EA045986B1 - NUCLEIC ACIDS FOR INHIBITION OF LPA EXPRESSION IN THE CELL - Google Patents

Description

Technical field

In accordance with the present invention, products and compositions are provided, as well as applications thereof. In particular, the present invention relates to nucleic acid derivatives that interfere with or inhibit the expression of the LPA gene. These Lp(a)-lowering therapies serve to prevent and reduce the risk of stroke, atherosclerosis, thrombosis and cardiovascular diseases such as coronary heart disease and aortic stenosis, or any other disorder, pathology or syndrome associated with increased levels of Lp(a) particles.

State of the art

Double-stranded RNAs (dsRNAs) capable of complementarily binding to expressed mRNA have been shown to block gene expression (Fire et al., 1998, Nature. 1998 Feb 19;391(6669):806-11 and Elbashir et al., 2001, Nature 2001 May 24;411(6836):494-8) through a mechanism called RNA interference (RNAi). Short dsRNAs direct gene-specific posttranscriptional silencing in many organisms, including vertebrates, and such molecules have become useful tools for studying gene function. RNAi is mediated by the RNA-induced silencing complex (RISC), a sequence-specific multicomponent nuclease that degrades messenger RNAs homologous to the initiating silencing factor loaded into the RISC complex. Interfering RNAs (referred to herein as mRNAs), such as siRNAs, antisense RNAs and microRNAs, are oligonucleotides that prevent the formation of proteins by silencing genes, i.e. inhibit the translation of a protein gene by destroying mRNA molecules. Gene silencing agents are becoming increasingly important for therapeutic applications in medicine.

According to Watts and Corey in the Journal of Pathology (2012; Vol. 226, p. 365-379), there are algorithms that can be used to design nucleic acid silencing triggers, but they all have serious limitations. Identifying effective mRNAs may require different experimental techniques because the algorithms do not take into account factors such as the tertiary structure of the target mRNA or the involvement of RNA-binding proteins. Thus, discovering an effective initiating factor for nucleic acid silencing with minimal off-target effects is a complex process. Pharmaceutical development of these highly potentially dangerous molecules requires that they be synthesized economically, be distributed to target tissues, enter cells, and function within acceptable toxicity limits.

Lp(a) particles are heterogeneous low-density lipoprotein particles expressed predominantly in the liver (Witztum and Ginsberg, J. Lipid Res. 2016 Mar; 57(3):336-9). They consist of apolipoprotein (a) (Apo(a) or Lp(a), encoded by the LPA gene), linked to an LDL-like particle by the ApoB polypeptide. High levels of serum Lp(a) particles, genetically determined, are independent of diet and exercise and are associated with an increased risk of cardiovascular disease due to the associated potential for the development of atherosclerosis (Alonso et al., Journal of the American College of Cardiology Vol. 63, No. 19, 2014). From a diagnostic and preventive medicine perspective, patient serum Lp(a) particle levels are a common, independent genetic risk factor for coronary artery disease and aortic stenosis (Saeedi and Frohlich Clinical Diabetes and Endocrinology (2016) 2:7). There are currently no approved specific therapies to reduce Lp(a) particle levels beyond indirect, standard general LDL-lowering measures. Accordingly, there is currently a need for methods to effectively treat, prevent and reduce the risk of developing disorders such as stroke, atherosclerosis, thrombosis and cardiovascular diseases or associated with them, such as coronary heart disease, aortic stenosis and other as yet unidentified associated disorders, pathologies or syndromes. The present invention addresses this unmet medical need.

Brief description of the invention

A first aspect of the invention relates to a nucleic acid for inhibiting the expression of LPA in a cell, comprising at least one duplex region that contains at least a portion of a first strand and at least a portion of a second strand that is at least partially complementary to the first strand, wherein said first strand the strand is at least partially complementary to at least a portion of the RNA transcribed from the LPA gene, wherein said first strand contains a nucleotide sequence selected from the following sequences: SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15 , 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41 or 43, where the nucleotides at positions 2 and 14 from the 5' end of the first strand are modified by a 2'-fluoro modification, and nucleotides on the second strand that correspond to positions 11-13 of the first strand are modified by a 2'-fluoro modification.

The present invention also provides a composition comprising a nucleic acid or conjugated nucleic acid according to any aspect of the present invention and optionally a physiologically acceptable excipient.

- 1 045986

One aspect also relates to a nucleic acid that is capable of inhibiting the expression of LPA for use as a drug.

Also provided is a nucleic acid or conjugated nucleic acid in accordance with any aspect of the present invention for use in the treatment of a disease, disorder or syndrome and/or for the preparation of a medicament for the treatment of a disease, disorder or syndrome.

The present invention provides a method of treating or preventing a disease, disorder or syndrome, comprising administering a composition comprising a nucleic acid or conjugated nucleic acid in accordance with any aspect of the present invention to an individual in need of treatment. The nucleic acid or conjugated nucleic acid can be administered to a subject subcutaneously, intravenously, or through any other route of administration, such as oral, rectal, or intraperitoneal.

Also provided is a method for producing a nucleic acid or conjugated nucleic acid in accordance with the present invention.

A nucleic acid or composition containing a nucleic acid or conjugated nucleic acid according to the present invention can be used in the treatment of a disease, disorder or syndrome. Treatment may involve preventing and reducing the risk of stroke, atherosclerosis, thrombosis or cardiovascular disease such as coronary artery disease or aortic stenosis, and any other disease or pathology associated with elevated levels of Lp(a) containing particles.

Detailed Description of the Invention

The present invention relates to a nucleic acid that is double-stranded and directed to an expressed LPA RNA transcript, and compositions thereof. These nucleic acids or conjugated nucleic acids can be used in the treatment and prevention of various diseases, disorders and syndromes in which reduced expression of the LPA gene product is desired.

One aspect relates to a nucleic acid for inhibiting the expression of LPA in a cell comprising at least one duplex region that contains at least a portion of a first strand and at least a portion of a second strand that is at least partially complementary to the first strand, wherein said first strand is at least partially complementary to at least a portion of the RNA transcribed from the LPA gene, wherein said first strand contains or preferably consists of a nucleotide sequence selected from the following sequences: SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41 or 43, wherein the nucleotides at positions 2 and 14 from the 5' end of the first strand are modified by 2' -fluoro modification, and nucleotides on the second strand that correspond to positions 11-13 of the first strand are modified by 2'-fluoro modification.

One aspect relates to a nucleic acid for inhibiting the expression of LPA in a cell comprising at least one duplex region that includes a first strand and a second strand that is at least partially complementary to the first strand, wherein said first strand is at least partially complementary to at least least part of the RNA transcribed from the LPA gene, wherein said first strand contains or preferably consists of a nucleotide sequence selected from the following sequences: SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41 or 43, wherein the nucleotides at positions 2 and 14 from the 5' end of the first strand are modified by a 2'-fluoro modification, and the nucleotides at the second the chains that correspond to positions 11-13 of the first chain are modified by 2'-fluoro modification.

Such nucleic acids are capable of effectively reducing the expression of LPA in the cell and are very stable. The nucleic acid of the present invention is preferably capable of inhibiting the expression of LPA in a cell to a similar, eg the same, or higher degree of expression than the same nucleic acids with a different type of modification under comparable conditions. More specifically, the nucleic acid of the present invention is preferably capable of inhibiting the expression of LPA in a cell by 80, 90, 100, 105, 110 percent or more compared to the same nucleic acid with a different type of modification under comparable conditions.

One aspect relates to a nucleic acid in which all nucleotides of the nucleic acid are modified at the 2' position of the sugar.

One aspect relates to a nucleic acid, wherein the nucleic acid is preferably modified along the entire length of the first strand by alternating 2' O-methyl and 2'-fluoro modifications.

