Classifications

• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
  • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
  • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
  • C12Q1/6844—Nucleic acid amplification reactions
  • C12Q1/6865—Promoter-based amplification, e.g. nucleic acid sequence amplification [NASBA], self-sustained sequence replication [3SR] or transcription-based amplification system [TAS]

Definitions

• the present invention relates generally to methods and kits for amplifying target nucleic acid segments in samples of nucleic acids.
• the invention also concerns applications of the methods and kits in molecular biology, molecular genetics and nucleic acid probe hybridization assays, including such assays employed in diagnoses of diseases.
• nucleic acid probe hybridization assays for diagnosing diseases by detecting blood-borne pathogens or defective genes, involves the detection or isolation of a particular nucleic acid seguence (i.e., a nucleic acid segment with a particular sequence) from a background of a very large number of different, but sometimes similar, sequences of the same or nearly the same length.
• a fundamental problem in such work is to detect or isolate, and if possible quantitate, a particular nucleic acid sequence of interest in such a background.
• the problem has been a difficult one because biological materials, such as cell cultures, tissue specimens and blood samples, which provide the mixtures of nucleic acids, in which a particular segment needs to be detected or from which a particular segment needs to be isolated, typically are comprised of a complex mixture of RNAs and DNAs, of which at most only a minuscule fraction has a segment of interest.
• biological materials such as cell cultures, tissue specimens and blood samples, which provide the mixtures of nucleic acids, in which a particular segment needs to be detected or from which a particular segment needs to be isolated, typically are comprised of a complex mixture of RNAs and DNAs, of which at most only a minuscule fraction has a segment of interest.
• target segment a nucleic acid segment of interest
• the amount of nucleic acid (including the target segment) in a sample of nucleic acid subjected to analysis is not altered; instead, a signal-generating system is associated with the target segment and produces a detectable signal representative of the presence or the number of copies of target segment in the sample.
• a nucleic acid probe with a sequence complementary of that of at least a subsegment of the target segment and linked to an enzyme, such as alkaline phosphatase, is mixed with sample under hybridization conditions, that effect hybridization between the probe and target segment but not appreciably between probe and other nucleic acid segments in the sample.
• a substrate for the enzyme e.g., a chromogenic substrate for alkaline phosphatase
• a substrate for the enzyme e.g., a chromogenic substrate for alkaline phosphatase
• a large number of detectable molecules is rapidly produced in the enzyme-catalyzed reaction (visibly colored in the case of a chromogenic substrate with alkaline phosphatase) for each probe molecule hybridized to target segment.
• Numerous other systems for detecting nucleic acid segments without altering the amount of target nucleic acid in the sample are known to the art.
• target nucleic acid segments have been detected on the basis of hybridization with a probe labelled with a radioactive isotope (e.g., 32 P) or a fluorescent moiety.
• a probe which comprises or is linked to an autocatalytically replicatable RNA molecule (e.g., an RNA that is a substrate for the RNA-dependent RNA polymerase of Q ⁇ phage or brome mosaic virus (BMV, see Miele et al., J. Mol. Biol. 171, 281
• probe for a target segment is linked to a RNA capable of being replicated by Q ⁇ replicase is described by Chu et al., Nucl. Acids Res. 14, 5591 (1986) and United States Patent No. 4,957,858 and by BMV replicase by Marsh et al.. Positive Strand RNV Viruses (Proceedings of 1986 UCLA Symposium), Alan R. Liss Publ. Co., New York, New York (1987) .
• signal generation and amplification occur at essentially the same rates from "background” signal-generating molecules (e.g., probe molecules hybridized to segments with sequences nearly the same but not identical to the sequence of target segment, probe molecules adhering to glass, plastic or other components of a system, etc.) as from signal-generating molecules actually associated with target.
• background signal-generating molecules e.g., probe molecules hybridized to segments with sequences nearly the same but not identical to the sequence of target segment, probe molecules adhering to glass, plastic or other components of a system, etc.
• the second approach is fundamentally different. It involves increasing the copy number of the target segment itself, preferably to an extent greater than that of other segments in a sample, particularly those that might erroneously be detected as target segments because of similarities in sequences.
• Examples of this second approach include various culture techniques in which cells that harbor the target segment are caused to increase in number, sometimes more rapidly than other cells, or in which particular nucleic acids (e.g., plasmids, RNAs), which comprise target segment, are caused to increase in number.
• nucleic acids e.g., plasmids, RNAs
• Another example of this second approach is amplification of a DNA target segment in a so-called
• PCR polymerase chain reaction
• PCR technique is described in Saiki et al.. Science 230, 135 (1985) and Mullis et al., European Patent Application Publication Nos. 0 200 362 and 0 201 184 and US Patent Nos. 4,683,195 and 4,683,202.
• TAS transcription-based amplification system
• TAS employs an RNA-transcript-production step from a DNA synthesized to incorporate a segment with the sequence of target and a promoter positioned, with respect to the target-sequence-containing segment, to enable transcription from the segment of a RNA with the seguence complementary to that of target.
• Multiple cycles can be carried out, as the RNA made in the transcription step can serve as template for making similarly transcribable DNA, which, in turn, can be transcribed to yield additional RNA.
• Amplification proceeds very rapidly with each cycle, as between about 10 and about 1,000 copies of RNA comprising the sequence of target segment or the sequence complementary thereto are produced rapidly from each double-stranded DNA which incorporates a promoter driving transcription of a segment comprising target segment.
• the TAS method is described in commonly owned United States Patent
• the TAS method of target nucleic acid amplification provides a rapid increase in copy number of a selected target segment by making use of two properties of DNA-dependent RNA polymerases: (1) appreciable initiation of transcription from only a small number of sequences specific for each polymerase, see, e.g., Brom et al., Nucl. Acids Res.
• the TAS method utilizes RNA-dependent DNA polymerase activity and DNA-dependent DNA polymerase activity, both of which can be provided by a reverse transcriptase, as well as DNA-dependent RNA polymerase activity and primers.
• the primers define the ends of the target segment to be amplified.
• At least one of the primers, typically that which hybridizes to the 3'-end of the target segment includes a segment which has the sequence of the sense strand of a promoter and is operatively linked for transcription to the segment of the primer with the sequence complementary to that of the 3'-end of the target segment, to initiate transcription in the double-stranded DNA, which comprises the promoter and target segment.
• Exemplary promoters employed in the TAS method are those recognized by the RNA polymerases of T7 phage, T3 phage, and SP6 phage.
• the TAS method can be employed to amplify an RNA target segment.
• the primers are employed to make from the RNA comprising the target segment a double stranded DNA which incorporates a promoter driving transcription of a DNA which comprises a segment with the sequence of target segment, to yield RNA comprising a segment with the sequence complementary to that target segment.
• the TAS method can also be employed to amplify a target segment of a double-stranded nucleic acid.
• the double-stranded nucleic acid of a sample is denatured and the primers are allowed to hybridize to their respective strands, one primer (the "antisense” primer) hybridizing to the 3'-end of target segment and the other (the “sense” primer) to the 3'-end of the complement of target segment.
• the primers are then extended with a suitable polymerase and the resulting duplexes are thermally denatured and cooled to allow the respective primers to hybridize again, to not only the strands of double-stranded sample nucleic acid which comprise target segment but also to the extension products made in the initial primer extension reaction.
• the hybridized primers are again extended in a reaction catalyzed by a suitable polymerase and, with the primers hybridized to extension products of the initial primer extension, two types of double-stranded DNA are formed, at least one of which comprises a promoter operatively linked for transcription to a segment which comprises target segment.
• the double-stranded DNAs, which comprise such promoters are transcribed by a DNA-dependent RNA polymerase which recognizes the promoter, to yield RNA comprising a segment complementary to that of target segment and, thereby, in effect, to amplify target segment itself.
• the above process of hybridization, extension, thermal denaturation, hybridization, extension and transcription may be repeated using both the strands of the newly produced double-stranded DNAs and the resulting RNA transcripts as templates.
• TAS provides an abundance of single-stranded RNA which can be detected without the necessity of cumbersome, repeated PCR thermal cycling or strand separation.
• the present invention entails the surprising discovery of a method of substantially continuous, self-sustained, target nucleic acid amplification which proceeds spontaneously and isothermally.
