EP0377627A1

EP0377627A1 - Dna probe

Info

Publication number: EP0377627A1
Application number: EP88907733A
Authority: EP
Inventors: Ian Craig; Neil Fraser; Yvonne L. Boyd
Original assignee: Oxford University Innovation Ltd
Current assignee: Oxford University Innovation Ltd
Priority date: 1987-09-04
Filing date: 1988-08-19
Publication date: 1990-07-18
Also published as: WO1989001979A1; JPH03501202A; GB8720855D0

Abstract

Sont décrites une région hypervariable chromosomique X, ainsi que des sondes d'ADN adaptées pour détecter des fragments d'ADN, comprenant la région hypervariable. L'utilisation des sondes comprend l'analyse du statut d'activation du chromosome X, la possibilité de clonage et le diagnostic de maladies liées à l'X.Described are a chromosomal X hypervariable region, as well as DNA probes adapted to detect DNA fragments, including the hypervariable region. The use of the probes includes analysis of the activation status of the X chromosome, the possibility of cloning and the diagnosis of X-linked diseases.

Description

DNA PROBE

There has recently been isolated a DNA probe, the so called "hypervariable probe" which detects differences in individuals at the DNA level (5). The hypervariable probe is able to detect variable DNA sequences in human DNA. The hypervariable regions detected by this probe comprise a basic DNA sequence repeated a number of times. Hypervariable regions have been detected at different places on many chromosomes. The variability of these regions is due to differences in the number of times the repeat sequence of a region is repeated.

Digestion of an individuals DNA with restriction enzymes which do not cut within the hypervariable region results in a number of DNA fragments which contain iiypervariable regions. DNA fragments can be separated by well known means according to the number of base pairs in a fragment. In the case of the hypervariable regions the size of a fragment produced will depend on the number of times the repeat sequence is repeated in that region thus giving restriction fragment length polymorphisms. The fragments can be detected by hybridisation with the hypervariable probe. These can be displayed as "genetic fingerprints" by simple examination of DNA prepared from extremely small samples of body tissue. Such is the extent of the variability detected by the probe that only identical twins have undistinguishable patterns.

In addition to its value in establishing the identity of individuals the hypervariable probe, and derivatives from it which can identify variable regions on particular human chromosomes, can be used to map inherited diseases and to follow them through families Inheritance or tne fragments has been shown to be Mendelian. Using these probes it is possible to predict the likely disease status of progeny.

However the variable regions detected by the hypervariability probe(5) are all autosomal in origin. No X-chromosome linked sequences have hitherto been detected.

A DNA sequence has now been isolated independently and without reference to previously described variable sequences. This novel sequence hybridises to an X-chromosomal hypervariable region and flanking sequences.

It maps by analysis of a human mouse hybrid cell panel to X cen- Xp11.3 and by in situ hybridisation to Xcen- Xp11.22 with a probable location at Xp11.22.

Accordingly the present invention provides a

DNA sequence characterised as follows:

It maps to the X cen - Xp11.22 region of the human X chromosome by in situ hybridisation. It is all or part of the DNA from the X cen-

Xp11.3 region that has the pattern of restriction sites generally as shown in figure 1.

It contains a region which comprises a variable number of repeats of a repeat sequence (HYPERXOX) which, when X chromosomal human DNA is cut with a restriction enzyme that does not cut within the repeat sequence, produces a restriction fragment whose length is variable between one individual and another depending en the number of times the repeat sequence is present.

Reference is directed to the accompanying drawings in which:

Figure 1 is a restriction map o f the cosmid

M27 in the region of M27β. Figure 2 is the sequence of a Sau 3A/HaeIII restriction fragment isolated from the sequence M27 which includes 3½ copies of a 26 bp repeat sequence HYPERXOX. Figure 3 is a southern blot of EcoRI digested female DNAs probed with M27β demonstrating multiallelic variation.

Figure 4 is a southern blot of EcoRI digested DNA from related individuals probed with M27β which shows simple sex linked Mendelian inheritance.

Figure 5 and 6 are pedigrees and EcoRI digests of DNA from families in which the disease retinitis pigmentosa is known to occur.

Figures 7 and 8 a re Msp1 and Hpall digests of X chromosomal DNA probed with M27β illustrating the pattern of X inactivation.

Figure 9 is a proposed structure for the repeating sequence HYPERXOX.

