EXPRESSION OF GENES IN TRANSGENIC PLANTS
The present invention relates to the expression of genes in transgenic plants. In particular it is concerned with the isolation and use of DNA sequences which control the expression of foreign genes in ripening fruits and in response to ethylene.
The ability to isolate and manipulate plant genes has opened the way to gain understanding about the mechanisms involved in the regulation of plant gene expression. This knowledge is important for the exploitation of genetic engineering techniques to applied problems such as the expression of genes in genetically manipulated crop plants exhibiting improved quality and production characteristics. Many examples are now in the literature of plant DNA sequences which have been used to drive the expression of foreign genes in plants. In most instances the regions immediately 5' to the coding regions of genes have been used in gene constructs. These regions are referred to as promoter sequences. They may be derived from plant DNA; or from other sources, eg, viruses. It has been demonstrated that sequences up to 500-1000 bases in most instances are sufficient to allow for the regulated expression of foreign genes. This regulation has involved tissue-specificity, regulation by external factors such as light, heat treatment, chemicals, hormones, and developmental regulation. However, it has also been shown that sequences much longer than 1 kb may have useful features which permit high levels of gene expression in transgenic plants.
These experiments have been carried out using gene fusions between the promoter sequences and foreign genes such as bacterial promoter genes, etc. This has led to the identification of useful promoter sequences. In work leading to the present invention we have identified a gene which expresses an enzyme involved in the ripening of
tomatoes. We have now shown that it is involved in carotenoid synthesis. The gene in question is encoded (almost completely) in the clone pTOM5, disclosed by Ray et al (Nucleic Acids Research, 15, 10587, 1989). Hereinafter this gene is referred to as the phytoene synthase (or PS) gene; the enzyme for which the pTOM5 gene codes is the pTOM5 gene product. We have shown that the pTOM5 gene is involved in the step or steps of the pathway between geranylgeranyl pyrophosphate and phytoene, and that the pTOMS gene product is the enzyme known as phytoene synthase. Among the products produced by this branch of the pathway are carotenes, lutein, xanthophylls, and pigments such as lycopene, as well as plant growth regulators such as IBA. We have now isolated a part of the chromosomes of tomato in which the pTOM5 gene is localised. We now disclose the structure of this gene and its transcriptional control sequences, in particular its promoter.
Evidence for the involvement of the pTOMS gene product in carotenoid synthesis has come from experiments in which the expression of the pTOM5 gene has been inhibited using antisense RNA (see PCT patent application 90/01924). The resulting plants have fruit which are yellow and lack lycopene, indicating that lycopene synthesis has been inhibited. Biochemical precursor feeding experiments have shown that geranylgeranyl pyrophosphate accumulates in extracts of these fruit, indicating that phytoene synthase is inhibited.
Further evidence for the function of the pTOMδ gene in the carotenoid pathway is the significant degree of homology (27% identity; 17% similarity) between the polypeptide predicted from the translation of the open sequence in the clone pTOM5 and the protein encoded by the crtB gene from Rhodobacter capsulatus, a gram-negative purple non-sulphur bacterium. The crtB gene product catalyses the tail-to-tail di erisation of geranylgeranyl
diphosphate to form prephytoene diphosphate. This enzyme (phytoene synthase) is the point of divergence of carotenoid biosynthesis from other isoprenoid metabolism. Further, an enzyme has been isolated from Capsicum annuum fruit chromoplasts which is believed to catalyse both the synthesis of prephytoene diphosphate and its subsequent conversion to phytoene. This enzyme has a molecular weight of 47,500, in close agreement with the predicted size of the pTOM5 gene product (48,000). The final conclusion comes from complementation experiments in which pTOM5 cDNA has been used to complement an Erwinia mutant which is deficient in phytoene synthase.
