EP0092574B1 - Oligonucleotide therapeutic agent and methods of making same - Google Patents

Oligonucleotide therapeutic agent and methods of making same Download PDF

Info

Publication number
EP0092574B1
EP0092574B1 EP82903424A EP82903424A EP0092574B1 EP 0092574 B1 EP0092574 B1 EP 0092574B1 EP 82903424 A EP82903424 A EP 82903424A EP 82903424 A EP82903424 A EP 82903424A EP 0092574 B1 EP0092574 B1 EP 0092574B1
Authority
EP
European Patent Office
Prior art keywords
oligonucleotide
mrna
protein
sequence
organism
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Lifetime
Application number
EP82903424A
Other languages
German (de)
French (fr)
Other versions
EP0092574A1 (en
EP0092574A4 (en
Inventor
Richard H. Tullis
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Molecular Biosystems Inc
Original Assignee
Molecular Biosystems Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Family has litigation
First worldwide family litigation filed litigation Critical https://patents.darts-ip.com/?family=23218662&utm_source=google_patent&utm_medium=platform_link&utm_campaign=public_patent_search&patent=EP0092574(B1) "Global patent litigation dataset” by Darts-ip is licensed under a Creative Commons Attribution 4.0 International License.
Application filed by Molecular Biosystems Inc filed Critical Molecular Biosystems Inc
Priority to AT82903424T priority Critical patent/ATE75483T1/en
Publication of EP0092574A1 publication Critical patent/EP0092574A1/en
Publication of EP0092574A4 publication Critical patent/EP0092574A4/en
Application granted granted Critical
Publication of EP0092574B1 publication Critical patent/EP0092574B1/en
Anticipated expiration legal-status Critical
Expired - Lifetime legal-status Critical Current

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1131Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against viruses
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7135Compounds containing heavy metals
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07HSUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
    • C07H21/00Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1136Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against growth factors, growth regulators, cytokines, lymphokines or hormones
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/32Chemical structure of the sugar
    • C12N2310/3212'-O-R Modification

