the protein σE.
Afin d'obtenir des mutants sigK- de Bt il est particulièrement avantageu.x d'utiliser une technique d'interruption, par insertion ou délétion ou changement de phase, du gène sigK en introduisant une séquence d'ADN quelconque, cette séquence d'ADN pouvant, d'ailleurs, être choisie de façon à conférer au mutant un caractère de sélection ; il pourra s'agir, par exemple, d'une résistance à un antibiotique, notamment à la kanamycine, ce qui permettra de sélectionner les souches ayant subi l'interruption.In order to obtain Bt sigK- mutants it is particularly advantageous to use a technique of interruption, by insertion or deletion or phase change, of the sigK gene by introducing a any DNA sequence, it being possible for this DNA sequence to be chosen so as to confer a selection character on the mutant; it could be, for example, resistance to an antibiotic, in particular to kanamycin, which will make it possible to select the strains which have undergone the interruption.
Les mutants sigK- peuvent également être obtenus par la délétion de tout ou partie de la séquence nucléotidique correspondant à celle du gène sigK avec ou sans régions régulatrices.The sigK- mutants can also be obtained by deleting all or part of the nucleotide sequence corresponding to that of the sigK gene with or without regulatory regions.
Les techniques d'interruption de gènes sont connues, elles consistent essentiellement à introduire au sein d'une séquence d'ADN portant le gène sigK une séquence d'ADN quelconque, l'ensemble étant introduit dans la souche, il se produit une recombinaison homologue, le gène sigK étant remplacé par le gène sigK interrompu. Le caractère de sélection permet à ce moment de sélectionner les mutants intéressants. Bien entendu, il est particulièrement intéressant de choisir, à titre de souches destinées à être transformées, des souches de Bacillus thuringiensis présentant une production de toxines très variées ou très importante. En effet, comme cela a été indiqué précédemment, le fait d'interrompre le gène sigK ne bloque que la sporulation mais ne bloque pas la production des toxines.Gene interruption techniques are known, they essentially consist in introducing into a DNA sequence carrying the sigK gene any DNA sequence, the whole being introduced into the strain, there is homologous recombination , the sigK gene being replaced by the interrupted sigK gene. The selection character allows at this time to select the mutants of interest. Of course, it is particularly advantageous to choose, as strains intended for transformation, strains of Bacillus thuringiensis having a very varied or very large production of toxins. Indeed, as has been indicated previously, the fact of interrupting the sigK gene only blocks sporulation but does not block the production of toxins.
Par Bt, on entend n'importe quelle souche de Ba cillus th uringiensis.By Bt is meant any strain of Ba cillus th uringiensis.
Ainsi, parmi les souches destinées à subir l'interruption, on pourra utiliser les souches industrielles. Par exemple, Bt subsp. kurstaki HD-1 décrite par Dulmage H. T. (1970), ou Bt israelensis, ou une souche sauvage telle que Bt aizawai 7-29 (cette souche est accessible à IEBC sous le n° T07029).Thus, among the strains intended to undergo the interruption, it will be possible to use industrial strains. For example, Bt subsp. kurstaki HD-1 described by Dulmage H. T. (1970), or Bt israelensis, or a wild strain such as Bt aizawai 7-29 (this strain is accessible at IEBC under the n ° T07029).
La présente invention concerne plus particulièrement la souche Bacillus thuringiensis 407 SigK- (pHT410) ainsi que la souche recombinante Bacillus thuringiensis Kto SigK- (pHTF3-lC/A (b)-IRS-T-Δ) déposées à la Collection Nationale de Cultures de Microorganismes de l'Institut Pasteur, respectivement le 26 octobre 1995 sous le n° 1-1634 et le 22 octobre 1996 sous le n° 1-1776.The present invention relates more particularly to the Bacillus thuringiensis 407 SigK- strain (pHT410) as well as the recombinant Bacillus thuringiensis Kto SigK- strain (pHTF3-1C / A (b) -IRS-T-Δ) deposited in the National Collection of Cultures of Microorganisms of the Institut Pasteur, respectively on October 26, 1995 under the number 1-1634 and on October 22, 1996 under the number 1-1776.
Il est également possible, afin d'augmenter la production de toxines, d'introduire dans les souches sigK- selon l'invention des systèmes plasmidiques autoréplicatifs assurant l'expression desdites toxines selon des constructions qui sont également connues de l'homme du métier. INDICATIONS RELATI VES Λ UN MI CRO-ORGANISME DEPOSEIt is also possible, in order to increase the production of toxins, to introduce into the sigK- strains according to the invention self-replicating plasmid systems ensuring the expression of said toxins according to constructions which are also known to those skilled in the art. INDICATIONS RELATING TO A MID CRO-ORGANIZATION DEPOSITED
(règle 13ύύ du PCT)(PCT rule 13ύύ)
A. AT.
II. IDENTIFICATION DU DEPOT D 'autres font l 'objel d'une feuille supplémentaire I ΛII. IDENTIFICATION OF THE DEPOSIT OF OTHERS are the subject of an additional sheet I Λ
Nom de l 'institution de dépôtName of depository institution
INSTITUT PASTEURPASTOR INSTITUTE
Adresse de l'institution de dépôt (y compris le cale postal et le pays)Address of the depository institution (including the post office and the country)
28 Rue du Docteur Roux28 Rue du Docteur Roux
75015 PARIS75015 PARIS
FRANCEFRANCE
Date du dépôt n° d 'ordreDate tabled No. of order
26 Octobre 1995 1 - 1634October 26, 1995 1 - 1634
Une feuille supplémentaire est jointe t— ιAn additional sheet is attached t— ι
C. INDICATIONS SUPPLEMENTAIRES (le cas éditant ) pour la suite de ces renseignements l_JC. ADDITIONAL INFORMATION (if applicable) for the continuation of this information l_J
D. ETATS DESIGNES POUR LESQUELS LES IND ICAl IONS SONT DONNEESD. DESIGNATED STATES FOR WHICH IND ICAl IONS ARE GIVEN
(si to indications ne sont pas données pour tous les Etats désignés)(if indications are not given for all designated states)
E. INDICATIONS FOURNIES SEPAREMENT (le cas échéant)E. INDICATIONS PROVIDED SEPARATELY (if applicable)
Les indications énumérέes ci-après seront fournies ultérieurement au Bureau internationa l (spécifxer la nature générale des indications p ex., "n' d'ordre du dépôt")The indications listed below will be supplied later to the International Bureau (specify the general nature of the indications, for example, "deposit order")
Réservé à l'office récepteur Réservé au Bureau internationalReserved for the receiving Office Reserved for the International Bureau
0 Cette feuille a élé reçue en même temps que la | [ Cette feuille est parvenue au Bureau international le demande interna liona le0 This sheet was received at the same time as the | [This sheet reached the International Bureau on request interna liona on
Fonctionnaire autorisé Fonctionnaire autoriséAuthorized official Authorized official
J. LE PICAUDJ. LE PICAUD
Formulaire PCT/RO/134 (juillet 1992) INDICATIONS RELATI VES Λ UN M ICRO-ORGANISM E DEPOSEForm PCT / RO / 134 (July 1992) INDICATIONS RELATING TO A M ICRO-ORGANISM DEPOSITED
(règle 13-Ji.v du PCT)(PCT Rule 13-Ji.v)
A. Les indications ont trait au micro-organisme vise dans la description page ligne 33A. The indications relate to the microorganism referred to in the description on page line 33
IJ. IDENTIFICATION DU DEPOT D 'autres dépôts font l 'objet d'une feuille supplémentaire 1IJ. IDENTIFICATION OF THE DEPOSIT Other deposits are the subject of an additional sheet 1
Nom de l 'institution de dépôtName of depository institution
INSTITUT PASTEURPASTOR INSTITUTE
Adresse de l'institution de dépôt (y compris le code postal et le pays)Address of the depositary institution (including postal code and country)
28 Rue du Docteur Roux28 Rue du Docteur Roux
75015 PARIS75015 PARIS
FRANCEFRANCE
Date du dépôt n° d'ordreDate of deposit order number
22 Octobre 1996 1 - 1776October 22, 1996 1 - 1776
Une feuille supplémentaire est jointe r— ιAn additional sheet is attached r— ι
C. INDICATIONS SUPPLEMENTAIRES (le cas éditant ) pour la suite de ces renseignements I IC. ADDITIONAL INFORMATION (if applicable) for the continuation of this information I I
D. ETATS DES IGNES POUR LESQUELS LES INDICA l IONS SONT DONNEESD. STATES OF IGNES FOR WHICH THE INDICA IONS ARE GIVEN
(si les indications ne sont pas données pour tous les Etats désignés)(if indications are not given for all designated states)
E. INDICATIONS FOURNIES SEPAREMENT (le cas échéant)E. INDICATIONS PROVIDED SEPARATELY (if applicable)
Les indications énumérées ci-après seront fournies ultérieurement au Bureau international (spécifier la nature générale des indications p ex , "n' d'ordre du dépôt')The indications listed after will be provided later at the International Bureau (specify the general nature of indications eg, "n" of order of filing ')
Réservé à l'office récepteur Réservé au Bureau internationalReserved for the receiving Office Reserved for the International Bureau
S Cette feuille a été reçue en même temps que la | | Cette feuille est parvenue au Bureau international le demande internauonaleS This sheet was received at the same time as | | This sheet has reached the International Bureau the international request
Fonctionnaire autorisé Fonctionnaire autoriséAuthorized official Authorized official
J . LE P I CAU DJ. THE P I CAU D
Formulaire PCT/RO/134 (juillet 1992) Les protéines exprimées par la souche pourront dépendre du type d'activité pesticide recherché, ainsi, Cryl est toxique pour les lépidoptères, Cryll contre les lépidoptères et les diptères et CrylV contre les diptères. De façon générale, il est possible de rendre sigK- des souches sauvages qui expriment de façon naturelle un certain nombre de toxines telles que crylC, crylA, cryIVA,B,D. On peut également utiliser les souches mutantes telles que décrites selon l'invention qui sont sigK- et qui expriment, après intégration chromosomique ou plasmidique, des gènes codant pour des protéines homologues ou hétérologues vis à vis du génome de Bt.Form PCT / RO / 134 (j uly 1992) The proteins expressed by the strain may depend on the type of pesticidal activity sought, thus, Cryl is toxic for lepidoptera, Cryll against lepidoptera and diptera and CrylV against diptera. In general, it is possible to make sigK- wild strains which naturally express a certain number of toxins such as crylC, crylA, cryIVA, B, D. It is also possible to use the mutant strains as described according to the invention which are sigK- and which express, after chromosomal or plasmid integration, genes coding for proteins homologous or heterologous with respect to the Bt genome.
Une illustration de la technique utilisable est décrite dans Biotechnology, 1992, vol. 10, p. 418 (Lereclus et al.).An illustration of the technique that can be used is described in Biotechnology, 1992, vol. 10, p. 418 (Lereclus et al.).
On peut introduire dans la souche de Bt sigK-, par recombinaison homologue, un gène, par exemple le gène crylC. Le recombinant acquiert le gène crylC et ne retient pas d'ADN étranger.One can introduce into the strain of Bt sigK-, by homologous recombination, a gene, for example the gene crylC. The recombinant acquires the crylC gene and does not retain foreign DNA.