• This method for self-sustained sequence replication (hereinafter "3SR") provides for amplification of an RNA target segment utilizing RNA-dependent DNA polymerase activity, DNA- dependent DNA polymerase activity, RNAse H activity and DNA-dependent RNA polymerase activity, and primers which are capable of hybridizing to the target segment or complement thereof and priming a primer extension reaction utilizing, as the template, the target segment or complement thereof. At least one of the primers provides a promoter sense sequence.
• the RNAse H activity obviates the need for thermal cycling by enzymatically catalyzing the digestion of an RNA strand of an RNA-DNA duplex rendering single stranded the DNA strand of said duplex which was synthesized in a primer extension reaction utilizing said RNA strand as template.
• the four enzymatic activities may be provided by a combination of reverse transcriptase and DNA dependent RNA polymerase.
• the present invention entails methods of 3SR amplification wherein the inherent RNAse H activity of . reverse transciptase provides the required RNAse H activity and methods wherein the RNAse H activity of reverse transcriptase is supplemented with another source of RNAse H activity, such as E. coli RNAse H, whereby increased levels of amplification of from about 10 s - to 10 6 -fold may be achieved.
• the present invention also entails the surprising discovery that, under certain reaction conditions, reverse transcriptases have sufficient RNAse H activity to provide extremely sensitive 3SR amplification reactions which are capable of amplifying an RNA target segment from about 10 5 -fold to about 10 9 -fold in less than 4 hours without supplementing the reaction medium with a source of RNAse H activity other than the reverse transcriptase.
• 3SR amplification levels greater than about 10 3 - to 10 4 -fold are not attainable unless the RNAse H activity of reverse transcriptase is supplemented with RNAse H activity from, for example, E. coli RNAse H.
• the present invention relates to 2-enzyme 3SR methods of target nucleic acid segment amplification which enable a target nucleic acid segment to be amplified from about 10 5 -fold to about 10-fold within 4 hours, typically in from 1/2 hour to 2 hours.
• the present invention is further concerned with novel improvements in 3SR amplification methods. These improvements entail improved reaction media and other reaction conditions, which enable target segment amplification by 3SR to proceed with only two enzymes, and provide for increased levels of amplification in both 2-enzyme 3SR and 3-enzyme 3SR reactions.
• the present invention also provides methods for 2-enzyme 3SR amplification, whereby relatively large target segments, in excess of about 700 bases, may be amplified to levels otherwise achievable with only smaller target segments.
• kits for amplification by 3SR of target nucleic acid segments and for assays of samples for the presence of target nucleic acids by methods comprising amplification by 3SR said kits comprising improved reaction media for 3-enzyme 3SR amplification or components for 2-enzyme 3SR amplification.
• Figure 1 is a schematic representation of an embodiment of the present invention.
• Figure 1 depicts the process of self-sustained sequence replication (3SR) as a step-by-step process, although it will be understood that in practice all of the various steps occur simultaneously in a highly interactive fashion.
• the enzyme activities necessary for the 3SR amplification reaction are RNA-dependent DNA polymerase activity (RT activity 1) , DNA-dependent DNA polymerase activity (RT activity 2) , RNAse H activity (RT activity 3) , and DNA-dependent RNA polymerase activity.
• the darkened rectangular blocks represent promoter-providing segments of the first primer (designated "A") and the second primer (designated "B”) .
• Figures 2a and 2b depict a detailed schematic representation of the various steps of an embodiment of the present invention which shows the various subsegments which comprise the nucleic acid species stably or transiently present during the 3SR amplification reaction, as described hereinafter.
• Self-sustained sequence replication can be made to proceed to completion because, as was discovered surprisingly, it is possible to maintain a reaction mixture, including enzymes for providing the four necessary enzymatic activities, primers, ribonucleoside triphosphates and 2'-deoxyribonucleoside triphosphates, and RNA, under reaction conditions suitable for both hybridization of primers and, at suitable levels, the four necessary enzymatic activities.
• the 3SR method employs two DNA- primers, which prime chain-extension reactions using the target segment or complement thereof, respectively, as template. At least one of the primers includes the sense strand of a promoter. Amplification by the 3SR method, which is continuous and substantially isothermal, requires four enzymatic activities provided by at least two enzymes - reverse transcriptase (to provide RNA-dependent DNA polymerase activity and DNA-dependent DNA polymerase activity, and RNAse H activity) and a DNA-dependent RNA polymerase.
• the RNAse H activity employed in 3SR is used to render single-stranded a DNA extension product when an RNA segment acts as template for making the extension product, unlike TAS, which requires a denaturation step.
• RNAse H activity of a reverse transcriptase used in the 3SR reactions of the invention may optionally be supplemented with a source of RNAse H activity other than the reverse transcriptase, such as E. coli RNAse H.
• a source of RNAse H activity other than the reverse transcriptase such as E. coli RNAse H.
• E.coli RNAse H has its own optimal reaction conditions which differ from the optimal reaction conditions of the other two enzymes, and because E.
• coli RNAse H is not easily isolated in acceptably pure form, and is considerably more expensive than the other two enzymes required for 3SR amplification, it is highly desirable to eliminate the requirement for an enzyme separate from a reverse transcriptase to provide an amount of RNAse H activity effective for high sensitivity amplification which is necessary to detect nucleic acid target segments present, before amplification, at very low concentrations.
• DNA probe or primer preparation including DNA synthesis
• hybridization methodology including variations in stringency conditions for producing more or less hybridization specificity depending upon the degree of homology of a primer to a target DNA segment
• RNA- and DNA-dependent DNA polymerization reactions and synthesis of cDNAs identification, isolation, sequencing or preparation of promoters, or more specifically, promoters or sites recognized by bacteriophage DNA-dependent RNA polymerases for binding preparatory to catalysis of transcription, or, in the employment of eukaryotic systems, such promoters or sites recognized by viral DNA- and RNA-dependent RNA polymerases, for example, adenovirus-encoded RNA polymerase and bro e mosaic virus RNA polymerase; conditions conducive to the production of RNA transcripts, including so-called transcription enhancer sequences; polymerase chain reaction methods including the reagents used therein; and so
• primer in the present context is meant a single-stranded nucleic acid that has a segment at its 3•-end with sufficient homology to a segment of the target segment or complement thereof such that, under suitable hybridization conditions, it is capable of hybridizing to the target segment (or complement thereof) and priming a primer extension reaction in which a nucleic acid having the sequence of the target segment (or complement thereof) is the template.
• a hybridizing segment of a typical primer is at least about 10 nucleotides in length, more preferably 15-50 nucleotides, and most preferably approximately 15-25 nucleotide bases in length.
• a "primer” is preferably a DNA.
• an "antisense primer” means a primer which has a sequence sufficiently complementary to a sequence at the 3'-end of the target segment to be extended in a chain-extension reaction using target segment as template; a “sense primer” means a primer which has a sequence similarly sufficiently homologous to a sequence at the 5'-end of such target segment.
• the primers define the ends of the target segment to be amplified.
• the sense and antisense primers, respectively have segments, which include at least their 3'-ends, that share identity or very high homology with the 5'-end of the target segment and the complement of the 3'-end of the target segment, respectively. See, for example, EPA 128042 (publd.
• At least one, optionally both, of the primers comprise a segment with a promoter sense sequence.
• promoter sense strand is meant a single stranded nucleic acid which, when hybridized with its complement to be in its double-stranded form (i.e., as a double-stranded promoter) , is specifically recognized by an RNA polymerase, which binds to a polymerase-binding sequence of the promoter and initiates the process of transcription whereby an RNA transcript is produced.
• any sense promoter sequence may be employed for which there is a known and available polymerase that is capable of recognizing the sequence.
• promoters are those that are recognized by certain bacteriophage RNA polymerases, such as those from bacteriophage T3, T7 or SP6. See Siebenlist et al. r Cell 20. 269 (1980). These are but examples of the RNA polymerases which can be employed in the practice of the present invention in conjunction with their associated promoter sequences.
• a "promoter sense strand,” as used herein, preferably comprises one or more nucleotides, more preferably about 4 to about 10 or more nucleotides, adjoining the 5'-most nucleotide of the promoter (sense-strand) consensus sequence (i.e., the sense sequence of the consensus polymerase-binding site) .
• a "promoter sense seguence" must be of sufficient length such that, upon completion of a cDNA incorporating said sequence, the consensus sequence of the promoter is completely double-stranded.
• transcription occurs from the promoter when an RNA polymerase that recognizes the promoter is present under conditions suitable for transcription from the promoter.