In one embodiment, the sequence comprises the DNA fragment of the M27β region including HYPERXOX.

Single stranded DNA probes labelled with a detectable marker are conventionally prepared DNA molecules or fragments thereof for use in detecting complementary sequences. According to a specific embodiment the present invention provides a DNA probe comprising single stranded DNA as defined. which single stranded DNA molecule is labelled with a detectable marker. Typically the detectable marker will be selected from fluorescent and radioactive markers and components of chromogenic and chemiluminescent enzyme systems. Such markers are well known in the art.

The sub-regional localisation of M27β to the pericentric region of the X chromesome (Xp11.3→Xcen), means that the probe may be of use for linkage analysis of disease loci thought to reside in this region. Because the level of recombination between sequences near to the centromere is thought to be lower than that between sequences located more distal ly it may be applicable to loci on proximal Xq as well as those on proximal Xp. Loci in this region include those for retinitis pigmentosa (Xp11.3). incontinentia pigmenti

(Xp11), Menkes syndrome (Xp11-q11 ) and Wiskott-Aldrich syndrome (Xp11-q12).

According to a further aspect the present invention provides an assay method (suitable inter alia for determining the inheritance of hypervariable regions within families and the likely disease status of progeny) which comprises treating X-chromosomal DNA which has been cut with a restriction enzyme with the DNA probe of the invention under hybridising conditions then analysing the treated DNA to detect the presence and/or size of fragments in an individuals DNA. One suitable way of carrying out such a method would be to employ the well known Southern blotting technique. According to this technique tne DNA to be treated is cut with one or mere restriction enzymes and the fragments are separated according to size by gel electrophcresis. By standard methods the DNA in the gel is transferred to a nitrocellulose filter and is there hybridised with the labelled probe which binds to any DNA fragments containing a DNA sequence complementary to the probe. Any bound probe is then detected by means of its detectable marker. There are a number of variants of such techniques well known in the art and these will also be suitable according tc the present invention. In such a method of screening, a DNA fragment will be produced for each X-chromosome. Thus, two fragments will normally be produced by female DNA and one fragment will normally be produced by male DNA. Comparison of positions of fragments on gels from family members will reveal which of the X fragments was inherited by progeny, and the likely disease status of progeny with respect to X-chromosome linked diseases with loci mapping in the region of the probe.

A further aspect of the invention provides a method for the screening and diagnosis of disease states in which an abnormal number of X-chromosomes are present. One way of carrying out such a method would be to employ the Southern blotting technique. In such a method the number of fragments of different length produced is normally the same as the number of X-chromosomes present. Thus simply determining the number of fragments present would enable diagnosis to be made. By this technique, the probe has been employed to demonstrate the maternal contribution of both X chromosomes in a case of Klinefelter's syndrome. The invention also provides a method for studying the inactivation of X chromosomes in cells from a wide variety of sources. This is made possible through the existence of one or more adjacent recognition sites for the restriction enzymes Msp1 and Hpall. The enzyme Msp1 cleaves the sequence CCGG and will do so even when the internal cytosine is methylated; its isoschizomer Hpall will only cleave at an unmethy lated CCGG sequence. Probes of this invention and the hypervariable region do not contain target sites for these enzymes thus hypervariability extends to fragments generated by them. It has been observed that the active X chromosome is methylated and the inactive X unmethylated at target sites adjacent to binding sites of probes of this invention. Preliminary studies confirm predictions based on results with other enzymes ie that most females will be heterozygous for Msp1/HpaII restriction fragment alleles.

Probes according to the present invention may be employed to assess the X inactivation status in many situations eg imprinting, X-linked disorders in females and clonal analysis - through the persistence of one pattern of methylation resulting from the consistent inactivation of one of the two X-chromosomes in the descendants of a single somatic cell. This type of approach has been described for other (non- hypervariable) X-chromosome probes (7). The DNA sequence characterised above was isolated by the following procedure.

Isolation of the DNA Sequence.

A genomic library constructed from the human- mouse hybrid cell line MOG-T using the cosmid vector pTM1 (1) was screened for cosmids containing numan material using 32P raαio label led total human genomic DNA. The hybrid MOG-T has two fragments of the human X-chromosome translocated onto mouse chromosomes spanning the whole of the X-chromosome as its only human ccmponent (2). Together the fragments a re thought to span the whole of the X chromosome.