Definitions

  • This invention relates to a therapeutic agent for selectively blocking the translation of mRNA into a targeted protein by utilizing hybridization techniques of the type having messenger ribonucleic acid attached to oligonucleotides for in vivo protein synthesis regulation.
  • therapeutic agents In the field of pharmacology, the use of therapeutic agents has long been recognized as an effective way to control diseases. Such agents are often used in treating bacterial or viral infection, chemical imbalances and the like, to cure, or at least mitigate, the diseased state. Although researchers occasionally discover new therapeutic agents after major breakthroughs have elucidated the molecular basis of a disease, more often they must rely on observing for antibiosis or modifying the chemical structures of functionally related chemicals.
  • a corresponding tridecamer is described in PNAS USA vol. 75, No. 1 (1978), pages 285 to 288.
  • the document refers to the ability of the tridecamer to prime virus RNA and to inhibit protein synthesis from the virion RNA. It is speculated that the inhibition might be due to hybridization of the tridecamer near potential initiation sites for viral protein synthesis.
  • modified nucleosides or nucleotides as antimetabolic agents for inhibiting the nucleic acid metabolism and particularly the synthesis of virus induced cDNA.
  • the modified nucleosides or nucleotides are competing with their unmodified analogues for specific binding sites and positions within complex structures thereby blocking the physiological functions of the resulting products. It is further considered that the compounds may have immunological effect since DNA synthesis inhibitors are effective in suppressing the proliferation of sensitized lymphocytes and cell-mediated immunity.
  • oligonucleotides on the basis of the observation that antibody stimulation occurred with a gross mixture of DNA digest, the optimal size of the oligomers being indicated as tri- to hexanucleotides. It is speculated that the modified oligonucleotides would compete with their naturally occurring analogues for the protein binding sites, thereby blocking antibody production particularly in auto-immune diseases.
  • the present invention provides a methodology of identifying and constructing therapeutic agents for use in living organisms that substantially reduces the uncertainty surrounding the development of new antagonists, significantly increasing the scope of materia medica .
  • the agent construction of the present invention lends itself readily to simple manufacture, even in large quantities, is extremely effective in use, and attains its improved results without undue cross-reactions.
  • a stabilized oligonucleotide preferably in a phosphotriester form, having a base sequence substantially complementary to a portion of messenger ribonucleic acid coding for a biological component of an organism. Due to the complementary nature of the oligonucleotide and the messenger ribonucleic acid, the two components can readily hybridize under appropriate conditions to control synthesis of the organism's biological component and, if the protein is vital to the organism's viability, to act as an antibiotic.
  • a method, in accordance with the present invention, of developing therapeutic agents may typically include the steps of: providing a base sequence of an organism's nucleic acid that contains at least a portion of the genetic information for a biological component of the organism, and synthesizing an oligonucleotide the sequence of which is derived from the base sequence, for subsequent hybridization with the messenger ribonucleic acid specific for the biological component.
  • the biological component may be a vital protein, or simply a hormone such as the gonadotropin, follicle stimulating hormone.
  • the order of the base sequence may be determined from deoxyribonucleic acid (DNA) or ribonucleic acid (RNA), preferably messenger ribonucleic acid (mRNA).
  • the desired oligonucleotide base sequence may be determined from the biological component's sequence, as when the biological component is a protein.
  • the oligonucleotide of the invention has fourteen to twenty-three bases, and for increased stability, is transformed to a more stable form, such as a phosphotriester form, to inhibit degradation during use.
  • the oligonucleotide may be synthesized chemically, such as in automated machines, or inserted into a plasmid, such as pBR322, for cloning.
  • the plasmid insertion may be accomplished with linker base sequences, such as GATTCGAATC or CTAAGCTTAG, which are susceptible to degradation by Hind III restrictive nuclease or Alu I restriction nuclease.
  • linker base sequences such as GATTCGAATC or CTAAGCTTAG, which are susceptible to degradation by Hind III restrictive nuclease or Alu I restriction nuclease.
  • Another aspect of the present invention is a method of selectively controlling activity of one or more biological components in a cell without substantially interfering with the activity of other biological components in the cell.
  • the method includes the steps of forming an oligonucleotide having a base sequence substantially complementary to a portion of mRNA coding for the specific biological component, and introducing the oligonucleotide into the cell for hybridization with the selected mRNA. This causes blocking of the translation of the mRNA into protein.
  • the oligonucleotide has fourteen to twenty-three bases.
  • the target mRNA can code for a protein, such as the hormone, follicle stimulating hormone.
  • This hormone has an alpha and beta chain, and the oligonucleotide should be specific for the mRNA coding for the beta chain to avoid cross-reacting with other gonadatropin mRNA.
  • a suitable oligonucleotide base sequence would be ACCACGCGR1CCR2ATGACGATGTG, wherein R1 is G or T and R2 is also G or T.
  • a method for inhibiting the infection of a host organism by a foreign organism.
  • This method entails isolating a base sequence containing at least a portion of the genetic information coding for a vital protein from the foreign organism's nucleic acid; synthesizing an oligonucleotide, the order of which is derived from the base sequence and substantially complementary to the messenger ribonucleic acid coding for the protein; and treating the foreign organism with an effective amount of the oligonucleotide to hybridize with a portion of the messenger ribonucleic acid and block translation of the protein.
  • the oligonucleotide which can be a deoxyribonucleotide, is transformed to a more stable form, such as a phosphotriester form, to inhibit degradation, and the order of the sequence determined prior to its synthesis. Further, to increase the oligonucleotide's specificity, it may be cross-hybridized against mRNA from different organisms, such as the host organism, to remove non-unique oligonucleotide sequences.
  • DNA deoxyribonucleic acid
  • FIGS. 1 and 2 there is shown the so-called "central dogma” of the molecular biology of life.
  • the code exists in the form of an organized sequence of four nucleotide bases attached to a phosphorylated, deoxyribose sugar backbone.
  • DNA exists in the form of a double strand helix formed of two oppositely directed strands, which are held together in an opposing manner by various weak forces.
  • a primary constituent of these weak forces are the so-called hydrogen bonds that exist between nuclectides on the opposing strands.
  • mRNA messenger ribonucleic acid
  • mRNA messenger ribonucleic acid
  • U uracil
  • each three nucleotide base grouping codes for one amino acid of a protein. Therefore, by knowing the mRNA sequence of a protein, its amino acid sequence can generally be determined. However, the reverse is not true, that is, knowing the amino acid sequence does not guarantee precise knowledge of the mRNA sequence. This stems from the fact that there exist 64 (43) possible triplet codes, yet there exists only about twenty amino acids, allowing some amino acids to have multiple triplet codes.
  • a synthetic oligonucleotide having a base sequence of 14 to 23 bases capable of substantially matching that of a chosen mRNA is provided for hydridization with that mRNA.
  • the translation of the mRNA into protein becomes significantly inhibited. If the inhibited protein is vital to an organism's survival, the organism's viability, i.e., either growth or continued life, is jeopardized.
  • the oligonucleotide can be designed specifically for the mRNA coding for just one protein, and should not cross-react with mRNA for other proteins.
  • the method of developing the oligonucleotide entails basically two steps. As described more fully below, a possible first step is to determine the appropriate sequence of the mRNA specific for the protein to be inhibited, and a second step is to manufacture an oligonucleotide complementary to the mRNA. Once made, the oligonucleotide is treated into e.g. a phosphotriester form for increased stability.
  • nucleic acid base sequences A variety of techniques exists for determining nucleic acid base sequences. In many instances the sequence of the mRNA or the gene have been determined and published in the biochemical literature. In fact, researchers have determined the complete nucleotide sequence for the SV-40 virus (Reddy et al, Science 200 :494 (1978)). As is well known, an alternative method entails isolating and purifying mRNA in sufficient quantities to permit sequencing studies, but this can prove difficult due to the relative instability and, in some cases, extreme rarity of many mRNA sequences.
  • Still another method for determining nucleic acid base sequences requires resolving the amino acid sequence from the target protein. After determining the amino acid sequence of the target protein in purified form, a sequential degradation utilizing commercially available protein sequences (e.g. from Beckman Instruments, Fullerton, California) can be used to provide the amino acid sequence. Once this has been obtained, knowledge of the triplet code can be applied to give prospective base sequences.
  • a sequential degradation utilizing commercially available protein sequences (e.g. from Beckman Instruments, Fullerton, California) can be used to provide the amino acid sequence.
  • knowledge of the triplet code can be applied to give prospective base sequences.
  • An example of such a process for the hormone glucagon can be found in Tullis et al, Biochemical and Biophysical Research Communications 93 :941 (1980).
  • an oligonucleotide such as deoxyribonucleotide, complementary to the mRNA can be constructed.
  • a number of synthetic techniques are known, most typical is the diester approach described by Agarwal et al, Nature 227: 27 (1970), and oligonucleotide synthesizers may be purchased commercially from Vega Biochemicals, P.O. Box 11648, Arlington, Arizona and Biologicals, Inc., Toronto, Canada.
  • a suitable oligonucleotide can be prepared as follows. After isolating mRNA from a target organism, multiple copies are made, preferably in the form of DNA, so-called copy DNA (cDNA). This cDNA is then cross-hybridized against mRNA isolated from other organisms, and any cDNA hybridizing is removed. The remaining cDNA is specific only to the target organism, and can serve as the therapeutic agent.
  • cDNA copy DNA
  • an oligomer of 14 to 23 bases is constructed. Although shorter sequences would work, these sequences provide higher specificity. This can readily be seen mathematically. Whereas a ten unit polymer chosen from four bases can have 410 (1,048,576) random combinations, a 20-unit polymer has 420 random combinations, which equals 1.09 x 1012 (1,090,000,000, 000).
  • oligonucleotides of twenty units in comparison to ten bases it is warranted because the exponential increase in complexity reduces undesirable cross-reactivity. It has been estimated that a mammalian cell contains about 2x108 nucleotides of RNA complexity or, in other words, approximately 200 million nucleotides of unique sequence mRNA, which is equivalent to about 30,000 mRNA sequences. The probability that one of those sequences contains a randomly chosen 20-unit polymer is approximately one in fifty-five hundred. In comparison, a ten-unit polymer has about a one hundred and ninety to one chance for random cross-reaction.
  • SV-40 virus manufactures a vital protein commonly known as the "T protein” or "T antigen protein".
  • T protein or "T antigen protein”.
  • the complete genetic code for the SV-40 virus has been determined, and it is known that residues 5091 to 5071 on the viral genome code for a portion of the T protein mRNA.
  • the sequence of these residues, the viral T protein mRNA sequence, and the designed T protein specific oligonucleotide are shown in Fig. 3.
  • the T protein specific oligonucleotide is complementary to the viral T protein mRNA, and identical to the portion of the viral DNA code.
  • the oligonucleotide Prior to testing the effectiveness of the T protein specific oligonucleotide in vivo , the oligonucleotide can be mixed with total mRNA from an organism to check for cross-reactivity. If it hybridizes, then a different portion of the viral genome coding for the T protein should be utilized. Otherwise, the oligonucleotide is ready for further testing.
  • S-40 virus is grown and titered in African green monkey cells, such as the cell line BSC-1, according to Hopps et al, Journal of Immunology 91 :416 (1963). The identity of the virus can be confirmed by the following methods:
  • RNA isolation of SV-40 mRNA can be accomplished as follows. Total RNA is first obtained by the guanidine hydrochloric acid extraction procedure using glassware previously baked and treated with diethylpyrocarbonate to remove traces of RNase as taught by Cox et al, Methods in Enzymology 12B :120 (1968). The A+ RNA is isolated on oligo-dTcellulose, which can be obtained from Collaborative Research, Waltham, Massachusetts, or P. L. Biochemicals, Inc., Milwaukee, Wisconsin, utilizing the technique described by Bantle et al, Analytical Biochemistry 72 :413 (1976).
  • RNA fractions are assayed for purity and intactness by electropheresis according to the method described in Bailey et al, Analytical Biochemistry 70 :75 (1976). Also, the RNA can be assayed for translatability in the wheat embryo in vitro system described in Marcus, et al, Methods in Enzymology: 30 :749 (1974). The in vitro translation products are monitored on sodium lauryl sulphate 9% polyacrylamide gels as described in Laemmeli, Nature 227 :680 (1970).
  • This purified A+ mRNA containing the viral mRNA sequences can hybridize to the synthetic oligonucleotide at 37 o C in 0.5 M sodium phosphate buffer, pH 6.8, containing 0.2% sodium lauryl sulphate. Solutions containing about 1 mg A+ mRNA and synthetic oligonucleotide at a concentration of about 100 ug/ml are heated to 100 o C for 1-2 minutes, then cooled to 37 o C and allowed to anneal. The extent of the hybridization reaction as a function of time may be monitored on a gel filtration column.
  • temperatures ranging from 0 o C to about 80 o C provide for good hybridization, but preferred temperatures range from about 10 o C to about 40 o C.
  • the optimal annealing temperature for the formation of specific hybrids is believed to be about 20 o C to 25 o C below their melting temperature.
  • Synthetic oligonucleotides operating at 37.5 o C should thus be designed on the basis of their base sequence and length, such that the melting temperature is between about 57 o C and 62 o C when tested under approximately physiological conditions.
  • the ratio of the synthetic oligonucleotide to its mRNA complement is generally about 30:1. Lower ratios are acceptable, however, sequences below about 3:1 can cause lower hybrid formation. Control reactions utilizing yeast RNA or globin mRNA can be used, and should show no detectable hybrids, indicating hybridization specificity only to SV-40 mRNA. Also, thermal denaturation profile studies and comparison of the kinetics of hybridization can confirm that the synthetic oligonucleotide reacts only with SV-40 mRNA sequences.
  • oligonucleotide hybridizes to the isolated SV-40 mRNA
  • in vitro translation tests can be attempted utilizing the wheat embryo system (described previously) to show that the hybrid is not translated.
  • the system upon introduction of SV-40 mRNA into the wheat embryo system, the system produces large T antigen protein.
  • T antigen protein synthesis can be substantially inhibited, without interference with synthesis of other SV-40 proteins whose mRNA was also introduced.
  • Testing of the oligonucleotide in vivo can be accomplished-by adding the oligonucleotide to cultures of cells infected with SV-40. Synthesis of T antigen protein should be inhibited significantly in about six hours, and SV-40 growth should be strongly inhibited within about 24 hours. The growth of control cultures should be largely unaffected.
  • the synthetic oligonucleotide of the present invention may be mass produced according to common cloning techniques, such as those developed in the art to clone the gene for proinsulin.
  • the oligonucleotide can be chemically synthesized in commercially available equipment (described previously).
  • the cloning method entails enzymatic insertion of the oligonucleotide into a bacterial gene carried on a larger piece of DNA, known as a plasmid.
  • the plasmid can be incorporated into a suitable host bacteria, and multiple copies made as the bacteria multiply as in Boyer and Cohen, U. S. Patent No. 4,237,224.
  • the cloning plasmid designated as pBR322 can be used to mass produce the T protein specific oligonucleotide. Using standard techniques, the oligonucleotide is converted to double stranded form and then a terminal 5'PO4 is added to each of the 5' termini with polynucleotide kinase to permit subsequent joining through T-4 ligase.
  • the reaction conditions for forming the 5' termini can be found in Richardson, Progress in Nucleic Acids Research 2 :815 (1972).
  • oligonucleotide After purification of the double stranded oligonucleotide by chromatography on hydroxylapatite columns, it is inserted into the plasmid. Because the oligonucleotide is blunt ended, the plasmid should not have uneven or "sticky" ends. To remove sticky ends from the plasmid, S1 nuclease or other single strand specific nucleases can be utilized. A general description of methods for using restriction nucleases can be found in Nathans and Smith, Annual Review of Biochemistry 44 : 273 (1975).
  • a linker system between the oligonucleotide and the plasmid can be utilized, specifically a linker having both Hind III and Alu I enzymatic cleaving sites.
  • one such linker has a sequence: 5'... CTAAGCTTAG...3'. This sequence represents a double stranded, bisymmetric molecule containing a recognition sequence both for Alu I (AGCT) and for Hind III (AAGCTT).
  • AGCT Alu I
  • AAGCTT Hind III
  • this molecule can be ligated to the oligonucleotide to form linker-oligonucleotide-linker molecules.
  • the linked oligonucleotide can be introduced into linearized blunt-ended, Hind III cleaved pBR322 carrier molecules.
  • the plasmid After ligation, the plasmid has resumed its covalently closed circular configuration with the linker-oligonucleotide incorporated, all of which is shown in FIG. 5 as pT-protein oligonucleotide.
  • the recircularized plasmid is then used to transform a suitable bacterial host such as E. coli.
  • suitable bacterial host such as E. coli.
  • the methods for transformation and selection of transformants are known in the art and described in detail in Cohen and Boyer, U.S. Patent No. 4,237,224.
  • the oligonucleotide is ready for purification.
  • the plasmid is treated with appropriate restriction endonucleases. As illustrated in FIG. 5, the plasmid is first cleaved with Hind III to give various by-products, including linker-T-protein-oligonucleotide-linker and fragments of the original plasmid. These are readily separated utilizing gel electrophoresis or high pressure liquid chromatography.
  • the oligonucleotide can then be modified to a nuclease resistant phosphotriester form utilizing the reaction described in Miller et al, Biochemistry 16 :1988 (1977).
  • the oligonucleotide is first acylated using 50% acetic anhydride-pyridine during an overnight incubation period. The product is precipitated and isolated from ether.
  • the phosphotriester can then be formed utilizing 30% ethanol in anydrous 2, 6 lutidine (30%), NN-dimethyl formamide (30%) and p-toluene sulfonyl chloride (17%), and reacting for about 6 hours.
  • the protecting acetyl groups are then hydrolyzed by the addition of 0.5 volumes of concentrated ammonium hydroxide, followed by incubation for about 1 hour at 55 o C,
  • the final oligonucleotide product in the ethyl phosphotriester form can then be isolated on paper chromatography or high pressure liquid chromatography.
  • transforming the oligonucleotide to a phosphotriester form will improve the oligonucleotide's stability in vivo due to an enhanced resistance against various degradative enzymes.
  • the oligonucleotide will eventually degrade because of spontaneous de-ethylation, which leaves the molecule unprotected. Indeed, by controlling the initial level of ethylation, the in vivo degradation rate can be controlled.
  • a further advantage of a phosphotriester form is believed to be an increase in the oligonucleotide's ability to penetrate a cell membrane.
  • a synthetic oligonucleotide capable of inhibiting the synthesis of follicle stimulating hormone (FSH), a protein hormone produced by the pituitary that functions in the maturation of ova in females and sperm cells in males, can also be constructed.
  • FSH follicle stimulating hormone
  • alpha chain of FSH is common to other gonadotropic hormones, including thyroid stimulating hormone, luteinizing hormone, and chorionic gonadotropin, while the beta chain varies. Therefore, to selectively shut off the synthesis of FSH without substantially affecting the other gonadotropins, the oligonucleotide must be specific for the mRNA coding for the beta chain.
  • the sequence of the beta chain amino acids 32 through 40 is shown in FIG. 7. As discussed earlier, it is possible to predict the mRNA base sequence for these amino acids, although not with absolute certainty. The points of uncertainty are indicated by the letter "X" in the predicted mRNA sequence. Thus, the resultant oligonucleotide family consists of eight possible 26 base sequences; the potential alternate bases are shown in parentheses below the primary base sequence.
  • One of these four sequences should be precisely correct and thus able to hybridize fully with the FSH mRNA.
  • a hybridization test against FSH mRNA with subsequent purification on hydroxylapatite or other suitable column, can be performed as previously described.
  • the present invention provides a systematic method of designing new therapeutic agents for use in living organisms and that this method is versatile and inexpensive. Further, the oligonucleotide produced in accordance with the present invention is extremely effective and specific, enabling selective control of protein synthesis in a living organism.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Organic Chemistry (AREA)
  • Biotechnology (AREA)
  • General Health & Medical Sciences (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Medicinal Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Veterinary Medicine (AREA)
  • Plant Pathology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Microbiology (AREA)
  • Epidemiology (AREA)
  • Virology (AREA)
  • Endocrinology (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Saccharide Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

For use in controlling biologic functions in an organism, a stabilized oligonucleotide, preferably in a phosphotriester form, having a base sequence substantially complementary to a portion of messenger ribonucleic acid coding for a biological component, such as a protein, of the organism. The oligonucleotide has about fourteen bases or more, such as twenty-three bases, and can be a deoxyribo-nucleotide. The oligonucleotide sequence can be derived from the organism's ribonucleic or deoxyribonucleic acid that codes for a vital protein, and can be synthesized in bulk either chemically or by insertion into a plasmid.