Plusieurs gènes de toxines peuvent être ainsi ajoutés, soit dans le chromosome bactérien par recombinaison homologue, ou intégrés sur des plasmides résidents. A titre d'exemple, une souche de Bt kurstaki exprimant à la fois le gène crylAc sous contrôle de son propre promoteur et le gène crylC sous contrôle du promoteur du gène crylIIA.Several toxin genes can thus be added, either into the bacterial chromosome by homologous recombination, or integrated into resident plasmids. For example, a strain of Bt kurstaki expressing both the crylAc gene under the control of its own promoter and the crylC gene under the control of the promoter of the crylIIA gene.
Parmi les gènes cry utilisables dans ces constructions, il faut citer : cryl, cry II, cry IV et cyt. Un autre mode d'introduction d'un gène à exprimer consiste à utiliser des plasmides de bactéries gram positive comportant une origine de réplication fonctionnelle chez Bt qui est décrit, par exemple, dans la demande de brevet PCT WO93/02199 concernant les plasmides pHT304 et pHT315. Les souches sigK* obtenues selon le procédé selon l'invention sont utilisables, éventuellement après inactivation, dans des compositions pesticides, en particulier dans les compositions insecticides destinées à être utilisées afin de détruire les larves, en particulier les larves d'insectes. Les compositions pesticides seront préparées selon des techniques elles-mêmes connues, c'est-à-dire, si cela est nécessaire, en mélange avec un support inerte ou non assurant une activité optimum des toxines de Bacillus en cause. L'inactivation des souches, qui est indispensable pour l'exploitation des souches sporulantes dans certains pays, est facultative dans le cas des mutants sigK- construits dans le cadre de la présente invention. Cette inactivation peut être réalisée par toute méthode physique ou chimique, notamment par une irradiation qui assure la non-viabilité des souches. Les souches selon l'invention ne comportent pas de spores viables, leur inactivation est plus aisée que dans le cas souches sporulées.Among the cry genes which can be used in these constructions, mention should be made of: cryl, cry II, cry IV and cyt. Another mode of introduction of a gene to be expressed consists in using plasmids of gram positive bacteria comprising an origin of functional replication in Bt which is described, for example, in PCT patent application WO93 / 02199 concerning the plasmids pHT304 and pHT315. The sigK * strains obtained according to the process according to the invention can be used, optionally after inactivation, in pesticidal compositions, in particular in insecticidal compositions intended to be used in order to destroy the larvae, in particular the insect larvae. The pesticidal compositions will be prepared according to techniques themselves known, that is to say, if necessary, in admixture with an inert support or not ensuring optimum activity of the Bacillus toxins in question. The inactivation of the strains, which is essential for the exploitation of the sporulating strains in certain countries, is optional in the case of the sigK- mutants constructed in the context of the present invention. This inactivation can be carried out by any physical or chemical method, in particular by irradiation which ensures the non-viability of the strains. The strains according to the invention do not contain viable spores, their inactivation is easier than in the case of sporulated strains.
Comme cela été indiqué précédemment, les toxines étant maintenues à l'intérieur des bactéries, ceci permet d'augmenter la durée de vie des toxines dans l'environnement (la toxine n'étant libérée que lors de la digestion de la bactérie par la larve). Toutefois, on a pu mettre en évidence le fait que certains mutants selon l'invention présentaient une résistance tout à fait exceptionnelle, dans ce cas il est nécessaire de prévoir, soit l'utilisation de souches spécifiques sélectionnées pour leur bonne digestibilité chez les insectes à traiter, ou bien prévoir des traitements chimiques, agents tensio-actifs par exemple, physiques, traitements par les ultrasons, ou biologiques, introduction d'éléments particuliers dans les parois du microorganisme (par technique de recombinaison génétique ou autres) afin d'assurer une meilleure digestibilité ou une accessibilité plus aisée de la toxine lorsque le microorganisme a été ingéré.As previously indicated, the toxins being kept inside the bacteria, this makes it possible to increase the lifespan of the toxins in the environment (the toxin being released only during digestion of the bacteria by the larva ). However, it has been possible to highlight the fact that certain mutants according to the invention exhibited quite exceptional resistance, in this case it is necessary to provide for either the use of specific strains selected for their good digestibility in insects to treat, or even provide chemical treatments, surface-active agents for example, physical, ultrasonic or biological treatments, introduction of particular elements into the walls of the microorganism (by genetic recombination technique or others) in order to ensure a better digestibility or easier accessibility of the toxin when the microorganism has been ingested.
Cette nouvelle souche de Bt est capable de fournir un des éléments à une composition pesticide, mais également utile comme vecteur pour exprimer des gènes homologues ou hétérologues vis à vis du génome de Bt, lesdits gènes étant clones dans le mutant sigK- de Bt, soit à l'aide d'un plasmide autoréplicatif, soit par recombinaison homologue vis à vis du génome de la bactérie.This new strain of Bt is capable of supplying one of the elements to a pesticidal composition, but also useful as a vector for expressing homologous or heterologous genes with respect to the Bt genome, said genes being cloned in the sigK- mutant of Bt, ie using a self-replicating plasmid, either by homologous recombination with respect to the genome of the bacteria.
La construction du système de vecteur pouvant exprimer, par exemple des protéases, des lipases, ou tout autre type de protéine, peut être similaire à celle décrite dans la demande de brevet PCT W094/25612. L'invention concerne également une séquence nucléotidique contenant le gène SigE, ne contenant pas de gène SigK actif et contenant une séquence codant pour un gène d'intérêt.The construction of the vector system capable of expressing, for example proteases, lipases, or any other type of protein, can be similar to that described in PCT patent application WO94 / 25612. The invention also relates to a nucleotide sequence containing the SigE gene, not containing an active SigK gene and containing a sequence coding for a gene of interest.
D'autres caractéristiques et avantages de la présente invention apparaîtront à la lecture des exemples ci-après et en se référant aux figures sur lesquelles : la figure 1 représente l'interruption des gènes chromosomiques sigE et sigK de Bacillus thuringiensis ; les plasmides pABl et pAB2 sont intégrés dans le chromosome de Bt par recombinaison homologue, le second événement de recombinaison homologue conduit à la perte de toute la séquence de pRN5101 ; les flèches indiquent la direction de transcription des gènes ApR, EmR et Km R qui correspondent aux gènes conférant, respectivement, la résistance à l'ampicilline, l'érythromycine et la kanamycine, les triangles représentent, respectivement, l'origine de réplication de pBR322 (oriEc) et l'origine de réplication de pE194ts (orits) ;Other characteristics and advantages of the present invention will appear on reading the examples below and with reference to the figures in which: FIG. 1 represents the interruption of the chromosomal genes sigE and sigK of Bacillus thuringiensis; the plasmids pAB1 and pAB2 are integrated into the Bt chromosome by homologous recombination, the second homologous recombination event leads to the loss of the entire sequence of pRN5101; the arrows indicate the direction of transcription of the ApR, EmR and Km R genes which correspond to the genes conferring, respectively, resistance to ampicillin, erythromycin and kanamycin, the triangles represent, respectively, the origin of replication of pBR322 (oriEc) and the origin of replication of pE194ts (orits);
- la figure 2 représente la construction des plasmides pour l'analyse de la transcription dans Bacillus thuringiensis ; pHT304-18Z est, comme cela a été préalablement décrit ( Agaisse et Lereclus 1994b) ; les flèches indiquent la direction de transcription de ermC, bla et lacZ et la direction de réplication fonctionnelle dans E. coli (oriEc) ; ori l030 est l'origine de réplication du plasmide de Bt pHT1030 (Lereclus et Arantes 1992) ; les flèches brisées indiquent la direction de iranscription initiée à partir du promoteur psigE, psigK, Bt I et Bt II, comme cela a été indiqué précédemment (Rong et al. 1986 ; Sandman et al. 1988 ; Wong et al. 1983) ; les fragments HindIII-BamHI portant les régions promotrices des gènes spoIID, cotA et cryLAa ont été clones dans pHT304-18Z ;- Figure 2 shows the construction of plasmids for the analysis of transcription in Bacillus thuringiensis; pHT304-18Z is, as previously described (Agaisse and Lereclus 1994b); the arrows indicate the direction of transcription of ermC, bla and lacZ and the direction of functional replication in E. coli (oriEc); ori l030 is the origin of replication of the Bt plasmid pHT1030 (Lereclus and Arantes 1992); the broken arrows indicate the direction of transcription initiated from the psigE promoter, psigK, Bt I and Bt II, as previously indicated (Rong et al. 1986; Sandman et al. 1988; Wong et al. 1983); the HindIII-BamHI fragments carrying the promoter regions of the spoIID, cotA and cryLAa genes were cloned in pHT304-18Z;