One aspect relates to a nucleic acid in which the remaining second strand modifications are naturally occurring modifications, preferably 2' O-methyl. In other words, the nucleotides on the second strand that correspond to positions 11-13 of the first strand are modified with a 2'-fluoro modification, and all other nucleotides on the second strand are modified with a natural modification, which is preferably 2'-O-methyl.

The second strand may contain the nucleotide sequence SEQ ID NO: 2, 4, 6, 8, 10, 12, 14,

- 2 045986

16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 38, 40, 42 or 44.

A nucleic acid may: a) contain a blunt end at both ends; b) may contain a sticky end at one end and a blunt end at the other end; or c) contain a sticky end at both ends.

These nucleic acids have, among other things, the advantage of being active against a variety of species that are relevant for preclinical and clinical development and/or having few relevant side effects, as well as being stable in vivo and having a long duration of action . They also contain relatively small amounts of non-naturally occurring modified nucleotides, but are nonetheless capable of effectively inhibiting the target gene for long periods of time. The specific modification pattern with several non-naturally occurring modified nucleotides (2 ^g B-modified nucleotides) also simplifies their synthesis.

The nucleic acid may comprise a first strand that contains or preferably consists of the nucleotide sequence of SEQ ID NO: 9, and optionally a second strand that contains or preferably consists of the nucleotide sequence of SEQ ID NO: 10; or a first strand that contains or preferably consists of the nucleotide sequence of SEQ ID NO: 5, and optionally a second strand that contains or preferably consists of the nucleotide sequence of SEQ ID NO: 6; or a first strand that contains or preferably consists of the nucleotide sequence of SEQ ID NO: 1, and optionally a second strand that contains or preferably consists of the nucleotide sequence of SEQ ID NO: 2; or a first strand that contains or preferably consists of the nucleotide sequence of SEQ ID NO: 3, and optionally a second strand that contains or preferably consists of the nucleotide sequence of SEQ ID NO: 4; or a first strand that contains or preferably consists of the nucleotide sequence of SEQ ID NO: 7, and optionally a second strand that contains or preferably consists of the nucleotide sequence of SEQ ID NO: 8; or a first strand that contains or preferably consists of the nucleotide sequence of SEQ ID NO: 11, and optionally a second strand that contains or preferably consists of the nucleotide sequence of SEQ ID NO: 12; or a first strand that contains or preferably consists of the nucleotide sequence of SEQ ID NO: 13, and optionally a second strand that contains or preferably consists of the nucleotide sequence of SEQ ID NO: 14; or a first strand that contains or preferably consists of the nucleotide sequence of SEQ ID NO: 15, and optionally a second strand that contains or preferably consists of the nucleotide sequence of SEQ ID NO: 16; or a first strand that contains or preferably consists of the nucleotide sequence of SEQ ID NO: 17, and optionally a second strand that contains or preferably consists of the nucleotide sequence of SEQ ID NO: 18; or a first strand that contains or preferably consists of the nucleotide sequence of SEQ ID NO: 19, and optionally a second strand that contains or preferably consists of the nucleotide sequence of SEQ ID NO: 20; or a first strand that contains or preferably consists of the nucleotide sequence of SEQ ID NO: 21, and optionally a second strand that contains or preferably consists of the nucleotide sequence of SEQ ID NO: 22; or a first strand that contains or preferably consists of the nucleotide sequence of SEQ ID NO:23, and optionally a second strand that contains or preferably consists of the nucleotide sequence of SEQ ID NO:24; or a first strand that contains or preferably consists of the nucleotide sequence of SEQ ID NO: 25, and optionally a second strand that contains or preferably consists of the nucleotide sequence of SEQ ID NO: 26; or a first strand that contains or preferably consists of the nucleotide sequence of SEQ ID NO: 27, and optionally a second strand that contains or preferably consists of the nucleotide sequence of SEQ ID NO: 28; or a first strand that contains or preferably consists of the nucleotide sequence of SEQ ID NO: 29, and optionally a second strand that contains or preferably consists of the nucleotide sequence of SEQ ID NO: 30; or a first strand that contains or preferably consists of the nucleotide sequence of SEQ ID NO: 31, and optionally a second strand that contains or preferably consists of the nucleotide sequence of SEQ ID NO: 32; or a first strand that contains or preferably consists of the nucleotide sequence of SEQ ID NO: 33, and optionally a second strand that contains or preferably consists of the nucleotide sequence of SEQ ID NO: 34; or a first strand that contains or preferably consists of the nucleotide sequence of SEQ ID NO: 35, and optionally a second strand that contains or preferably consists of the nucleotide sequence of SEQ ID NO: 36; or a first strand that contains or preferably consists of the nucleotide sequence of SEQ ID NO: 37, and optionally a second strand that contains or preferably consists of the nucleotide sequence of SEQ ID NO: 38; or a first strand that contains or preferably consists of the nucleotide sequence of SEQ ID NO: 39, and optionally a second strand that contains or preferably consists of the nucleotide sequence of SEQ ID NO: 40; or the first strand that contains or is preferred

- 3 045986 but consists of the nucleotide sequence SEQ ID NO: 41, and optionally a second strand that contains or preferably consists of the nucleotide sequence SEQ ID NO: 42; or a first strand that contains or preferably consists of the nucleotide sequence of SEQ ID NO: 43, and optionally a second strand that contains or preferably consists of the nucleotide sequence of SEQ ID NO: 44.

A nucleic acid is provided, in which the first strand contains or preferably consists of the nucleotide sequence of SEQ ID NO: 9, and in which the second strand optionally contains or preferably consists of the nucleotide sequence of SEQ ID NO: 10.

The LPA gene contains sequences with a very large number of repeats. Therefore, first-strand nucleic acids with very similar sequences may have perfect sequence complementarity with very different mRNA target regions.

One aspect is a nucleic acid for inhibiting the expression of LPA in a cell, the nucleic acid comprising at least one duplex region that contains: a first strand; and a second chain, wherein said second chain is at least partially complementary to the first chain, wherein said first chain comprises a sequence of at least 15, preferably at least 16, more preferably at least 17, even more preferably at least 18 and most preferably at least 19 nucleotides of any of the reference sequences SEQ ID NO: 9, 5, 1, 3, 7, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35 , 37, 39, 41 or 43, and wherein the number of individual nucleotide mismatches and/or deletions and/or insertions in the first strand sequence relative to the portion of the reference sequence that is contained in the first strand sequence is no more than three, preferably no more than two, more preferably no more than one and most preferably zero. However, the sequence can be modified through a number of modifications that do not change the identity of the nucleotide. For example, modifications to the nucleic acid backbone do not change the identity of the nucleotide because the base itself remains the same as in the reference sequence.

In one aspect, the first nucleic acid strand comprises a sequence of at least 18 nucleotides of any of the reference sequences, preferably any of the reference sequences of SEQ ID NOs: 9 and 5, and wherein the number of individual nucleotide mismatches and/or deletions and/or insertions in the sequence of the first strand relative to the portion of the reference sequence that is contained in the sequence of the first strand is no more than one, and preferably zero.

In one aspect, the first nucleic acid strand comprises a sequence of at least 19 nucleotides of any of the reference sequences SEQ ID NOs: 9 and 5.

When reference is made herein to a reference sequence containing or consisting of unmodified nucleotides, the reference is not limited to the sequence with unmodified nucleotides. The same reference also covers the same nucleotide sequence in which one, more, such as two, three, four, five, six, seven, or more, including all, nucleotides are modified with modifications such as 2'-OMe, 2'-F , ligand, linker, 3'-end or 5'-end modification or any other modification. This also applies to sequences in which two or more nucleotides are linked to each other by a natural phosphodiester bond or any other bond such as a phosphorothioate or phosphodithioate bond.