• Bacteriophage promoters are preferred because of their high specificity for their cognate RNA polymerases.
• promoters and their corresponding DNA-dependent RNA polymerases which have similarly high specificity could be employed in accordance with the invention in place of the bacteriophage promoter polymerases, and the invention is intended to cover such other promoters and RNA polymerases as well, provided that said promoter shows a high degree of specificity for said polymerase.
• the preferred of the bacteriophage promoter sense sequences are the (+) strands of T7, T3 and SP6 promoters which include the segment to which the corresponding RNA polymerase binds and at least one, and preferably about 4 up to about 10, nucleotides 5' from the 5'-end of this polymerase-binding segment.
• Preferred promoters and their corresponding RNA polymerases are described in the examples and claims, but numerous other promoters and RNA polymerases are known in the art and can be employed as well.
• variable subsegments that are optionally included in the DNA primers serve one or more functions.
• the variable subsegments preferably include transcription initiation sequences that are preferred by the RNA polymerase corresponding to the promoter. While the bacteriophage T7 transcription initiation sequence 5•-GGGA-3' , which is located adjacent to the 3* end of the 17 nucleotide T7 promoter consensus sequence, is believed to be important to in vivo transcription, it does not appear to be crucial for transcription during 3SR amplification.
• Example IX shows the effect on amplification levels caused by mutations (nucleotide changes or deletions) in the transcription initiation seguence immediately downstream from the 17 nt consensus sequence of the T7 promoter.
• the transcription initiation sequence is optional for primers having a promoter-providing segment.
• Such primers having the 3'-most nucleotide of the promoter consensus seguence adjoining a target hybridization segment may provide high levels of amplification comparable to those attained where the transcription initiation sequence 5'-GGGA-3' is present. It is preferred, however, to include a segment of at least one to about four, preferably four, nucleotides adjoining the 3'-most nucleotide of the promoter consensus sequence.
• a variable subsegment can optionally contain a particular non-target segment whereby RNA product from the amplification can be detected in a nucleic acid probe hybridization assay.
• variable subsegment may also contain a polylinker seguence that conveniently contains a plurality of restriction sites for ease of subsequent cloning.
• the variable subsegment may contain the sequence of a self-replicatable RNA, such as Qj3 virus, which, in the presence of its corresponding replicase (e.g., Q ⁇ replicase) , can multiply and autoreplicate an RNA transcript having such variable subsegment.
• cDNAs so produced are capable of producing RNA transcripts in the presence of a DNA-dependent RNA polymerase that recognizes the promoter, when the promoter sense-strand segment of a primer is "operably linked for transcription" to the primer 3'-segment, which hybridizes to target for complement of target.
• the primer extension reaction to produce a DNA-RNA or DNA-DNA duplex is well known.
• Reverse transcriptases particularly from retroviruses, are known to be useful for providing DNA-dependent-DNA polymerase and RNA-dependent-DNA polymerase activity.
• RNAse H activity an amount of RNAse H activity which, in a reaction mixture containing appropriate primers (for 3SR amplification of an RNA target segment) and RNA-dependent DNA polymerase activity, DNA-dependent DNA polymerase activity and DNA-dependent RNA polymerase (and substrates therefor) , and which is incubated in a temperature range at which the latter three enzymatic activities are active, is capable of amplifying said RNA target segment at least about 10 5 -fold in 2-4 hours.
• RNAse H high sensitivity amplification-effective amount of RNAse H as used herein is meant to relate to the level of amplification necessary in a 3SR reaction to detect, using known nucleic acid hybridization assay techniques, a nucleic acid target segment which is present, prior to amplification, in a reaction medium at a level of 1 to 10,000 molecules (e.g., in a reaction volume of about 0.05 to about 1 ml) .
• An amount of RNAse H activity which is effective for 3SR amplification reaction may be less than a "high sensitivity amplification-effective amount" of RNAse H activity, and in such cases may be sufficient to amplify, in a 3SR amplification reaction, a target nucleic acid segment which is present at a concentration such that the level of amplification needed for detection is less than about 10 2 -fold to about 10 4 -fold.
• RNAse H activity known to be possessed by retroviral reverse transcriptases is known under certain conditions, to digest the RNA strand of an RNA-DNA duplex into small oligonucleotides (e.g., oligoribonucleotides of less than about 5-10 bases in length) while leaving the DNA strand intact.
• small oligonucleotides e.g., oligoribonucleotides of less than about 5-10 bases in length
• E.coli RNAse H supplements the inherent RNAse H activity of a reverse transcriptse and allows 3SR amplification levels necessary for detection, by nucleic acid hybridization, of a nucleic acid target segment present at a concentration of about 10 attomole/ml before amplification.
• rNTPs The four ribonucleoside triphosphates, rATP, rUTP, rCTP and rGTP, are referred to collectively herein as "rNTPs" or "rXTPs.”
• the invention entails a method for 3SR amplification of a target RNA segment of a target RNA molecule which segment comprises a 5'-subsegment, which includes a 5'-terminal nucleotide and extends at least 9 nucleotides in the 3'-direction from the 5'-terminal nucleotide of the target segment, and a 3*-subsegment, which does not overlap the 5'-subsegment and which includes a 3'-terminal nucleotide and extends at least 9 nucleotides in the 5'-direction from the 3'-terminal nucleotide of the target segment (see, e.g., Figure 2a, step 1), which method comprises incubating in a reaction medium:
• a first DNA primer which is a single stranded DNA which comprises at its 3'-end a first subsegment having a 3'-terminal nucleotide and extending at least 9 nucleotides in the 5'-direction, said first subsegment of said first primer being of the same length as the 3'-subsegment of the target segment and having a seguence sufficiently complementary to that of the 3'-subsegment of the target segment to prime, in the reaction medium, a primer extension reaction in which a nucleic acid with the sequence of the target segment is the template, and (2) a second DNA primer, which is a single-stranded DNA which comprises at its 3*-end a firs subsegment having a 3*-terminal nucleotide and extending at least 9 nucleotides in the 5'-direction, said first subsegment of said second primer being of the same length as the 5'-subsegment of the target segment and having
• nucleoside triphosphates required as substrates for the DNA-dependent DNA polymerase, RNA-dependent DNA polymerase, and DNA-dependent RNA polymerase activities; wherein said incubation occurs in a range of temperatures at which said enzymes in said reaction medium are active in providing said DNA-dependent DNA polymerase, RNA-dependent DNA polymerase, RNAse H, and DNA-dependent RNA polymerase activities.
• the invention entails a method for highly sensitive, highly productive, 2-enzyme 3SR amplification of a target RNA segment of a target RNA molecule which segment comprises a 5'-subsegment, which includes a 5'-terminal nucleotide and extends at least 9 nucleotides in the 3'-direction from the 5'-terminal nucleotide of the target segment, and a 3'-subsegment, which does not overlap the 5 1 -subsegment and which includes a 3'-terminal nucleotide and extends at least 9 nucleotides in the 5'-direction from the 3'-terminal nucleotide of the target segment (see, e.g., Figure 2a, step 1), which method comprises incubating in a reaction medium:
• a first DNA primer which is a single stranded DNA which comprises at its 3•-end a first subsegment having a 3*-terminal nucleotide and extending at least 9 nucleotides in the 5'-direction
• said first subsegment of said first primer being of the same length as the 3'-subsegment of the target segment and having a sequence sufficiently complementary to that of the 3'-subsegment of the target segment to prime, in the reaction medium, a primer extension reaction in which a nucleic acid with the sequence of the target segment is the template
• a second DNA primer which is a single-stranded DNA which comprises at its 3•-end a first subsegment having a 3'-terminal nucleotide and extending at least 9 nucleotides in the 5'-direction
• said first subsegment of said second primer being of the same length as the 5'-subsegment of the target segment and having a seguence
• 5'-terminal nucleotide of said 5•-subsegment of said target RNA segment is the 5'-terminal nucleotide of the target RNA molecule
• nucleoside triphosphates required as substrates for the DNA-dependent DNA polymerase, RNA-dependent DNA polymerase, and DNA-dependent RNA polymerase activities; wherein said incubation occurs in a range of temperatures at which said enzymes in said reaction medium are active in providing said DNA-dependent DNA polymerase, RNA-dependent DNA polymerase, RNAse H, and DNA-dependent RNA polymerase activities.
• 3SR amplification methods require at least one promoter-providing primer, which is a primer which comprises a segment with the sense sequence of a promoter, which segment is linked operably for transcription to the 3'-segment of the primer, through which the primer hybridizes to the target segment or complement of target segment.
• the first primer and the second primer are also referred to herein as the "antisense primer” and “sense primer,” respectively.
• the antisense primer is the preferred primer to include a promoter sequence, although as will become clear from the description of the present invention, the antisense and the sense primers may each include a promoter sequence, and in certain instances, amplification may proceed where only the sense primer includes such a promoter sequence.