Since little cross hybridisation occurs between human ano rodent repetitive sequences only clones containing the human X-chromosomal DNA hybridise to the probe and these were identified by autoradiography. Single-copy DNA fragments within the cosmid inserts were identified by Southern analysis of restriction digested clones again by using radio- labelled total human DNA to detect repeat containing fragments. Fragments which did not give a signal on autoradiography were assumed to contain unique or low copy sequences. One such cosmid (M27) was found to contain three low copy Eco RI restriction fragments - M27α , M27β and ranging in size from 3kb (M27α) to 1.5kb M27β is 2.3kb. These have been sub- cloned into the plasmid vector pUC9.

The X localisation and sub-regional assignment of M27β was achieved using a hybrid mapping panel consisting of Eco RI digested DNA from hybrid cell- lines containing different representations of the human X-chromosome. The hybrids used in this study were:

HYBRID REGIONS OF HUMAN X Ref CHROMOSOME RETAINED

HORL911R8B Xpter-Xq2 ( 2-4 ) (2)

PIP Xp11.4-Xp22.1

Xq25-Xqter (2)

WAG.8 Xqter-Xp21 (2)

MCP6 Xq13-Xqter (4)

Sequences detected by M27β were found only in the hybrids H0RL911R8B and WAG 8. This sub-reglonally assigns them to Xp11.3-Xq12. This localisation has been further refined by probing DNA from a cell hybrid which contains an X chromosome cerived from a cell-line with an isoXq chromosome. M27β does not detect any sequences present in this hybrid, thus refining the localisation to X cen - Xp11.3. It is to be understood that the localisation X cen- Xp 11.3 referred to herein includes the region of the X chromosome up to the break point Xp 11.4 i.e. up to region present in the hybrid PIP. In situ hybridisation studies have further refined localisation to X cen- Xp 11.22 with a probable location at Xp 11.22. The X chromosomes present in the hybrid cell-lines have different origins. The sizes of the Eco RI restriction fragments detected by M27β in WAG 8 and H0RL911R8B (and also those of control male and female DNAs) were all of different sizes, thus indicating a region of hypervariability. i A significant observation was that the Eco RI restriction fragment detected by M27β when used to probe DNA from the cell-line MOG-T (from which the clone was originally derived) is ~5.1kb in length as opposed to the expected length of 2.3kb. A restriction map of the cosmid M27 has been constructed in the region of M27β (see Fig.1). Restriction fragments to the left of the Bgl II site B⁺ (constant region) detected in genomic digests probed with M27β (HXoxS1) a re the same size as those present in the cosmid. Genomic restriction fragments to the right of B⁺ (Bgl II-Eco RI, Bgl Il-Bgl II, Bgl II - PvuII and Bgl II- Hind III) detected by M27s and HXoxS2 "show pronounced variation between different individuals (variable region). The restriction fragment B⁺-E⁺ (HXoxS2) appears to contain a deletion of 2.8kb, since the Bgl II-Eco RI genomic fragment detected by HXoxS2 in the hybrid MOG-T is ~ 3.6kb a s opposed to the O.Skb predicted from this map. Many of the repeats responsible for the observed hypervariability are presumed to fall within this deletion. A plausible explanation for the observed deletion of sequences is that the repeat responsible for the hypervariability at this locus is unstable in the recA⁺ E. coli host used to propagate the cosmid library (E.coli ED8767). This phenomenon has been noticed by several other workers. In an attempt to isolate this repeat an approach described by Nicholls et al. (6) has been followed. They describe a simple and rapid technique for the cloning of specific genomic DNA fragments in small, but representative plasmid libraries using the vector pUC9 and the recA E.coli strain HB101. Such hypervariable repeats have been shown to be stable using this system and the approach has been successfully employed to isolate, amongst others, a hypervariable repeat associated with the α-globin locus. This approach is being employed to attempt to clone a 5.3 kb Bgl II-Eco RI restrictionfragment from the 4X cell-line GM1416 that has been shown to contain the hypervariable repeat described above.

In another embodiment of the invention, the probe comprises a DNA fragment present in multiple copies within the hypervariable repeat region.

The hypervariable repeat HYPERXOX is the sequence that is responsible for the observed multiallelic variation.

The sequence described as M27β , refers to the mainly single-copy probe that detects hypervariability but which also includes a number of repeats of the repeat sequence HYPERXOX.