A double-stranded nucleic acid is a nucleic acid in which the first strand and the second strand hybridize to each other for at least part of their length and are therefore capable of forming a duplex region under physiological conditions, such as PBS at 37°C at a concentration of 1 μM each chains. The first and second strands are preferably capable of hybridizing to each other and therefore forming a duplex region of at least 15 nucleotides, preferably 16, 17, 18 or 19 nucleotides. This duplex region includes nucleotide base pairings between the two strands, preferably based on Watson-Crick base pairing and/or ambiguous base pairing (eg, GU base pairing). All the nucleotides of the two strands in a duplex region must not form base pairs with each other to form a duplex region. A certain number of mismatches, deletions, or insertions are allowed between the nucleotide sequences of two chains. Also possible are sticky ends at either end of the first or second strand or unpaired nucleotides at either end of a double-stranded nucleic acid. The double-stranded nucleic acid is preferably a stable double-stranded nucleic acid under physiological conditions and preferably has a melting point (Tm) of 45°C or more, preferably 50°C or more, and more preferably 55°C or more, for example in PBS at a concentration of 1 µM of each strand, the first strand and the second strand are preferably capable of forming a duplex region (i.e. complementary to each other) for: i) at least part of their length, preferably more than 15 nucleotides along the length of both, ii) along the entire length of the first strand , iii) along the entire length of the second chain and/or iv) along the entire length of both the first and second chains. If the chains are complementary to each other over a certain length, this means that the chains can form base pairs with each other, either through Watson-Crick pairing or through non-uniform pairing.

- 4,045,986 digit base pairings at this length. Each nucleotide in length does not necessarily have to be capable of forming a base pair with the opposite nucleotide in another strand along the entire given length, as long as a stable double-stranded nucleotide can be formed under physiological conditions. However, this is preferred.

A certain number of mismatches, deletions or insertions between the first (antisense) strand and the target sequence or between the first strand and the second (sense) strand can be tolerated in siRNA and in some cases can even increase activity.

By nucleic acid we mean a nucleic acid containing two chains containing nucleotides, which is capable of interfering with the expression of genes. Inhibition can be complete or partial and results in decreased gene expression in a targeted manner. Nucleic acid contains two separate polynucleotide chains; a first chain, which may also be a guide chain; and a second circuit, which may also be a passenger circuit. The first strand and the second strand may be part of the same polynucleotide molecule, which is self-complementary and folds backward to form a double-stranded molecule. The nucleic acid may be a siRNA molecule.

A nucleic acid may contain ribonucleotides, modified ribonucleotides, deoxynucleotides, deoxyribonucleotides, or non-nucleotide nucleotide analogues that are capable of mimicking nucleotides such that they can pair with a corresponding base on a target sequence or complementary strand. The nucleic acid may further comprise a double-stranded nucleic acid portion or a duplex region formed by all or part of a first strand (also known in the art as a guide strand) and all or part of a second strand (also known in the art as a passenger strand). A duplex region is defined as the region starting with the first base pair formed between the first strand and the second strand and ending with the last base pair formed between the first strand and the second strand, inclusive.

By duplex region is meant a region in two complementary or substantially complementary oligonucleotides that are base paired with each other, either by Watson-Crick base pairing or any other method that produces a duplex between oligonucleotide chains that are complementary or substantially complementary. complementary. For example, an oligonucleotide strand containing 21 nucleotide units may pair with another oligonucleotide of 21 nucleotide units, but only 19 nucleotides on each strand are complementary or substantially complementary such that the duplex region consists of 19 base pairs.

The remaining base pairs may exist as 5' and 3' overhangs or as single-stranded regions. Additionally, 100% complementarity is not required in the duplex region; In the duplex region, significant complementarity is allowed. Essential complementarity refers to such complementarity between chains that they are capable of renaturation under biological conditions. Techniques for empirically determining whether two chains are capable of renaturation under biological conditions are well known in the art. In another embodiment, the two chains can be synthesized and added together under biological conditions to determine whether they renature with each other.

The portions of the first strand and the second strand that form the at least one duplex region may be fully complementary or at least partially complementary to each other.

Depending on the length of the nucleic acid, a perfect match between the first strand and the second strand in terms of base complementarity is not necessarily required. However, the first and second strands must be able to hybridize under physiological conditions.

The complementarity between the first strand and the second strand in at least one duplex region may be ideal in that there are no nucleotide mismatches or additional/deleted nucleotides on either strand. In another embodiment, the complementarity may not be ideal. Complementarity can range from about 70% to about 100%. More specifically, the complementarity may be at least 70%, 75%, 80%, 85%, 90%, or 95%, and values in between.

For purposes of the present invention, a portion, for example, in one duplex region that contains at least a portion of the first strand is to be understood as meaning that the duplex region contains at least 10, preferably at least 12, more preferably at least 14, more more preferably at least 16, even more preferably at least 18, and most preferably all of the nucleotides of a given chain reference sequence. A portion of the reference sequence in the duplex region is at least 70%, preferably at least 80%, more preferably at least 90%, even more preferably at least 95%, and most preferably 100% identical to the corresponding portion of the reference sequence . According to another option, the number of individual nucleotide mismatches relative to part of the reference sequence is no more than three, preferably not

- 5 045986 more than two, more preferably no more than one and most preferably zero.

The first strand and the second strand may each contain a region of complementarity that contains at least 15 contiguous nucleotides, differing by no more than 3 nucleotides from any of the sequences listed in table. 1.

Use of a nucleic acid in accordance with the present invention involves the formation of a duplex region between all or part of the first strand and a portion of the target nucleic acid. The portion of a target nucleic acid that forms a first-strand duplex region, defined as the region that begins with the first base pair formed between the first strand and the target sequence and ends with the last base pair formed between the first strand and the target sequence, inclusive , is the target nucleic acid sequence or simply the target sequence. The duplex region formed between the first strand and the second strand need not be similar to the duplex region formed between the first strand and the target sequence. This means that the second strand may have a different sequence from the target sequence; however, the first strand must be capable of forming a duplex structure with both the second strand and the target sequence, at least under physiological conditions.

The complementarity between the first strand and the target sequence can be perfect (there are no nucleotide mismatches or additional/deleted nucleotides in each nucleic acid).

The complementarity between the first strand and the target sequence may not be ideal. Complementarity can range from about 70% to about 100%. More specifically, the complementarity may be at least 70%, 80%, 85%, 90%, or 95%, and values in between.

The identity between the first strand and the complementary sequence of the target sequence can range from about 75% to about 100%. More specifically, the complementarity may be at least 75%, 80%, 85%, 90%, or 95%, and values in between, as long as the nucleic acid is capable of reducing or inhibiting LPA expression.

A nucleic acid having less than 100% complementarity between the first strand and the target sequence may be able to reduce LPA expression to the same level as a nucleic acid having perfect complementarity between the first strand and the target sequence. In another embodiment, it may be able to reduce LPA expression to a level that is 15-100% of the reduction achieved with a perfectly complementary nucleic acid.

In one aspect, the nucleic acid includes a first nucleic acid strand and a second nucleic acid strand, wherein the first strand is capable of hybridizing under physiological conditions to a nucleic acid of the sequence SEQ ID NO: 10, 6, 2, 4, 8, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42 or 44;

wherein the second strand is capable of hybridizing under physiological conditions with the first strand to form a duplex region; and wherein the nucleotides at positions 2 and 14 from the 5' end of the first strand are modified with a 2'-fluoro modification, and the nucleotides on the second strand that correspond to positions 11-13 of the first strand are modified with a 2'-fluoro modification.

Nucleic acids capable of hybridization under physiological conditions are nucleic acids that are capable of forming base pairs, preferably Watson-Crick base pairs or ambiguous base pairs, between at least a portion of opposing nucleotides in the strands to form at least a duplex region. Such double-stranded nucleic acid is preferably a stable double-stranded nucleic acid under physiological conditions (eg, in PBS at 37°C at a concentration of 1 μM each strand), meaning that under such conditions the two strands remain hybridized to each other. The Tm of the double-stranded nucleotide is preferably 45°C or more, preferably 50°C or more, and more preferably 55°C or more.