- la figure 3 représente l'expression de la β-galactosidase dans Bt sous contrôle des promoteurs des gènes spoIID et cotA ; les cellules sont mises en croissance sur milieu SP à 30°C ; le temps zéro indique la fin de la phase exponentielle, tn est le nombre d'heures avant ou après le temps zéro ; Λ est l'activité β-galactosidase de la souche Bt portant pHTspoIID ; B est l'activité β-galactosidase de la souche Bt portant pHTcotA ; l'activité spécifique de β-galactosidase est déterminée aux temps indiqués dans Spo+ 407 (m), 407 SigE- (•) et 407 SigK- (O) ; - la figure 4 représente l'expression de la β-galactosidase dirigée sous contrôle de crylAa dans les souches de Bt portant pHTcryIA2, mise en croissance sur milieu SP à 30°C et l'activité β-galactosidase étant déterminée aux temps indiqués Spo+ 407 ( a), 407 SigE- ( •) et 407 SigK- (O) ; - la figure 5 représente le plasmide pHTF3- lC/A(b)-IRS-T ; ce plasmide dérive du pBluescript II KS- (l'ADN de pBluescript II KS- étant représenté par la boîte "bla + oriEc"), il porte deux séquences comportant le site de résolution interne (1RS) du transposon Tn 4430 (Lereclus et al., 1986) localisées en orientation directe de part et d'autre du pBluescript II KS- et d'un gène tet conférant la résistance à la tétracycline provenant de Bacillus cereus, il contient, de plus, la partie codante du gène chimère crylC/A (b) sous contrôle du promoteur p3 de crylIIA (Agaisse et- Figure 3 shows the expression of β-galactosidase in Bt under the control of the promoters of the spoIID and cotA genes; the cells are grown on SP medium at 30 ° C; time zero indicates the end of the exponential phase, t n is the number of hours before or after time zero; Λ is the β-galactosidase activity of the Bt strain carrying pHTspoIID; B is the β-galactosidase activity of the Bt strain carrying pHTcotA; the specific activity of β-galactosidase is determined at the times indicated in Spo + 407 (m), 407 SigE- (•) and 407 SigK- (O); - Figure 4 shows the expression of β-galactosidase directed under control of crylAa in Bt strains carrying pHTcryIA2, grown on SP medium at 30 ° C and the β-galactosidase activity being determined at the times indicated Spo + 407 (a), 407 SigE- (•) and 407 SigK- (O); - Figure 5 shows the plasmid pHTF3-1C / A (b) -IRS-T; this plasmid is derived from pBluescript II KS- (the DNA of pBluescript II KS- being represented by the box "bla + oriEc"), it carries two sequences comprising the site of internal resolution (1RS) of the transposon Tn 4430 (Lereclus et al., 1986) located in direct orientation on either side of pBluescript II KS- and of a tet gene conferring resistance to tetracycline originating from Bacillus cereus, it additionally contains the coding part of the chimeric crylC / A gene (b) under the control of the p3 promoter of crylIIA (Agaisse et
Lereclus, 1994) et l'origine de réplication du plasmide pHT1030 de B. thuringiensis (Lereclus et Arantes, 1992) ; - la figure 6 représente la réaction de recombinaison entre les deux sites 1RS, catalysée par l'intégrase Tnpl du transposon Tn 4430 présent dans la souche Kto SigK-, le plasmide issu de la recombinaison site-spécifique est désigné pHTF3-lC/A(b)-IRS-T-Δ. EXEMPLE 1 Matériel et méthodes Souches bactériennes et milieux La souche Bt 407 (sérotype H l ) et son dérivé acristallifèreLereclus, 1994) and the origin of replication of the plasmid pHT1030 from B. thuringiensis (Lereclus and Arantes, 1992); FIG. 6 represents the recombination reaction between the two 1RS sites, catalyzed by the integrase Tnpl of the transposon Tn 4430 present in the strain Kto SigK-, the plasmid resulting from site-specific recombination is designated pHTF3-1C / A ( b) -IRS-T-Δ. EXAMPLE 1 Material and methods Bacterial strains and media The Bt 407 strain (serotype H l) and its acristalliferous derivative
(Cry-) ont été isolés par O. Arantes comme cela a été décrit précédemment (Lereclus et al. 1989). E coli K-12 souche TG1 ( Δ (lac-proAB) supE thi hsd D5 (F'traD36 pro+ proB+ laclq lacZ ΔM 15)) est utilisé pour les expériences de clonage (Gibson 1984). Les souches de Bt sont cultivées à 30°C dans un milieu Luria (LB) et en milieu HCT (Lecadet et al. 1980) ou dans un milieu nutritif de sporulation (milieu SP) (Lereclus et al. 1995). Les souches de E. coli sont cultivées à 37°C dans un milieu LB. La concentration en antibiotique pour la sélection bactérienne est la suivante : ampicilline, 100 μg/ml (pour E. coli) ; erythrom veine, 5 μg/ml (pour Bt) ; kanamycine, 10 μg/ml pour E. coli et 200 μg/ml pour Bt.(Cry-) were isolated by O. Arantes as described above (Lereclus et al. 1989). E coli K-12 strain TG1 (Δ (lac-proAB) supE thi hsd D5 (F'traD36 pro + proB + laclq lacZ ΔM 15)) is used for the cloning experiments (Gibson 1984). The Bt strains are cultivated at 30 ° C. in Luria medium (LB) and in HCT medium (Lecadet et al. 1980) or in a nutritive sporulation medium (SP medium) (Lereclus et al. 1995). E. coli strains are grown at 37 ° C in LB medium. The antibiotic concentration for bacterial selection is as follows: ampicillin, 100 μg / ml (for E. coli); erythrom vein, 5 μg / ml (for Bt); kanamycin, 10 μg / ml for E. coli and 200 μg / ml for Bt.
Plasmides et fragments d'ADNPlasmids and DNA fragments
Le plasmide pRN5101 qui a été fourni par S. Gruss est un plasmide à origine de réplication thermosensible chez les gram positifs, il a été construit par insertion de pE194ts (Villafane et al. 1987) dans le site Clal de pBR322. Le plasmide Bluescript (pBS KS- ) provient de la société Stratagène et les constructions des plasmides pHT304-18Z et pHT410 ont déjà été décrites (Agaisse et Lereclus 1994b ; Lereclus et al. 1989). Les oligonucléotides (CryIA-1 et CryIA-2) utilisés pour l'amplification PCR du fragment de 362 bp contenant la région promoteur du gène crylAa (Wong et al. 1983) sont décrits dans le tableau 1. Le primer CryIA-1 a une extension de 7 bp à l'extrémité 5' contenant le site de restriction HindIII et le primer CryIA-2 contient une extension de 8 bp avec le site de restriction BamHI. Les deux sites de restriction sont introduits pour faciliter le clonage dans pHT304-18Z. Pour interrompre les gènes Bt sigE et sigK, les régions 5' et 3' des gènes correspondants sont amplifiées par PCR en utilisant des oligonucléotides avec les sites de restriction appropriés à l'extrémité 5 ' (tableau 1 ) et sous-clonées séparément dans pBS KS\ Les régions 5' des gènes sigE et sigK sont des fragments de restriction de BamHI-Xbal de 857 et 61 1 bp respectivement. Les régions 3' sont des fragments de restriction EcoRI-BamHI de 807 et 606 bp respectivement. Les fragments d'ADN contenant les régions 5' et 3' de chacun des gènes sont purifiés et ligaturés avec un fragment de 1 ,5 kb Xbal-EcoRI portant le gène aphA3 d'Enterococcus faecalis (cassette KmR) (Trieu-Cuot et Courvalin 1983) dans le site de restriction BamHI du plasmide pRN5101. Les plasmides thermosensibles résultants pABl et pAB2 portent une copie interrompue par un gène de résistance à la kanamycine dans les gènes sigE et sigK respectivement. Les plasmides pDG675 et pDG676 portant respectivement la région promotrice des gènes spoIID et cotA de B. subtilis ont été fournis par le Dr. P. Stragier ( Institut de Biologie Physico-Chimique, Paris, France). pHTspoIID a été construit en sous-clonant le fragment de restriction de 300 bp HindIII-BamHI de pDG675 entre les sites de restriction HindIII et BamHI de pHT304-18Z. pHTcotA a été construit comme suit : les 400 bp du fragment EcoRI-BamHI de pDG676 sont d'abord sous-clonées dans pBS KS-, donnant pKScotA. Le fragment de restriction HindIII-BamHI de pKScotA est alors sous-cloné entre les sites de restriction HindIII et BamHI de pHT304- 18Z, le plasmide résultant étant désigné sous la dénomination pHTcotA. Construction et transformationThe plasmid pRN5101 which was supplied by S. Gruss is a plasmid originating from thermosensitive replication in gram positive cells, it was constructed by insertion of pE194ts (Villafane et al. 1987) in the ClaI site of pBR322. The Bluescript plasmid (pBS KS-) comes from the company Stratagène and the constructions of the plasmids pHT304-18Z and pHT410 have already been described (Agaisse and Lereclus 1994b; Lereclus et al. 1989). The oligonucleotides (CryIA-1 and CryIA-2) used for the PCR amplification of the 362 bp fragment containing the promoter region of the crylAa gene (Wong et al. 1983) are described in Table 1. The primer CryIA-1 has a 7 bp extension at the 5 'end containing the HindIII restriction site and the CryIA-2 primer contains an 8 bp extension with the BamHI restriction site. The two restriction sites are introduced to facilitate cloning in pHT304-18Z. To interrupt the Bt sigE and sigK genes, the 5 'and 3' regions of the corresponding genes are amplified by PCR using oligonucleotides with the appropriate restriction sites at the 5 'end (Table 1) and subcloned separately in pBS KS \ The 5 'regions of the sigE and sigK genes are BamHI-Xbal restriction fragments of 857 and 61 1 bp respectively. The 3 'regions are EcoRI-BamHI restriction fragments of 807 and 606 bp respectively. The DNA fragments containing the 5 'and 3' regions of each of the genes are purified and ligated with a 1.5 kb Xbal-EcoRI fragment carrying the aphA3 gene of Enterococcus faecalis (KmR cassette) (Trieu-Cuot and Courvalin 1983) in the BamHI restriction site of the plasmid pRN5101. The resulting heat-sensitive plasmids pAB1 and pAB2 carry a copy interrupted by a kanamycin resistance gene in the sigE and sigK genes respectively. The plasmids pDG675 and pDG676 carrying respectively the promoter region of the spoIID and cotA genes of B. subtilis were supplied by Dr. P. Stragier (Institute of Physico-Chemical Biology, Paris, France). pHTspoIID was constructed by subcloning the 300 bp HindIII-BamHI restriction fragment of pDG675 between the HindIII and BamHI restriction sites of pHT304-18Z. pHTcotA was constructed as follows: the 400 bp of the EcoRI-BamHI fragment of pDG676 are first subcloned in pBS KS-, giving pKScotA. The HindIII-BamHI restriction fragment of pKScotA is then subcloned between the HindIII and BamHI restriction sites of pHT304-18Z, the resulting plasmid being designated under the name pHTcotA. Construction and transformation
L'ADN plasmidique est extrait de E. coli par le procédé standard de lyse alcaline. L'ADN chromosomique est extrait de Bt comme cela a été décrit précédemment (Msadek et al. 1990). Les enzymes de restriction et la ligase T4 proviennent de New England Biolabs, beverly, MA. Les fragments d'ADN sont purifiés sur gel d'agarose en utilisant le kit Prep-A-Gene (Bio- Rad Laboratories, Richmond, CA.). Les primers d'oligonucléotides sont synthétisés par Genset (Paris, France) et l'amplification PCR est effectuée en utilisant le Système GeneAmp PCR 2400 (Perkin-Bmer, Foster City, CA). La matrice d'ADN utilisée dans l'amplification PCR est soit le gène crylAa déjà clone à partir de la souche Bt 407 (Lereclus et al. 1989) soit l'ADN chromosomique extrait de la souche 407 Cry. Les conditions de réaction sont les suivantes : une incubation de 5 min à 95°C, suivie par 30 cycles d'une min à 57°C pour l'hybridation, une min à 72°C pour l'extension et une min à 92°C pour la dénaturation ; à la fin, une nouvelle incubation à 72°C pendant 10 min est effectuée. La Taq polymerase provient des Laboratoires USB (Cleveland, OH). La procédure standard est utilisée pour la transformation d'E. coli et les souches de Bt sont transformées par électroporation, comme cela a déjà été décrit (Lereclus et al. 1989).Plasmid DNA is extracted from E. coli by the standard alkaline lysis method. Chromosomal DNA is extracted from Bt as previously described (Msadek et al. 1990). The restriction enzymes and T4 ligase are from New England Biolabs, beverly, MA. The DNA fragments are purified on agarose gel using the Prep-A-Gene kit (Bio-Rad Laboratories, Richmond, CA.). The oligonucleotide primers are synthesized by Genset (Paris, France) and the PCR amplification is carried out using the GeneAmp PCR 2400 System (Perkin-Bmer, Foster City, CA). The DNA template used in the PCR amplification is either the crylAa gene already cloned from the Bt 407 strain (Lereclus et al. 1989) or the chromosomal DNA extracted from the 407 Cry strain. The reaction conditions are as follows: an incubation of 5 min at 95 ° C, followed by 30 cycles of one min at 57 ° C for hybridization, one min at 72 ° C for extension and one min at 92 ° C for denaturation; at the end, a new incubation at 72 ° C for 10 min is carried out. Taq polymerase comes from USB Laboratories (Cleveland, OH). The standard procedure is used for the transformation of E. coli and Bt strains are transformed by electroporation, as has already been described (Lereclus et al. 1989).