• the latter embodiments, in which only the sense primer comprises a sense strand of a promoter require an RNA target segment wherein the 5 1 terminal nucleotide of the 5•-subsegment is also the 5'-end of the entire target RNA molecule.
• the segment designated hereinafter as (3'-subsegment tcd ) is a DNA (d) sequence which is complementary (c) to the 3•-subsegment (i.e., primer hybridizing segment) of the RNA target (t) segment, which hybridizing segment is designated (3'-subsegment tr ) .
• RNA target segment in the reaction medium. Also described thereafter is the production of an RNA target segment from a double-stranded DNA, which includes a segment with the same seguence as the target RNA segment (substituting ribonucleotides for 2'-deoxyribunucleotides and U for T) , for situations where a target RNA segment may not be present initially in a biological sample or other sample of nucleic acid to which the method of the invention is to be applied.
• 2-enzyme 3SR amplification in accordance with the present invention, is initiated with a target RNA segment of Formula I:
• the subsegment designated (5'-subsegment tr ) is an RNA segment of known sequence having at least 10 nucleotides, including the 5'-most nucleotide of the RNA target segment and extending in the 3' direction therefrom at least 9 nucleotides.
• the (3'-subsegment tr ) is an RNA segment of known sequence of at least 10 nucleotides, including the 3'-most nucleotide of the RNA target segment and extending in the 5' direction therefrom at least 9 nucleotides.
• the (intermediate subsegment tr ) is an RNA segment of 0 or more nucleotides which adjoins the (3'-subsegment tr ) and the (5'-subsegment tr ) . If (intermediate subsegment tP ) has 0 nucleotides, then the 3'-terminus of (5'-subsegment tr ) adjoins the 5'-terminus of (3'-subsegment tr ) .
• the first step in the 3SR amplification process involves hybridization of the first (antisense) primer to the 3•-subsegment of the RNA target (3*-subsegment tr ) and extension thereof by the RNA-dependent DNA polymerase activity of a reverse transcriptase using the target RNA as a template to form a DNA-RNA duplex.
• the so-formed DNA-RNA duplex extends at least to the 5'-terminal nucleotide of the (5'-subsegment tp ) . See Figure 2a, step 3.
• the first primer is a single-stranded DNA which comprises the nucleic acid segment of Formula II:
• the segment designated (promoter 1d ) is a single-stranded DNA segment with the sequence of the sense strand of a first promoter, preferably one recognized by a bacteriophage DNA-dependent RNA polymerase;
• (3'-subsegment tcd ) is a single-stranded DNA segment having the same number of nucleotides as, and a sequence which is sufficiently complementary to, (3'-subsegment tr ) to hybridize to and prime an extension reaction using the target RNA as template;
• (variable subsegment 1d ) is a single-stranded DNA segment of 0 to 50 nucleotides adjoining the 3'-terminal nucleotide of (promoter 1d ) .
• variable subsegment 1d has 0 nucleotides, the 3'-end of the promoter sense strand, (promoter 1d ) , adjoins the 5'-terminus of said (3'-subsegment tcd ) .
• (Variable subsegment 1d ) may comprise, for example, a native transcription-initiation segment recognized by the RNA polymerase which recognizes the promoter; in the case of bacteriophage T7 polymerase, this native transcription- initiation segment would have the sequence 5'-GGGA-3'.
• a presently preferred transcription initiation segment comprises the seguence 5'-GAAA-3' .
• the improved reaction media of the present invention enable the 2-enzyme 3SR amplification methods of the present invention because such reaction media enable the expression of inherent RNAse H activity of reverse transcriptase.
• This RNAse H activity of reverse transcriptase degrades the RNA strand of a DNA-RNA duplex yielding a first complementary DNA strand comprising the DNA segment of Formula III.
• DNA-RNA duplex may include a DNA-RNA duplex segment which extends (relative to the RNA strand) in the 5'-direction beyond the 5'-subsegment of the target and/or single stranded RNA sequence which extends in the 3'-direction from the 3'-subsegment.
• a second DNA primer (“sense primer”) hybridizes to the single-stranded first complementary DNA and primes a primer extension reaction on this first complementary DNA.
• the second DNA primer is a single-stranded DNA comprising a sequence of at least 10 nucleotides and corresponds to Formula IV (promoter-less primer) or Formula IV(a) , a promoter-containing primer:
• the segment designated (5'-subsegment td ) is a DNA with a sequence which is sufficiently homologous to the sequence of (5'-subsegment ⁇ ) to hybridize to a first complementary DNA (at (5'-subsegment tcd ) ) and prime a primer extension reaction using a first complementary DNA of Formula III as template.
• the segment designated (variable subsegment 2d ) is a segment of 0 to 100 nucleotides which adjoins the 5'-terminus of (5'-subsegment td ) .
• the second promoter sense sequence is designated (promoter 2d ) .
• (variable subsegment ⁇ ) may consist of a
• the second promoter sense sequence if present, may be the same or different from the first promoter sequence.
• the reaction medium may optionally include a second DNA-dependent RNA polymerase which recognizes the second promoter.
• segment designated is an optional segment of a promoter-less sense primer of Formula IV (although it will be understood that inclusion of such subsegment may be desirable for example to provide a non-target sequence for hybridization assay purposes)
• this optional segment will be omitted from the description which follows which pertains to embodiments of the present invention employing a promoter-less sense primer.
• the DNA-dependent DNA polymerase activity of reverse transcriptase extends the second primer using the first complementary DNA as a template to form a first double stranded cDNA (hereinafter cDNA I) which comprises a promoter operatively linked for transcription to a cDNA segment that is the complement of the RNA target segment (i.e., has the sequence exactly complementary to that of the target segment). See Figure 2a, step 6.
• the cDNA comprises the first complementary DNA strand, as defined above in Formula III, and second complementary DNA strand comprising the DNA of Formula V or V(a) :
• (3'-subsegment td ) , (variable subsegment 1cd ) and ( romoter 1cd ) are segments which are complementary to (intermediate subsegment tcd ) , (3'-subsegment tcd ) , (variable subsegment 1d ) and (promoter 1d ) , respectively.
• the segments (promoter 2d ) , (variable subsegment 2d ) and (5'-subsegment ⁇ ) are defined as in Formulae IV and IV(a) ;
• cDNA I consisting of the first and second complementary DNA strands is transcribed from the first promoter in the presence of corresponding DNA-dependent RNA polymerase to produce multiple copies of an RNA transcript of Formula VI or Formula VI(a) (See Figure 2b, step 7) :
• the segment (variable subsegment,, r ) is an RNA segment corresponding to (variable subsegment 1d ) ; the segments (3'-subsegment tcr ) , (intermediate subsegment tcr ) , (5'-subsegment tcr ) , (variable subsegment 2cr ) , and
• promoter 2cr are complementary to (3'-subsegment tr ) , (intermediate subsegment tr ) , (5'-subsegment tr ) , (variable subsegment 2d ) and (promoter 2d ) , respectively.
• Each of the multiple copies of the RNA transcript of Formula VI or VI(a) is capable of hybridizing with second primer of Formula IV or IV(a) , respectively, and functioning as template for a primer extension reaction to form a DNA-RNA duplex. See Figure 2b, steps 8 and 9.
• the inherent RNAse H activity of reverse transcriptase digests the RNA transcript strand of the DNA-RNA duplex, thus rendering single stranded the third complementary DNA of Formula VII or Formula VII(a) :
• Each of the segments is defined as in Formulae V or V(a) above .
• a first primer of Formula II hybridizes with this third complementary DNA strand and is extended to form a fourth complementary DNA. See Figure 2b, step 12.
• the fourth complementary DNA is a segment of Formula VIII:
• Each of the segments is defined in Formula III above.
• the overhanging end of the fourth complementary DNA, the promoter-encoding sequence acts as a template for extension of the third complementary DNA to complete a cDNA II, Formula X, which consists of a third complementary DNA strand of Formula VII and a fourth complementary strand of Formula VIII (or Formulae VII(a) and VIII(a)) .
• transcription produces either antisense transcripts (where only the antisense primer contains a promoter sense strand) or both sense and antisense transcripts (where each primer contains a promoter sense strand) .
• Sense transcripts are of Formula IX: 5*-(variable subsegment 2r )- (5'-subsegment tr )-(intermediate subsegment tr )- (3'-subsegment tr )-(variable subsegment 1cr )- (promoter, cr )-3'
• the segments designated (5'-subsegment tr ) , (intermediate subsegment tr ) and (3'-subsegment ⁇ ) are identical to or substantially homologous to the RNA target segment of Formula I.
• the segments (variable subsegment 1cr ) and (promoter, cr ) are the RNA sequences complementary to (variable subsegment 1d ) and (promoter,.,) .
• the antisense transcripts reenter the antisens amplification loop as template to produce additional copies of cDNA II.
• Figure 2b steps 7-12.
• the sense transcripts of Formula IX enter a discrete sense amplification loop analogous to the just-described antisense loop.
• each of the multiple copies of the sense transcript is capable of hybridizing with first primer of Formula II and functioning as template for an extension product to form a DNA-RNA duplex comprising a fifth complementary DNA which is rendered single-stranded by inherent RNAse H activity of reverse transcriptase. See Figure 2b, steps 7a-10a.
• a second primer of Formula IV(a) hybridizes therewith and is extended to form a double stranded cDNA II which is identical to the cDNA II which consists of DNA strands of Formulae VII(a) and VIII(a).