We have shown that phytoene synthase mRNA is expressed in ripening tomato fruit. No expression could be detected in green fruit. The phytoene synthase gene is expressed most strongly at the full orange stage of ripening. The level of mRNA then declines in line with the general decline in biosynthetic capacity of the ripening fruit. Expression of phytoene synthase mRNA could also be induced by exposing mature green fruit to exogenous ethylene. The expression of the phytoene synthase gene is reduced in the Ripening Inhibitor (rin) and Neverripe (Nr) tomato fruit ripening mutants, which mature very slowly and never achieve the full red colour of ordinary tomato fruit. The genomic locations in the tomato of sequences homologous to the pTOM5 clone have been identified using RFLP mapping: two loci, on chromosome 2 and chromosome 3 respectively, carry sequences homologous to the pTO 5 clone. It has also been shown by Southern blotting that the pTOM5 gene may be present as a small multigene family. The present invention proposes to use the promoters of the phytoene synthase and similar genes to control the expression of novel and exogenous proteins and genes in tomato fruit.
According to the present invention we provide a DNA construct for use in transforming plant cells which
comprises an exogenous coding sequence under the control of upstream promoter and downstream terminator sequences, characterised in that the upstream promoter has homology to a promoter of a gene of the carotenoid biosynthesis pathway. We further provide novel plant cells, and plants, particularly tomatoes, transformed with constructs according to the present invention.
We further provide a process for stimulating the expression of exogenous coding sequences in plants by applying ethylene to plants transformed with constructs according to the invention.
Promoters for use in the invention may be derived from genes such as phytoene desaturase, cyclase and epoxydase. Such promoters may be isolated from genomic libraries by the use of cDNA probes, as has been done in the case of pTOM5. We particularly prefer to use the promoter of the phytoene synthase gene.
The downstream (3') terminator sequences can also be derived from the phytoene synthase gene: or they can be derived from other genes such as the polygalacturonase gene (see UK Patent Application 9025323.9 filed 8 November 1990). Many other possibilities are available from the literature.
By the term 'exogenous coding sequence' we indicate a sequence of DNA, other than that which follows the promoter region in the natural pTOM5 gene, that is adapted to be transcribed into functional RNA under the action of plant cell enzymes such as RNA polymerase. Functional RNA is RNA which affects the biochemistry of the cell: it may for example be mRNA which is translated into protein by ribosomes; or antisense RNA which inhibits the translation of mRNA complementary (or otherwise related) to it into protein. In principle all kinds of exogenous coding sequences are useful in the present invention.
Where the exogenous coding sequence codes for mRNA for a protein, this protein may be of bacterial origin
- _> -
(such as enzymes involved in polysaccharide metabolism and cell wall metabolism), of eukaryotic origin (such as pharmaceutically active polypeptides) or of plant origin (such as the product of the phytoene synthase gene itself, enzymes involved in respiration, ethylene synthesis, sugar metabolism, aroma and flavour production and cell wall metabolism), or genes or parts thereof in sense and antisense orientation. Of particular interest is the ability of the phytoene synthase gene promoter to respond to exogenously supplied ethylene.
A wide variety of exogenous coding sequences is known from the literature, and the present invention is applicable to these as well as many others yet to be reported. As well as functional mRNA, the exogenous gene may code for RNA that interferes with the function of any kind of mRNA produced by the plant cell: for example, antisense RNA complementary to mRNA for fruit ripening genes such as polygalacturonase, pectinesterase, 3-1,4-glucanase, pTOMl3 etc. The construction of these vectors and constructs is described in more detail in the Examples below. For convenience it will be generally found suitable to use promoter sequences (upstream - i.e. 5' - of the coding sequence of the gene) of between 100 and 2000 bases in length.
Plant cells according to the invention may be transformed with constructs of the invention according to a variety of known methods (Agrobacterium Ti plasmids, electroporation, microinjection, microprojectile gun, etc). The transformed cells may then in suitable cases be regenerated into whole plants in which the new nuclear material is stably incorporated into the genome. Both transformed monocot and dicot plants may be obtained in this way, although the latter are usually more easy to regenerate.
Examples of genetically modified plants according to
the present invention include, as well as tomatoes, fruits such as mangoes, peaches, apples, pears, strawberries, bananas and melons; and field crops such as maize (corn), sunflowers, sugarbeet, canola, and smallgrain cereals such as wheat, barley and rice.