L'analyse des protéines est effectuée après culture des souches de Bt et sonication, l'analyse étant effectuée sur 0,1% SDS - 12% PAGE Bio-essais d'activité insecticideProtein analysis is carried out after culture of Bt strains and sonication, the analysis being carried out on 0.1% SDS - 12% PAGE Insecticide activity bioassays
La toxicité des préparations est estimée en utilisant la larve de Plutella xylostella au second stade et la technique d'ingestion libre telle qu'elle a été décrite précédemment (Sanchis et al. 1988). EXEMPLE 2 Construction des mutants SigE et SieKz de BtThe toxicity of the preparations is estimated using the larva of Plutella xylostella in the second stage and the free ingestion technique as described above (Sanchis et al. 1988). EXAMPLE 2 Construction of the SigE and SieKz mutants of Bt
Les plasmides thermosensibles pABl et pAB2 contenant la copie du gène interrompu par KmR de sigE et sigK respectivement sont introduits dans la souche Bt 407 Cry- par électroporation. Le remplacement des gènes sigE et sigK par la copie interrompue sigE::Km et sigK::Km est obtenu par cultures successives des transformants en présence de kanamycine à une température non permissive (40°C) (voir figure 1 ). Comme cela ressort de la figure 1 , les souches de Bt transformées par les plasmides pABl ou pAB2 sont tout à la fois résistantes à l'érythromycine et à la kanamycine à 37°C.The heat-sensitive plasmids pAB1 and pAB2 containing the copy of the gene interrupted by KmR of sigE and sigK respectively are introduced into the strain Bt 407 Cry- by electroporation. The replacement of the sigE and sigK genes with the interrupted copy sigE :: Km and sigK :: Km is obtained by successive cultures of the transformants in the presence of kanamycin at a non-permissive temperature (40 ° C.) (see FIG. 1). As can be seen from FIG. 1, the Bt strains transformed by the plasmids pAB1 or pAB2 are both resistant to erythromycin and to kanamycin at 37 ° C.
Les transformants dans lesquels le gène sigE ou sigK a été échangé pour sa copie interrompue sont cultivés à une température non permissive, c'est-à-dire à laquelle la réplication des plasmides a été bloquée. Ils peuvent être sélectionnés pour leur résistance à la kanamycine. Les mutants Spo- (ci-après 407-SigE- et 407-SigK-) sont résistants à la kanamycine mais sensibles à l'érythromycine. Le remplacement des gènes Bt sigE et sigK par leur copie interrompue est contrôlé par analyse PCR, l'ADN chromosomique des mutants sélectionnés est utilisé comme matrice pour la PCR et les séquences externes complémentaires de chaque gène sont utilisées comme primer en association avec des oligonucléotides sigE-4 et sigK-4, respectivement. La taille des produits de PCR correspond à des gènes interrompus par KmR. Les souches de mutants Bt SigE- et SigK- sont incapables de sporuler. Aucune spore thermorésistante n'est produite après 72 heures de croissance à 30°C en milieu HCT ou SP. En utilisant des conditions similaires de croissance, au moins 90 % des cellules de la souche sauvage sporulent après 24 ou 48 heures. L'examen des cellules par microscopie en contraste de phase indique que la souche mutante sigE est bloquée à un stade de sporulation précoce (stade II), après la formation du septum asymétrique divisant la cellule mère et le compartiment des spores. La souche mutante sigK- est bloquée dans un stade de sporulation plus tardif (stade IV). Une préspore grise placée à l'un des pôles de la cellule peut être observé à l'intérieur des cellules.The transformants in which the sigE or sigK gene has been exchanged for its interrupted copy are cultured at a non-permissive temperature, that is to say at which the replication of the plasmids has been blocked. They can be selected for their resistance to kanamycin. The Spo- mutants (hereinafter 407-SigE- and 407-SigK- ) are resistant to kanamycin but sensitive to erythromycin. The replacement of the Bt sigE and sigK genes by their interrupted copy is controlled by PCR analysis, the chromosomal DNA of the selected mutants is used as a template for PCR and the external sequences complementary to each gene are used as a primer in association with sigE oligonucleotides. -4 and sigK-4, respectively. The size of the PCR products corresponds to genes interrupted by KmR. The Bt SigE- and SigK- mutant strains are unable to sporulate. No heat-resistant spore is produced after 72 hours of growth at 30 ° C in HCT or SP medium. Using similar growth conditions, at least 90% of the sporulent wild strain cells after 24 or 48 hours. Examination of the cells by phase contrast microscopy indicates that the sigE mutant strain is blocked at an early sporulation stage (stage II), after the formation of the asymmetric septum dividing the mother cell and the spore compartment. The mutant strain sigK- is blocked in a later stage of sporulation (stage IV). A gray prespore placed at one of the poles of the cell can be seen inside the cells.
Les plasmides pHTspoIID et pHTcotA (voir figure 2) ponant les régions promotrices des gènes spoIID et cotA de Bacillus subtilis fusionnées avec le gène lacZ sont construits pour suivre l'apparition et la disparition des facteurs σE et σK durant la sporulation de Bt. spoIID est transcrit par une ARN polymerase contenant le facteur σE (Lopez-Diaz et al. 1986 ; Rong et al. 1986). Ce gène est impliqué dans le développement morphologique des spores au stade II (Young et Mandelstam 1979). Le gène cotA code pour une protéine d'enveloppe de spore (Donavan et al. 1987) et sa transcription dépend de σK (Sandman et al. 1988). Les plasmides pHTspoIID et pHTcotA sont introduits dans Bt 407 Cry- Spo+, 407-SigE- et 407-SigK- par électroporation et la synthèse de β-galactosidase est suivie durant la croissance en milieu SP (figures 3A et 3B). Dans la souche Spo+ la synthèse de β-galactosidase sous le contrôle du promoteur de spoIID démarre à t2 pour atteindre un maximum d'environ 10 000 U/mg de protéines à t5 el décroît ensuite. Dans la souche dans laquelle la synthèse de β-galactosidase est sous le contrôle du promoteur cotA, celle-ci est détectée seulement à t6 et atteint un maximum de 4 000 U/mg de protéines à tl 1. Il n'y a aucune expression détectable de β- galactosidase (moins de 10 U/mg de protéines) dans le mutant 407-SigE- pour les fusions transcriptionnelles spoIID' ou cotA'-'lacZ. Comme la transcription de sigK dépend de σE (Sandman et al. 1988) il n'y a pas de production du facteur K dans cette souche mutante. Il n'y a pas d'expression détectable de lacZ à partir du promoteur cotA dans le mutant 407-SigK- et l'expression à partir du promoteur spoIID a un maximum à t6 comme dans la souche sauvage. EXEMPLE 3 Expression de crvIAa'-'lacZ dans les mutants SigE- et SigKi de BtThe plasmids pHTspoIID and pHTcotA (see Figure 2) pon the promoter regions of the spoIID and cotA genes of Bacillus subtilis fused with the lacZ gene are constructed to monitor the appearance and disappearance of the factors σE and σK during the sporulation of Bt. SpoIID est transcribed by an RNA polymerase containing the factor σE (Lopez-Diaz et al. 1986; Rong et al. 1986). This gene is involved in the morphological development of stage II spores (Young and Mandelstam 1979). The cotA gene codes for a spore coat protein (Donavan et al. 1987) and its transcription depends on σK (Sandman et al. 1988). The plasmids pHTspoIID and pHTcotA are introduced into Bt 407 Cry-Spo +, 407-SigE- and 407-SigK- by electroporation and the synthesis of β-galactosidase is followed during growth in SP medium (FIGS. 3A and 3B). In the Spo + strain, the synthesis of β-galactosidase under the control of the spoIID promoter starts at t2 to reach a maximum of approximately 10,000 U / mg of proteins at t5 and then decreases. In the strain in which the synthesis of β-galactosidase is under the control of the cotA promoter, this is detected only at t6 and reaches a maximum of 4,000 U / mg of proteins at tl 1. There is no expression detectable β-galactosidase (less than 10 U / mg protein) in the mutant 407-SigE- for spoIID 'or cotA' - 'lacZ transcriptional fusions. As the transcription of sigK depends on σE (Sandman et al. 1988) there is no production of factor K in this mutant strain. There is no detectable expression of lacZ from the cotA promoter in the 407-SigK- mutant and expression from the spoIID promoter has a maximum at t6 as in the wild-type strain. EXAMPLE 3 Expression of crvIAa '-' lacZ in the SigE- and SigKi mutants of Bt
Pour déterminer la régulation temporelle des promoteurs du gène crylAa dans la souche sauvage de Bt et dans les mutants Spo-, un plasmide contenant la fusion transcriptionnelle crylAa'-lacZ a été construit. Une région contenant la région promotrice du gène crylAa est amplifiée par PCR, comme cela a été décrit, puis clonée en amont du gène rapporteur lacZ dans pHT304-18Z. Le plasmide résultant, désigné sous la dénomination pHTcryIA2 (figure 2), est introduit dans les souches Bt 407 Cry Spo +, 407 SigE et 407 SigK- par électroporation. La production de β- galactosidase dans la souche Spo+ 407 Cry- débute à t2 et présente deux pics, le premier à t7 et le second tl 1 (figure 4). Comme cela a été indiqué pour les fusions spoIID'-'lacZ et cotA'-'lacZ, t7 et tl 1 correspondent avec les périodes d'expression maximale de σE et σK. L'expression de la synthèse de β- galactosidase dirigée par la région promotrice de crylAa est sévèrement réduite dans les mutants 407-SigE- (figure 4). Toutefois, une faible activité β- galactosidase est détectée à t2 avec un maximum de 200 U/mg de protéines à tlO. La synthèse β-galactosidase dirigée par la région promotrice de crylAa démarre à t2 et montre un maximum de 9 000 U/mg de protéines à T7 dans le mutant 407-sigK- (figure 4). Le second pic d'expression à un temps de sporulation plus tardif dans la souche Spo+ n'est pas apparent dans le mutant SigK-, ce qui indique une participation du facteur σK dans la transcription du gène crylAa durant la phase tardive de sporulation. EXEMPLE 4 Production de la toxine CrylAa dans les mutants SigE et SigK de BtTo determine the temporal regulation of the promoters of the crylAa gene in the wild strain of Bt and in the Spo- mutants, a plasmid containing the transcriptional fusion crylAa'-lacZ was constructed. A region containing the promoter region of the crylAa gene is amplified by PCR, as described, then cloned upstream of the gene lacZ reporter in pHT304-18Z. The resulting plasmid, designated under the name pHTcryIA2 (FIG. 2), is introduced into the Bt 407 Cry Spo +, 407 SigE and 407 SigK- strains by electroporation. The production of β-galactosidase in the Spo + 407 Cry- strain begins at t2 and presents two peaks, the first at t7 and the second tl 1 (FIG. 4). As indicated for the spoIID '-' lacZ and cotA '-' lacZ, t7 and tl 1 fusions correspond with the periods of maximum expression of σE and σK. The expression of the synthesis of β-galactosidase directed by the promoter region of crylAa is severely reduced in the mutants 407-SigE- (FIG. 4). However, a weak β-galactosidase activity is detected at t2 with a maximum of 200 U / mg of proteins at t10. The β-galactosidase synthesis directed by the promoter region of crylAa starts at t2 and shows a maximum of 9000 U / mg of proteins at T7 in the mutant 407-sigK- (FIG. 4). The second expression peak at a later sporulation time in the Spo + strain is not apparent in the mutant SigK-, which indicates a participation of the factor σK in the transcription of the crylAa gene during the late phase of sporulation. EXAMPLE 4 Production of the CrylAa Toxin in the SigE and SigK Mutants of Bt