• cDNA II has a completely double stranded promoter at each of its ends.
• Transcription may proceed from each of the two DNA strands, to produce multiple copies of sense transcripts (i.e., transcripts comprising a segment with sequence of target segments) and antisense transcripts (i.e., transcripts comprising segment with the sequence complementary to that of targe segment) to feed the two complementary amplification loops.
• sense transcripts i.e., transcripts comprising a segment with sequence of target segments
• antisense transcripts i.e., transcripts comprising segment with the sequence complementary to that of targe segment
• RNA containing a target segment may be amplified within 2 hours to 10 6 copies or more of an RNA transcript having a segment with the sequence of the target segment or the complement thereof without the need for thermal cycling or the repeated addition of enzymes.
• the 3SR reaction of the present invention carried out in the improved reaction media of the present invention, requires only two enzymes, reverse transcriptase and
• DNA-dependent RNA polymerase to provide the necessary four enzyme activities.
• RNA target molecule should not extend in the 5•-direction beyond the 5'-nucleotide of the RNA target segment (i.e., the 5'-nucleotide of the subsegment designated (5'-subsegment tr ) should be the 5*-nucleotide of the target molecule) .
• the 5'-terminal nucleotide of the target segment is the 5'-terminal nucleotide of the entire target RNA molecule
• amplification will proceed by steps which are analogous to those depicted in Figures 2a and 2b, but the transcripts produced will be sense transcripts which will directly enter the amplification loop depicted by steps 7a-12. No antisense transcripts will be produced.
• One way to ensure that the 5'-terminal nucleotide of the RNA target molecule is the 5'-terminal nucleotide of the RNA target segment is to amplify an RNA target segment of predetermined nucleic acid sequence which segment is at the 5'-end of the RNA target molecule.
• a suitable sense primer may comprise a DNA segment which includes a promoter sense strand operatively linked for transcription to a segment having a sequence homologous to e.g., the 20 nucleotide segment at the 5'-end of the RNA target molecule including the 5'-terminal nucleotide of the RNA target molecule and extending 19 nucleotides in the 3'-direction therefrom.
• the antisense primer may consist of a DNA segment having a sequence which is complementary to a segment at the 3'-end of the target segment.
• a second way to provide an RNA segment meeting the limitation that the 5"-terminal nucleotide of the target RNA molecule is the 5'-terminal nucleotide of the target segment is to produce such an RNA target molecule, from a DNA segment which encodes the target sequence, by conducting a cycle of TAS amplification.
• An appropriate target RNA segment thus may be generated from a double stranded DNA (or single stranded DNA or RNA) known to encode the target sequence. For example, where a double stranded DNA encodes the target segment of interest, the first and second DNA primers are added to the reaction solution and the solution is heated at about 94*C - 100 ⁇ C for 1 minute and is then cooled to 42*C over the course of 1 minute.
• DNA-dependent DNA polymerase (and the necessary nucleoside triphosphates, if not previously added) is added to polymerize the extension reaction.
• the heat-stable DNA polymerase from Thermus aquaticus (see Chien et al. J. Bacteriol. 127. 1550 (1976)), SequenaseTM brand recombinant T7 DNA polymerase from the U. S.
• the nucleic acid containing solution is again heated to 100°C for 1 minute and cooled to 42° for 1 minute during which step first and second primers hybridize with the extension products of the prior primer extension reaction.
• first and second primers hybridize with the extension products of the prior primer extension reaction.
• reverse transcriptase and DNA-dependent RNA polymerase are then added such that the hybridized primers are extended to complete the cDNA synthesis and the cDNA is transcribed to produce target RNA transcripts. 3SR amplification is thereby initiated.
• the target RNA segment provided by such a cycle of TAS amplification has its 5'-end and 3'-end defined by the two primers utilized. Such an RNA therefore satisfies the requirement that the 5'-terminal nucleotide of the RNA target molecule is the 5'-terminal nucleotide of the 5'-subsegment of the target RNA. It should also be clear, however, that such a cycle of TAS amplification may virtually always be used to produce an RNA target segment suitable for 3SR amplification, without regard to which primer(s) include(s) a promoter seguence. See Example II.
• the amplifiable target segment of a nucleic acid of interest has an (intermediate subsegment tr ) including at least 20, and more preferably at least about 50, nucleotides to permit, optionally, the use of a second round of 3SR amplification using third and fourth DNA primers to amplify the (intermediate subsegment tr ) ) in a further refinement of the amplification method.
• the (intermediate subsegment tp ) may be used for detecting 3SR-produced transcripts by a nucleic acid hybridization assay, where the (variable subsegment) does not have a non-target segment which may be used for this purpose.
• the present invention involves the discovery that two enzymes, a retroviral reverse transcriptase and a DNA-dependent RNA polymerase by themselves and in the absence of an exogenous any source of RNAse H activity other than the reverse transcriptase, can provide the four enzyme activities necessary for high sensitivity 3SR amplification, which requires a high sensitivity amplification effective amount of RNAse H activity.
• One such method for augmenting the endogenous RNAse H activity of the reverse transcriptase entails carrying out the reaction in a reaction medium comprising about 20 to 40 mM of a magnesium-containing salt such as magnesium chloride, magnesium sulfate and the like; about 1 to 25 mM of an alkali metal chloride such as KC1 or NaCl and the like; about 0 to 20 mM of a sulfhydryl reducing agent such as dithiothreitol (DTT) , beta mercaptoethanol and the like; about 0 to 10 mM spermidine; about 1 to 8 mM ribonucleoside triphosphates; about 1 ⁇ M to 8 M 2'-deoxyribonucleoside triphosphates and about 0 to 25 volume percent of a sulfoxide compound such as dimethylsulfoxide.
• a magnesium-containing salt such as magnesium chloride, magnesium sulfate and the like
• Preferred reaction media comprise: 20 - 40 mM MgCl 2 1 - 25 mM KC1
• reaction medium has a pH of between about 7.5 and about 8.5, preferably pH 8.1.
• DMSO is required when AMV reverse transcriptase is the source of RNAse H activity.
• 3SR reactions were believed to be unsupportable using as a source of the four required enzymatic activities only a retroviral reverse transcriptase, such as AMV reverse transcriptase, and DNA-dependent RNA polymerase, where amplification levels greater than about 10 3 were desired. It has been found by the inventors that improved reaction media, surprisingly, allows the inherent RNAse H activity of retroviral reverse transcriptases to function to support such levels of 3SR amplification even in the absence of other sources of RNase H activity, such as E. coli RNAse H.
• retroviral reverse transcriptase such as AMV reverse transcriptase
• DNA-dependent RNA polymerase DNA-dependent RNA polymerase
• Hydroxyl containing compounds include, but are not limited to C,-C 10 alcohols such as methanol, ethanol, propanol, isopropanol, butanol, isobutanol, and the like; glycols such as ethylene glycol, diethylene glycol, triethylene glycol and polyethylene glycols having an average molecular weight of up to about 20,000 daltons which are aqueous soluble; mono-, di- and trisaccharides such as glucose, galactose, mannose, fructose, sucrose, maltose, raffinose and the like; and sugar alcohols such as sorbitol, glycerol, glucitol, mannitol, inositol and the like.
• C,-C 10 alcohols such as methanol, ethanol, propanol, isopropanol, butanol, isobutanol, and the like
• glycols such as ethylene glycol, diethylene glyco
• the improved reaction media of the present invention therefore preferably include one or more of the following compounds: (i) a C1-C10 alcohol; (ii) a compound of the formula HOCH 2 (CHOH) ⁇ CH 2 OH, wherein x is 0-20; (iii) a polyethylene glycol compound of the formula H(OCH 2 -CH 2 ) n OH, wherein n is 2-600, or a mixture of such compounds with an average molecular weight of about 1,000 to about 20,000, preferably about 6,000 to about 10,000, and (iv) a sugar from the group of mono-, di- and tri-saccharides and derivatives thereof.
• Preferred compounds of the above-defined formulae include ethanol, glycerol, sorbitol, sucrose and PEG-8000.
• Several of the examples below show the effect of sulfoxide and hydroxyl containing compounds on the levels of amplification attainable with 2-enzyme 3SR or 3-enzyme 3SR.
• RTs are AMV reverse transcriptase, recombinant MMLV reverse transcriptase and HIV-1 reverse transcriptase, which lack 5'-to-3' exonuclease activity.
• the improved reaction media should be supplemented with a sulfoxide compound of the formula R,-(SO)-R 2 , wherein R, and g are independently C,-C 4 alkyl and wherein R, and g can be joined as part of a saturated cyclic moiety (preferably 10% dimethylsulfoxide (DMSO) by volume) where AMV reverse transcriptase is employed for 2-enzyme 3SR, but such a sulfoxide compound may be omitted where a reverse transcriptase derived from MMLV, HIV-1, or other retrovirus is utilized.
• the improved reaction media further improves amplification levels in 3SR reactions carried out in the presence of E. coli RNAse H. Again, DMSO or other sulfoxide containing compound may be used to increase amplification levels in such 3-enzyme 3SR reactions utilizing AMV reverse transcriptase.
• the reaction media should be supplemented with 0.1 - 10 mM MnCl 2 or similar manganese salt where MMLV reverse transcriptase is employed in the 2-enzyme 3SR reactions of the present invention.