Description

  • This invention relates to a therapeutic agent for selectively blocking the translation of mRNA into a targeted protein by utilizing hybridization techniques of the type having messenger ribonucleic acid attached to oligonucleotides for in vivo protein synthesis regulation.
  • In the field of pharmacology, the use of therapeutic agents has long been recognized as an effective way to control diseases. Such agents are often used in treating bacterial or viral infection, chemical imbalances and the like, to cure, or at least mitigate, the diseased state. Although researchers occasionally discover new therapeutic agents after major breakthroughs have elucidated the molecular basis of a disease, more often they must rely on observing for antibiosis or modifying the chemical structures of functionally related chemicals.
  • With respect to antibiotic agents, some are quite effective at the outset, but over time many organisms become resistant or totally immune to their action. Additionally, very few effective anti-viral agents have ever been developed, and without explicit, detailed knowledge of an infecting organism's physiology, the development of new operative agents remains haphazard.
  • In PNAS USA vol. 75, No. 1 (1978), pages 280 to 284 a particular tridecamer complementary to 13 nucleotides of the 3' and 5' reiterated terminal sequence of Rous Sarcoma virus 35 RNA is described. The tridecamer is observed to inhibit the virus production in chick embryo fibroblast tissue cultures. It is contemplated that the tridecamer might hybridize with the repetitive terminal sequence of the RNA and might interfere with the circularization step of the pro-virus DNA.
  • A corresponding tridecamer is described in PNAS USA vol. 75, No. 1 (1978), pages 285 to 288. The document refers to the ability of the tridecamer to prime virus RNA and to inhibit protein synthesis from the virion RNA. It is speculated that the inhibition might be due to hybridization of the tridecamer near potential initiation sites for viral protein synthesis.
  • In PNAS USA vol. 75, No. 3 (1978), pages 1271 to 1221 and PNAS USA vol. 74, No. 10, (1977), pages 4370 to 4374 in vitro methods of structural gene identification and mapping by DNA-mRNA hybrid-arrested cell-free translation are described. In the method DNA fragments of 500 to 1000 bases in length were hybridized with mRNA coding for known proteins at a temperature of 65°C for 20 min. or 48°C for 2 hr. It was found that translation of the hybridized regions of mRNA was reversably blocked at these conditions.
  • Angewandte Chemie International Edition, vol. 9 (1970), No. 9, pages 678 to 688 describes the use of modified nucleosides or nucleotides as antimetabolic agents for inhibiting the nucleic acid metabolism and particularly the synthesis of virus induced cDNA. The modified nucleosides or nucleotides are competing with their unmodified analogues for specific binding sites and positions within complex structures thereby blocking the physiological functions of the resulting products. It is further considered that the compounds may have immunological effect since DNA synthesis inhibitors are effective in suppressing the proliferation of sensitized lymphocytes and cell-mediated immunity. In this context reference is also made to oligonucleotides on the basis of the observation that antibody stimulation occurred with a gross mixture of DNA digest, the optimal size of the oligomers being indicated as tri- to hexanucleotides. It is speculated that the modified oligonucleotides would compete with their naturally occurring analogues for the protein binding sites, thereby blocking antibody production particularly in auto-immune diseases.
  • Finally, in Biochemistry, vol. 16, No. 9 (1977), pages 1988 to 1996 the preparation of a particular modified trinucleotide is described, which is complementary to a three base sequence common to the aminoacid accepting stem of most tRNAs. The document reports in vitro experiments, showing that the triplet is bound to tRNAs and inhibits amino acylation at a rate of 39% at 37°C. It was further shown that the triplet passes into the cells in vivo unspecificially reducing peptide synthesis for an interval of about 24 hours.
  • No therapeutic agent has up to now been described in the prior art, by means of which it would be possible to selectively block the translation of mRNA into a particular, targeted protein without effecting the synthesis of other proteins.
  • Thus, there exists a definite need for a therapeutic agent that is versatile and inexpensive and yet both extremely specific and effective. The present invention fulfils these needs.
  • SUMMARY OF THE INVENTION
  • The present invention provides a methodology of identifying and constructing therapeutic agents for use in living organisms that substantially reduces the uncertainty surrounding the development of new antagonists, significantly increasing the scope of materia medica. Moreover, the agent construction of the present invention lends itself readily to simple manufacture, even in large quantities, is extremely effective in use, and attains its improved results without undue cross-reactions.
  • According to the invention a stabilized oligonucleotide, preferably in a phosphotriester form, is provided having a base sequence substantially complementary to a portion of messenger ribonucleic acid coding for a biological component of an organism. Due to the complementary nature of the oligonucleotide and the messenger ribonucleic acid, the two components can readily hybridize under appropriate conditions to control synthesis of the organism's biological component and, if the protein is vital to the organism's viability, to act as an antibiotic.
  • A method, in accordance with the present invention, of developing therapeutic agents may typically include the steps of: providing a base sequence of an organism's nucleic acid that contains at least a portion of the genetic information for a biological component of the organism, and synthesizing an oligonucleotide the sequence of which is derived from the base sequence, for subsequent hybridization with the messenger ribonucleic acid specific for the biological component. The biological component may be a vital protein, or simply a hormone such as the gonadotropin, follicle stimulating hormone. The order of the base sequence may be determined from deoxyribonucleic acid (DNA) or ribonucleic acid (RNA), preferably messenger ribonucleic acid (mRNA). Alternatively, the desired oligonucleotide base sequence may be determined from the biological component's sequence, as when the biological component is a protein. The oligonucleotide of the invention has fourteen to twenty-three bases, and for increased stability, is transformed to a more stable form, such as a phosphotriester form, to inhibit degradation during use.
  • To produce large quantities of the oligonucleotide, it may be synthesized chemically, such as in automated machines, or inserted into a plasmid, such as pBR322, for cloning. The plasmid insertion may be accomplished with linker base sequences, such as GATTCGAATC or CTAAGCTTAG, which are susceptible to degradation by Hind III restrictive nuclease or Alu I restriction nuclease. When the order of the base sequence has not been determined, the base sequence can be cloned and then cross-hybridized against messenger ribonucleic acid from the other sources to remove base sequences non-specific to the target.
  • Another aspect of the present invention is a method of selectively controlling activity of one or more biological components in a cell without substantially interfering with the activity of other biological components in the cell. The method includes the steps of forming an oligonucleotide having a base sequence substantially complementary to a portion of mRNA coding for the specific biological component, and introducing the oligonucleotide into the cell for hybridization with the selected mRNA. This causes blocking of the translation of the mRNA into protein. The oligonucleotide has fourteen to twenty-three bases. The target mRNA can code for a protein, such as the hormone, follicle stimulating hormone. This hormone has an alpha and beta chain, and the oligonucleotide should be specific for the mRNA coding for the beta chain to avoid cross-reacting with other gonadatropin mRNA. A suitable oligonucleotide base sequence would be ACCACGCGR₁CCR₂ATGACGATGTG, wherein R₁ is G or T and R₂ is also G or T.
  • In accordance with another aspect of the present invention, a method is provided for inhibiting the infection of a host organism by a foreign organism. This method entails isolating a base sequence containing at least a portion of the genetic information coding for a vital protein from the foreign organism's nucleic acid; synthesizing an oligonucleotide, the order of which is derived from the base sequence and substantially complementary to the messenger ribonucleic acid coding for the protein; and treating the foreign organism with an effective amount of the oligonucleotide to hybridize with a portion of the messenger ribonucleic acid and block translation of the protein. The oligonucleotide, which can be a deoxyribonucleotide, is transformed to a more stable form, such as a phosphotriester form, to inhibit degradation, and the order of the sequence determined prior to its synthesis. Further, to increase the oligonucleotide's specificity, it may be cross-hybridized against mRNA from different organisms, such as the host organism, to remove non-unique oligonucleotide sequences.
  • It will be appreciated from the foregoing that the present invention satisfies a long existing need for improved methods of developing therapeutic agents for use in living organisms, and represents a significant advance over previously available methods, principally because it is very versatile, and yet provides a very specific agent against a biological component. Other aspects and advantages of the invention will become apparent from the following more detailed description taken in conjunction with the accompanying drawings.
  • BRIEF DESCRIPTION OF THE DRAWINGS
    • FIG. 1 is a flow diagram showing the central dogma of molecular biology;
    • FIG. 2 is a flow diagram showing normal translation of messenger ribonucleic acid (mRNA) into T protein, as well as a synthetic oligonucleotide of the present invention blocking translation of the T protein;
    • FIG.3 is a list of the viral deoxyribonucleic acid (DNA) code specific for SV-40 T protein, and the related mRNA and oligonucleotide;
    • FIG.4 is a flow diagram showing the construction of high yield plasmids containing the T protein oligonucleotide;
    • FIG.5 is a flow diagram showing the use of restriction nucleases to cleave the plasmids to give a purified T protein oligonucleotide;
    • FIG. 6 is a flow diagram showing the treatment of a DNA sequence to form DNA polyphosphotriesters; and
    • FIG. 7 is a chart showing the partial amino acid sequence of follicle stimulating hormone, as well as the predicted mRNA sequence and related oligonucleotide family.
    DETAILED DESCRIPTION OF THE INVENTION
  • Referring now to the drawings, and particularly to FIGS. 1 and 2, there is shown the so-called "central dogma" of the molecular biology of life. Basically, it is now accepted that deoxyribonucleic acid (DNA) carries the genetic code for almost all living organisms. The code exists in the form of an organized sequence of four nucleotide bases attached to a phosphorylated, deoxyribose sugar backbone. Generally, DNA exists in the form of a double strand helix formed of two oppositely directed strands, which are held together in an opposing manner by various weak forces.
  • A primary constituent of these weak forces are the so-called hydrogen bonds that exist between nuclectides on the opposing strands. The four bases, adenine (A), cytosine (C), guanine (G), and thymine (T), form hydrogen bonds generally in only one fashion: A with T and C with G. Thus, by knowing the sequence of one strand, the sequence of the second strand can be readily determined.
  • Another aspect of the central dogma is that proteins are produced indirectly from the DNA strand, through messenger ribonucleic acid (mRNA). Apparently, mRNA, which has the same structure as single stranded DNA except with a ribose backbone and with uracil (U) replacing thymine, is transcribed directly from one DNA strand and has an essentially opposite base sequence, i.e., if a DNA strand sequence is 5 ...ACGT...3' the transcribed mRNA sequence is 3'...UGCA...5'.
  • An additional aspect of the central dogma relates to the translation of mRNA into proteins. Briefly, excluding initiation sites and the like, each three nucleotide base grouping (triplet code) codes for one amino acid of a protein. Therefore, by knowing the mRNA sequence of a protein, its amino acid sequence can generally be determined. However, the reverse is not true, that is, knowing the amino acid sequence does not guarantee precise knowledge of the mRNA sequence. This stems from the fact that there exist 64 (4³) possible triplet codes, yet there exists only about twenty amino acids, allowing some amino acids to have multiple triplet codes.
  • The similarity in the structure of DNA and mRNA strands creates interesting effects. Most notably, if complementary DNA and RNA strands exist contemporaneously in a solution, under certain established conditions the strands can anneal, forming hybrids. One important factor in proper annealing is the melting temperature, which can be calculated according to Britten et al, Methods of Enzymology 29:363 (1974).
  • In accordance with the present invention, a synthetic oligonucleotide having a base sequence of 14 to 23 bases capable of substantially matching that of a chosen mRNA is provided for hydridization with that mRNA. Once such a hybrid exists, the translation of the mRNA into protein becomes significantly inhibited. If the inhibited protein is vital to an organism's survival, the organism's viability, i.e., either growth or continued life, is jeopardized. Importantly, the oligonucleotide can be designed specifically for the mRNA coding for just one protein, and should not cross-react with mRNA for other proteins.
  • The method of developing the oligonucleotide entails basically two steps. As described more fully below, a possible first step is to determine the appropriate sequence of the mRNA specific for the protein to be inhibited, and a second step is to manufacture an oligonucleotide complementary to the mRNA. Once made, the oligonucleotide is treated into e.g. a phosphotriester form for increased stability.
  • A variety of techniques exists for determining nucleic acid base sequences. In many instances the sequence of the mRNA or the gene have been determined and published in the biochemical literature. In fact, researchers have determined the complete nucleotide sequence for the SV-40 virus (Reddy et al, Science 200:494 (1978)). As is well known, an alternative method entails isolating and purifying mRNA in sufficient quantities to permit sequencing studies, but this can prove difficult due to the relative instability and, in some cases, extreme rarity of many mRNA sequences.