One aspect relates to a nucleic acid for inhibiting LPA expression, wherein the nucleic acid comprises a first sequence of at least 15, preferably at least 16, more preferably at least 17, even more preferably at least 18, and most preferably all nucleotides different no more than 3 nucleotides, preferably no more than 2 nucleotides, more preferably no more than 1 nucleotide, and most preferably not different by a single nucleotide from any of the sequences in the table. 1, wherein the first sequence is capable of hybridizing to a transcript of a target gene (eg, mRNA) under physiological conditions. Preferably, the nucleic acid further comprises a second sequence of at least 15, preferably at least 16, more preferably at least 17, even more preferably at least 18, and most preferably all nucleotides differing by no more than 3 nucleotides, preferably no more how

- 6 045986 by 2 nucleotides, more preferably by no more than 1 nucleotide and most preferably not differing by a single nucleotide from any of the sequences in the table. 1, wherein the second sequence is capable of hybridizing with the first sequence under physiological conditions, and preferably the nucleic acid is a siRNA capable of inhibiting the expression of LPA through the RNAi pathway.

The nucleic acids described herein can inhibit the expression of LPA. Inhibition can be complete, i.e. 0% residual expression compared to the expression level of LPA in the absence of the nucleic acid according to the invention. Inhibition of LPA expression may be partial, i.e. may be 15%, 20%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95% or intermediate expression values LPA in the absence of a nucleic acid according to the invention. The level of inhibition can be measured by comparing the treated sample with an untreated sample or with a sample treated with a control, such as, for example, siRNA that does not target LPA. Inhibition can be measured by measuring LPA mRNA and/or protein levels or levels of a biomarker or indicator that correlates with the presence or activity of LPA. It can be measured in cells that may have been treated in vitro with the nucleic acid described herein. Alternatively or in addition, inhibition can be measured in cells such as hepatocytes, or in tissue such as liver tissue, or in an organ such as liver, or in a body fluid such as blood, serum, lymph, or any another part of the body that was taken from a subject who has previously received treatment with a nucleic acid described herein. Preferably, inhibition of LPA expression is determined by comparing the level of LPA mRNA measured in LPA-expressing cells after 24 or 48 hours of in vitro treatment under ideal conditions (see examples for relevant concentrations and conditions) with the nucleic acid described herein with the level of LPA mRNA , measured in the same cells without or with mock treatment or with control nucleic acid treatment.

As used herein, the term inhibit, suppress, or reduce, with respect to gene expression, means that the expression of a gene or the level of RNA molecules or equivalent RNA molecules encoding one or more proteins or protein subunits (e.g., mRNA), or the activity of one or more proteins or protein subunits is reduced below the level observed in the absence of the nucleic acid or conjugated nucleic acid of the present invention, or in relation to an siRNA molecule with no known homology to human transcripts (referred to herein as a non-inhibitory control). Such a control may be conjugated and modified in a similar manner to the molecule of the present invention and delivered to the target cell in a similar manner; for example, expression may be reduced to 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, 15% or intermediate values, or to a value less than that observed in the absence of nucleic acid acid or conjugated nucleic acid or in the presence of a non-inhibitory control.

The nucleic acid may comprise a first strand and a second strand, each of which is 19-25 nucleotides in length. The first chain and the second chain may have different lengths.

The first strand and/or second strand may each be 17-35, preferably 18-30, more preferably 19-25, and most preferably 19 nucleotides in length, and at least one duplex region may be 10-25 nucleotides, preferably 18-23 nucleotides in length. The duplex may contain two separate strands or may contain a single strand that includes a first strand and a second strand.

The first strand may be 17-25 nucleotides long, preferably it may be 18-24 nucleotides long, it may be 18, 19, 20, 21, 22, 23 or 24 nucleotides long. Most preferably, the first strand is 19 nucleotides in length. The second strand may independently be 17-25 nucleotides long, preferably it may be 18-24 nucleotides long, it may be 18, 19, 20, 21, 22, 23 or 24 nucleotides long. More preferably, the second strand is 18 or 19 nucleotides in length, and most preferably it is 18 nucleotides in length.

A nucleic acid can be 15-25 base pairs in length. A nucleic acid can be 17-23 base pairs in length. A nucleic acid can be 17-25 base pairs in length. A nucleic acid can be 23-24 base pairs in length. A nucleic acid can be 19-21 base pairs in length. A nucleic acid can be 21-23 base pairs in length.

The nucleic acid may contain a duplex region that consists of 19-25 nucleotide base pairs. The duplex region may consist of 17, 18, 19, 20, 21, 22, 23, 24, or 25 base pairs, which may be contiguous. Preferably, the duplex region consists of 19 base pairs.

Preferably, the nucleic acid mediates RNA interference.

According to one embodiment of the present invention, a nucleic acid for inhibiting the expression of LPA in a cell contains at least one duplex region that contains a first strand and a second strand that is at least partially complementary to the first strand, wherein said first strand contains a sequence of at least 15 , preferably at least 16, more preferably at least 17, even more preferably at least

- 7 045986 at least 18 and most preferably at least 19 nucleotides, wherein the sequence is at least 70%, preferably at least 80%, more preferably at least 90%, even more preferably at least 95% and most preferably 100% identical to any of the sequences of SEQ ID NO: 9, 5, 1, 3, 7, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41 or 43.

In a further aspect, the disclosed nucleic acid or conjugated nucleic acid can reduce LPA expression by at least 15% compared to the expression observed in the absence of the nucleic acid or conjugated nucleic acid. All preferred features of any of the previous aspects also apply to this aspect. In particular, LPA expression may be reduced to at least the following predetermined percentages (%) or to less than 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, 15%, or less than and intermediate values relative to the expression that was observed in the absence of nucleic acid or conjugated nucleic acid or in the presence of a non-inhibitory control.

The nucleic acid may contain a sticky end at one end and a blunt end at the other. The nucleic acid may contain a sticky end at both ends. The nucleic acid may contain blunt ends at both ends. The nucleic acid may be blunt ended at the 5' end of the first strand and the 3' end of the second strand or at the 3' end of the first strand and the 5' end of the second strand.

In this application, overhang has its usual and accepted meaning in the art, i.e. a single-stranded portion of a nucleic acid that extends beyond the terminal nucleotide of the complementary strand in a double-stranded nucleic acid. The term blunt end includes a double-stranded nucleic acid in which both strands end at the same position, regardless of whether the terminal nucleotide(s) are paired. The terminal nucleotide of the first strand and the second strand at the blunt end may be paired. The terminal nucleotide of the first strand and the second strand at the blunt end may be unpaired. The two terminal nucleotides of the first strand and the second strand at the blunt end may be paired. The two terminal nucleotides of the first strand and the second strand at the blunt end may be unpaired.

The nucleic acid may contain a sticky end at the 3' or 5' end. The nucleic acid may contain a 3' overhang on the first strand. The nucleic acid may contain a 3' overhang on the second strand. The nucleic acid may contain a 5' overhang on the first strand. The nucleic acid may contain a 5' overhang on the second strand. The nucleic acid may contain a sticky end at either the 5' end or the 3' end of the first strand. The nucleic acid may contain a sticky end at either the 5' end or the 3' end of the second strand. The nucleic acid may contain a 5' overhang on the first strand and a 3' overhang on the second strand. The nucleic acid may contain a 3' overhang on the first strand and a 5' overhang on the second strand. The nucleic acid may contain a 3' overhang on the first strand and a 3' overhang on the second strand. The nucleic acid may contain a 5' overhang on the first strand and a 5' overhang on the second strand.

The overhang at the 3' end or 5' end of the second strand or the first strand may be selected from 1, 2, 3, 4 and 5 nucleotides in length. Optionally, the overhang may consist of 1 or 2 nucleotides, which may or may not be modified.

Preferably the nucleic acid is siRNA. MiRNAs are short interfering or short silencing RNAs that are capable of inhibiting target gene expression through the RNA interference (RNAi) pathway. Inhibition occurs through targeted degradation of target gene mRNA transcripts after transcription. MiRNA is part of the RISC complex. The RISC complex specifically targets the target RNA through sequence complementarity of the first (antisense) strand with the target sequence.