• concentration of rNTPs in the improved reaction media of the present invention should be most preferably about 6mM although lesser concentrations of rNTPs in the improved reaction media may be employed for 3-enzyme 3SR.
• Unexpected increases in amplification levels of up to 10-fold or more are obtained in 2-enzyme 3SR reactions where rNTP concentration is increased from 4mM to 6mM in the improved reaction media, even though the lower concentration of rNTPs represents a large molar excess of substrate. Concentrations of rNTPs greater than about 8mM or 9mM tend to reduce the levels of amplification which may be obtained in two-enzyme 3SR reactions.
• Example III below, demonstrates the capacity of an improved reaction medium of the invention, but not a prior art reaction medium reported to support 3-enzyme 3SR, to sustain 2-enzyme 3SR.
• target segments longer than about 200 nucleotides in length may be more effectively amplified where the reaction medium is supplemented with about 1 to about 25 weight percent of an alcohol or polyhydroxy compound using either the 2-enzyme or 3-enzyme methods. It is expecially preferred to supplement the improved reaction media of the present invention with between about 5 and about 15 weight percent of sugar alcohol of the formula HOCH 2 (CHOH) ⁇ CH 2 OH, wherein x is 0-20, more preferably. wherein x is 0-5, and most preferably where the compound is sorbitol or glycerol.
• a preferred reaction medium of the present invention for carrying out 2-enzyme 3SR amplification is an aqueous solution comprising:
• BUFFER Tris pH 8.1, 40 mM.
• NUCLEOTIDES rNTPs, 6mM, dNTPs, lmM.
• 0.25 ⁇ g antisense primer comprising a
• reaction solution comprising 10% dimethyl sulfoxide (DMSO) and 15% sorbitol
• reaction solution 1000 Units/100 ⁇ l reaction solution (reaction solution comprising 1 mM MnCl 2 and 15% sorbitol) and
• Temperature of the reaction mixture during 2-enzyme or 3-enzyme 3SR amplification also has a marked effect on the level of amplification achieved. While amplification may be carried out at temperatures between about 5°C and about 50 ⁇ C, more preferably amplification is carried out at between about 37 ⁇ C and about 47 ⁇ C and most preferably at about 42"C. Reaction temperature is particularly important in the 2-enzyme 3SR methods of the present invention, with amplification at 42 ⁇ C being approximately 100-fold more effective than at 37 ⁇ C.
• amplification rates are 2- to 3-fold greater in the 42 ⁇ C - 45 ⁇ C temperature range in the presence of an alcohol or polyhydroxyl-containing additive such as sorbitol, glycerol, ethanol and the like, and additionally DMSO, or like sulfoxide compound where AMV reverse transcriptase is utilized.
• an alcohol or polyhydroxyl-containing additive such as sorbitol, glycerol, ethanol and the like, and additionally DMSO, or like sulfoxide compound where AMV reverse transcriptase is utilized.
• the present invention concerns DNA primers capable of priming a chain elongation reaction which primers comprise a promoter sense strand having at least one to ten nucleotides extending 5' from and adjoining the 5'-most nucleotide of the segment with the sense strand of the promoter's polymerase binding site (preferably with the sequence of the promoter's consensus sequence).
• the inventors have surprisingly discovered that the length and seguence of the promoter-providing segment of a primer having a promoter sense strand has a marked affect on the level of amplification in 3SR. It has been found that primers truncated at their 5'-end with the 5•-nucleotide of the promoter consensus sequence (i.e., the 5'-end of the primer is the 5'-most nucleotide of the consensus sequence) exhibit less than about 10 5 -fold amplification in 1 hour at 42 ⁇ C in the improved reaction media of the present invention. As understood in the art, a promoter has a number of parts.
• polymerase binding segment which is the segment of double-stranded DNA to which the polymerase binds in initiating transcription.
• a promoter must have at least a polymerase binding segment to function in transcription. It is thought that the consensus sequence is the minimum sequence necessary, in completely double-stranded form, which is necessary for the binding of RNA polymerase in the process of initiating transcription.
• the consensus sequence for the T7 promoter is disclosed herein. Other promoter consensus sequences are well-known in the art.
• the sense strand of the T3 consensus sequence is 5'-ATTAACCCTCACTAAA-3' and the T3 transcription initiation sequence is 5•-GGGA-3* .
• two versions of the SP6 promoter are well-known.
• the consensus sequence of the sense strand of the SP6 promoter (version 1) is 5*-ATTTAGGTGACACTATA-3' and the consensus sequence of the sense strand of the SP6 promoter (version 2) is 5*-AATTAGGGGACACTATA-3• ;
• the transcription initiation sequence for both version 1 and version 2 of the SP6 promoter is 5'-GAAG-3'.
• the initial concentration of target segment is in the concentration range of about 0.01 - 1 attomole in a lOO ⁇ l aliquot - a concentration which is not unusual for detection of the presence of, for example, HIV-1 virus or a defective gene characteristic of a disease state - such a level of amplification is not detectable by standard nucleic acid hybridization assays.
• promoter-providing primers which have as few as 1 additional nucleotide adjoining the 5'-end of the promoter consensus sequence surprisingly show about a 10-fold increase in amplification; and for each additional nucleotide up to a 4-nucleotide sequence added to the 5'-end of the consensus sequence an additional 7- to 10- fold increase is achieved.
• Extending an oligonucleotide from its 5'-end more than 4 nucleotides, and up to about 10 nucleotides, relative to a promoter consensus sequence may improve amplification over the level achieved with 1 to 4 nucleotides, as shown in the following Table.
• GGGA is from the T7 sequence
• +5 nucleotides onward is the HIV-1 sequence; subsequent sequences are identical for each oligonucleotide.
• Olignonucleotides are aligned to display differences among the primers.
• RNA product made is 214 nucleotides long. Amplified targets were quantitated using beadbased sandwich hybridization (BBSH) employing
• the promoter-containing primers of the present invention having 1-10 nucleotides, and preferably 1-4 nucleotides, adjoining the 5'-terminal nucleotide of the consensus sequence significantly enhance amplification levels relative to promoter-providing primers described in the prior art.
• the one to ten nucleotide sequence adjoining the 5'-end of the consensus sequence ensures that the reverse transcriptase remains associated with the DNA template strand at least until a cDNA having a completely double stranded promoter segment is completed.
• the complete double-strandedness of the promoter segment comprising the consensus sequence (presumably the polymerase-binding segment) is presumably important for efficient transcription from the promoter.
• oligonucleotide primers used in the Examples which follow have the nucleotide seguence corresponding to the indicated region of the HIV-1 genome as disclosed in Ratner et al., Nature (London) 313, 277-284 (1985) , which is incorporated herein by reference.
• an asterisk (*) denotes a promoter-providing oligonucleotide primer comprising the segment 5'-AATTTAATAC GACTCACTAT AGGGA-3' (SEQ ID NO: 15), wherein the underlined sequence is the 17-nucleotide consensus sequence of the promoter recognized by the T7 bacteriophage DNA-dependent RNA polymerase.
• the 4 nt sequence (5*-AATT-3 • ) at the 5'-end of the consensus sequence is defined herein to be included within the term "promoter sense strand” and the 4 nt segment (e.g., 5'-GGGA-3' or 5'-GAAA-3', etc.) at the 3'-end of the consensus sequence is the T7 transcription initiation segment, which, in the parlance adopted above, is a "variable subsegment" of the primer. Sequence corresponding to this variable subsegment will occur in transcripts made from the promoter corresponding to the promoter sense strand.
• the promoter-containing oligonucleotide probe designated 88-347 * consists of a segment which is the complement of the segment of the HIV-1 genome corresponding to nucleotides, 6661-6631 (inclusive) the 4 nt variable subsegment corresponding to the transcription initiation sequence 5'-GGGA-3', and the 21 nt promoter sense strand with the sequence given above, and has the following complete sequence: 5'-AATTTAATAC GACTCACTAT AGGGATGTAC TATTATGGTT
• oligonucleotide primers designated by primer #
• primer # The nucleotide sequences of the following oligonucleotide primers (designated by primer #) are disclosed in accordance with the above convention. Several of these oligonucleotides are referred to in the specification and examples herein.
• a designation of "sense” means that the primer comprises a segment with the same sequence as the indicated segment from the HIV-1 genome.
• a designation of "Antisense” means that the primer comprises a segment that is complementary in sequence to the indicated segment from the HIV-1 genome.
• variable subsegment corresponding to the transcription initiation site has the sequence is 5'-GGGATC-3•, instead of 5•-GGGA-3' .
• the invention in another of its aspects concerns methods useful for detection of at least one specific RNA target segment in a sample containing nucleic acid, comprising amplifying said RNA target segment according to the above-recited methods and detecting the presence of RNA transcripts which comprise a sequence that is the same as or complementary to that of said target segment.
• Detecting amplified nucleic acid products may be accomplished by well known nucleic acid hybridization techniques.
• Example II describes the bead-based sandwich hybridization technique, which is the preferred method for detecting amplification products.
• RNA transcripts which have been labelled with a radioisotope, or a chromogenic or fluorescent substrate, or a group such as biotinyl, capable of being bound by a complex comprising an enzyme capable of catalyzing a chromogenic reaction, as well known in the art, and detecting the presence in a hybridization assay of RNA transcripts which have incorporated such labelled rNTPS.