  • Still another method for determining nucleic acid base sequences requires resolving the amino acid sequence from the target protein. After determining the amino acid sequence of the target protein in purified form, a sequential degradation utilizing commercially available protein sequences (e.g. from Beckman Instruments, Fullerton, California) can be used to provide the amino acid sequence. Once this has been obtained, knowledge of the triplet code can be applied to give prospective base sequences. An example of such a process for the hormone glucagon can be found in Tullis et al, Biochemical and Biophysical Research Communications 93:941 (1980).
  • Once the sequence of the appropriate nucleic acid and the desired mRNA sequence have been determined, an oligonucleotide, such as deoxyribonucleotide, complementary to the mRNA can be constructed. A number of synthetic techniques are known, most typical is the diester approach described by Agarwal et al, Nature 227: 27 (1970), and oligonucleotide synthesizers may be purchased commercially from Vega Biochemicals, P.O. Box 11648, Tucson, Arizona and Biologicals, Inc., Toronto, Canada.
  • If the desired oligonucleotide sequence is unknown, a suitable oligonucleotide can be prepared as follows. After isolating mRNA from a target organism, multiple copies are made, preferably in the form of DNA, so-called copy DNA (cDNA). This cDNA is then cross-hybridized against mRNA isolated from other organisms, and any cDNA hybridizing is removed. The remaining cDNA is specific only to the target organism, and can serve as the therapeutic agent.
  • In order to obtain a high degree of specificity, an oligomer of 14 to 23 bases is constructed. Although shorter sequences would work, these sequences provide higher specificity. This can readily be seen mathematically. Whereas a ten unit polymer chosen from four bases can have 4¹⁰ (1,048,576) random combinations, a 20-unit polymer has 4²⁰ random combinations, which equals 1.09 x 10¹² (1,090,000,000, 000).
  • In spite of the added difficulty in making oligonucleotides of twenty units in comparison to ten bases, it is warranted because the exponential increase in complexity reduces undesirable cross-reactivity. It has been estimated that a mammalian cell contains about 2x10⁸ nucleotides of RNA complexity or, in other words, approximately 200 million nucleotides of unique sequence mRNA, which is equivalent to about 30,000 mRNA sequences. The probability that one of those sequences contains a randomly chosen 20-unit polymer is approximately one in fifty-five hundred. In comparison, a ten-unit polymer has about a one hundred and ninety to one chance for random cross-reaction.
  • The present invention is illustrated by, but not limited to, the following examples.
  • EXAMPLE I
  • SV-40 virus manufactures a vital protein commonly known as the "T protein" or "T antigen protein". As noted earlier, the complete genetic code for the SV-40 virus has been determined, and it is known that residues 5091 to 5071 on the viral genome code for a portion of the T protein mRNA. The sequence of these residues, the viral T protein mRNA sequence, and the designed T protein specific oligonucleotide are shown in Fig. 3. In this case, the T protein specific oligonucleotide is complementary to the viral T protein mRNA, and identical to the portion of the viral DNA code.
  • Prior to testing the effectiveness of the T protein specific oligonucleotide in vivo, the oligonucleotide can be mixed with total mRNA from an organism to check for cross-reactivity. If it hybridizes, then a different portion of the viral genome coding for the T protein should be utilized. Otherwise, the oligonucleotide is ready for further testing.
  • Further testing requires growth of S-40 virus. For purposes of these experiments, SV-40 virus is grown and titered in African green monkey cells, such as the cell line BSC-1, according to Hopps et al, Journal of Immunology 91:416 (1963). The identity of the virus can be confirmed by the following methods:
    • a) checking for tumor production after innoculation of the newborn hamsters with the virus;
    • b) neutralization of the virus by anti-SV-40 antiserum; and
    • c) reaction of the infected cells with anti-SV-40 T antigen directed antibodies prepared by standard techniques.
  • The isolation of SV-40 mRNA can be accomplished as follows. Total RNA is first obtained by the guanidine hydrochloric acid extraction procedure using glassware previously baked and treated with diethylpyrocarbonate to remove traces of RNase as taught by Cox et al, Methods in Enzymology 12B:120 (1968). The A+ RNA is isolated on oligo-dTcellulose, which can be obtained from Collaborative Research, Waltham, Massachusetts, or P. L. Biochemicals, Inc., Milwaukee, Wisconsin, utilizing the technique described by Bantle et al, Analytical Biochemistry 72:413 (1976). The RNA fractions are assayed for purity and intactness by electropheresis according to the method described in Bailey et al, Analytical Biochemistry 70:75 (1976). Also, the RNA can be assayed for translatability in the wheat embryo in vitro system described in Marcus, et al, Methods in Enzymology: 30:749 (1974). The in vitro translation products are monitored on sodium lauryl sulphate 9% polyacrylamide gels as described in Laemmeli, Nature 227:680 (1970).
  • This purified A+ mRNA containing the viral mRNA sequences can hybridize to the synthetic oligonucleotide at 37oC in 0.5 M sodium phosphate buffer, pH 6.8, containing 0.2% sodium lauryl sulphate. Solutions containing about 1 mg A+ mRNA and synthetic oligonucleotide at a concentration of about 100 ug/ml are heated to 100oC for 1-2 minutes, then cooled to 37oC and allowed to anneal. The extent of the hybridization reaction as a function of time may be monitored on a gel filtration column.
  • Actually, while any theoretically suitable temperature may be used for the hybrid formation, temperatures ranging from 0oC to about 80oC provide for good hybridization, but preferred temperatures range from about 10oC to about 40oC. Generally, the optimal annealing temperature for the formation of specific hybrids is believed to be about 20oC to 25oC below their melting temperature. Synthetic oligonucleotides operating at 37.5oC should thus be designed on the basis of their base sequence and length, such that the melting temperature is between about 57oC and 62oC when tested under approximately physiological conditions.
  • For hybridization testing the ratio of the synthetic oligonucleotide to its mRNA complement is generally about 30:1. Lower ratios are acceptable, however, sequences below about 3:1 can cause lower hybrid formation. Control reactions utilizing yeast RNA or globin mRNA can be used, and should show no detectable hybrids, indicating hybridization specificity only to SV-40 mRNA. Also, thermal denaturation profile studies and comparison of the kinetics of hybridization can confirm that the synthetic oligonucleotide reacts only with SV-40 mRNA sequences.
  • Once it is shown that the oligonucleotide hybridizes to the isolated SV-40 mRNA, in vitro translation tests can be attempted utilizing the wheat embryo system (described previously) to show that the hybrid is not translated. Basically, upon introduction of SV-40 mRNA into the wheat embryo system, the system produces large T antigen protein. However, when an equal amount or more of synthetic oligonucleotide is also added to the system, T antigen protein synthesis can be substantially inhibited, without interference with synthesis of other SV-40 proteins whose mRNA was also introduced.
  • Testing of the oligonucleotide in vivo can be accomplished-by adding the oligonucleotide to cultures of cells infected with SV-40. Synthesis of T antigen protein should be inhibited significantly in about six hours, and SV-40 growth should be strongly inhibited within about 24 hours. The growth of control cultures should be largely unaffected.
  • The synthetic oligonucleotide of the present invention may be mass produced according to common cloning techniques, such as those developed in the art to clone the gene for proinsulin. Alternatively, the oligonucleotide can be chemically synthesized in commercially available equipment (described previously). Briefly, the cloning method entails enzymatic insertion of the oligonucleotide into a bacterial gene carried on a larger piece of DNA, known as a plasmid. The plasmid can be incorporated into a suitable host bacteria, and multiple copies made as the bacteria multiply as in Boyer and Cohen, U. S. Patent No. 4,237,224.
  • More particularly, and with reference to FIGS. 4 and 5, the cloning plasmid designated as pBR322, available from Bethesda Research Labs, Inc., Rockville, Maryland, can be used to mass produce the T protein specific oligonucleotide. Using standard techniques, the oligonucleotide is converted to double stranded form and then a terminal 5'PO₄ is added to each of the 5' termini with polynucleotide kinase to permit subsequent joining through T-4 ligase. The reaction conditions for forming the 5' termini can be found in Richardson, Progress in Nucleic Acids Research 2:815 (1972).
  • After purification of the double stranded oligonucleotide by chromatography on hydroxylapatite columns, it is inserted into the plasmid. Because the oligonucleotide is blunt ended, the plasmid should not have uneven or "sticky" ends. To remove sticky ends from the plasmid, S1 nuclease or other single strand specific nucleases can be utilized. A general description of methods for using restriction nucleases can be found in Nathans and Smith, Annual Review of Biochemistry 44: 273 (1975).
  • For best results, a linker system between the oligonucleotide and the plasmid can be utilized, specifically a linker having both Hind III and Alu I enzymatic cleaving sites. As seen in FIG. 4, one such linker has a sequence: 5'... CTAAGCTTAG...3'. This sequence represents a double stranded, bisymmetric molecule containing a recognition sequence both for Alu I (AGCT) and for Hind III (AAGCTT). Utilizing DNA ligase under standard conditions, this molecule can be ligated to the oligonucleotide to form linker-oligonucleotide-linker molecules. Similarly, the linked oligonucleotide can be introduced into linearized blunt-ended, Hind III cleaved pBR322 carrier molecules.
  • After ligation, the plasmid has resumed its covalently closed circular configuration with the linker-oligonucleotide incorporated, all of which is shown in FIG. 5 as pT-protein oligonucleotide. The recircularized plasmid is then used to transform a suitable bacterial host such as E. coli. The methods for transformation and selection of transformants are known in the art and described in detail in Cohen and Boyer, U.S. Patent No. 4,237,224.
  • Once the transformed bacteria containing the ligated plasmid p-oligonucleotide have been grown to high density and produced large amounts of the ligated plasmid, the oligonucleotide is ready for purification. After the plasmid has been removed from the mature cells, the plasmid is treated with appropriate restriction endonucleases. As illustrated in FIG. 5, the plasmid is first cleaved with Hind III to give various by-products, including linker-T-protein-oligonucleotide-linker and fragments of the original plasmid. These are readily separated utilizing gel electrophoresis or high pressure liquid chromatography. Further cleavage of the isolated linker-oligonucleotide-linker with the endonuclease Alu I yields pure double stranded oligonucleotide and partially degraded linker. These can also be separated based on their size differences.
  • As shown in FIG. 6, the oligonucleotide can then be modified to a nuclease resistant phosphotriester form utilizing the reaction described in Miller et al, Biochemistry 16:1988 (1977). Basically, the oligonucleotide is first acylated using 50% acetic anhydride-pyridine during an overnight incubation period. The product is precipitated and isolated from ether. The phosphotriester can then be formed utilizing 30% ethanol in anydrous 2, 6 lutidine (30%), NN-dimethyl formamide (30%) and p-toluene sulfonyl chloride (17%), and reacting for about 6 hours. The protecting acetyl groups are then hydrolyzed by the addition of 0.5 volumes of concentrated ammonium hydroxide, followed by incubation for about 1 hour at 55oC, The final oligonucleotide product in the ethyl phosphotriester form can then be isolated on paper chromatography or high pressure liquid chromatography.
  • It is believed that transforming the oligonucleotide to a phosphotriester form will improve the oligonucleotide's stability in vivo due to an enhanced resistance against various degradative enzymes. However, the oligonucleotide will eventually degrade because of spontaneous de-ethylation, which leaves the molecule unprotected. Indeed, by controlling the initial level of ethylation, the in vivo degradation rate can be controlled. A further advantage of a phosphotriester form is believed to be an increase in the oligonucleotide's ability to penetrate a cell membrane.
  • EXAMPLE 2
  • A synthetic oligonucleotide capable of inhibiting the synthesis of follicle stimulating hormone (FSH), a protein hormone produced by the pituitary that functions in the maturation of ova in females and sperm cells in males, can also be constructed. It is known that FSH is composed of two chains, alpha and beta, the amino acid sequence of which has been determined for several animal species. Interestingly, the alpha chain of FSH is common to other gonadotropic hormones, including thyroid stimulating hormone, luteinizing hormone, and chorionic gonadotropin, while the beta chain varies. Therefore, to selectively shut off the synthesis of FSH without substantially affecting the other gonadotropins, the oligonucleotide must be specific for the mRNA coding for the beta chain.
  • The sequence of the beta chain amino acids 32 through 40 is shown in FIG. 7. As discussed earlier, it is possible to predict the mRNA base sequence for these amino acids, although not with absolute certainty. The points of uncertainty are indicated by the letter "X" in the predicted mRNA sequence. Thus, the resultant oligonucleotide family consists of eight possible 26 base sequences; the potential alternate bases are shown in parentheses below the primary base sequence.
  • By beginning with the projected mRNA sequence for the 33rd through 40th amino acids, it can be seen that four different 23 base oligonucleotides exist that could correspond to the FSH mRNA. The sequences could be as follows, reading from the 5' end: GTGTAGCAGTAGCCGGCGCACCA, GTGTAGCAGTATCCGGCGCACCA, GTGTAGCAGTAGCCTGCGCACCA, and GTGTAGCAGTATCCTGCGCACCA.
  • One of these four sequences should be precisely correct and thus able to hybridize fully with the FSH mRNA. To determine the best sequence, a hybridization test against FSH mRNA, with subsequent purification on hydroxylapatite or other suitable column, can be performed as previously described. Once the best sequence has been determined, it is placed in a plasmid or chemically synthesized, as described above, for bulk synthesis. This oligonucleotide should substantially inhibit the synthesis of FSH in vivo.
  • From the foregoing, it will be appreciated that the present invention provides a systematic method of designing new therapeutic agents for use in living organisms and that this method is versatile and inexpensive. Further, the oligonucleotide produced in accordance with the present invention is extremely effective and specific, enabling selective control of protein synthesis in a living organism.
  • While several particular forms of the invention have been illustrated and described, it will be apparent that various modifications can be made without departing from the spirit and scope of the invention. Accordingly, it is not intended that the invention be limited, except as by the appended claims.