Preferably, the nucleic acid mediates RNA interference (RNAi). Therefore, the nucleic acid, or at least the first strand of the nucleic acid, may preferably be included in the RISC complex. As a result, the nucleic acid or at least the first nucleic acid strand is therefore capable of directing the RISC complex to a particular RNA target with which the nucleic acid or at least the first nucleic acid strand is at least partially complementary. The RISC complex then specifically cleaves this target RNA and results in inhibition of expression of the gene from which the RNA is derived.

Nucleic acid modifications

Unmodified polynucleotides, in particular ribonucleotides, may be susceptible to degradation by cellular nucleases, and as such, modifications/modified nucleotides may be incorporated into the nucleic acid of the present invention. Such modifications can help stabilize the nucleic acid, making it more resistant to nucleases. Improved stability ensures that the nucleic acids are active as RNA interference mediators for longer periods of time and is particularly desirable if the nucleic acids are to be used for treatment.

The nucleic acid modifications of the present invention generally provide an effective tool to overcome potential limitations, including, but not limited to

- 8 045986 this, stability and bioavailability in vitro and in vivo, inherent in natural RNA molecules. The nucleic acid in accordance with the present invention can be modified by chemical modifications. The modified nucleic acid may also minimize the possibility of inducing interferon activity in humans. The modification may further enhance the functional delivery of the nucleic acid to the target cell. The modified nucleic acid of the present invention may contain one or more chemically modified ribonucleotides of either or both of the first strand or the second strand. A ribonucleotide may contain chemical modification of a base, sugar, or phosphate groups. Ribonucleic acid can be modified by substitution or insertion of nucleic acid analogues or bases.

Preferably, at least one nucleotide of the first and/or second strand of the nucleic acid is a modified nucleotide, preferably a non-naturally occurring nucleotide, such as preferably a 2'-F modified nucleotide.

One or more nucleic acid nucleotides of the present invention may be modified. The nucleic acid may contain at least one modified nucleotide. The modified nucleotide may be in the first strand. The modified nucleotide may be in the second strand. The modified nucleotide may be located in a duplex region.

The modified nucleotide may be located outside the duplex region, i.e. in the single-stranded region. The modified nucleotide may be on the first strand and may be located outside the duplex region. The modified nucleotide may be on the second strand and may be located outside the duplex region. The 3' terminal nucleotide of the first strand may be a modified nucleotide. The 3' terminal nucleotide of the second strand may be a modified nucleotide. The 5' terminal nucleotide of the first strand may be a modified nucleotide. The 5' terminal nucleotide of the second strand may be a modified nucleotide.

A nucleic acid of the present invention may contain 1 modified nucleotide, or a nucleic acid of the present invention may contain about 2-4 modified nucleotides, or a nucleic acid may contain about 4-6 modified nucleotides, about 6-8 modified nucleotides, about 8-10 modified nucleotides , approximately 10-12 modified nucleotides, approximately 12-14 modified nucleotides, approximately 14-16 modified nucleotides, approximately 16-18 modified nucleotides, approximately 18-20 modified nucleotides, approximately 20-22 modified nucleotides, approximately 22-24 modified nucleotides, 24-26 modified nucleotides or approximately 26-28 modified nucleotides or all of the nucleotides may be modified. In each case, the nucleic acid containing the specified modified nucleotides retains at least 50% of its activity compared to the same nucleic acid, but without the specified modified nucleotides, or vice versa. A nucleic acid may retain 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 100%, including intermediate values, of its activity compared to the same nucleic acid, but without the specified modified nucleotides, or may have more than 100% of the activity of the same nucleic acid without the specified modified nucleotides.

The modified nucleotide may be a purine or a pyrimidine. At least half of the purines can be modified. At least half of the pyrimidines can be modified. All of the purines can be modified. All of the pyrimidines can be modified. The modified nucleotides may be selected from the group consisting of a 3'terminal deoxythymine (dT) nucleotide, a 2'-O-methyl-modified nucleotide, a 2'modified nucleotide, a 2'deoxy-modified nucleotide, a closed nucleotide, a nitrogen-base-deprived nucleotide, 2'-amino-modified nucleotide, 2'-alkyl-modified nucleotide, morpholino nucleotide, phosphoamidate, unnatural base-containing nucleotide, nucleotide containing 5'-phosphothioate group, nucleotide containing 5'phosphate or 5'-phosphate mimetic, and terminal nucleotide , connected to a cholesterol derivative or dodecanoic acid bisdecylamide group.

The nucleic acid may contain a nucleotide containing a modified nucleotide, the base being selected from 2-aminoadenosine, 2,6-diaminopurine, inosine, pyridin-4-one, pyridin2-one, phenyl, pseudouracil, 2,4,6-trimethoxybenzene, 3- methyluracil, dihydrouridine, naphthyl, aminophenyl, 5-alkylcytidine (e.g. 5-methylcytidine), 5-alkyluridine (e.g. ribothymidine), 5-halouridine (e.g. 5-bromuridine), 6-azapyrimidine, 6-alkylpyrimidine (e.g. 6methyluridine ), propine, queuosine, 2-thiouridine, 4-thiouridine, vaibutosine, vaibutoxosine, 4-acetylcytidine, 5-(carboxyhydroxymethyl)uridine, 5'-carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminomethyluridine, beta-O-galactosylqueuosine, 1-methyladenosine, 1 - methylinosine, 2,2-dimethylguanosine, 3-methylcytidine, 2-methyladenosine, 2-methylguanosine, F-methyladenosine, 7

- 9 045986 methylguanosine, 5-methoxyaminomethyl-2-thiouridine, 5-methylaminomethyluridine, 5-methylcarbonylmethyluridine, 5-methyloxyuridine, 5-methyl-2-thiouridine, 2-methylthio-N-6-isopentenyladenosine, beta-O-mannosylqueuosine, uridine -5-hydroxyacetic acid and 2-thiocytidine.

The nucleic acids discussed herein include unmodified RNA, as well as RNA that has been modified, for example, to improve potency, and nucleoside surrogate polymers. Unmodified RNA refers to a molecule in which the nucleic acid components, namely sugars, bases and phosphate groups, are the same or substantially the same as those that occur naturally, such as those that occur naturally in the human body. As used herein, a modified nucleotide refers to a nucleotide in which one or more of the nucleotide components, namely sugars, bases and phosphate groups, are different from those found in nature. Although modified nucleotides are so called because of their modification, the term also includes molecules that are not nucleotides, such as a polynucleotide molecule in which the ribophosphate backbone is replaced by a non-ribophosphate construct that allows hybridization between the strands, i.e. modified nucleotides mimic the ribophosphate backbone.

Many of the modifications described below that occur in a nucleic acid will be repeated in a polynucleotide molecule, such as modification of a base or a phosphate group, or a non-union O from a phosphate group. In some cases the modification will occur at all possible positions/nucleotides in a polynucleotide, but in many cases it will not occur. The modification may occur only at the 3' or 5' terminal position, may occur only in terminal regions, for example, at a position on the terminal nucleotide or in the last 2, 3, 4, 5 or 10 nucleotides of the chain. The modification may occur in a double-stranded region, a single-stranded region, or both. The modification may occur only in the double-stranded region of the nucleic acid according to the present invention, or may occur only in the single-stranded region of the nucleic acid according to the present invention. The phosphothioate modification at the non-connecting O position may occur at only one or both ends, may occur only at the terminal region, for example at a position on the terminal nucleotide or the last 2, 3, 4 or 5 nucleotides, or may occur in duplex and/or single-stranded areas, particularly at the ends. The 5'-end or 3'-end can be phosphorylated.