A Sau3A/HaeIII restriction fragment has been isolated from M27β which contains three complete and one partial copy of a 26 base pair repeated sequence. The complete sequence of this restriction fragment is provided in Figure 2. The repeating motif is designated in bold lettering. It can be seen (Figure 9) that the 26 base pair repeat sequence HYPERXOX contains within it a perfect inverted repeat of 10 base pairs separated by 3 base pairs and has therefore the potential to generate a cruciform structure with a symmetrical stem loop configuration. This type of sequence may be of biological significance particularly in promoting recombination. It is possible that such a sequence is distributed elsewhere in the human genome and in the genomes of other organisms.

A further derivative of the 26 bp repeat sequence HYPERXOX has been prepared by ol igonucleotide synthesis and comprises the polynucleotide

AGATACTATCCAGGACTC (3')

This derivative (oligoHYPERXOX) is incapable of forming a stable internally folded structure and, unlike HYPERXOX, can be easily hybridised to complementary sequences. Radioacti vely labelled oligoHYPERXOX is capable of hybridising to the restriction fragment carrying HYPERXOX repeats in digests of M27β .

Probes comprising the polynucleotide sequences oligoHYPERXOX and HYPERXOX or complementary sequences will bybridise to the HYPERXOX or its complementary sequence and to DNA fragments which include the repeat sequence. Other probes comprising sequences such as oligoHYPERXOX which include a significant part of the HYPERXOX sequence or complementary sequence will also hybridise to DNA fragments containing the repeat sequence provided that a sufficient part of the sequence is used to ensure specific hybridisation. It will also be recognised that a probe comprising a polynucleotide sequence having a sufficiently high degree of homology with the HYPERXOX sequence or complementary sequence or a significant part tnereof to give a specific pattern of hybridisation could be used to detect DNA fragments containing the repeat sequence.

Thus polynucleotide probes suitable for detecting the variable DNA fragments containing the HYPERXOX can be prepared from any polynucleotide sequences which hybridise specifically to the HYPERXOX sequence or its complementary sequence. The shorter the sequence or the lower the homology the less specific the hybridisation will be. Using such less specific probes, it may be possible to isolate sequences related to HYPERXOX from throughout the human genome or genomes of other species. The degree of homology should not however be reduced so far as to cause binding to unrelated sequences. Similarly probes comprising the polynucleotide sequence of the single copy sequence flanking the HYPERXOX repeat sequence as shown in Figure 2 will hybridise to restriction fragments containing the HYPERXOX sequence. Again a probe comprising only sufficient of the sequence, or complementary sequence, to give specific hybridisation could be used rather than the whole sequence. Once a DNA fragment has been isolated which includes the

HYPERXOX sequence it can be used as a probe to isolate further sequences which bind to the single copy regions flanking the HYPERXOX region any of which can be used as a probe to detect hypervariability due to HYPERXOX provided that the restriction enzyme used does not cleave between the hybridisation site of the probe and the HYPERXOX region or within the HYPERXOX sequence. The probe M27β can be isolated by synthesising a polynucleotide probe including at least part of the sequence complementary to that of the Sau3A/HaeIII fragment give in Figure 2 . The probe so produced is then used to probe an EcoRI digested genomic library constructed from the MOG-T hybrid cell line under hybridising conditions as previously described.

The present invention thus also provides a method of making probes hybridising to restriction fragments containing a variable number of copies of the repeat sequence HYPERXOX which method comprises the following steps;

- Preparing a polynucleotide probe comprising a marker or label component and at least part of the sequence of Figure 2 sufficient to hybridise specifically to a restriction fragment containing the repeat sequence HYPERXOX.

- Incubating a genomic library containing X chromosomal DNA, prepared by restriction enzyme digestion or other means, under hybridising conditions.

- Identifying plasmids containing hybridised fragments

- Using such isolated plasmids to prepare further probes hybridising to restriction fragments containing HYPERXOX repeat sequences and optionally to isolate further suitable probes as above.