• kits for carrying out the amplification methods of the invention may comprise one sense and one antisense primer (one or both including a promoter sense strand) , components of a reaction medium enabling 2-enzyme 3SR amplification, and only the bacteriophage DNA-dependent RNA polymerase(s) corresponding to the promoters of the primers, and a reverse transcriptase.
• kits of the invention may include components for 3-enzyme 3SR, including an enzyme that provides RNAse H activity but is not a reverse transcriptase, and an aqueous solution to provide an improved reaction medium of the invention or compound (e.g., salts, buffers, hydroxy compounds, DMSO, nucleoside triphosphates) to prepare such an improved reaction medium.
• an enzyme that provides RNAse H activity but is not a reverse transcriptase e.g., a reverse transcriptase
• an aqueous solution to provide an improved reaction medium of the invention or compound (e.g., salts, buffers, hydroxy compounds, DMSO, nucleoside triphosphates) to prepare such an improved reaction medium.
• compound e.g., salts, buffers, hydroxy compounds, DMSO, nucleoside triphosphates
• the invention also encompasses the improved reaction medium.
• Methods and kits for carrying out nucleic acid hybridization probe assays may entail, in addition, steps and components necessary for detecting the RNA product resulting from amplification according to the invention.
• the skilled understand the various additional steps and components, respectively, that are required to detect RNA from an amplification process by any of the numerous nucleic acid probe hybridization assay methods known in the art.
• Trisacryl-sulphydryl was carried out by first equili ⁇ brating the beads (10 g wet weight) with 0.5 M NaHC0 3 , pH 9.7. The volume was adjusted to 40 ml in a 50-ml Sarstedt conical tube, solid N-acetyl homocysteine thiolactone (2.5 g) was added, and the tube was agitated at room temperature for 1 h. Subsequently, another gram of reagent was added, and the sample was shaken over ⁇ night. The beads were washed with 250 ml 0.1 M NaCl and then filtered using a sintered glass funnel.
• a 10-g sample of Trisacryl-sulphydryl was then equilibrated in 30 ml 0.1 M NaOAc, pH 6.0, and treated with 200 mg solid succinic anhydride. After shaking for 30 min, an addi ⁇ tional 200 mg of anhydride was added to the suspension, and the capping reaction was allowed to proceed for a further 30 min. The beads were then equilibrated in 50 ml 0.1 M Tris, pH 8.5, to hydrolyze the thioester linkages. After 1 h, the support was washed with TE, pH 8.0, and stored at 4'C.
• the sulphydryl group concen ⁇ tration in the support was estimated by titrating with 5,5'-dithiobis(2-nitrobenzoic acid) and monitoring the release of 3-carboxylate-4-nitrothiophenolate at 412 nm.
• the covalent attachment of 5'-bromoacetyl-derivatized oligonucleotides to sulphydryl Trisacryl was performed by the following procedure.
• the Trisacryl-sulphydryl support (1 g) obtained from the above reaction, was reduced with 30 ml 20 mM DTT in 0.05 M K g HPO ⁇ , pH 8.0, and 1 mM EDTA for 1 h.
• the support was then washed four times with 25 ml of 0.05 M K j HPO ⁇ pH 8.0, 1 mM EDTA, followed by two washes with 25 ml of 0.1 M triethylammonium phosphate (TEAP) , 1 mM EDTA, pH 9.0.
• TEAP triethylammonium phosphate
• the beads were washed twice with 35 ml of 0.1 M Tris, pH 8.0, 0.1 M NaCl, 1 mM EDTA, and 0.1% SDS, four times with 45 ml of 0.1 M Na 2 P 2 0 7 , pH 7.5, followed by two washes with 45 ml of TE, pH 8.0, and stored at 4*C.
• This example shows that detectable levels of amplification are observed with a 3-enzyme 3SR amplification of a DNA target.
• nucleic acids from 2.5 x 10 5 PBMC from both normal patients and patients with cystic fibrosis were extracted as in Example 1.
• the precipitated nucleic acids were pelleted by ⁇ entrifugation. The pellet was drained, rinsed with 70% ethanol one time, dried and then resuspended in lOO ⁇ l containing:
• the samples were heated at 100"C for 1 minute, cooled to 42 ⁇ C for 1 minute and 10 units AMV reverse transcriptase (RT) (Life Science, Inc.) were added. The samples were incubated at 42 ⁇ C for 15 minutes then heated to 100 ⁇ C for 1 minute. Thirty units of AMV RT, 100 units T7 RNA polymerase (Stratagene) and 4 units E. coli Rnase H (Bethesda Research Labs) were added. The samples were incubated at 42 ⁇ C. for 1 hour. The samples were then frozen at -20 ⁇ C.
• RT reverse transcriptase
• BBSH BBSH
• 2S-GS 2 ml micro-column
• the target in 20 ⁇ l of TE, is added to the column, along with lO ⁇ l of 2x hybridization solution (20% dextran sulfate, 20x SSPE, 0.2% SDS) which had been warmed to 42 ⁇ C.
• the micro-columns are vortexed and incubated with occasional agitation at 42 ⁇ C for two hours.
• the beads are washed six times with 1ml each of 2x SSC which had been equilibrated at 42 ⁇ C. Cerenkov counting of the columns and washes is used to determine the amount of target detected. Counter background is subtracted from all samples and the fm of target detected is calculated as follows:
• This Example shows that detectable levels of amplification are observed with the 2-enzyme 3SR reaction at 37 ⁇ C with a preferred reaction medium of the present invention but not with a prior art reaction medium suitable for 3-enzyme 3SR reactions.
• 0.1 attomoles of HIV-1 RNA was amplified in 2-enzyme 3SR or 3-enzyme 3SR reactions at 37 ⁇ C under prior art reaction conditions and under improved reaction conditions of the invention.
• 2-enzyme.3SR amplification yielded a detectable amount of amplification product.
• Higher levels of amplification in the 3-enzyme reactions were observed with the improved reaction media, such as the preferred medium described below in this Example.
• Each reaction solution contained 0.25 ⁇ g each of oligonucleotide primers 88-211 * and 88-347 * , 10 units AMV reverse transcriptase and 20 units T7 RNA polymerase. Total reaction volume was 100 ⁇ l.
• a "+” in the "Exogenously added RNAse H” column denotes the presence of 4 U E. coli RNAse H in the reaction medium, while a “+” in the "DMSO/PEG-8000” column denotes that the reaction medium was supplemented with 10% dimethylsulfoxide and 5% PEG-8000.
• reaction products were detected by bead-based sandwich hybridization (Example II) using OligobeadsTM derivatized with oligonucleotide #86-273 and oligonucleotide #87-81 as probe. 3SR Reactions on env Region at 37 ⁇ C.
• Glycerol and/or 5% polyethylene glycol (PEG-8000) on the level of amplification obtainable in 2-enzyme or 3-enzyme 3SR reactions.
• reaction conditions used for the 3SR reactions were the same as the "Preferred 3SR Reaction Medium" disclosed in Example III except that reactions were carried out at 42 ⁇ C for 1 hour.
• the 3SR reactions were carried out using 0.1 attomoles HIV-1 RNA as target and the primer pair 88-29/89-263 * (approximately 400 bases apart) .
• the products of amplification were detected by bead-based sandwich hybridization (Example II) using OligobeadTM derivatized with oligonucleotide 86-273 and oligonucleotide 87-81 as probe. As shown below, enhanced levels of amplification are obtained in the presence of 10% DMSO and 10% glycerol.
• This example compares the levels of 2-enzyme 3SR amplification and 3-enzyme 3SR amplification (0.1 attomoles of HIV-1 RNA target and primer pair 88-211 * /88-347 * in each case) in the presence and absence of 10% DMSO and 5% PEG-8000 in the preferred 3SR reaction medium.
• the products were detected by bead-based sandwich hybridization as in Example II using OligobeadsTM derivatized with oligonucleotide 86-273 and using oligonucleotide 87-81 as probe.
• MMLV reverse transcriptases from Moloney murine leukemia virus (MMLV) , HIV-1 and avian myeloblastosis virus (AMV) .
• MMLV reverse transcriptase has a requirement for manganese ion to provide an effective amount of inherent RNAse H activity.
• This Example demonstrates increased amplification levels achieved in 3-enzyme 3SR reactions, in the presence and absence of 5% PEG-8000/10% DMSO with incubation at 42°C or 45°C.
• 0.1 attomoles of HIV-1 RNA was amplified in 3-enzyme 3SR reactions with 30 Units AMV reverse transcriptase, 100 Units T7 DNA-dependent RNA polymerase, 4 Units RNAse H, at 42° C for 1 hour in the preferred reaction medium disclosed in Example III using one of the following sets of env primer pairs: 88-211 * /88-347 * or 87-79/88-347 * .
• This Example demonstrates the effect of temperature on 3-enzyme 3SR amplification in the preferred reaction medium (See Example III) in the presence and absence of 10% DMSO.
• the target was 0.1 attomoles of HIV-1 RNA.
• Each lOO ⁇ l reaction mixture had 30 U AMV RT, 100 U T7 RNA Polymerase and 4 U E. coli RNase H.
• This example shows the effect of nucleotide alterations at 5• and 3* ends of oligonucleotide primers containing the consensus sequence of the T7 promoter. 3SR reactions were performed in 50 ⁇ l containing
• RNA product made is 214 nucleotides long.
• BBSH beadbased sandwich hybridization
• the underlined sequence corresponds to the cannonical 17 nt T7-pretnoter sequence and the initiation of RNA transcription is denoted by +1.
• the sequence GGGA is from the T7 sequence; the +5 nucleotides onward is the HIV-1 sequence. Only the 5 1 end portion of each oligonucleotide is presented; subsequent sequences are identical for each oligonucleotide. Ol gnonucleotides are aligned to display differences among the primers.
• This example demonstrates the effect of various combinations of additives on the amplification of a 707-base region of the pol gene from HIV-1. Reactions were performed at 42°C for two hours with 0.1 attomoles of HIV-1 RNA as the target and 90-249 (sense) 5 » -GAAAAAATAAAAGCATTAGTAGA-3 ' (SEQ ID NO: 30) and 89-391 * (antisense) 5•-AATTTAATACGACTCACTATAGGGATTTCCCCACTAACTTCTGTATGTCATTGA CA-3 • (SEQ ID NO: 31) as the priming oligonucleotides.
• Three-enzyme reactions contained 30 U AMV RT, 100 U T7 RNA polymerase and 2 U E.Coli RNase H. Two-enzyme reactions contained 10 U AMV RT and 20 U T7 RNA polymerase.
• the probe and OligobeadTM sequences were 89-534 5'-AGGATCTGACTTAGAAATAGGGCAGCA-3 ' (SEQ ID NO: 32) and 89-419 5 «-AGAACTCAAGACTTCTGGGAAGTTC-3 • (SEQ ID NO: 33) , respectively.
• MOLECULE T ⁇ EE ENA (genomic)
• POSITION IN GENCME GENCME