The stability of the nucleic acid of the present invention can be increased by including specific bases at the overhangs or by including modified nucleotides at the single-stranded overhangs, for example, at the 5' or 3' overhangs or both. Purine nucleotides may be included in the sticky ends. All or some of the bases at the 3' or 5' overhang may be modified. Modifications may include the use of modifications on the 2'-OH group of the ribose sugar, the use of deoxyribonucleotides instead of ribonucleotides, and modifications on the phosphate group, such as phosphorothioate modifications. The sticky ends do not need to be homologous to the target sequence.

Nucleases can hydrolyze phosphodiester bonds of nucleic acids. However, chemical modifications of nucleic acids can impart improved properties and can make oligoribonucleotides more resistant to nucleases.

As used herein, modified nucleic acids may include one or more of the following:

(i) a change, for example, substitution of one or both of the non-joining phosphate oxygen atoms and/or one or more of the joining phosphate oxygen atoms (referred to as a joining event, even if occurring at the 5' and 3' end of the nucleic acid according to the present invention );

(ii) alteration, eg substitution of a ribose sugar component, eg 2'-hydroxyl on the ribose sugar;

(iii) replacement of the phosphate group with dephospho linkers;

(iv) modification or replacement of natural substrate;

(v) replacement or modification of the ribose phosphate backbone;

(vi) modification of the 3' end or 5' end of the RNA, for example, removal, modification or replacement of a terminal phosphate group or conjugation of a group, for example a fluorescently labeled group, to the 3' or 5' end of the RNA.

The terms substitution, modification, change indicate a difference from a natural molecule.

Specific modifications are discussed in more detail below.

Examples of modified phosphate groups include phosphorothioate, phosphoselenates, boranophosphates, boranophosphate esters, hydrogen phosphonates, phosphoamidates, alkyl or arylphosphonates, and phosphotriesters. In phosphodithioates, both non-bonding oxygen atoms are replaced by sulfur. One, each, or both of the non-bonding oxygen atoms in the phosphate group may be independently substituted by any of S, Se, B, C, H, N, or OR (R is alkyl or aryl).

The phosphate linker can also be modified by replacing the connecting oxygen atom with nitrogen (bridged phosphoamidates), sulfur (bridged phosphorothioates) and carbon (bridged phosphoamidates).

- 10 045986 tylenephosphonates). Substitution can occur at the terminal oxygen. It is possible to replace non-bonding oxygen atoms with nitrogen.

The modified nucleotide may contain modification of sugar groups. The 2'-hydroxyl group (OH) may be modified or replaced with a number of different oxy or deoxy substituents.

Examples of modifications with an oxy-2'-hydroxyl group include alkoxy or aryloxy (OR, eg R=H, alkyl, cycloalkyl, aryl, aralkyl, heteroaryl or sugar); polyethylene glycols (PEG), O(CH ₂ CH ₂ O)nCH ₂ CH ₂ OR; closed nucleic acids (LNA), in which the 2'-hydroxyl is connected, for example, by a methylene bridge, to the 4'-carbon of the same ribose sugar; O-AMINE (AMHH=NH ₂ ; alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino or diheteroarylamino, ethylenediamine, polyamino) and aminoalkoxy, O(CH ₂ ) _p -AMIN, (for example, AMMANNU alkylamino, dialkylamino, heterocyclyl, arylamino , diarylamino, heteroarylamino or diheteroarylamino, ethylenediamine, polyamino).

Deoxy modifications include hydrogen, halogen, amino (eg, NH2; alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino, diheteroarylamino or amino acid); KH(CH ₂ CH ₂ KH) _p CH ₂ CH ₂ -AMIN (AMIN=KH ₂ ; alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino or diheteroarylamino), -NHC(O)R (P=alkyl. cycloalkyl, aryl , aralkyl, heteroaryl or sugar), cyano; mercapto; alkyl-thio-alkyl; thioalkoxy; and alkyl, cycloalkyl, aryl, alkenyl and alkynyl, which may be optionally substituted, for example, with an amino function. Other substituents from certain embodiments include 2'-methoxyethyl, 2'OCH3, 2'-O-allyl, 2'-C-allyl, and 2'-fluoro. A sugar group may also contain one or more carbon atoms that have a stereochemical configuration opposite that of the corresponding carbon in ribose. Thus, the modified nucleotide may contain a sugar such as arabinose.

Modified nucleotides may also contain baseless sugars that lack the nucleobase at C-1'. These baseless sugars may further contain modifications on one or more of the sugar atoms.

2' modifications can be used in combination with one or more phosphate linker modifications (eg, phosphorothioate).

Phosphate groups can be individually replaced by connectors that do not contain phosphorus.

Examples of groups that can replace the phosphate group include siloxane, carbonate, carboxymethyl, carbamate, amide, thioether, ethylene oxide linker, sulfonate, sulfonamide, thioformacetal, formoacetal, oxime, methyleneimino, methylenemethylimino, methylenehydrazo, methylenedimethylhydrazo and methyleneoxymethylimino. In certain embodiments of the present invention, substitutions may include methylenecarbonylamino and methylenemethylimino groups.

The phosphate linker and ribose sugar can be replaced with nuclease-resistant nucleotides.

Examples include nucleoside surrogates such as morpholino, cyclobutyl, pyrrolidine, and peptide nucleic acid (PNA). In certain embodiments, PNC surrogates may be used.

The 3' and 5' ends of the oligonucleotide can be modified. Such modifications may be at the 3' end or the 5' end or at both ends of the molecule. These may involve modification or substitution of the entire terminal phosphate or one or more phosphate group atoms. For example, the 3' and 5' ends of the oligonucleotide may be conjugated to other functional molecular groups, such as labeling groups, such as fluorophores (e.g., pyrene, TAMRA, fluorescein, Cy3 or Cy5 dyes), or protecting groups ( e.g. based on sulfur, silicon, boron or ester). Functional molecular groups can be attached to the sugar via a phosphate group and/or a linker. The terminal linker atom may connect to or replace the connecting atom of a phosphate group or a C-3' or C-5' O, N, S or C sugar group. In another embodiment, the linker can connect to or replace the terminal atom of a surrogate nucleotide (eg, PNA). These spacers or linkers may include, for example, -(CH ₂ ) _n -, -(CH ₂ ) _n N-, -(CH ₂ ) _n O-, -(CH ₂ ) _n S-, -(CH ₂ CH ₂ O) _n CH ₂ CH ₂ O- (for example, n=3 or 6), baseless sugars, amide, carboxy, amine, oxyamine, hydroxyimine, thioether, disulfide, thiourea, sulfonamide or morpholino, or biotin and fluorescein reagents. The 3' end may be an -OH group.

Other examples of terminal modifications include dyes, intercalating agents (eg, acridines), cross-linkers (eg, psoralen, mitomycin C), porphyrins (TPPC4, texaphyrin, sapphirin), polycyclic aromatic hydrocarbons (eg, phenazine, dihydrophenazine), artificial endonucleases, EDTA , lipophilic carriers (e.g. cholesterol, bile acid, adamantaneacetic acid, 1-pyrenebutyric acid, dihydrotestosterone, 1,3-bis-O(hexadecyl)glycerol, geranyloxyhexyl group, hexadecylglycerol, borneol, menthol, 1,3propanediol, heptadecyl group, palmitic acid, myristic acid, O3(oleoyl)lithocholic acid, O3-(oleoyl)cholenic acid, dimethoxytrityl or phenoxazine) and peptide conjugates (e.g. Antennapedia peptide, Tat peptide), alkylating agents, phosphate, amino,

- 11 045986 mercapto, PEG (e.g. PEG-40K), MPEG, [MPEG]2, polyamino, alkyl, substituted alkyl, radiolabeled markers, enzymes, haptens (e.g. biotin), transport/absorption stimulants (e.g. aspirin, vitamin E, folic acid), synthetic ribonucleases (eg, imidazole, bisimidazole, histamine, imidazole clusters, acridine-imidazole conjugates, Eu ³⁺ and tetraazamacrocycle complexes).