Plants produced by the process of the invention may contain more than one recombinant construct. As well as one or more constructs containing the phytoene synthase promoter, they may contain a wide variety of other recombinant constructs, for example constructs having different effects on fruit ripening. In particular where the invention is applied to tomatoes, these may be of enhanced colour (as a result of inserting extra gene copies of the PS gene and thereby overexpressing phytoene synthase) and may also contain constructs inhibiting the production of enzymes such as polygalacturonase and pectinesterase, or interfering with ethylene production (eg from pTOMl3, see PCT Application 90/01072 filed 12 July 1990). Such tomatoes can have higher solids contents than conventional tomatoes and produce more tomato paste per unit of fruit weight. The extra lycopene production in such tomatoes is desirable to prevent any lightening of colour that might otherwise be observed in such pastes. Tomatoes containing more than one type of recombinant construct may be made either by successive transformations, or by successively crossing varieties that each contain one of the constructs, and selecting among the progeny for those that contain all the desired constructs.
A further aspect of the present invention is a process of activating exogenous coding sequences in plants under the control of the phytoene synthase promoter which comprises the application of exogenous ethylene. This may find particular use when fruit is stored in the absence of ethylene, and ethylene is then used to switch on the production of a given useful character providing extra value to the fruit at the point of sale. This may lead tc
increase in sweetness of the fruit, or the production of special flavours or aromas, or the production of special polypeptides desired by the consumer. This will enable more flexibility in control of the fruit ripening process, particularly at the point of sale.
We now describe the isolation of genomic clones from a tomato library encoding the phytoene synthase gene and related sequences. Genomic clones representing two individual genes have been isolated and characterised by DNA sequence analysis. The clone gTOM5 represents part of a gene with exon sequence identical to the clone pTOM5. Clone F contains a sequence similar but not identical to pTOM5. Details of these clones are given below. Sequence and expression data suggest that Clone F encodes an untranscribed pseudogene. The genomic clones described in the Examples cover most of the coding region and the complete transcriptional initiation region of the phytoene synthase gene. The clone gTOM5 has been deposited at the National Collections of Industrial and Marine Bacteria (NCIB), now at 23 St. Machar Drive, Aberdeen AB2 1RY,
Scotland, on 11 March 1991 under the reference NCIB Number 40382 while pTOM5 has been deposited at NCIB as a plasmid in E.coli, under the reference NCIB 40191, on 1 September 1989. The invention will be further described with reference to the following drawings, in which:
Figures 1 and 1A show the nucleotide sequence of the 3.5 kb EcoRI - Sail fragment of gTOM5 (SEQ ID: 1) and the 3' region of the phytoene synthase gene (SEQ ID: 2);
Figure 2 is a diagram of the structure of the phytoene synthase gene;
Figure 3 outlines a scheme for polymerase chain reaction amplification of the phytoene synthase gene promoter fragment;
Figure 4 outlines a scheme for construction of the plant transformation vector p5TAK.
EXAMPLE 1
1.1 Isolation of pTOMδ related genes
A library was constructed from tomato ( ycopersicon esculentum var. Ailsa Craig) genomic DNA which was partially digested with Sau3A and cloned into lambda EMBL3 (Bird et al (1988) Plant Molecular Biology 11, 651-662). The library was screened with the pTOM5 cDNA insert (Ray et al (1987) Nucleic Acids Research 1_5, 10587) and positive phages were purified by four successive cycles of plaque purification. Five positive clones were isolated. Restriction fragment mapping and DNA sequence analysis of these clones indicated that all 5 clones were overlapping and related. The clones did not have 100% sequence homology to pTOM5 in the regions that probably represented exons. This indicated that these clones represented a gene (designated clone F) that was not the pTOMδ gene.