Claims (2)

  1. A method for preparing a therapeutic agent for selectively blocking a translation of mRNA into a targeted protein comprising the manufacturing of a stabilized oligonucleotide of 14 to 23 bases having a base sequence substantial complementary to a portion of the coding region of the mRNA coding for said targeted protein and formulating the same into a therapeutic agent.
  2. A method for preparing a therapeutic agent according to claim 1, characterized in that the oligonucleotide is prepared in a phosphotriester form.
EP82903424A 1981-10-23 1982-10-08 Oligonucleotide therapeutic agent and methods of making same Expired - Lifetime EP0092574B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AT82903424T ATE75483T1 (en) 1981-10-23 1982-10-08 OLIGONUCLEOTIDE REMEDY AND ITS PRODUCTION PROCESS.

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US31412481A 1981-10-23 1981-10-23
US314124 1981-10-23

Publications (3)

Publication Number Publication Date
EP0092574A1 EP0092574A1 (en) 1983-11-02
EP0092574A4 EP0092574A4 (en) 1984-02-09
EP0092574B1 true EP0092574B1 (en) 1992-04-29

Family

ID=23218662

Family Applications (1)

Application Number Title Priority Date Filing Date
EP82903424A Expired - Lifetime EP0092574B1 (en) 1981-10-23 1982-10-08 Oligonucleotide therapeutic agent and methods of making same

Country Status (12)

Country Link
US (2) US7285537B1 (en)
EP (1) EP0092574B1 (en)
JP (2) JP2547714B2 (en)
AT (1) ATE75483T1 (en)
AU (1) AU568067B2 (en)
CA (1) CA1208147A (en)
DE (1) DE3280400D1 (en)
DK (1) DK288183A (en)
IE (1) IE58009B1 (en)
IL (1) IL67053A (en)
IT (1) IT1206311B (en)
WO (1) WO1983001451A1 (en)

Cited By (23)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5453566A (en) * 1986-03-28 1995-09-26 Calgene, Inc. Antisense regulation of gene expression in plant/cells
US5633360A (en) * 1992-04-14 1997-05-27 Gilead Sciences, Inc. Oligonucleotide analogs capable of passive cell membrane permeation
US5728518A (en) * 1994-01-12 1998-03-17 The Immune Response Corporation Antiviral poly-and oligonucleotides
US6214806B1 (en) 1997-02-28 2001-04-10 University Of Iowa Research Foundation Use of nucleic acids containing unmethylated CPC dinucleotide in the treatment of LPS-associated disorders
US6949520B1 (en) 1999-09-27 2005-09-27 Coley Pharmaceutical Group, Inc. Methods related to immunostimulatory nucleic acid-induced interferon
US6977245B2 (en) 1999-04-12 2005-12-20 The United States Of America As Represented By The Department Of Health And Human Services Oligodeoxynucleotide and its use to induce an immune response
US7001890B1 (en) 1997-01-23 2006-02-21 Coley Pharmaceutical Gmbh Pharmaceutical compositions comprising a polynucleotide and optionally an antigen especially for vaccination
US7354909B2 (en) 2001-08-14 2008-04-08 The United States Of America As Represented By Secretary Of The Department Of Health And Human Services Method for rapid generation of mature dendritic cells
US7521063B2 (en) 2000-01-14 2009-04-21 The United States Of America As Represented By The Department Of Health And Human Services Multiple CPG oligodeoxynucleotides and their use to induce an immune response
US7534772B2 (en) 2000-06-22 2009-05-19 University Of Iowa Research Foundation Methods for enhancing antibody-induced cell lysis and treating cancer
US7615227B2 (en) 2001-12-20 2009-11-10 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Use of CpG oligodeoxynucleotides to induce angiogenesis
US7666674B2 (en) 2001-07-27 2010-02-23 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Use of sterically stabilized cationic liposomes to efficiently deliver CPG oligonucleotides in vivo
US7776343B1 (en) 1999-02-17 2010-08-17 Csl Limited Immunogenic complexes and methods relating thereto
US8153141B2 (en) 2002-04-04 2012-04-10 Coley Pharmaceutical Gmbh Immunostimulatory G, U-containing oligoribonucleotides
US8158592B2 (en) 1994-07-15 2012-04-17 Coley Pharmaceutical Group, Inc. Immunostimulatory nucleic acid molecules
US8263091B2 (en) 2002-09-18 2012-09-11 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Method of treating and preventing infections in immunocompromised subjects with immunostimulatory CpG oligonucleotides
US8283328B2 (en) 2002-08-19 2012-10-09 Coley Pharmaceutical Group, Inc. Immunostimulatory nucleic acids
US8466116B2 (en) 2001-12-20 2013-06-18 The Unites States Of America As Represented By The Secretary Of The Department Of Health And Human Services Use of CpG oligodeoxynucleotides to induce epithelial cell growth
US9200287B2 (en) 2007-05-18 2015-12-01 Adiutide Pharmaceuticals Gmbh Phosphate-modified oligonucleotide analogs with enhanced immunostimulatory activity
US9809824B2 (en) 2004-12-13 2017-11-07 The United States Of America, Represented By The Secretary, Department Of Health And Human Services CpG oligonucleotide prodrugs, compositions thereof and associated therapeutic methods
US10682365B2 (en) 2014-12-31 2020-06-16 Checkmate Pharmaceuticals, Inc. Combination tumor immunotherapy
US12084655B2 (en) 2018-04-09 2024-09-10 Checkmate Pharmaceuticals Packaging oligonucleotides into virus-like particles
US12246031B2 (en) 2018-02-13 2025-03-11 Checkmate Pharmaceuticals, Inc. Compositions and methods for tumor immunotherapy