Furthermore, the possible existence of sequences closely related to HYPERXOX in other regions of the human genome and in other organisms could similarly form the basis for the isolation of single copy sequences adjacent to them. Both the hypervariable repeat and the adjacent single copy sequences (within 40kb) will have considerable potential value in the genetic analysis of disease loci, as for example has been demonstrated by us for M27β and retinitis pigmentosa (8). Close proximity of HYPERXOX sequences to disease loci would also provide an approach to their subsequent isolation. Furthermore, the capacity to form multiple cruciform structures as depicted in Figure 9 may predispose the sequences to inter and intra strand recombination. An additional application of the probe or a derivative thereof is in the introduction of sequences linked to the repeating motif into the genome of man and the genomes of other organisms which possess homologous sequences.

The plasmid M27 can form the basis for the production of a reagent containing as its significant elements (1) a gene conferring a selectable phenotype following its introduction into target cells eg neomycin resistance (2) copies of the HYPERXOX sequence flanking the selectable "marker" gene (3) sequences enabling the propagation and selection of the modified plasmid in bacteria. This reagent can be introduced into target cells by the process known as "transfection"; a procedure described in "A Practical Guide to Molecular Cloning" (Perbal, B. 1984 Wiley Interscience pp510-512). Following "transfection", a proportion of donor sequences will be integrated into the recipient genome through recombination. Homologous recombination occurs at low frequency, but may be considerably enhanced through the HYPERXOX sequences. Such a procedure could serve to introduce a selectable marker into the genome at HYPERXOX sites. Further enrichment of the adjacent sequences, including linked genes, could be achieved by the established procedures of chromosome mediated gene transfer (CM6T) and preparation of genomic libraries (see eg. Pritchard, C. and Goodfellow, P.N. 1987 Development 101, Supplement 59-65). Furthermore, the possible enhancement of homologous recombination via HYPERXOX would allow the introduction of other genetic material into the genome of humans and other organisms. In particular, this approach would enable the introduction of a normal gene copy into a recipient with a defective gene (gene therapy) or the addition of a new gene into an experimental organism (gene manipulation).

Example 1.

This hypervariability was investigated further by probing Eco RI digested RNA from a panel of 18 unrelated females. A filter was prepared from 2.5ug samples of each digest and was probed with M27β insert. The filter was washed to a final stringency of 0.1xSSC/0.1% SDS. The results are shown in Figure 3. The degree of hypervariability found was quite marked, with 17 different variants being detected in the 18 females tested. Only two of the females were found to be homozygous at this locus, sugge sting a hete rozgosity of around 90%. The resolution of the gel was not good enough to estimate accurately the precise size differences between the alleles, but they would seem to be due to additions/deletions of a basic repeat unit of length in the order of one to a few hundred bases. Example 2 .

The stability of this multiallelic variation through female meiosis has been analysed by probing ONA from a three generation family. The variants show simple sex linked Mendelian inheritance. Results are shown in Figure 4.

All experimental techniques used were as described in Maniatis et al. Molecular Cloning, A Laboratory Manual published by Cold Spring Harbor Laboratory Press N.Y. (1982).

The hypervariabi 1 ity detected by the probe and the localisation to Xcen-Xp11.3 suggests that the marker will be of considerable value in mapping and in prenatal diagnosis of diseases whose loci map to this region (retinitis pigmentosa and incontentia pigmenti) and in the analysis of other disease loci believed to be pericentrically located including Mehke's syndrome.

Example 3

Investigation of the linkage between M27β and the locus for retinitis pigmentosa. Retinitis pigmentosa (RP) occurs at a frequency in the region of 1-2 in 5,000 of the general population 36-38% of RP patients are isolated cases, the remainder show autosomal dominant, autosomal recessive or X- linked modes of inheritance. The X-linked variety (XLRP) is found in 14-22% of RP families in the U.K.

Linkage studies using the RFLP probe L1.28 show RP has a locus close to Xp 11.3 but this probe provides limited information since net all carriers a re informative; heterozygosity of the two Taq I alleles detected by L1.28 is estimated at ~40%. Since M27β detects such a high degree of polymorphism, with heterozygosity estimated at over 90%, nearly all the individuals in any particular kindred could be informative in this type of analysis and if linkage is established within a family, then detection of suspect carriers and prenatal diagnosis of affected individuals should be possible.

Blood samples from four large German and Yugoslavian families in which retinitis pigmentosa was known to be segregating had become available, therefore it was decided to analyse DNA isolated from these samples with M27β , to see if any of the alieles detected by the probe could be linked to the disease locus. Blood samples were collected from which DNA samples were prepared by standard means.