In order to isolate the phytoene synthase gene, synthetic oligonucleotides were designed that hybridised specifically to either pTOM5 or the clone F. The sequences of oligonucleotides CL100 and CL99 represented a region where the pTOMS sequence is only 54% homologous to the sequence of clone F:
CLIOO - 5'-CATCTGTTCCGATGTCATCGTCCG-3' pTOM5 specific CL99 - 5'-TTTTTTTTCTGATGACACAGCCAT-3' clone F specific
CL100 was used to screen the same genomic library. After four rounds of purification, one phage (designated GTOM5 ) was isolated which hybridised to CL100 and pTOM5 but not to CL99.
1.2 Characterisation of the phytoene synthase gene promoter sequence
A 3.5 kb EcoRI - Sail fragment was isolated from GTOM5 and the complete nucleotide sequence of fragment has been determined (Fig 1). This sequence contained exon regions that were 100% homologous to pTOM5 but did not contain the 3' end of the cDNA (Fig 2). The fragment contained 1.1 kb of sequence extending 5' of the end of the cDNA. This sequence represents the pTOM5 gene promoter.
1.3 Isolation and characterisation of the 3' region of the phytoene synthase gene
Synthetic oligonucleotides were designed for use as primers for polymerase chain reaction (PCR) amplification of a specific fragment containing the 3' region of the pTOM5 gene with BamHI restriction sites at each end. The oligonucleotides (designated 5GENE-5 and 5GENE-3) contain sequences from base 3405 to 3442 of SEQ ID:1 and 1604 to 1630 of the pTOMδ cDNA.
After PCR followed by BamHI digestion, two fragments (approximately 800 and 570 bp) were identified by agarose gel electrophoresis. These fragments were isolated, restricted with BamHI and cloned into Ml3mpl8. Clones containing each fragment were identified and the nucleotide sequence was determined (Fig 1).
1.4 Isolation of a phytoene synthase gene promoter fragment
Synthetic oligonucleotides were designed for use as primers for polymerase chain reaction (PCR) amplification of a specific fragment containing the phytoene synthase gene promoter with restriction sites at each end (5'- Hindlll : 3'- BamHI). The oligonucleotides (designated 5PRO-5 and 5PRO-3) contain sequences from base 1 to 30 and 1155 to 1105 of the phytoene synthase gene:
1 30
5PRO-5 TCGAAGTCAGAAGCTTGAATTCATAAACTTTAAATTTTAAATTTTG
Hindlll ' 1155 1105
5PRO-3 CAAACAAAGGATCCCACTTTCTCTTCTGTAGAAAAAGATTATAAAAAGACC BamHI
These primers were used in a PCR with tomato genomic DNA (Lycopersicon esculentum var. Ailsa Craig) to amplify a 1171 bp fragment that contained the phytoene synthase gene promoter sequence and 52 bp of the 5' untranslated region of pTOM5 (Fig 3). This fragment was digested with Hindlll and BamHI and cloned into Ml3mpl8. The nucleotide sequence of one clone (p5PRO) was found to be identical to that of the same region of GTOM5.
1.5 Construction of plant transformation vector - p5TAK
The 1151 bp Hindlll/BamHI phytoene synthase gene promoter fragment from the Ml3mpl8 clone (p5PRO) is excised from replicative form DNA and cloned into Hindlll and BamHI cut pTAKl (described in EP 271988 A). Plasmids with the correct orientation of the PS gene promoter are identified by restriction analysis and DNA sequencing. One such clone is designated p5TAK (Fig 4).
EXAMPLE 2
Generation of transformed plants
The vector p5TAK (from Example 1.5) is transferred to Agrobacterium tumefaciens LBA4404 (a micro-organism widely available to plant biotechnologists) and is used to transform tomato plants. Transformation of tomato stem segments follows standard protocols (eg. Bird et al Plant Molecular Biology 1_1, 651-662, 1988). Transformed plants are identified by their ability to grow on media containing the antibiotic kanamycin. Plants are regenerated and grown to maturity.
The ripening-specific expression of the β-glucuronidase (GUS) gene as determined by the phytoene synthase gene promoter is demonstrated by analysis of mature green, breaker and ripening fruit for GUS enzyme activity. The response of the gene to exogenous ethylene is demonstrated by incubation of breaker stage fruit in an atmosphere containing additional ethylene followed by analysis of GUS enzyme activity.