Families Citing this family (124)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1983001451A1 (en) * 1981-10-23 1983-04-28 Molecular Biosystems Inc Oligonucleotide therapeutic agent and methods of making same
NZ209840A (en) * 1983-10-17 1988-11-29 Kaji Akira A method of inhibiting viral propagation by hybridising dna with the viral rna thus blocking its action
US5190931A (en) * 1983-10-20 1993-03-02 The Research Foundation Of State University Of New York Regulation of gene expression by employing translational inhibition of MRNA utilizing interfering complementary MRNA
US5272065A (en) * 1983-10-20 1993-12-21 Research Foundation Of State University Of New York Regulation of gene expression by employing translational inhibition of MRNA utilizing interfering complementary MRNA
US5208149A (en) * 1983-10-20 1993-05-04 The Research Foundation Of State University Of New York Nucleic acid constructs containing stable stem and loop structures
US4751181A (en) * 1984-12-31 1988-06-14 Duke University Methods and compositions useful in the diagnosis and treatment of autoimmune diseases
EP0477994B1 (en) * 1985-03-21 2001-06-13 Johnston, Stephen, Ph.D. Parasite-derived resistance
US5580716A (en) * 1985-03-21 1996-12-03 Stephen A. Johnston Parasite-derived resistance
US4959463A (en) * 1985-10-15 1990-09-25 Genentech, Inc. Intermediates
EP0252940A4 (en) * 1985-12-05 1989-07-27 Hutchinson Fred Cancer Res ANTI-DETECTION RNA FOR THE TREATMENT OF RETROVIRAL DISEASES.
US5637573A (en) * 1986-05-23 1997-06-10 Agrawal; Sudhir Influenza virus replication inhibiting oligonucleotide analogues and their pharmaceutical compositions
US4806463A (en) * 1986-05-23 1989-02-21 Worcester Foundation For Experimental Biology Inhibition of HTLV-III by exogenous oligonucleotides
US5194428A (en) * 1986-05-23 1993-03-16 Worcester Foundation For Experimental Biology Inhibition of influenza virus replication by oligonucleotide phosphorothioates
AU613989B2 (en) * 1987-11-24 1991-08-15 Gen-Probe Incorporated Means and method for enhancing nucleic acid hybridization
EP0348458B1 (en) * 1987-11-30 1997-04-09 University Of Iowa Research Foundation Dna molecules stabilized by modifications of the 3'-terminal phosphodiester linkage and their use as nucleic acid probes and as therapeutic agents to block the expression of specifically targeted genes
EP0424473B1 (en) * 1988-07-05 1996-05-08 Baylor College Of Medicine Methods for identification of bacteria
US5004810A (en) * 1988-09-30 1991-04-02 Schering Corporation Antiviral oligomers
FR2686882B1 (en) * 1992-02-05 1994-05-06 Centre Nat Rech Scient OLIGOTHIONUCLEOTIDES.
FR2687679B1 (en) * 1992-02-05 1994-10-28 Centre Nat Rech Scient OLIGOTHIONUCLEOTIDES.
CA2159639A1 (en) * 1993-04-02 1994-10-13 Vincent J. Miles Method for selective inactivation of viral replication
US6824976B1 (en) 1993-04-02 2004-11-30 Rigel Pharmaceuticals, Inc. Method for selective inactivation of viral replication
US6727230B1 (en) 1994-03-25 2004-04-27 Coley Pharmaceutical Group, Inc. Immune stimulation by phosphorothioate oligonucleotide analogs
US6429199B1 (en) 1994-07-15 2002-08-06 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules for activating dendritic cells
AU753688B2 (en) 1997-03-10 2002-10-24 Ottawa Civic Loeb Research Institute Use of nucleic acids containing unmethylated CpG dinucleotide as an adjuvant
US6126965A (en) * 1997-03-21 2000-10-03 Georgetown University School Of Medicine Liposomes containing oligonucleotides
US7262173B2 (en) * 1997-03-21 2007-08-28 Georgetown University Chemosensitizing with liposomes containing oligonucleotides
WO1999054459A2 (en) 1998-04-20 1999-10-28 Ribozyme Pharmaceuticals, Inc. Nucleic acid molecules with novel chemical compositions capable of modulating gene expression
DK1733735T3 (en) 1998-05-22 2017-06-19 Ottawa Hospital Res Inst Methods and products for the induction of mucosal immunity
US6887464B1 (en) 1999-02-02 2005-05-03 Biocache Pharmaceuticals, Inc. Advanced antigen presentation platform
ES2307568T3 (en) 2000-12-08 2008-12-01 Coley Pharmaceutical Gmbh CPG TYPE NUCLEIC ACIDS AND SAME USE METHODS.
ES2314099T3 (en) 2001-08-17 2009-03-16 Coley Pharmaceutical Gmbh IMMUNO STIMULANT OLIGONUCLEOTIDES WITH REASONS COMBINED WITH IMPROVED ACTIVITY.
AU2002353783A1 (en) 2001-09-24 2003-04-07 The Government Of The United States Of America As Represented By The Secretary Of The Department Of SUPPRESSORS OF CpG OLIGONUCLEOTIDES AND METHODS OF USE
AU2002346960A1 (en) 2001-10-06 2003-04-22 Merial Limited Methods and compositions for promoting growth and innate immunity in young animals
AU2003240934A1 (en) * 2002-05-29 2003-12-19 Neopharm, Inc. Method for determining oligonucleotide concentration
US7704965B2 (en) * 2002-06-26 2010-04-27 The Penn State Research Foundation Methods and materials for treating human papillomavirus infections
AU2003263963A1 (en) 2002-08-01 2004-02-23 The Government Of The United States Of America As Represented By The Secretary Of The Department Of Method of treating inflammatory arthropathies with suppressors of cpg oligonucleotides
US20050059025A1 (en) * 2002-10-07 2005-03-17 Five Giralda Farms Compositions, organisms and methodologies employing a novel human kinase
US8043622B2 (en) 2002-10-08 2011-10-25 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Method of treating inflammatory lung disease with suppressors of CpG oligonucleotides
EP1575518A4 (en) * 2002-10-10 2007-08-22 Wyeth Corp Compositions, organisms and methodologies employing a novel human kinase
MXPA05003673A (en) * 2002-10-10 2005-06-08 Wyeth Corp Compositions, organisms and methodologies employing a novel human kinase.
AU2003301348A1 (en) * 2002-10-18 2004-05-04 Wyeth Compositions and methods for diagnosing and treating autoimmune disease
US7208306B2 (en) * 2002-10-24 2007-04-24 Wyeth Compositions employing a novel human protein phosphatase
CA2503693A1 (en) 2002-10-29 2004-05-13 Coley Pharmaceutical Group, Ltd. Use of cpg oligonucleotides in the treatment of hepatitis c virus infection
AU2003298689A1 (en) * 2002-11-21 2004-06-18 Wyeth Methods for diagnosing rcc and other solid tumors
WO2004050831A2 (en) * 2002-11-27 2004-06-17 Wyeth Compositions, organisms and methodologies employing a novel human kinase
US9388427B2 (en) * 2002-12-02 2016-07-12 Biovec, Llc In vivo and ex vivo gene transfer into renal tissue using gutless adenovirus vectors
US7803365B2 (en) * 2002-12-02 2010-09-28 Biovec, Llc Ex vivo and in vivo expression of the thrombomodulin gene for the treatment of cardiovascular and peripheral vascular diseases
DE602004015064D1 (en) * 2003-01-06 2008-08-28 Wyeth Corp COMPOSITIONS AND METHODS FOR DIAGNOSIS AND TREATMENT OF COLONY CANCER
US20050266409A1 (en) * 2003-02-04 2005-12-01 Wyeth Compositions and methods for diagnosing, preventing, and treating cancers
US20050106124A1 (en) * 2003-02-25 2005-05-19 Sehgal Lakshman R. Therapeutic applications of thrombomodulin gene via viral and non-viral vectors
WO2004076639A2 (en) * 2003-02-26 2004-09-10 Wyeth Use of gene expression profiling in the diagnosis and treatment of lupus nephritis and systemic lupus erythematosus
KR20050106483A (en) * 2003-03-04 2005-11-09 와이어쓰 Compositions and methods for diagnosing and treating asthma or other allergic or inflammatory diseases
US20040198640A1 (en) * 2003-04-02 2004-10-07 Dharmacon, Inc. Stabilized polynucleotides for use in RNA interference
WO2005001092A2 (en) * 2003-05-20 2005-01-06 Wyeth Compositions and methods for diagnosing and treating cancers
US8071652B2 (en) * 2003-08-21 2011-12-06 The Board Of Regents Of The University Of Texas System Method of treating irritable bowel syndrome
AU2004275876B2 (en) 2003-09-25 2011-03-31 Coley Pharmaceutical Gmbh Nucleic acid-lipophilic conjugates
WO2005072088A2 (en) * 2003-12-11 2005-08-11 Sciperio, Inc. Immunotherapy compositions, method of making and method of use thereof
EP2248895B8 (en) 2003-12-19 2016-09-21 Autotelic LLC Combination therapy associating a TGF-beta antagonist with a chemotherapeutic agent
EP1720568A2 (en) 2004-02-19 2006-11-15 Coley Pharmaceutical Group, Inc. Immunostimulatory viral rna oligonucleotides
EP1568383A3 (en) 2004-02-27 2005-11-16 Antisense Pharma GmbH Use of an oligonucleotide or its active derivative for the preparation of a pharmaceutical composition for inhibiting the formation of metastases in cancer treatment
KR101147147B1 (en) 2004-04-01 2012-05-25 머크 샤프 앤드 돔 코포레이션 Modified polynucleotides for reducing off-target effects in rna interference
CA2565714C (en) 2004-05-06 2014-12-23 The Government Of The United States Of America, As Represented By The Secretary Of The Department Of Health And Human Services Methods and compositions for the treatment of uveitis
CA2572427A1 (en) 2004-07-18 2006-01-18 Heather L. Davis Immuno stimulating complex and oligonucleotide formulations for inducing enhanced interferon-gamma responses
WO2006017673A2 (en) 2004-08-03 2006-02-16 Biogen Idec Ma Inc. Taj in neuronal function
KR100721928B1 (en) 2004-11-05 2007-05-28 주식회사 바이오씨에스 Pharmaceutical composition for the treatment or prevention of skin diseases containing CJ oligodeoxynucleotide
US7923207B2 (en) 2004-11-22 2011-04-12 Dharmacon, Inc. Apparatus and system having dry gene silencing pools
US20060166234A1 (en) 2004-11-22 2006-07-27 Barbara Robertson Apparatus and system having dry control gene silencing compositions
US7935811B2 (en) 2004-11-22 2011-05-03 Dharmacon, Inc. Apparatus and system having dry gene silencing compositions
US7939490B2 (en) * 2004-12-13 2011-05-10 University Of Maryland, Baltimore TWEAK as a therapeutic target for treating central nervous system diseases associated with cerebral edema and cell death
FR2881143B1 (en) 2005-01-27 2010-12-17 Librophyt SYSTEM FOR PRODUCING TERPENOIDS IN PLANTS
US20100130425A1 (en) 2005-09-09 2010-05-27 Oregon Health & Science University Use of toll-like receptor ligands in treating excitotoxic injury, ischemia and/or hypoxia
CA2640423C (en) 2006-01-27 2016-03-15 Biogen Idec Ma Inc. Nogo receptor antagonists
PT1991678E (en) 2006-02-15 2015-11-25 Adiutide Pharmaceuticals Gmbh Compositions and methods for oligonucleotide formulations
US8809514B2 (en) 2006-09-22 2014-08-19 Ge Healthcare Dharmacon, Inc. Tripartite oligonucleotide complexes and methods for gene silencing by RNA interference
CN101517082B (en) 2006-09-27 2014-01-22 科勒制药有限责任公司 Cpg oligonucleotide analogs containing hydrophobic t analogs with enhanced immunostimulatory activity
AU2007353317B2 (en) * 2006-11-15 2012-09-06 Eli Lilly And Company Methods and compositions for treating influenza
KR20100068422A (en) 2007-10-09 2010-06-23 콜리 파마슈티칼 게엠베하 Immune stimulatory oligonucleotide analogs containing modified sugar moieties
JP5753382B2 (en) 2007-11-06 2015-07-22 アディウティーダ ファーマシューティカルズ ゲーエムベーハー Immunostimulatory oligoribonucleotide analogs containing modified oligophosphate groups
US7845686B2 (en) * 2007-12-17 2010-12-07 S & B Technical Products, Inc. Restrained pipe joining system for plastic pipe
US8188060B2 (en) 2008-02-11 2012-05-29 Dharmacon, Inc. Duplex oligonucleotides with enhanced functionality in gene regulation
EP2278979A4 (en) 2008-05-21 2012-09-26 Us Gov Health & Human Serv PROCESS FOR TREATING PNEUMOCONIOSIS WITH OLIGODESOXYNUCLEOTIDES
WO2010067262A1 (en) 2008-12-09 2010-06-17 Pfizer Inc. Immunostimulatory oligonucleotides
MX337723B (en) 2008-12-09 2016-03-15 Pfizer Vaccines Llc IgE CH3 PEPTIDE VACCINE.
WO2010125480A1 (en) 2009-04-30 2010-11-04 Coley Pharmaceutical Group, Inc. Pneumococcal vaccine and uses thereof
CA2768346A1 (en) 2009-07-30 2011-02-03 Pfizer Vaccines Llc Antigenic tau peptides and uses thereof
AU2010277554B2 (en) 2009-07-30 2015-02-19 Antisense Pharma Gmbh Combination of a chemotherapeutic agent and an inhibitor of the TGF-beta system
DK2473605T3 (en) 2009-09-03 2018-05-28 Pfizer Vaccines Llc PCSK9-VACCINE
WO2011109422A2 (en) 2010-03-02 2011-09-09 The United States Of America, Represented By The Secretary, Department Of Health And Human Services Compositions and methods for the treatment of cancer
EP2575878B1 (en) 2010-05-28 2018-06-13 Zoetis Belgium S.A. Vaccines comprising cholesterol and cpg as sole adjuvant-carrier molecules
EP2942061A3 (en) 2010-06-07 2016-01-13 Pfizer Vaccines LLC Ige ch3 peptide vaccine
AU2011325956B2 (en) 2010-11-12 2016-07-14 The General Hospital Corporation Polycomb-associated non-coding RNAs
US9920317B2 (en) 2010-11-12 2018-03-20 The General Hospital Corporation Polycomb-associated non-coding RNAs
WO2012131504A1 (en) 2011-03-02 2012-10-04 Pfizer Inc. Pcsk9 vaccine
SG10201605170VA (en) 2011-07-01 2016-08-30 Harvard College Method for forming nanoparticles having predetermined shapes
JP6129844B2 (en) 2011-09-14 2017-05-17 ラナ セラピューティクス インコーポレイテッド Multimeric oligonucleotide compounds
EP2830991A1 (en) 2012-03-26 2015-02-04 President and Fellows of Harvard College Lipid-coated nucleic acid nanostructures of defined shape
WO2013162828A1 (en) 2012-04-27 2013-10-31 The United States Of America, As Represented By The Secretary, Department Of Health & Human Services Use of cpg oligonucleotides co-formulated with an antibiotic to accelarate wound healing
RU2737765C2 (en) 2012-05-04 2020-12-02 Пфайзер Инк. Prostate-associated antigens and immunotherapeutic regimens based on vaccines
EA201492121A1 (en) 2012-05-16 2015-10-30 Рана Терапьютикс, Инк. COMPOSITIONS AND METHODS FOR MODULATING THE EXPRESSION OF THE FAMILY OF HEMOGLOBIN GENES
US10837014B2 (en) 2012-05-16 2020-11-17 Translate Bio Ma, Inc. Compositions and methods for modulating SMN gene family expression
JP2015523853A (en) 2012-05-16 2015-08-20 ラナ セラピューティクス インコーポレイテッド Compositions and methods for modulating ATP2A2 expression
KR20150030205A (en) 2012-05-16 2015-03-19 라나 테라퓨틱스, 인크. Compositions and methods for modulating smn gene family expression
SG11201407486PA (en) 2012-05-16 2014-12-30 Rana Therapeutics Inc Compositions and methods for modulating utrn expression
AU2013262709A1 (en) 2012-05-16 2015-01-22 Rana Therapeutics, Inc. Compositions and methods for modulating MECP2 expression
JP6246121B2 (en) 2012-07-13 2017-12-13 株式会社新日本科学 Chiral nucleic acid adjuvant
CA2884608C (en) 2012-09-14 2025-05-20 Translate Bio Ma, Inc. Multimeric oligonucleotide compounds
WO2014201245A1 (en) 2013-06-12 2014-12-18 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Tlr-9 agonist with tlr-7 and/or tlr-8 agonist for treating tumors
EP3033422A4 (en) 2013-08-16 2017-08-02 Rana Therapeutics Inc. Oligonucleotides targeting euchromatin regions of genes
WO2015108048A1 (en) 2014-01-15 2015-07-23 株式会社新日本科学 Chiral nucleic acid adjuvant having antitumor effect and antitumor agent
US10322173B2 (en) 2014-01-15 2019-06-18 Shin Nippon Biomedical Laboratories, Ltd. Chiral nucleic acid adjuvant having anti-allergic activity, and anti-allergic agent
EP3095461A4 (en) 2014-01-15 2017-08-23 Shin Nippon Biomedical Laboratories, Ltd. Chiral nucleic acid adjuvant having immunity induction activity, and immunity induction activator
JP2017514467A (en) 2014-04-23 2017-06-08 チルドレンズ メディカル センター コーポレーション High-throughput structure determination using nucleic acid calipers
US10858650B2 (en) 2014-10-30 2020-12-08 The General Hospital Corporation Methods for modulating ATRX-dependent gene repression
WO2016130943A1 (en) 2015-02-13 2016-08-18 Rana Therapeutics, Inc. Hybrid oligonucleotides and uses thereof
WO2016149455A2 (en) 2015-03-17 2016-09-22 The General Hospital Corporation The rna interactome of polycomb repressive complex 1 (prc1)
WO2016183371A1 (en) 2015-05-13 2016-11-17 The United States Of America, As Represented By The Secretary, Department Of Health & Human Services Methods for the treatment or prevention of ischemic tissue damage
WO2016183370A1 (en) 2015-05-13 2016-11-17 The United States Of America, As Represented By The Secretary, Department Of Health & Human Services Synthetic immunosuppressive oligodeoxynucleotides reduce ischemic tissue damage
US20190298824A1 (en) 2016-05-04 2019-10-03 The United States Of America, As Represented By The Secretary, Department Of Health And Human Serv Albumin-binding immunomodulatory compositions and methods of use thereof
US11767557B2 (en) 2017-12-07 2023-09-26 Massachusetts Institute Of Technology Single cell analyses
US20230241196A1 (en) 2020-01-27 2023-08-03 Oregon State University Gonorrhea subunit vaccine
TW202438104A (en) 2022-12-13 2024-10-01 美商輝瑞股份有限公司 Immunogenic compositions and methods for eliciting an immune response against clostridioides (clostridium) difficile
TW202602467A (en) 2024-03-11 2026-01-16 美商輝瑞股份有限公司 Immunogenic compositions comprising conjugated escherichia coli saccharides and uses thereof
WO2025238502A1 (en) 2024-05-14 2025-11-20 Pfizer Inc. Aluminum adjuvant nanoparticles, methods of manufacture, and uses thereof
WO2025257712A1 (en) 2024-06-12 2025-12-18 Pfizer Inc. Immunogenic compositions and methods for eliciting an immune response against clostridioides (clostridium) difficile