Terminal modifications may be added for a number of reasons, including modulation of activity or modulation of degradation resistance. Terminal modifications that can be used to modulate activity include modification of the 5' end with phosphate or phosphate analogues. The nucleic acids of the present invention may be 5'-phosphorylated on the first or second strands or may contain a phosphoryl analogue at the 5' end. 5'-phosphate modifications include modifications that are compatible with RISC-mediated gene silencing. Suitable modifications include: 5'-monophosphate ((HO)2(O)P-O-5');5'-diphosphate((HO)2(O)P-O-P(HO)(O)-O-5');5'triphosphate((HO)2(O)P-O-(HO)(O)P-O-P(HO)(O)-O-5');5'-guanosine cap (7-methylated or unmethylated) (7m-G-0-5'-(H0)(0)P-0-(H0)(0)P-0-P(H0)(0)- 0-5');5'-adenosine cap (App) and any cap structure of a modified or unmodified nucleotide (X-O-5'-(HO)(O)P-O(NO)(O)P-O-P(HO)(O) )-O-5');5'-monothiophosphate(phosphothioate; (HO) ₂ (S)PO-5');5'-monodithiophosphate(phosphodithioate;(HO)(HS)(S)PO-5'),5'-phosphothiolate((HO)2(O)PS-5'); any additional combination of monophosphate, diphosphate and triphosphates in which oxygen is replaced by sulfur (for example, 5'-alphathiotriphosphate, 5'-gamma-thiotriphosphate, etc.), 5'-phosphoamidates ((HO)2(O)P-NH -5', (HO)(NH2)(O)PO-5'), 5'-alkylphosphonates (I=alkyl=methyl, ethyl, isopropyl, propyl, etc., for example, RP(OH)(O) -O-5'-, (OH) ₂ (O)P-5'-CH ₂ -), 5'-vinylphosphonate, 5'-alkyl ether phosphonates ^=alkleether=methoxymethyl (MeOCH2), ethoxymethyl, etc., for example , RP(OH)(O)-O-5'-).

Terminal modifications can also be used to monitor distribution, and in such cases the groups that will be added may include fluorophores such as fluorescein or Alexa dye. Terminal modifications can also be used to enhance absorption, suitable modifications include cholesterol. Terminal modifications can also be used to cross-link an RNA agent to another group.

Adenine, guanine, cytosine and uracil are the most common bases found in RNA. These bases can be modified or replaced to provide RNA with improved properties. For example, nuclease-resistant oligoribonucleotides can be prepared using these bases or synthetic and natural nucleic acid bases (eg, inosine, thymine, xanthine, hypoxanthine, nubularine, isoguanisine or tubercidin) and any one of the above modifications. In another embodiment, substituted or modified analogues of any of the above bases and universal bases can be used. Examples include 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 5-halouracil and cytosine, 5-propynyluracil and cytosine, 6-azouracil, cytosine and thymine, 5- uracil (pseudouracil), 4-thiouracil, 5-halouracil, 5-(2aminopropyl)uracil, 5-aminoallyluracyl, 8-halogen, amino, thiol, thioalkyl, hydroxyl and other 8-substituted adenines and guanines, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine, 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and O-6-substituted purines, including 2-aminopropyladenine, 5-propynyluracil and 5-propynylcytosine, dihydrouracil, 3-deaza-5azacytosine , 2-aminopurine, 5-alkyluracil, 7-alkylguanine, 5-alkylcytosine, 7-deazaadenine, N6,N6dimethyladenine, 2,6-diaminopurine, 5-aminoallyluracil, F-methyluracil, substituted 1,2,4-triazoles, 2- pyridinone, 5-nitroindole, 3-nitropyrrole, 5-methoxyuracil, uracil-5-hydroxyacetic acid, 5methoxycarbonylmethyluracil, 5-methyl-2-thiouracil, 5-methoxycarbonylmethyl-2-thiouracil, 5methylaminomethyl-2-thiouracil, 3-(3- amino-3-carboxypropyl)uracil, 3-methylcytosine, 5-methylcytosine, N<4>-acetylcytosine, 2-thiocytosine, F>-methyladenine. F-isopentyladenine, 2-methylthio-isopentenyladenine, N-methylguanines or O-alkylated bases.

As used herein, the term non-pairing nucleotide analog means a nucleotide analog that contains a non-base pairing group, including but not limited to: >deaminoadenosine (nebularine), 4-Me-indole, 3-nitropyrrole, 5-nitroindole, Ds, Pa, F -Me-ribo-i, N3Me-ribo-T, N3-Me dC, N3-Me-dT, N1-Me-dG, N1-Me-dA, Zh-ethyl-dC, N3-Me dC. In certain embodiments of the present invention, the non-base pairing nucleotide analog is a ribonucleotide. In other embodiments of the present invention, it is a deoxyribonucleotide.

As used herein, the term terminal functionality includes, but is not limited to, halogen, alcohol, amine, carbonic, ester, amide, aldehyde, ketone, and ether groups.

Certain groups may be connected to the 5' end of the first strand or the second strand. These include a baseless ribose group, a baseless deoxyribose group, baseless ribose modifications and a baseless deoxyribose group, including 2'-alkyl modifications; inverted deprived

- 12 045986 nitrogenous base ribose groups and deoxyribose groups devoid of nitrogenous base and their modifications, Sb-imino-Pi; mirror nucleotide, including L-DNA and L-RNA; 5'-OMe-nucleotide; and nucleotide analogues, including 4',5'-methylene nucleotide; 1-β-O-erythrofuranosylnucleotide; 4'-thionucleotide, carbocyclic nucleotide; 5'-aminoalkylphosphate; 1,3-diamino-2-propylphosphate, 3-aminopropylphosphate; 6-aminohexylphosphate; 12-aminododecylphosphate; hydroxypropyl phosphate; 1,5-anhydrohexitol nucleotide; alpha nucleotide; threopentofuranosyl nucleotide; acyclic 3',4'-seconucleotide; 3,4dihydroxybutylnucleotide; 3,5-dihydroxypentylnucleotide, 5'-5'-inverted baseless group; 1,4-butanediol phosphate; 5'-amino; and bridged or non-bridged methylphosphonate and 5'-mercapto groups.

The nucleic acid according to the present invention may contain a nucleotide devoid of a nitrogenous base. As used herein, the term baseless refers to groups that do not contain a base or have other chemical groups in place of the base at the 1' position, for example, a 3',3'-linked or 5',5'-linked deoxyribose baseless derivative.

The nucleic acid may contain one or more nucleotides on the second and/or first strands that are modified. Alternating nucleotides can be modified to form modified nucleotides.

Alternation, as described herein, means that it occurs one after another on a regular basis. In other words, alternation means repeating in turns. For example, if one nucleotide is modified, the next adjacent nucleotide is not modified, the next adjacent nucleotide is modified, and so on. One nucleotide can be modified with a first modification, the next adjacent nucleotide can be modified with a second modification, and the next adjacent nucleotide can be modified with a first modification, and so on, with the first and second modifications being different.

One or more of the nucleotides at odd positions in the first strand of the nucleic acid of the present invention may be modified, with the first strand numbered 5' to 3', the 5'most nucleotide being nucleotide number 1 of the first strand. The term odd, as used herein, means a number that is indivisible by two. Examples of odd numbers are 1, 3, 5, 7, 9, 11 and so on. One or more of the nucleotides at even-numbered positions of the first nucleic acid strand of the present invention may be modified, the first strand being numbered 5' to 3'. The term even, as used herein, means a number that is equally divisible by two. Examples of even numbers are 2, 4, 6, 8, 10, 12, 14 and so on. One or more of the nucleotides at odd positions in the second nucleic acid strand of the present invention may be modified, with the second strand numbered 3' to 5', with the 3'most terminal nucleotide being nucleotide number 1 of the second strand. One or more of the nucleotides at the even-numbered positions of the second nucleic acid strand of the present invention may be modified, the second strand being numbered 3' to 5'.