Pedigrees of the individuals analysed in this study are shown in Figures 5 and 6, along with resultant autoradiographs from EcoRI digests of DNA from these individuals probed with M27β .

PEDIGREE A (Figure 5)

From the pedigree it can be seen that females 57 and 58 are obligate carriers since they are daughters of an affected male. Both have alieles of M.W. 3.4kb and 3.0kb. In both cases the affected sons of these individuals (63 and 59) have inherited the 3.4kb allele, suggesting that in this family the disorder is co-segregating with the 3.4kb allele. Female 56 has been clinically diagnosed as a carrier and has also inherited the 3.4kb allele. Thus, for the purpose of linkage analysis there are 3 informative meioses with no cross-overs detected. Additionally, female 53 also appears to be a carrier. PEDIGREE B (Figure 6)

Female 49 is an obligate carrier, because she has had an affected son and daughters that have had affected sons in subsequent generations. She has alieles of

M.W. 4.8kb and 2.8kb. The affected son, 45, both the carrier daughters, 43 and 46, have 2.8kb allele, suggesting that in this family the disorder is co- segregating with the 2.8kb allele. The affected male 44 has also inherited this allele. In this family 4 informative meioses have been scored with no crossovers detected. In addition, female 42 appears to be a carrier whereas females 47 and 48 do not.

All the families are informative and results are consistent with simple X-linked Mendelian inheritance of the different alieles detected.

Example 4.

Assessment of X inactivation status.

DNA was prepared from blood (B), lymphoblastoid cell lines (L) or somatic cell hybrids (H) by standard methods. 5ug samples were digested with Msp1, or Hpall using restriction buffers supplied by the manufacturer (BRL), electrophoresed and transferred to Hybond N nylon membrane (Amersham Int.). Probe DNA was labelled by nick-translation to a specific activity of 10 dpm/ug and hybridisations and washes carried out to a final stringency of 0.5X SSC at 63°C. Details of Samples Studied

Sample Number/type number of alieles/

X inactivation status

46. XY 2(B) + 5(L) 1 active X

46. XX 3(B) + 1(L) 2 X's/random inactivation

46,Xt(X;8) 1(L) 1 active +

1 inactive X's non random inactivation

46,XdicX 1(L) 1 active +

2 inactive X's non random inactivation

48,XXXX 1(L) 1 active +

3 inactive X's

somatic cell hybrids 4(H) 1 active X

Figure 7 - normal males whose X chromosome is therefore active show a single band with Msp1 digests since Msp1 cleaves irrespective of methylation of the internal cytosine. In Hpall digests the single band is replaced by high molecular weight material. Hpall does not cleave when the internal cytosine is methylated. Normal females show two bands with Msp1 digests. After digestion with Hpall both bands are present but at reduced intensity and accompanied by high molecular weight material. This confirms most females are heterozygous for X in activation. Figure 8 - females with defined patterns of X inactivation show bands present in Msp1 digests that are absent from Hpall digest and high molecular weight material is present. The presence of the other band(s) in both digests provides a good control for the Hpall digestion.

Somatic cell hybrids containing M27β locus on an active X chromosomel give the same pattern as males. These results suggest that the hybridisation patterns revealed by M27β after digestion of genomic DNA with Msp1/HpaII may be applied directly to assess the X-inacti vation status in many situations e.g. imprinting, X-linked disorders in females and clonal analysis during tumor development. The high level of heterozygosity at this locus, and the direct detection of the polymorphisms with the methylation-sensitive enzyme pair Msp1 and Hpall indicate that the simple system described here will usefully supplement those previously published (7).

REFERENCES

1. Grosveld, F.G., et al., Nucleic Acids Res. (1982) Vol. 10, 6175-6733.

2. Boyd, Y. Ann. Hum. Genet. (1987) Vol. 51, 13-26.

3. Bishop, C.E., et al., Nature (1983) Vol. 303, 831-832

4. Goodfellow, P.N., et al., Proc. Natl. Acad. Sci. USA (1982) 79, 1190-1194.

5. Jeffreys A.J. et al., Nature (1985) Vol. 314, 67-73.

6. Nicholls R.D. et al., Nucleic Acids Res (1985) Vol.13, 7569-7578.

7. Vogelsteln, B., Fearon, E.R. Hamilton, S.R. et al. 1987, Cancer Res. 47, 4806-4813.

8. Meitinger et al, 1988 Human Genetics in press.

Claims

C LA I MS

1. A DNA sequence characterised as follows:

- It maps to the X cen- Xp 11.22 region of the human X chromosome by in situ hybridisation.