Family Cites Families (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3687808A (en) 1969-08-14 1972-08-29 Univ Leland Stanford Junior Synthetic polynucleotides
US4237224A (en) * 1974-11-04 1980-12-02 Board Of Trustees Of The Leland Stanford Jr. University Process for producing biologically functional molecular chimeras
US4321365A (en) * 1977-10-19 1982-03-23 Research Corporation Oligonucleotides useful as adaptors in DNA cloning, adapted DNA molecules, and methods of preparing adaptors and adapted molecules
GB2068971B (en) * 1980-01-30 1983-06-08 Searle & Co Recombinant dna techniques
US4399216A (en) 1980-02-25 1983-08-16 The Trustees Of Columbia University Processes for inserting DNA into eucaryotic cells and for producing proteinaceous materials
US4469863A (en) * 1980-11-12 1984-09-04 Ts O Paul O P Nonionic nucleic acid alkyl and aryl phosphonates and processes for manufacture and use thereof
US5023243A (en) * 1981-10-23 1991-06-11 Molecular Biosystems, Inc. Oligonucleotide therapeutic agent and method of making same
WO1983001451A1 (en) * 1981-10-23 1983-04-28 Molecular Biosystems Inc Oligonucleotide therapeutic agent and methods of making same

Non-Patent Citations (11)

* Cited by examiner, † Cited by third party
Title
Affidavit of Dr. Robert N. Bryan (06-02-1984) *
Angew. Chem. Int. Ed. Vol. 9 (1970) No. 9, p. 678-688 *
Biochemistry Vol. 24(22) (1985), 6139-6145 *
N. ALVARADO-URBINA ET AL, SCIENCE, VOLUME 214, 16 OCTOBER 1981, PAGES 270-74 *
N. HASTIE ET AL, PROC. NATL: ACAD. SCI., USA, VOLUME 75, NUMBER 3, MARCH 1978, PAGES 1217-21 *
N. INGLIS ET AL, VIROLOGY, VOLUME 78, 1977, PAGES 522-36 *
N. ITAKURA ET AL, SCIENCE, VOLUME 209, 19 SEPTEMBER 1980, PAGES 1401-1405 *
N. WALLACE ET AL. NUCLEIC ACIDS RESEARCH, VOLUME 6, NUMBER 11, 1979, PAGES 3543-57 *
PNAS USA Vo.. 83 (1986), 4143-4146 *
PNAS USA, Vol. 75 (1) (1978), 285-288 *
PROC. NATL: ACAD, SCI, USA, vol. 75, no. 1, January 1978 P.C. ZAMECNIK et al.: "Inhibition of Rous sarcoma virus replication and cell transformation by a specific oligodeoxynucleotide", pages 280-284 *

Cited By (31)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5759829A (en) * 1986-03-28 1998-06-02 Calgene, Inc. Antisense regulation of gene expression in plant cells
US5453566A (en) * 1986-03-28 1995-09-26 Calgene, Inc. Antisense regulation of gene expression in plant/cells
US5633360A (en) * 1992-04-14 1997-05-27 Gilead Sciences, Inc. Oligonucleotide analogs capable of passive cell membrane permeation
US5763208A (en) * 1992-04-14 1998-06-09 Gilead Sciences, Inc. Oligonucleotides and their analogs capable of passive cell membrane permeation
US5728518A (en) * 1994-01-12 1998-03-17 The Immune Response Corporation Antiviral poly-and oligonucleotides
US8158592B2 (en) 1994-07-15 2012-04-17 Coley Pharmaceutical Group, Inc. Immunostimulatory nucleic acid molecules
US7001890B1 (en) 1997-01-23 2006-02-21 Coley Pharmaceutical Gmbh Pharmaceutical compositions comprising a polynucleotide and optionally an antigen especially for vaccination
US6214806B1 (en) 1997-02-28 2001-04-10 University Of Iowa Research Foundation Use of nucleic acids containing unmethylated CPC dinucleotide in the treatment of LPS-associated disorders
US7776343B1 (en) 1999-02-17 2010-08-17 Csl Limited Immunogenic complexes and methods relating thereto
US8173141B2 (en) 1999-02-17 2012-05-08 Csl Limited Immunogenic complexes and methods relating thereto
US6977245B2 (en) 1999-04-12 2005-12-20 The United States Of America As Represented By The Department Of Health And Human Services Oligodeoxynucleotide and its use to induce an immune response
US7960356B2 (en) 1999-04-12 2011-06-14 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Oligodeoxynucleotide and its use to induce an immune response
US8227446B2 (en) 1999-04-12 2012-07-24 The United States Of America, As Represented By The Secretary Of The Department Of Health And Human Services Oligodeoxynucleotide and its use to induce an immune response
US6949520B1 (en) 1999-09-27 2005-09-27 Coley Pharmaceutical Group, Inc. Methods related to immunostimulatory nucleic acid-induced interferon
US7521063B2 (en) 2000-01-14 2009-04-21 The United States Of America As Represented By The Department Of Health And Human Services Multiple CPG oligodeoxynucleotides and their use to induce an immune response
US7534772B2 (en) 2000-06-22 2009-05-19 University Of Iowa Research Foundation Methods for enhancing antibody-induced cell lysis and treating cancer
US7666674B2 (en) 2001-07-27 2010-02-23 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Use of sterically stabilized cationic liposomes to efficiently deliver CPG oligonucleotides in vivo
US7959934B2 (en) 2001-08-14 2011-06-14 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Method for rapid generation of mature dendritic cells
US7354909B2 (en) 2001-08-14 2008-04-08 The United States Of America As Represented By Secretary Of The Department Of Health And Human Services Method for rapid generation of mature dendritic cells
US8466116B2 (en) 2001-12-20 2013-06-18 The Unites States Of America As Represented By The Secretary Of The Department Of Health And Human Services Use of CpG oligodeoxynucleotides to induce epithelial cell growth
US7935351B2 (en) 2001-12-20 2011-05-03 The United States Of America As Represented By The Department Of Health And Human Services Use of CPG oligodeoxynucleotides to induce angiogenesis
US7615227B2 (en) 2001-12-20 2009-11-10 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Use of CpG oligodeoxynucleotides to induce angiogenesis
US8153141B2 (en) 2002-04-04 2012-04-10 Coley Pharmaceutical Gmbh Immunostimulatory G, U-containing oligoribonucleotides
US8658607B2 (en) 2002-04-04 2014-02-25 Zoetis Belgium Immunostimulatory G, U-containing oligoribonucleotides
US8283328B2 (en) 2002-08-19 2012-10-09 Coley Pharmaceutical Group, Inc. Immunostimulatory nucleic acids
US8263091B2 (en) 2002-09-18 2012-09-11 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Method of treating and preventing infections in immunocompromised subjects with immunostimulatory CpG oligonucleotides
US9809824B2 (en) 2004-12-13 2017-11-07 The United States Of America, Represented By The Secretary, Department Of Health And Human Services CpG oligonucleotide prodrugs, compositions thereof and associated therapeutic methods
US9200287B2 (en) 2007-05-18 2015-12-01 Adiutide Pharmaceuticals Gmbh Phosphate-modified oligonucleotide analogs with enhanced immunostimulatory activity
US10682365B2 (en) 2014-12-31 2020-06-16 Checkmate Pharmaceuticals, Inc. Combination tumor immunotherapy
US12246031B2 (en) 2018-02-13 2025-03-11 Checkmate Pharmaceuticals, Inc. Compositions and methods for tumor immunotherapy
US12084655B2 (en) 2018-04-09 2024-09-10 Checkmate Pharmaceuticals Packaging oligonucleotides into virus-like particles