Landscapes

• Chemical & Material Sciences (AREA)
• Life Sciences & Earth Sciences (AREA)
• Health & Medical Sciences (AREA)
• Organic Chemistry (AREA)
• Engineering & Computer Science (AREA)
• Wood Science & Technology (AREA)
• Zoology (AREA)
• Genetics & Genomics (AREA)
• General Engineering & Computer Science (AREA)
• Biotechnology (AREA)
• Bioinformatics & Cheminformatics (AREA)
• Biochemistry (AREA)
• Biophysics (AREA)
• Physics & Mathematics (AREA)
• Biomedical Technology (AREA)
• Microbiology (AREA)
• Proteomics, Peptides & Aminoacids (AREA)
• Molecular Biology (AREA)
• General Health & Medical Sciences (AREA)
• Analytical Chemistry (AREA)
• Immunology (AREA)
• Crystallography & Structural Chemistry (AREA)
• Chemical Kinetics & Catalysis (AREA)
• Plant Pathology (AREA)
• Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
• Cosmetics (AREA)
• Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
• Enzymes And Modification Thereof (AREA)

Applications Claiming Priority (3)

Publications (2)

Family

ID=24454235

Family Applications (1)

Country Status (13)

Families Citing this family (55)

Citations (1)

Family Cites Families (3)

• 1991
  • 1991-11-12 IL IL10004091A patent/IL100040A/en not_active IP Right Cessation
  • 1991-11-12 IE IE393091A patent/IE913930A1/en not_active Application Discontinuation
  • 1991-11-12 ZA ZA918965A patent/ZA918965B/xx unknown
  • 1991-11-13 CA CA002096013A patent/CA2096013A1/en not_active Abandoned
  • 1991-11-13 WO PCT/US1991/008488 patent/WO1992008800A1/en not_active Application Discontinuation
  • 1991-11-13 HU HU9301369A patent/HUT69772A/hu unknown
  • 1991-11-13 JP JP4502286A patent/JPH06502767A/ja active Pending
  • 1991-11-13 NZ NZ240574A patent/NZ240574A/en unknown
  • 1991-11-13 AU AU91315/91A patent/AU9131591A/en not_active Abandoned
  • 1991-11-13 PT PT99500A patent/PT99500A/pt not_active Application Discontinuation
  • 1991-11-13 EP EP19920901557 patent/EP0572417A4/en not_active Ceased
• 1993
  • 1993-05-11 NO NO93931709A patent/NO931709L/no unknown
  • 1993-05-12 FI FI932144A patent/FI932144A/fi not_active Application Discontinuation

Patent Citations (1)

Also Published As

Similar Documents

Legal Events