- It is all or part of the DNA from the X cen- Xp 11.3 region that has the pattern of restriction sites generally as shown in Figure 1.

- It contains a region which comprises a variable number of repeats of a repeat sequence which when X chromosomal human DNA is cut with a restriction enzyme which does not cut within the repeat sequence produces a restriction fragment whose length is variable between one individual and another depending on the number of times the repeat sequence is present.

2 . A DNA probe includi ng a ma rker or label component which comprises DNA sequence of claim 1.

3. A polynucleotide in isolated or cloned or synthesised form having the formula read in t he 5' 3' sense

or a polynucleotide of complementary sequence to the above.

4. A polynucleotide in isolated or cloned form having the formula read in the 5'→ 3' sense

TCCTGGATAGATACTATCCAGGACTC

or a polynucleotide of complementary sequence to the above.

5. A polynucleotide in isolated or cloned form having the formula read 5'→3'

AGATACTATCCAGGACTC

or a polynucleotide of complementary sequence to the above.

6. A polynucleotide probe which comprises a polynucleotide including the sequence of any one of claims 3 to 5 and a label or marker component.

7. A polynucleotide probe including a label or marker component which hybridises to the sequence 5'→ 3'

TCCTGGATAGATACTATCCAGGACTC

or a complementary sequence.

8. A polynucleotide probe including a label or marker component which hybridises to single copy region of a DNA restriction fragment comprising more than 1 repeat of the sequence read 5'→ 3 '

TCCTGGATAGATACTATCCAGGACTC

or a complementary sequence.

9. Method of determining disease status of individuals with disease loci linked with M27 β or other loci including' HYPERXOX sequences which method comprises probing restriction enzyme digested chromosomal DNA with a probe which hybridises to restriction fragments containing a variable number of repeats of the sequence of claim 4, or a complementary sequence, under hybridising conditions and analysing the treated DNA to detect the presence and or size of restriction fragments from said chromosomal DNA compared with DNA from a similarly treated reference.

10. A method of determining the number of X chromosomes in an individuals genome which method comprises probing individuals restriction digested DNA or DNA from tissue samples with a probe which hybridises to restriction fragments containing a variable number of repeats of the sequence of claim A, or a complementary sequence, under hybridising conditions and analysing the treated DNA to determine the number of alieles detected.

11. A method of determining the X inactivation status which method comprises probing a sample of DNA digested with a first restriction enzyme which cleaves DNA irrespective of methylation of nucieotides within its recognition sequence with the production of restriction fragments containing at least one copy of the sequence of claim 4, with a p robe whi c h hy b r i di se s to re s t r i c t i on f r agmen t s c on t aining at leas, one copy of the sequence of claim 4; probing another sample of the DNA digested with a second restriction enzyme which will not cleave DNA wnen its recognition sequence contains methylated nucieotides with the probe and analysing tne presence and or size of the resulting fragments to determine the inactivation status of eacn

X chromosome.

12. A method according to claim 11 wherein the first and second enzymes are Msp1 and Hpall respectively.

13. A DNA sequence comprising a sequence of DNA which may be of any sequence flanked on either side by at least one copy of the sequence of claim 4.

14. A method of introducing a DNA sequence into a genome containing multiple copies of the sequence of claim 4 which method comprises producing a reagent comprising the DNA sequence desired to be inserted flanked on either side by at least one copy of the sequence of claim 4 and introducing the reagent produced into target cells by the process of transfection.

15. A polynucleotide probe including a label or marker component which hybridises to a DNA restriction fragment which fragment includes at least one copy of the sequence read 5' → 3 '

TCCTGGATAGATACTATCCAGGACTC

or a complementary sequence.

16. A method of making probes according to claim 15 which method comprises the following steps:

- Preparing a polynucleotide probe comprising a marker or label component and at least part of the sequence of claim 3 sufficient to hybridise specifically to a restriction fragment containing the repeat sequence HYPERXOX.

- Incubating a genomic liorary containing X chromosomal DNA, prepared by restriction enzyme digestion or otner means, under hybridising conditions. - Identifying plasmids, cosmids or phage containing hybridised fragments.