Le plasmide pHT410 portant le gène crylAa de la souche sauvage de Bt 407 (Lereclus et al. 1989) est introduit dans les souches Bt 407 Cry- Spo+, 407-SigE et 407-SigK- par électroporation.The plasmid pHT410 carrying the crylAa gene from the wild strain of Bt 407 (Lereclus et al. 1989) is introduced into the strains Bt 407 Cry-Spo +, 407-SigE and 407-SigK- by electroporation.
Les transformants sont cultivés sur milieu HCT et SP à 30°C et la production d'inclusions cristallines est examinée par microscopie en contraste de phase et microscopie électronique. Après 48 heures de croissance dans le milieu HCT, les cristaux larges bipyramidaux sont observés dans les transformants 407-Spo+ et 407-SigK-. Toutefois, les cristaux dans la souche Spo+ sont libérés tandis que ceux des mutants SigK- demeurent encapsulés dans la paroi cellulaire. Même après 72 heures de croissance dans le milieu HCT, il n'y a pas de libération des inclusions cristallines à partir du mutant SigK". Aucun cristal n'est observé dans la souche 407-SigE portant le plasmide pHT410.The transformants are cultured on HCT and SP medium at 30 ° C. and the production of crystal inclusions is examined by phase contrast microscopy and electron microscopy. After 48 hours of growth in HCT medium, the large bipyramidal crystals are observed in the transformants 407-Spo + and 407-SigK-. However, the crystals in the Spo + strain are released while those of the SigK- mutants remain encapsulated in the cell wall. Even after 72 hours of growth in HCT medium, there is no release of the crystal inclusions from the mutant SigK ". No crystal is observed in the 407-SigE strain carrying the plasmid pHT410.
Une analyse SDS-PAGE des protéines contenues dans les préparations cristal-cellule et spore-cristal à partir des cellules mises en croissance sur milieu HCT montre que la souche 407-SigE- portant pHT410 ne produit pas le polypeptide CrylAa de 130 kDa, au contraire de la souche 407- SigK- portant pHT410 qui produit une toxine similaire à celle obtenue à partir de la souche 407 Cry- Spo+ contenant le même plasmide. L'activité insecticide des préparations spore-cristal et cellule- cristal est analysée en utilisant les larves de lépidoptère Plutella xylostella au second stade (tableau 2). Compte tenu de la présence d'autres protéines que CrylAa dans le mutant 407-SigK-, il n'est pas possible de déterminer la concentration précise de toxine dans la préparation cristalline de cette souche. C'est pourquoi la DL50 est définie en terme de volume de culture pour estimer l'activité insecticide de ces produits. Les bio-essais indiquent que la toxine CrylAa produite dans 407-sigK- est très toxique pour les larves de P. xylostella. Toutefois, l'activité insecticide de ces produits est augmentée de façon significative par sonication.SDS-PAGE analysis of the proteins contained in the crystal-cell and spore-crystal preparations from the cells grown on HCT medium shows that the 407-SigE- strain carrying pHT410 does not produce the 130 kDa CrylAa polypeptide, on the contrary of the 407-SigK- strain carrying pHT410 which produces a toxin similar to that obtained from the 407 Cry-Spo + strain containing the same plasmid. The insecticidal activity of the spore-crystal and cell-crystal preparations is analyzed using the larvae of Plutella xylostella lepidoptera in the second stage (Table 2). Given the presence of proteins other than CrylAa in the mutant 407-SigK-, it is not possible to determine the precise concentration of toxin in the crystalline preparation of this strain. This is why the LD50 is defined in terms of culture volume to estimate the insecticidal activity of these products. Bioassays indicate that the CrylAa toxin produced in 407-sigK- is very toxic to P. xylostella larvae. However, the insecticidal activity of these products is significantly increased by sonication.
La souche Bacillus thuringiensis, n'exprimant pas, ou très faiblement, la protéine sigma K, dans les conditions expérimentales ci- dessus, et déposée à la CNCM sous le n° 1- 1634, est construite dans les conditions suivantes : Souche bactérienne dont le gène sigK est interrompu par le gène aphA3 conférant la résistance à la kanamycine. La souche ainsi construite est transformée par le plasmide pHT410 portant le gène crylAa et le gène ermC, conférant la résistance à l'érythromycine. Cette souche non sporulante produit d'importantes quantités de toxine CrylAa pendant la phase stationnaire. EXEMPLE 5The Bacillus thuringiensis strain, not expressing, or very weakly, the sigma K protein, under the above experimental conditions, and deposited at the CNCM under No. 1- 1634, is constructed under the following conditions: Bacterial strain of which the sigK gene is interrupted by the aphA3 gene conferring resistance to kanamycin. The strain thus constructed is transformed by the plasmid pHT410 carrying the crylAa gene and the ermC gene, conferring resistance to erythromycin. This non-sporulating strain produces large amounts of CrylAa toxin during the stationary phase. EXAMPLE 5
Construction d'une souche recombinante de B. thurinsiensis désignée Kto SigKi (pHTF3- l C/A(b)-IRS-T-Δ) exprimant un gène codant pour une δ-endotoxine chimère Crv l C/CrylA(b) sous le contrôle du promoteur du gène crvIIIAConstruction of a recombinant strain of B. thurinsiensis designated Kto SigKi (pHTF3-1 C / A (b) -IRS-T-Δ) expressing a gene coding for a chimeric v-endotoxin Crv l C / CrylA (b) under control of the promoter of the crvIIIA gene
La souche Kto est une souche naturelle sporulante de B. thuringiensis ; cette souche synthétise une δ-endotoxine de type CrylA(c). Cette δ-endotoxine possède une activité insecticide contre les larves de Ostrinia nubilalis (la pyrale du maïs) un ravageur majeur des cultures de maïs aux Etats Unis et en Europe. Cette δ-endotoxine (et donc la souche Kto), est, en revanche, très peu active contre d'autres ravageurs importants appartenant à la famille des Noctuidae tels que Spodoptera littoralis, Spodoptera e.xigua ou Mamestra brassicae (voir tableau 3). Inversement, la δ-endotoxine CrylC ou la δ-endotoxine chimère Cryl C/CrylA(b), désignée ci-après CrylC/A(b), dont la construction (plasmide PHT81 ) est décrite ailleurs par Sanchis et al. ( 1989), sont actives contre S. littoralis mais très peu actives contre O. nubilalis (tableau 3). Afin d'augmenter le spectre d'activité de la souche Kto, il était intéressant d'introduire le gène cryl C ou le gène chimère cryl C/A(b) dans la souche Kto. Il a cependant été montré que l'introduction d'un gène de type cryl (dépendant de la sporulation) dans une souche de B. thuringiensis contenant déjà un ou plusieurs autres gènes de δ-endotoxines, dont l'expression dépend également des facteurs sigma E et sigma K de sporulation, ne se traduit pas par une augmentation de la production totale de δ-endotoxines. Par conséquent, une souche recombinante contenant différents gènes de type cryl possédera un spectre d'activité plus large mais produira moins de chacune des δ-endotoxines ; elle possédera donc une efficacité moindre vis-à-vis de chacun des insectes cibles que des souches produisant une seule δ-endotoxine spécifique de chacun des insectes visés. Ce phénomène peut être expliqué par un effet de titration des facteurs sigma de sporulation par les promoteurs des différents gènes cryl présents dans la souche. Afin de résoudre ce problème, on a récemment montré (Sanchis et al., 1996) qu'il est possible de placer le gène codant pour la protéine Cryl C sous le contrôle du promoteur du gène crylIIA, dont l'expression est indépendante des facteurs sigma de sporulation (Agaisse et Lereclus, 1994). Le gène cryl C, sous contrôle du promoteur crylIIA, a été introduit dans la souche Kto pour donner la souche recombinante Kto(pHTF3- 1 C-IRS-Δ) (Sanchis et al., 1996). Cette souche recombinante produit à la fois les toxines CrylA(c) et Cry l C et la quantité de δ-endotoxines produite est augmentée d'un facteur 1 ,5 à 2 par rapport à la souche parentale. L'augmentation de la production totale des deux δ-endotoxines CrylA(c) et Cry lC obtenue dans la souche Kto(pHTF3-lC-IRS-Δ) résulte probablement du fait que l'expression du gène cryl C dans cette souche ne dépend pas des facteurs sigma spécifiques de la sporulation ; elle n'interfère donc pas avec celle du gène crylA(c) dépendant de la sporulation. Afin de construire la souche Kto SigK-(pHTF3-lC/A(b)-IRS-T-Δ) décrite ici, le gène codant pour la δ-endotoxine chimère CrylC/A(b) dont l'activité vis-à-vis de S. littoralis est légèrement supérieure à celle de CrylC, a été placé sous le contrôle du promoteur du gène crylIIA, comme décrit précédemment pour le gène cryl C (Sanchis et al., 1996). De même, un mutant sigK- (dont le gène sigK est interrompu par le gène aphA3), de la souche Kto a été construit comme décrit dans l'exemple 2 à l'aide du plasmide pAB2 (voir figure 1 ). Lorsque la souche Kto SigK-, qui est un mutant Spo- de Bt, est cultivée à 30°C en milieu HCT pendant 48 heures, elle produit des quantités importantes de la δ-endotoxine CrylA(c) qui s'accumule sous la forme d'une inclusion cristalline qui reste encapsulée dans la cellule qui ne lyse pas. L'activité de la souche Kto SigK- vis-à-vis de O. nubibalis est équivalente à celle de la souche parentale Kto, que la souche Kto SigK- ait été préalablement soniquée ou non.The Kto strain is a natural spore-forming strain of B. thuringiensis; this strain synthesizes a l-endotoxin of the CrylA (c) type. This δ-endotoxin has insecticidal activity against the larvae of Ostrinia nubilalis (the European corn borer), a major pest of corn crops in the United States and Europe. This δ-endotoxin (and therefore the Kto strain), on the other hand, is very little active against other major pests belonging to the Noctuidae family such as Spodoptera littoralis, Spodoptera e.xigua or Mamestra brassicae (see Table 3). Conversely, the l-endotoxin CrylC or the chimeric δ-endotoxin Cryl C / CrylA (b), hereinafter designated CrylC / A (b), the construction of which (plasmid PHT81) is described elsewhere by Sanchis et al. (1989) are active against S. littoralis but very little active against O. nubilalis (Table 3). In order to increase the activity spectrum of the Kto strain, it was advantageous to introduce the cryl C gene or the cryl chimeric C / A gene (b) into the Kto strain. However, it has been shown that the introduction of a cryl-type gene (dependent on sporulation) into a strain of B. thuringiensis already containing one or more other δ-endotoxin genes, the expression of which also depends on sigma factors E and sigma K of sporulation, does not result in an increase in the total production of δ-endotoxins. Consequently, a recombinant strain containing different genes of the cryl type will have a broader spectrum of activity but will produce less of each of the δ-endotoxins; it will therefore have less effectiveness with respect to each of the target insects than strains producing a single δ-endotoxin specific for each of the target insects. This phenomenon can be explained by a titration effect of the sporulation sigma factors by the promoters of the various cryl genes present in the strain. In order to solve this problem, it has recently been shown (Sanchis et al., 1996) that it is possible to place the gene coding for the protein Cryl C under the control of the promoter of the crylIIA gene, whose expression is independent of the factors sporulation sigma (Agaisse and Lereclus, 1994). The cryl C gene, under the control of the crylIIA promoter, was introduced into the Kto strain to give the recombinant Kto strain (pHTF3-1 C-IRS-Δ) (Sanchis et al., 1996). This recombinant strain produces both the toxins CrylA (c) and Cry l C and the amount of δ-endotoxins produced is increased by a factor of 1.5 to 2 compared to the parental strain. The increase in the total production of the two end-endotoxins CrylA (c) and Cry lC obtained in the Kto strain (pHTF3-lC-IRS-Δ) probably results from the fact that the expression of the cryl C gene in this strain does not depend not specific sigma factors of sporulation; it therefore does not interfere with that of the sporulation-dependent crylA (c) gene. In order to construct the strain Kto SigK- (pHTF3-1C / A (b) -IRS-T-Δ) described here, the gene coding for the chimeric δ-endotoxin CrylC / A (b) whose activity vis-à-vis screw of S. littoralis is slightly higher than that of CrylC, was placed under the control of the promoter of the crylIIA gene, as described previously for the cryl C gene (Sanchis et al., 1996). Similarly, a sigK- mutant (whose sigK gene is interrupted by the aphA3 gene), of the Kto strain was constructed as described in Example 2 using the plasmid pAB2 (see FIG. 1). When the Kto SigK- strain, which is a Spo- mutant of Bt, is cultured at 30 ° C. in HCT medium for 48 hours, it produces significant quantities of the l-endotoxin CrylA (c) which accumulates in the form of a crystalline inclusion which remains encapsulated in the cell which does not lyse. The activity of the Kto SigK- strain vis-à-vis O. nubibalis is equivalent to that of the parental Kto strain, whether the Kto SigK- strain has been previously sonicated or not.
La souche Kto SigK- a ensuite été transformée avec le plasmide pHTF3-lC/A(b)-IRS-T (voir figure 5). Ce plasmide dérivé du pBluescript II KS- porte deux séquences comportant le site de résolution interne (1RS) du transposon Tn 4430_ (Lereclus et al., 1986). Ces deux 1RS sont localisées en orientation directe de part et d'autre du pBluescript II KS- et d'un gène ret conférant la résistance à la tétracycline provenant de Bacillus cereus. En outre, le pHTF3- lC/A(b)-IRS-T contient la partie codante du gène chimère cryl C/A(b) sous le contrôle du promoteur p3 de crylIIA et l'origine de réplication du plasmide pHT1030 de B. thuringiensis (Lereclus et Arantes, 1992).The Kto SigK- strain was then transformed with the plasmid pHTF3-1C / A (b) -IRS-T (see FIG. 5). This plasmid derived from pBluescript II KS- carries two sequences comprising the internal resolution site (1RS) of the transposon Tn 4430_ (Lereclus et al., 1986). These two 1RS are located in direct orientation on either side of pBluescript II KS- and of a ret gene conferring resistance to tetracycline originating from Bacillus cereus. In addition, pHTF3-1C / A (b) -IRS-T contains the coding part of the chimeric gene cryl C / A (b) under the control of the promoter p3 of crylIIA and the origin of replication of the plasmid pHT1030 from B. thuringiensis (Lereclus and Arantes, 1992).
Après transformation, l'intégrase Tnpl du transposon Tn 4430 présent dans la souche Kto SigK- catalyse une réaction de recombinaison entre les deux sites 1RS et l'ADN contenu entre ces deux sites est excisé. Des deux molécules circulaires résultant de la recombinaison, seule celle qui porte l'origine de réplication du plasmide pHT1030 et le gène chimère cryl C/A(b) peut se répliquer et le plasmide ainsi obtenu, désigné pHTF3- l C/A(b)-IRS-T-Δ, a perdu l'ADN correspondant au pBluescript II KS- et au gène ret (voir figure 6). La souche recombinante Kto SigK- (pHTF3-lC/A(b)- IRS-T-Δ) produit à la fois les δ-endotoxines CrylA(c) et CrylC/A(b) en quantité importante et présente donc l'avantage de posséder un spectre d'activité plus large que la souche parentale Kto ou Kto SigK- (tableau 4). De plus, une telle souche présente deux autres intérêts : 1°) Les δ-endotoxines Cry l A(c) et Cry l C/A(b) restent encapsulées dans la cellule. Ceci pourrait se traduire par une augmentation de la persistance des toxines dans la zone des cultures traitées, en raison de la protection physique que cela pourrait leur conférer contre la dégradation et le rayonnement UV après épandage.After transformation, the integrase Tnpl of the transposon Tn 4430 present in the strain Kto SigK- catalyzes a recombination reaction between the two 1RS sites and the DNA contained between these two sites is excised. Of the two circular molecules resulting from the recombination, only the one which carries the origin of replication of the plasmid pHT1030 and the chimeric gene cryl C / A (b) can replicate and the plasmid thus obtained, designated pHTF3-1 C / A (b ) -IRS-T-Δ, lost the DNA corresponding to pBluescript II KS- and to the ret gene (see FIG. 6). The recombinant Kto SigK- strain (pHTF3-1C / A (b) - IRS-T-Δ) produces both the CrylA (c) and CrylC / A (b) δ-endotoxins in large quantities and therefore has the advantage to have a wider spectrum of activity than the parental Kto or Kto SigK- strain (Table 4). In addition, such a strain has two other advantages: 1) The δ-endotoxins Cry l A (c) and Cry l C / A (b) remain encapsulated in the cell. This could result in an increase in the persistence of toxins in the area of the treated crops, due to the physical protection that it could give them against degradation and UV radiation after spreading.
2°) Le mutant sigK- est un mutant Spcr bloqué au stade IV du processus de sporulation et ne produit donc pas une spore viable ; l'utilisation d'un tel mutant permet d'éviter la dissémination de spores dans l'environnement lors des traitements insecticides. Tableau 12 °) The mutant sigK- is a Spcr mutant blocked in stage IV of the sporulation process and therefore does not produce a viable spore; the use of such a mutant makes it possible to avoid the dissemination of spores in the environment during insecticide treatments. Table 1
Séquences d'oligonucléotides utilisés comme amorce de PCROligonucleotide sequences used as PCR primers
Position Site deSite Position of
Amorce Séquence en bpa restriction à l'extrémité 5'Bp primer sequence has restriction on the 5 'end
1010
c ry I A- 1 5 'CCCAAC<πTGCAGGTAMTGGTTCTAAC3 ' 156-177* HindIII cryIA-2 5'CC<:GGATCCATCTCTTTTATTAAGATACC3' 495-518* BamHI sigE-1 5'CGGGATCCCGTTGAAAGCGTAGAGGTCAGAA3' 16-38** BamHIc ry I A- 1 5 'CCCAAC <πTGCAGGTAMTGGTTCTAAC3' 156-177 * HindIII cryIA-2 5'CC <: GGATCCATCTCTTTTATTAAGATACC3 '495-518 * BamHI sigE-1 5'CGGGATCCCGTTGAAAGCGTAGAGGTCAGAA3' 16
15 sigE-2 5'GCTCTAGAGC(^CGCGATGCATATGTTGCTA3' 834-855** Xbal sigE-3 5'GGAATTCCATTGTCTGACGTGTTAGGTACA3' 961-982** EcoRI s i g E- 4 5 'CGGGATCCCGATACGCAATATCTCGCAATGA3 ' 1730-1751** BamHI sigK- 1 5 'CGGGATCCCGTCCACTrTATAATTTXÎAGCTCCAA3' 31-53** BamHI sigK-2 5'GCTCTAGAGCCCCGATTGTAC(^ATTGAAAT3' 603-623** Xbal15 sigE-2 5'GCTCTAGAGC (^ CGCGATGCATATGTTGCTA3 '834-855 ** Xbal sigE-3 5'GGAATTCCATTGTCTGACGTGTTAGGTACA3' EcoRI sig E- 4 5 'CGGGATCCCGATACGCAATGTGAAT1A '31-53 ** BamHI sigK-2 5'GCTCTAGAGCCCCGATTGTAC (^ ATTGAAAT3' 603-623 ** Xbal
20 sigK-3 5'GGAATTCCATTAAAGCGATCGAGAGCTATT3' 627-648** EcoRI s i g K- 4 5 'CCrGGATCCCGGCACCrTCTAATATTACAG ATAGAA3 ' 1 194-1217** BamHI sigE-Ch 5'TTTTCTAAAAAGCGTATTGAA3' 1-22** aucun s i g K- C h 5 'GG AG AAACC ATAGTTATGAA3 ' 1-20** aucun20 sigK-3 5'GGAATTCCATTAAAGCGATCGAGAGCTATT3 '627-648 ** EcoRI sig K- 4 5' CCrGGATCCCGGCACCrTCTAATATTACAG ATAGAA3 '1 194-1217 ** BamHI sigE-Ch 5'TTTTCTAAAAAGCGTATTGAA3' 1-2k ** no sig GG AG AAACC ATAGTTATGAA3 '1-20 ** none
?=; a la position des oligonucléotides est déterminée à partir de : * Wong et al. 1983 et ** Adams et al. 1991 ? =; to the position of the oligonucleotides is determined based on: * Wong et al. 1983 and ** Adams et al. 1991
Tableau 2Table 2
Activité insecticide des souches BtInsecticidal activity of Bt strains
Souche DL50a μl/ml de nourriture pulvérisée^LD50a strain μl / ml of sprayed food ^
407 Spo+ (pHT410) 14,7 (7,9 - 21,8)407 Spo + (pHT410) 14.7 (7.9 - 21.8)
407-SigK- (pHT410) 124,6 (68,6 - 1358,7)407-SigK- (pHT410) 124.6 (68.6 - 1358.7)
407-SigK- (pHT410) soniqué 1 mine 35,6 (15,2 - 71,2)407-SigK- (pHT410) sonic 1 mine 35.6 (15.2 - 71.2)
407-SigK- (pHT410) soniqué 5 mind 9,5 (6,2 - 12,6)407-SigK- (pHT410) sonic 5 mind 9.5 (6.2 - 12.6)
a la DL50 est le volume de préparation nécessaire pour tuer 50% des larves d'insectes t» μl de solution de spore-cristal ou cellule-cristal utilisée par ml de solution répandue sur les feuilles c les cellules sont partiellement cassées par sonication de 1 min, la majorité des inclusions cristallines demeure à l'intérieur des cellules d les cellules sont totalement cassées par sonication de 5 min, 95% des cristaux sont libérés a LD50 is the volume of preparation necessary to kill 50% of insect larvae t »μl of spore-crystal or cell-crystal solution used per ml of solution spilled on the leaves c the cells are partially broken by sonication of 1 min, the majority of crystal inclusions remain inside the cells d the cells are completely broken by sonication for 5 min, 95% of the crystals are released
Tableau 3Table 3
Activité comparée des ô-endotoxines CrylA(c). CrylC et Cryl C/A(b) vis-à-vis de S. littoralis et O. nubilalisComparative activity of CrylA ô-endotoxins (c). CrylC and Cryl C / A (b) against S. littoralis and O. nubilalis
CL50U) vis-à-vis de larves de second stade en ng de protéine/cm2 δ-endotoxinesLC50U) against second instar larvae in ng of protein / cm2 δ-endotoxins
S. littoralis O. nubilalisS. littoralis O. nubilalis
CrylA(c) 1 000 2CrylA (c) 1,000 2
CrylC 70 > 250CrylC 70> 250
CrylC/A(b) 20 87CrylC / A (b) 20 87
( D La CL50, ou concentration létale 50, est la concentration de δ-endotoxines qui est nécessaire pour tuer 50% de la population traitée après 5 jours ; les tests biologiques ont été réalisés comme décrit par Sanchis et al. 1996. ( D The LC50, or lethal concentration 50, is the concentration of δ-endotoxins which is necessary to kill 50% of the treated population after 5 days; the biological tests were carried out as described by Sanchis et al. 1996.