Also Published As

Publication number Publication date
IE58009B1 (en) 1993-06-16
WO1983001451A1 (en) 1983-04-28
AU9124382A (en) 1983-05-05
EP0092574A1 (en) 1983-11-02
AU568067B2 (en) 1987-12-17
IT1206311B (en) 1989-04-14
US5919619A (en) 1999-07-06
CA1208147A (en) 1986-07-22
JPS58501771A (en) 1983-10-20
DE3280400D1 (en) 1992-06-04
IE822547L (en) 1983-04-23
IL67053A (en) 1997-07-13
EP0092574A4 (en) 1984-02-09
JP2547714B2 (en) 1996-10-23
IT8223872A0 (en) 1982-10-22
DK288183D0 (en) 1983-06-22
JPH08294393A (en) 1996-11-12
US7285537B1 (en) 2007-10-23
DK288183A (en) 1983-06-22
ATE75483T1 (en) 1992-05-15

Similar Documents

Publication Publication Date Title
US5023243A (en) Oligonucleotide therapeutic agent and method of making same
US7285537B1 (en) Oligonucleotide therapeutic agent and methods of making same
Narang DNA synthesis
van Belkum et al. Five pseudoknots are present at the 204 nucleotides long 3'noncoding region of tobacco mosaic virus RNA
US6713456B1 (en) Nucleozymes
EP0375408B1 (en) Method for making synthetic oligonucleotides which bind specifically to target sites on duplex DNA molecules, by forming a colinear triplex, the synthetic oligonucleotides and methods of use
Engels et al. Gene Synthesis [New Synthetic Methods (77)]
EP0020147B1 (en) A dna transfer vector for human pre-growth hormone, a microorganism transformed thereby, and a method of cloning therefor
WO1985000831A1 (en) Microbial expression of insulin-like growth factor
EP0979869A1 (en) Short oligonucleotides for the inhibition of VEGF expression
Goodman et al. The nucleotide sequence at the 5′-terminus of the Qβ RNA minus strand
Zaug et al. Oligomerization of intervening sequence RNA molecules in the absence of proteins
CN114369130B (en) Modified thio-oligonucleotides and their applications
CN118460655B (en) Preparation method of siRNA for inhibiting FXI gene expression
CN118460656B (en) A preparation method of Lumasiran
CN118460650B (en) A preparation method of Nedosiran
CN118460649B (en) A kind of preparation method of Vutrisiran
GB1568047A (en) Purification of nucleotide sequences suitable for expression in bacteria
CN118460651B (en) Method for preparing Cemdisiran
US5856085A (en) Compositions and methods of developing oligonucleotides and oligonucleotide analogs having antiviral activity
CN118460648B (en) A preparation method of QPI-1002
US7960536B2 (en) Synthetic cell-or tissue-specific transcriptional regulatory regions
EP1311672B1 (en) tRNA-derived inhibitors of HIV reverse transcriptase
JP2547714C (en)
Randerath et al. Tumor mitochondrial transfer RNAs: the nucleotide sequence of mitochondrial tRNALeuUAG from Morris hepatoma 5123D

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

AK Designated contracting states

Designated state(s): AT BE CH DE FR GB LI NL SE

17P Request for examination filed

Effective date: 19831028

RBV Designated contracting states (corrected)

Designated state(s): AT BE CH DE FR GB LI NL SE

RAP1 Party data changed (applicant data changed or rights of an application transferred)

Owner name: MOLECULAR BIOSYSTEMS, INC.

GRAA (expected) grant

Free format text: ORIGINAL CODE: 0009210

AK Designated contracting states

Kind code of ref document: B1

Designated state(s): AT BE CH DE FR GB LI NL SE

REF Corresponds to:

Ref document number: 75483

Country of ref document: AT

Date of ref document: 19920515

Kind code of ref document: T

REF Corresponds to:

Ref document number: 3280400

Country of ref document: DE

Date of ref document: 19920604

ET Fr: translation filed
PLBI Opposition filed

Free format text: ORIGINAL CODE: 0009260

PLBI Opposition filed

Free format text: ORIGINAL CODE: 0009260

PLBI Opposition filed

Free format text: ORIGINAL CODE: 0009260

PLAB Opposition data, opponent's data or that of the opponent's representative modified

Free format text: ORIGINAL CODE: 0009299OPPO

26 Opposition filed

Opponent name: HYBRIDON INC.

Effective date: 19930108

26 Opposition filed

Opponent name: APPLIED BIOSYSTEMS, INC.

Effective date: 19930127

Opponent name: CHUGAI SEIYAKU KABUSHIKI KAISHA

Effective date: 19930126

Opponent name: HYBRIDON INC.

Effective date: 19930108

26 Opposition filed

Opponent name: GENTA INC.

Effective date: 19930129

Opponent name: CIBA-GEIGY AG

Effective date: 19930129

Opponent name: BANG & OLUFSEN

Effective date: 19930128

Opponent name: HOECHST AKTIENGESELLSCHAFT ZENTRALE PATENTABTEILUN

Effective date: 19930128

Opponent name: APPLIED BIOSYSTEMS, INC.

Effective date: 19930127

Opponent name: CHUGAI SEIYAKU KABUSHIKI KAISHA

Effective date: 19930126

Opponent name: HYBRIDON INC.

Effective date: 19930108

R26 Opposition filed (corrected)

Opponent name: HYBRIDON INC. * 930126 CHUGAI SEIYAKU KABUSHIKI KA

Effective date: 19930108

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: NL

Effective date: 19930501

NLR1 Nl: opposition has been filed with the epo

Opponent name: HYBRIDON INC.

NLR1 Nl: opposition has been filed with the epo

Opponent name: CENTA INC.

Opponent name: CIBA-GEIGA AG.

Opponent name: BANG & OLUFSEN

Opponent name: HOECHST AG.

Opponent name: APPLIED BIOSYSTEMS INC.

Opponent name: CHUGAI SEIYAKU K.K.

NLXE Nl: other communications concerning ep-patents (part 3 heading xe)

Free format text: PAT.BUL.08/93 CORR.:GEN-PROBE INC.

NLV4 Nl: lapsed or anulled due to non-payment of the annual fee
EAL Se: european patent in force in sweden

Ref document number: 82903424.8

APAC Appeal dossier modified

Free format text: ORIGINAL CODE: EPIDOS NOAPO

APAA Appeal reference recorded

Free format text: ORIGINAL CODE: EPIDOS REFN

PLBQ Unpublished change to opponent data

Free format text: ORIGINAL CODE: EPIDOS OPPO

PLAB Opposition data, opponent's data or that of the opponent's representative modified

Free format text: ORIGINAL CODE: 0009299OPPO

R26 Opposition filed (corrected)

Opponent name: HYBRIDON INC. * 930126 CHUGAI SEIYAKU KABUSHIKI KA

Effective date: 19930108

PLBQ Unpublished change to opponent data

Free format text: ORIGINAL CODE: EPIDOS OPPO

PLAB Opposition data, opponent's data or that of the opponent's representative modified

Free format text: ORIGINAL CODE: 0009299OPPO

PLBI Opposition filed

Free format text: ORIGINAL CODE: 0009260

26 Opposition filed

Opponent name: GENTA INC.

Effective date: 19930129

Opponent name: NOVARTIS AG PATENT AND TRADEMARK DEPT.

Effective date: 19930129

Opponent name: GEN- PROBE INC.

Effective date: 19930128

Opponent name: HOECHST AKTIENGESELLSCHAFT ZENTRALE PATENTABTEILUN

Effective date: 19930128

Opponent name: APPLIED BIOSYSTEMS, INC.

Effective date: 19930127

Opponent name: CHUGAI SEIYAKU KABUSHIKI KAISHA

Effective date: 19930126

Opponent name: HYBRIDON INC.

Effective date: 19930108

R26 Opposition filed (corrected)

Opponent name: HYBRIDON INC. * 930126 CHUGAI SEIYAKU KABUSHIKI KA

Effective date: 19930108

APAE Appeal reference modified

Free format text: ORIGINAL CODE: EPIDOS REFNO

PGFP Annual fee paid to national office [announced via postgrant information from national office to epo]

Ref country code: FR

Payment date: 19980917

Year of fee payment: 17

PGFP Annual fee paid to national office [announced via postgrant information from national office to epo]

Ref country code: SE

Payment date: 19980918

Year of fee payment: 17

PGFP Annual fee paid to national office [announced via postgrant information from national office to epo]

Ref country code: DE

Payment date: 19980921

Year of fee payment: 17

Ref country code: AT

Payment date: 19980921

Year of fee payment: 17

PGFP Annual fee paid to national office [announced via postgrant information from national office to epo]

Ref country code: BE

Payment date: 19981005

Year of fee payment: 17

PGFP Annual fee paid to national office [announced via postgrant information from national office to epo]

Ref country code: GB

Payment date: 19981008

Year of fee payment: 17

PGFP Annual fee paid to national office [announced via postgrant information from national office to epo]

Ref country code: CH

Payment date: 19981026

Year of fee payment: 17

PLBQ Unpublished change to opponent data

Free format text: ORIGINAL CODE: EPIDOS OPPO

PLAB Opposition data, opponent's data or that of the opponent's representative modified

Free format text: ORIGINAL CODE: 0009299OPPO

R26 Opposition filed (corrected)

Opponent name: HYBRIDON INC. * 930126 CHUGAI SEIYAKU KABUSHIKI KA

Effective date: 19930108

APAC Appeal dossier modified

Free format text: ORIGINAL CODE: EPIDOS NOAPO

RDAG Patent revoked

Free format text: ORIGINAL CODE: 0009271

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: PATENT REVOKED

27W Patent revoked

Effective date: 19990218

GBPR Gb: patent revoked under art. 102 of the ep convention designating the uk as contracting state

Free format text: 990218

REG Reference to a national code

Ref country code: CH

Ref legal event code: PL

APAH Appeal reference modified

Free format text: ORIGINAL CODE: EPIDOSCREFNO

PLAB Opposition data, opponent's data or that of the opponent's representative modified

Free format text: ORIGINAL CODE: 0009299OPPO