Tableau 4Table 4
Activité insecticide des souches de Bacillus thuringiensisInsecticidal activity of Bacillus thuringiensis strains
CL50U) vis-à-vis de larves de second stadeCL50U ) against second instar larvae
Caractéristiques en ng de protine/cm2Characteristics in ng of protein / cm2
Souches de là soucheStrains from there strain
S. littoralis O. nubilalisS. littoralis O. nubilalis
Kto Souche naturelle Spo+ 981 1,7 produisant CrylA(c) (758-1270) (0,9-3)Kto Spo + 981 1.7 natural strain producing CrylA (c) (758-1270) (0.9-3)
Kto(pHTF3-lC-IRS-Δ) Souche Kto Spo+ 25 < 4,2 produisant CrylA(c) ( 13-50) et CrylCKto (pHTF3-lC-IRS-Δ) Kto Spo + 25 strain <4.2 producing CrylA (c) (13-50) and CrylC
Kto SigK-(pHTF3- Souche Ktcr Spo- produi¬ 11 2,6 l C/A(b)-IRS-T-Δ) sant CrylA(c) et CrylC/A(b) (3-36) (0,06-1 10) sous forme encapsuléeKto SigK- (pHTF3- Ktcr strain Spo- produi¬ 11 2.6 l C / A (b) -IRS-T-Δ) sant CrylA (c) and CrylC / A (b) (3-36) (0, 06-1 10) in encapsulated form
( D La CL50 est la concentration qui est nécessaire pour tuer 50% de la population traitée en 5 jours ; les valeurs entre parenthèses représentent les intervalles de confiance à 95% ; les tests biologiques ont été réalisés comme décrit par Sanchis et al. ( 1996). ( D The LC50 is the concentration which is necessary to kill 50% of the treated population in 5 days; the values in brackets represent the 95% confidence intervals; the biological tests were carried out as described by Sanchis et al. (1996 ).
RéférencesReferences
Adams L.F., Brown K.L., Whiteley H.R. ( 1991 ) Molecular Cloning and characterization of two gènes encoding sigma factors that direct transcription from a Bacillus thuringiensis crystal protein gène promoter. J. Bacteriol. 173: 3846-3854.Adams L.F., Brown K.L., Whiteley H.R. (1991) Molecular Cloning and characterization of two genes encoding sigma factors that direct transcription from a Bacillus thuringiensis crystal protein gene promoter. J. Bacteriol. 173: 3846-3854.
Agaisse H. et Lereclus D. ( 1994). Expression in Bacillus subtilis of the Bacillus thuringiensis cry III A toxin gène is not dépendent on a sporulation-specific sigma factor and is increased in a spoOA mutant. J. Bacteriol., 176 : 4734-4741.Agaisse H. and Lereclus D. (1994). Expression in Bacillus subtilis of the Bacillus thuringiensis cry III A toxin gene is not depend on a sporulation-specific sigma factor and is increased in a mutant spoOA. J. Bacteriol., 176: 4734-4741.
Agaisse H., Lereclus D. ( 1994b) Structural and functional analysis of the promoter région involved in full expression of the crylIIA toxin gène of Bacillus thuringiensis . Mol. Microbiol. 13: 97-107.Agaisse H., Lereclus D. (1994b) Structural and functional analysis of the promoter region involved in full expression of the crylIIA toxin gene of Bacillus thuringiensis. Mol. Microbiol. 13: 97-107.
Donavan W.P., Zheng L, Sandman K., Lobsick R. ( 1987) Gènes encoding spore coat polypeptides from Bacillus subtilis. J. Mol. Biol. 196: 1-10.Donavan W.P., Zheng L, Sandman K., Lobsick R. (1987) Genes encoding spore coat polypeptides from Bacillus subtilis. J. Mol. Biol. 196: 1-10.
Dulmage H.T. ( 1970) Insecticidal activity of HD- 1 , a new isolate of Bacillus thuringiensis var. alesti J. Invert. Pathol, 15, 232-239.Dulmage H.T. (1970) Insecticidal activity of HD- 1, a new isolate of Bacillus thuringiensis var. alesti J. Invert. Pathol, 15, 232-239.
Gibson T.J. ( 1984) Studies on the Epstein-Barr virus génome.Gibson T.J. (1984) Studies on the Epstein-Barr virus genome.
Lecadet M. M., Blondel M.O., Ribier J. ( 1980) Generalized transduction in Bacillus th uringiensis var. berliner 1715, using bacteriophage CP54 Ber. J. Gen. Microbiol. 121: 203-212.Lecadet M. M., Blondel M.O., Ribier J. (1980) Generalized transduction in Bacillus th uringiensis var. berliner 1715, using bacteriophage CP54 Ber. J. Gen. Microbiol. 121: 203-212.
Lereclus D., Manillon J., Menou G. et Lecadet M-M. ( 1986). Identification of Tn.4430 a transposon of Bacillus thuringiensis functional in Escherichia coli. Mol. Gen. Genêt., 204 : 52-57.Lereclus D., Manillon J., Menou G. and Lecadet M-M. (1986). Identification of Tn.4430 a transposon of Bacillus thuringiensis functional in Escherichia coli. Mol. Gen. Genet., 204: 52-57.
Lereclus D. et Arantes O. ( 1992). spbA locus ensures the segregational stability of pHT1030, a novel type of Gram-positive réplicon. Mol. Microbiol., 7 : 35-46.Lereclus D. and Arantes O. (1992). spbA locus ensures the segregational stability of pHT1030, a novel type of Gram-positive replicon. Mol. Microbiol., 7: 35-46.
Lereclus D., Agaisse H., Gominet M., Chaufaux J. ( 1995) Overproduction of encapsulated insecticidal crystal proteins in a Bacillus thuringiensis spoOA mutant. Bio/Technology 13: 67-71. Lereclus D., Arantes O., Chaufaux J., Lecadet M.M. ( 1989) Transformation and expression of a cloned δ-endotoxin gène in Bacillus th uringiensis . FEMS Microbiol. Lett. 60: 211-218.Lereclus D., Agaisse H., Gominet M., Chaufaux J. (1995) Overproduction of encapsulated insecticidal crystal proteins in a Bacillus thuringiensis spoOA mutant. Bio / Technology 13: 67-71. Lereclus D., Arantes O., Chaufaux J., Lecadet MM (1989) Transformation and expression of a cloned δ-endotoxin gene in Bacillus th uringiensis. FEMS Microbiol. Lett. 60: 211-218.
Lopez-Diaz L, Clarke S., Mandelstam J. ( 1986) SpoIID operon of Bacillus subtilis: cloning and séquence. J. Gen. Microbiol. 132: 341-354.Lopez-Diaz L, Clarke S., Mandelstam J. (1986) SpoIID operon of Bacillus subtilis: cloning and sequence. J. Gen. Microbiol. 132: 341-354.
Msadek T., Kunst F., Henner D., Klier A., Rapoport G., Dedonder R. ( 1990) Signal transduction pathway controlling synthesis of a class of degradative enzymes in Bacillus subtilis: expression of the regulatory gènes and analysis of mutations in degS and degU. J. Bacteriol. 172: 824-834.Msadek T., Kunst F., Henner D., Klier A., Rapoport G., Dedonder R. (1990) Signal transduction pathway controlling synthesis of a class of degradative enzymes in Bacillus subtilis: expression of the regulatory genes and analysis of mutations in degS and degU. J. Bacteriol. 172: 824-834.
Rong S., Rozenkrantz M.S., Sonenshein A.L ( 1986) Transcriptional control of the Bacillus subtilis spoIID gène. J. Bacteriol. 165: 771-779.Rong S., Rozenkrantz M.S., Sonenshein A.L (1986) Transcriptional control of the Bacillus subtilis spoIID gene. J. Bacteriol. 165: 771-779.
Sanchis V., Lereclus D., Menous G., Chaufaux J., Lecadet M.M. ( 1988) Multiplicity of δ-endotoxin gènes with différent specificities in Bacillus thuringiensis aizawai 7.29. Mol. Microbiol. 2: 393-404.Sanchis V., Lereclus D., Menous G., Chaufaux J., Lecadet M.M. (1988) Multiplicity of δ-endotoxin genes with different specificities in Bacillus thuringiensis aizawai 7.29. Mol. Microbiol. 2: 393-404.
Sanchis V., Lereclus D., Menou G., Chaufaux J., Guo S. et Lecadet M.M. ( 1989). Nucleotide séquence and analysis of the N-terminal coding région of the Spodoptera active δ-endotoxin gène of Bacillus thuringiensis aizawai 7-29. Mol. Microbiol., 3: 229-238.Sanchis V., Lereclus D., Menou G., Chaufaux J., Guo S. and Lecadet M.M. (1989). Nucleotide sequence and analysis of the N-terminal coding region of the active Spodoptera δ-endotoxin gene of Bacillus thuringiensis aizawai 7-29. Mol. Microbiol., 3: 229-238.
Sanchis V., Agaisse H., Chaufaux J. et Lereclus D. ( 1996). Construction of new insecticidal Bacillus thuringiensis recombinant strains by using the sporulation non-dependent expression System of crylIIA and a site spécifie recombinaison vector. J. Biotechnol., 48 : 81-96.Sanchis V., Agaisse H., Chaufaux J. and Lereclus D. (1996). Construction of new insecticidal Bacillus thuringiensis recombinant strains by using the sporulation non-dependent expression System of crylIIA and a site specifies recombination vector. J. Biotechnol., 48: 81-96.
Sandman K.L, Kroos L, Cutting S., Youngman P., Losick R. ( 1988) Identification of a promoter for a spore coat protein in Bacillus subtilis and studies on the régulation of its induction at a late stage of sporulation. J. Mol. Biol. 200: 461-473.Sandman K.L, Kroos L, Cutting S., Youngman P., Losick R. (1988) Identification of a promoter for a spore coat protein in Bacillus subtilis and studies on the regulation of its induction at a late stage of sporulation. J. Mol. Biol. 200: 461-473.
Trieu-Cuot P., Courvalin P. ( 1983) Nucleotide séquence of the Streptococcus faecalis plasmid gène encoding the 3'5 "-aminoglycoside phospho-transferase type III. Gène 23: 331-341. Villafane R., Bechhofer D.H., Narayanan C.S., Dubnau D. ( 1987) Réplication control gènes of plasmid pE194. J. Bacteriol. 169: 4822-4829.Trieu-Cuot P., Courvalin P. (1983) Nucleotide sequence of the Streptococcus faecalis plasmid gene encoding the 3'5 "-aminoglycoside phospho-transferase type III. Gene 23: 331-341. Villafane R., Bechhofer DH, Narayanan CS, Dubnau D. (1987) Replication control genes of plasmid pE194. J. Bacteriol. 169: 4822-4829.
Wong H.C., Schnepf H.E, whiteley H.R. ( 1983) Transcriptional and translational star sites for the Bacillus thuringiensis crystal protein gène. J. Biol. Chem. 258: 1960-1967.Wong H.C., Schnepf H.E, whiteley H.R. (1983) Transcriptional and translational star sites for the Bacillus thuringiensis crystal protein gene. J. Biol. Chem. 258: 1960-1967.
Young M., Mandelstam J. ( 1979) Early events during bacterial endospore formation. Adv. Microb. Physiol. 20: 103-162.Young M., Mandelstam J. (1979) Early events during bacterial endospore formation. Adv. Microb. Physiol. 20: 103-162.
Yoshisue H., Nishimoto T., Sakai H., Komano TI ( 1993) Identification of a promoter for the crystal protein-encoding gène crylVB from Bacillus thuringiensis subsp. israelensis. Gène 137: 247-251.Yoshisue H., Nishimoto T., Sakai H., Komano TI (1993) Identification of a promoter for the crystal protein-encoding crylVB gene from Bacillus thuringiensis subsp. israelensis. Gene 137: 247-251.
Yoshisue H., Fukada T., Yoshida K.L, Sen K., Kwosawa S.I., Sakai H., Komano T. ( 1993) Transcriptional Régulation of Bacillus thuringiensis subsp. israelensis. Mosquito larvicidal crystal protein gène cryrVA. J. Bacterial. 175: 2750-2753.Yoshisue H., Fukada T., Yoshida K.L, Sen K., Kwosawa S.I., Sakai H., Komano T. (1993) Transcriptional Régulation of Bacillus thuringiensis subsp. israelensis. Mosquito larvicidal crystal protein gene cryrVA. J. Bacterial. 175: 2750-2753.
Demande de brevet PCT W094/25612. Demande de brevet PCT WO93/02199.PCT patent application W094 / 25612. PCT patent application WO93 / 02199.
Demande de brevet PCT WO82/03872.PCT patent application WO82 / 03872.
Demande de brevet Européen 0 178 151.European patent application 0 178 151.
Demande de brevet Européen 0 224 331.European patent application 0 224 331.
Demande de brevet Européen 0 192 319. Demande de brevet Européen 0 228 838.European patent application 0 192 319. European patent application 0 228 838.
Demande de brevet Européen 0 295 156.European patent application 0 295 156.
Demande de brevet Européen 0 349 353. European patent application 0 349 353.

Claims

REVENDICATIONS
I ) Bacillus thuringiensis caractérisé en ce qu'il exprime le gène sigma E (σE) et ne sporule pas ou peu ou ne produit pas de spores viables. 2) Bacillus thuringiensis selon la revendication 1 , caractérisé en ce que la souche ne sporule pas.I) Bacillus thuringiensis characterized in that it expresses the sigma E gene (σE) and does not sporulate or little or does not produce viable spores. 2) Bacillus thuringiensis according to claim 1, characterized in that the strain does not spore.
3) Bacillus thuringiensis selon l'une des revendications 1 et 2, caractérisé en ce qu'il s'agit d'une souche n'exprimant pas le gène sigma K.3) Bacillus thuringiensis according to one of claims 1 and 2, characterized in that it is a strain not expressing the sigma K gene.
4) Bacillus thuringiensis selon la revendication 3, caractérisé en ce que le gène SigK a été interrompu par introduction d'une séquence d'ADN ou a été au moins partiellement délété.4) Bacillus thuringiensis according to claim 3, characterized in that the SigK gene has been interrupted by the introduction of a DNA sequence or has been at least partially deleted.
5) Bacillus thuringiensis selon la revendication 4, caractérisé en ce que le gène sigK a été interrompu par introduction d'une séquence d'ADN conférant à la souche un caractère de sélection positif. 6) Bacillus thuringiensis selon la revendication 5, caractérisé en ce que le caractère de sélection positif est la résistance à un antibiotique.5) Bacillus thuringiensis according to claim 4, characterized in that the sigK gene was interrupted by introduction of a DNA sequence conferring on the strain a positive selection character. 6) Bacillus thuringiensis according to claim 5, characterized in that the positive selection character is resistance to an antibiotic.
7) Bacillus thuringiensis selon l'une des revendications 1 à 6, caractérisé en ce que la souche de Bt exprime un ou plusieurs gènes Cry.7) Bacillus thuringiensis according to one of claims 1 to 6, characterized in that the Bt strain expresses one or more Cry genes.
8) Bacillus thuringiensis selon la revendication 7, caractérisé en ce que le ou les gènes Cry sont portés par un vecteur, par exemple un plasmide.8) Bacillus thuringiensis according to claim 7, characterized in that the Cry gene (s) are carried by a vector, for example a plasmid.
9) Bacillus thuringiensis selon la revendication 7, caractérisé en ce que les gènes Cry sont intégrés dans le chromosome.9) Bacillus thuringiensis according to claim 7, characterized in that the Cry genes are integrated into the chromosome.
10) Bacillus thuringiensis selon l'une des revendications 1 à 9, caractérisé en ce qu'il exprime une protéine d'intérêt porté par un plasmide autoréplicatif ou par une séquence d'ADN intégrée dans le chromosome.10) Bacillus thuringiensis according to one of claims 1 to 9, characterized in that it expresses a protein of interest carried by a self-replicating plasmid or by a DNA sequence integrated in the chromosome.
I I ) Bacillus thuringiensis selon la revendication 10, caractérisé en ce qu'il comporte une séquence d'ADN dans le gène SigK exprimant une protéine d'intérêt.I I) Bacillus thuringiensis according to claim 10, characterized in that it comprises a DNA sequence in the SigK gene expressing a protein of interest.
12) Bacillus thuringiensis selon la revendication 10, caractérisé en ce qu'il comporte en remplacement de tout ou partie du gène SigK, une séquence d'ADN exprimant une protéine d'intérêt.12) Bacillus thuringiensis according to claim 10, characterized in that it comprises, in replacement of all or part of the SigK gene, a DNA sequence expressing a protein of interest.
13 ) Bacillus thuringiensis 407 SigK- (pHT410) déposée à la Collection Nationale de Cultures de Microorganismes de l'Institut Pasteur le 26 octobre 1995 sous le numéro 1-1634. 14) Bacillus thuringiensis Kto SigK- (pHTF3- l C/A(b)-IRS-T-Δ déposée à la Collection Nationale de Cultures de Microorganismes de l'Institut Pasteur le 22 octobre 1996 sous le n° 1-1776. 15) Composition pesticide, caractérisée en ce qu'elle contient une souche de Bt selon l'une des revendications 1 à 14.13) Bacillus thuringiensis 407 SigK- (pHT410) deposited in the National Collection of Cultures of Microorganisms of the Pasteur Institute on October 26, 1995 under number 1-1634. 14) Bacillus thuringiensis Kto SigK- (pHTF3- l C / A (b) -IRS-T-Δ deposited at the National Collection of Cultures of Microorganisms of the Pasteur Institute on October 22, 1996 under the number 1-1776. 15) Pesticide composition, characterized in that it contains a Bt strain according to one of claims 1 to 14.
16) Composition selon la revendication 15, caractérisée en ce que la souche de Bt a été inactivée. 17) Composition selon l'une des revendications 15 et 16, caractérisée en ce qu'elle a été inactivée par des moyens physiques.16) Composition according to claim 15, characterized in that the Bt strain has been inactivated. 17) Composition according to one of claims 15 and 16, characterized in that it has been inactivated by physical means.
18) Composition selon l'une des revendications 15 et 16, caractérisée en ce qu'elle a été inactivée par irradiation.18) Composition according to one of claims 15 and 16, characterized in that it has been inactivated by irradiation.
19) Composition selon l'une des revendications 1 5 et 16, caractérisée en ce qu'elle a été inactivée par des moyens chimiques.19) Composition according to one of claims 1 5 and 16, characterized in that it has been inactivated by chemical means.
20) Composition selon l'une des revendications 15 à 19, caractérisée en ce que la souche de Bt a été traitée pour améliorer la digestibilité de la souche ou bien améliorer l'accessibilité de la protéine.20) Composition according to one of claims 15 to 19, characterized in that the strain of Bt has been treated to improve the digestibility of the strain or else improve the accessibility of the protein.
21) Composition selon la revendication 20, caractérisée en ce que la souche de Bt a été traitée par sonication.21) Composition according to claim 20, characterized in that the Bt strain was treated by sonication.
22) Séquence nucléotidique contenant le gène SigE, ne contenant pas de gène SigK actif et contenant une séquence codant pour un gène d'intérêt. 22) Nucleotide sequence containing the SigE gene, not containing an active SigK gene and containing a sequence coding for a gene of interest.
EP96937346A 1995-10-27 1996-10-28 New strains of bacillus thuringiensis and pesticide composition containing them Withdrawn EP0861328A2 (en)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
FR9512741 1995-10-27
FR9512741A FR2740472B1 (en) 1995-10-27 1995-10-27 NOVEL STRAINS OF BACILLUS THURINGIENSIS AND PESTICIDE COMPOSITION CONTAINING THEM
PCT/FR1996/001684 WO1997015677A2 (en) 1995-10-27 1996-10-28 New strains of bacillus thuringiensis and pesticide composition containing them

Publications (1)

Publication Number Publication Date
EP0861328A2 true EP0861328A2 (en) 1998-09-02

Family

ID=9484017

Family Applications (1)

Application Number Title Priority Date Filing Date
EP96937346A Withdrawn EP0861328A2 (en) 1995-10-27 1996-10-28 New strains of bacillus thuringiensis and pesticide composition containing them

Country Status (6)

Country Link
US (2) US6096306A (en)
EP (1) EP0861328A2 (en)
JP (1) JPH11514236A (en)
CA (1) CA2233248A1 (en)
FR (1) FR2740472B1 (en)
WO (1) WO1997015677A2 (en)

Families Citing this family (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
FR2704860B1 (en) * 1993-05-05 1995-07-13 Pasteur Institut NUCLEOTIDE SEQUENCES OF THE LOCUS CRYIIIA FOR THE CONTROL OF THE EXPRESSION OF DNA SEQUENCES IN A CELL HOST.
KR100810527B1 (en) * 2001-01-15 2008-03-10 한국생명공학연구원 Method for Surface Display of Proteins on Genetic Carriers
CN100439492C (en) * 2001-05-29 2008-12-03 花王株式会社 Host microorganisms
AU2002248051A1 (en) * 2002-04-09 2003-12-19 Genofocus Co., Ltd. Stabilized biocatalysts and methods of bioconversion using the same
AU2004288078B2 (en) 2003-11-11 2010-09-02 Higeta Shoyu Co., Ltd. Novel brevibacillus choshinensis and method for producing protein using the microorganism as host
US10602743B2 (en) 2012-08-14 2020-03-31 Marrone Bio Innovations, Inc. Method of inducing drought/salt tolerance using Bacillus megaterium
US9084428B2 (en) * 2012-08-14 2015-07-21 Marrone Bio Innovations, Inc. Bacillus megaterium bioactive compositions and metabolites
US9125419B2 (en) * 2012-08-14 2015-09-08 Marrone Bio Innovations, Inc. Bacillus sp. strain with antifungal, antibacterial and growth promotion activity
EP3345918A1 (en) * 2017-01-05 2018-07-11 Institut National De La Recherche Agronomique Use of the cpcr regulator gene for obtaining new recombinant strains of bacillus thuringiensis with reduced sporulation capacity
CN109628362A (en) * 2018-12-26 2019-04-16 中国农业科学院植物保护研究所 The sigK deletion mutant body of Bti bacterial strain Bt-59 and its application

Family Cites Families (15)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JPH0795953B2 (en) * 1981-04-27 1995-10-18 ワシントン・リサ−チ・ファンデ−ション Bacillus thuringiensis microcrystalline protein in Escherichia coli
GB8425487D0 (en) * 1984-10-09 1984-11-14 Agricultural Genetics Co Strain of bacillus thuringiensis
DE3685968T2 (en) * 1985-01-22 1993-07-01 Mycogen Corp CELLULAR ENCLOSURE OF BIOLOGICAL PESTICIDES.
KR870004140A (en) * 1985-10-28 1987-05-07 모리 히데오 Method for preparing insecticidal protein of Bacillus thuringiensis isizai IPL subspecies by host cell expression of insecticidal protein gene
CA1341092C (en) * 1985-12-12 2000-09-05 David L. Edwards Process for altering the host range of bacillus thuringiensis toxins, and novel toxins produced thereby
FR2616444B1 (en) * 1987-06-10 1990-03-02 Pasteur Institut NUCLEOTIDE SEQUENCES ENCODING POLYPEPTIDES HAVING LARVICIDAL ACTIVITY AGAINST LEPIDOPTERA
EP0349353A1 (en) * 1988-03-22 1990-01-03 Institut Pasteur DNA sequences comprising the bacillus subtilis functional part of locus sacU and sacUh, vectors containing these sequences and their use in processes for the production of proteins
US4990332A (en) * 1988-10-25 1991-02-05 Mycogen Corporation Novel lepidopteran-active Bacillus thuringiensis isolate
US5164180A (en) * 1989-05-18 1992-11-17 Mycogen Corporation Bacillus thuringiensis isolates active against lepidopteran pests
US5126133A (en) * 1989-06-27 1992-06-30 Mycogen Corporation Bacillus thuringiensis isolate active against lepidopteran pests, and genes encoding novel lepidopteran-active toxins
US5275815A (en) * 1990-10-12 1994-01-04 Mycogen Corporation Bacillus thuringiensio NRRL B-18721 active against dipteran pests
JPH04335894A (en) * 1991-05-10 1992-11-24 Toagosei Chem Ind Co Ltd Production of insecticidal protein
FR2679568B1 (en) * 1991-07-22 1994-09-02 Pasteur Institut NEW TYPE OF GRAM-POSITIVE REPLICON - CONSTRUCTION OF RECOMBINANT VECTORS CONTAINING IT.
US5262159A (en) * 1992-08-24 1993-11-16 Mycogen Corporation Use of Bacillus thuringiensis isolates for controlling pests in the family aphididae
FR2704860B1 (en) * 1993-05-05 1995-07-13 Pasteur Institut NUCLEOTIDE SEQUENCES OF THE LOCUS CRYIIIA FOR THE CONTROL OF THE EXPRESSION OF DNA SEQUENCES IN A CELL HOST.

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO9715677A3 *

Also Published As

Publication number Publication date
FR2740472B1 (en) 1998-01-16
JPH11514236A (en) 1999-12-07
WO1997015677A3 (en) 1997-06-05
CA2233248A1 (en) 1997-05-01
US20030091550A1 (en) 2003-05-15
US6096306A (en) 2000-08-01
WO1997015677A2 (en) 1997-05-01
FR2740472A1 (en) 1997-04-30

Similar Documents

Publication Publication Date Title
EP0698105B1 (en) Nucleotide sequences for the control of the expression of dna sequences in a cellular host
Lereclus et al. Overproduction of encapsulated insecticidal crystal proteins in a Bacillus thuringiensis spoOA mutant
AU699752B2 (en) Improved (bacillus thuringiensis) delta-endotoxin
JP3878209B2 (en) Expression of chimeric delta-endotoxin in Pseudomonas florescence
AU645080B2 (en) B. Thuringiensis CRYIIIC gene and coleopteran toxic protein
CA1341388C (en) Hybrid pesticidal toxins
JP3979447B2 (en) Insecticide composition comprising CryIF chimera and CryIA (c) chimera of Bacillus Thuringiensis delta endotoxin
US5378625A (en) Bacillus thuringiensis cryIIIC, (b) protein toxic to coleopteran insects
US5596071A (en) Bacillus thuringiensis toxins active against hymenopteran pests
US5686069A (en) Protein toxins active against lepidopteran pests
US6294184B1 (en) Process for controlling lepidopteron pests
US5286486A (en) Coleopteran-active bacillus thuringiensis isolates and genes encoding coleopteran-active toxins
EP0861328A2 (en) New strains of bacillus thuringiensis and pesticide composition containing them
US5206166A (en) Genes encoding lepidopteran-active toxins and transformed hosts
Kaelin et al. Occurrence of Bacillus thuringiensis on cured tobacco leaves
EP0569438A1 (en) BACILLUS THURINGIENSIS CRYIIIC(b) TOXIN GENE AND PROTEIN TOXIC TO COLEOPTERAN INSECTS
CZ275195A3 (en) Dna segment containing a gene encoding insecticidal protein
EP0585396B1 (en) Novel bacillus thuringiensis isolates active against hymenopteran pests and genes encoding hymenopteran-active toxins
US11375720B2 (en) Construction of a quadruple enterotoxin-deficient mutant of Bacillus thuringiensis
US6051556A (en) Hybrid pesticidal toxins
WO1992020802A2 (en) Novel bacillus thuringiensis isolates active against hymenopteran pests and genes encoding hymenopteran-active toxins
JP2001515355A (en) Insecticidal Bacillus thuringiensis strain
US6051550A (en) Materials and methods for controlling homopteran pests
US5616495A (en) Bacillus thuringiensis gene encoding hymenopteran-active toxins
WO1993003619A1 (en) Multi-targeted bacillus thuringiensis bioinsecticide

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 19980522

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AT BE CH DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE

17Q First examination report despatched

Effective date: 20021119

GRAP Despatch of communication of intention to grant a patent

Free format text: ORIGINAL CODE: EPIDOSNIGR1

RTI1 Title (correction)

Free format text: USE OF STRAINS OF BACILLUS THURINGIENSIS AS PESTICIDE AND PESTICIDE COMPOSITION CONTAINING THEM

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20060502