One or more nucleotides on the first and/or second strands may be modified to form modified nucleotides. One or more of the nucleotides at odd positions in the first strand may be modified. One or more of the nucleotides at the even-numbered positions of the first strand may be modified using at least a second modification, wherein at least the second modification is different from the modification of the one or more nucleotides at the odd-numbered positions. At least one of the one or more modified nucleotides at even positions may be adjacent to at least one or more modified nucleotides at odd positions.

A plurality of nucleotides at odd positions of the first strand may be modified in the nucleic acid of the present invention. Multiple nucleotides at even-numbered positions on the first strand may be modified using a second modification. The first strand may contain contiguous nucleotides that are modified using a common modification. The first strand may also contain adjacent nucleotides that are modified with a second different modification.

One or more of the nucleotides at the odd positions of the second strand may be modified using a modification that is different from the modification of the nucleotides at the odd positions of the first strand, and/or one or more of the nucleotides at the even positions of the second strand may be modified using a modification similar to that for nucleotides in odd positions of the first strand. At least one of the one or more modified nucleotides at the even positions of the second strand may be adjacent to one or more modified odd nucleotides. A plurality of nucleotides at odd positions of the second strand may be modified using a common modification, and/or a plurality of nucleotides at even positions may be modified using a modification that is similar to that present on the odd nucleotides of the first strand. A plurality of nucleotides at odd positions in the second strand may be modified using a second modification, wherein the second modification is different from the modification

- 13,045,986 nucleotides in odd positions of the first strand.

The second strand may contain contiguous nucleotides that are modified using a common modification, which may be a second modification that is different from the modification of nucleotides at odd positions of the first strand.

In the nucleic acid of the present invention, each of the nucleotides at odd positions in the first strand and each of the nucleotides at even positions in the second strand can be modified using a general modification, and each of the nucleotides at even positions in the first strand can be modified using a second modification, and each of the nucleotides at odd positions in the second strand may be modified using a second different modification.

The modified first strand nucleic acid nucleotides of the present invention may be shifted by at least one nucleotide relative to the unmodified or otherwise modified second strand nucleotides.

One or more or each of the nucleotides at the odd positions may be modified in the first strand, and one or more or each of the nucleotides at the even positions at the even positions may be modified in the second strand. One or more or each of the alternating nucleotides on either or both strands may be modified using a second modification. One or more or each of the nucleotides at the even-numbered positions may be modified in the first strand, and one or more or each of the nucleotides at the even-numbered positions may be modified in the second strand. One or more or each of the alternating nucleotides on either or both strands may be modified using a second modification. One or more or each of the nucleotides at odd positions in the first strand may be modified, and one or more of the nucleotides at odd positions in the second strand may be modified using a common modification. One or more or each of the alternating nucleotides on either or both strands may be modified using a second modification. One or more or each of the nucleotides at even positions in the first strand may be modified, and one or more or each of the nucleotides at odd positions in the second strand may be modified using a common modification. One or more or each of the alternating nucleotides on either or both strands may be modified using a second modification.

The nucleic acid of the present invention may contain single-stranded or double-stranded constructs that contain at least two regions of alternating modifications in one or both chains. These alternating regions may contain up to about 12 nucleotides, but preferably contain from about 3 to about 10 nucleotides. Regions of alternating nucleotides may be located at the ends of one or both nucleic acid strands of the present invention. A nucleic acid may contain from 4 to about 10 alternating nucleotides at each end (3' and 5'), and these regions can be separated by about 5 to about 12 contiguous unmodified or differently modified or modified using a common nucleotide modification .

The odd nucleotides of the first strand can be modified and the even nucleotides can be modified using a second modification. The second strand may contain adjacent nucleotides that are modified using a common modification that may be similar to the modification of nucleotides at odd positions in the first strand. One or more nucleotides of the second strand may also be modified using a second modification. One or more nucleotides with a second modification may be adjacent to each other and to nucleotides having a modification that is similar to the modification of nucleotides at odd positions of the first strand. The first strand may also contain phosphorothioate bonds between two nucleotides at the 3' end and at the 5' end. The second strand may contain a phosphorothioate bond between two nucleotides at the 5' end. The second strand may also be conjugated to a ligand at the 5' end.

The nucleic acid of the present invention may comprise a first strand containing contiguous nucleotides that are modified using a common modification. One or more such nucleotides may be adjacent to one or more nucleotides that may be modified using a second modification. One or more nucleotides with a second modification may be contiguous. The second strand may contain contiguous nucleotides that are modified using a common modification, which may be similar to one of the modifications of one or more nucleotides of the first strand. One or more nucleotides of the second strand may also be modified using a second modification. One or more nucleotides with a second modification may be contiguous. The first strand may also contain phosphorothioate bonds between two nucleotides at the 5' end and at the 3' end. The second strand may contain a phosphorothioate bond between two nucleotides at the 3' end. The second strand may also be conjugated to a ligand at the 5' end.

Nucleotides numbered 5' to 3' on the first strand and 3' to 5' on the second strand 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23 and 25 can be modified using modification on the first chain. Nucleotides numbered 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22 and 24 can be modified with

- 14 045986 using the second modification on the first circuit. Nucleotides numbered 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23 can be modified using modification on the second strand. Nucleotides numbered 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22 and 24 can be modified using a second modification on the second strand. In relation to the nucleic acid of the present invention, the nucleotides are numbered from 5' to 3' on the first strand and from 3' to 5' on the second strand.

Nucleotides numbered 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22 and 24 can be modified using modification on the first strand. Nucleotides numbered 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23 can be modified by applying a second modification on the first strand. Nucleotides numbered 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23 can be modified using modification on the second strand. Nucleotides numbered 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22 and 24 can be modified using a second modification on the second strand.

It is understood that if the first and/or second strands are shorter than 25 nucleotides in length, for example 19 nucleotides in length, then there are no nucleotides numbered 20, 21, 22, 23, 24 and 25 to be modified. One skilled in the art will understand the above description to apply to shorter circuits accordingly.

One or more modified nucleotides on the first strand may be paired with modified nucleotides on the second strand having a common modification. One or more modified nucleotides on the first strand may be paired with modified nucleotides on the second strand having a different modification. One or more modified nucleotides on the first strand may be paired with unmodified nucleotides on the second strand. One or more modified nucleotides on the second strand may be paired with unmodified nucleotides on the first strand. In other words, alternating nucleotides may be aligned on two strands such that, for example, all modifications in alternating regions of the second strand are paired with identical modifications in the first strand or, alternatively, the modifications may be offset by a single nucleotide sharing modifications in the alternating regions one strand paired with different modifications (i.e., a second or additional modification) on another strand. Another option is to have different modifications in each of the circuits.

Modifications on the first strand can be shifted by one nucleotide relative to modified nucleotides on the second strand so that nucleotides with a common modification do not pair with each other.

The modification and/or modifications may be individually and independently selected from the group consisting of 3'-terminal deoxythymine, 2'-O-methyl, 2'-deoxy modification, 2'-amino modification, 2'-alkyl modification , morpholino modification, phosphoamidate modification, modification with a 5'phosphothioate group, modification with a 5'-phosphate or a 5'-phosphate mimetic, as well as modification with a cholesterol derivative or a dodecanoic acid bisdecylamide group, and/or the modified nucleotide may be any of the closed nucleotide, a nucleotide lacking a nitrogenous base or containing a non-naturally occurring nucleotide base.

At least one modification may be 2'-O-methyl and/or at least one modification may be 2'-F. Additional modifications described herein may be present on the first and/or second circuits.

As used herein, similar or common modification means the same modification for any nucleotide, whether A, G, C or U, modified with a group such as a methyl group or a fluoro group. This does not imply a similar addition at the same nucleotide. For example, 2'F-dU, 2'F-dA, 2'F-dC, 2'F-dG are all considered analogous or common modifications, as are 2'-OMe-rU, 2'-OMe-rA; 2'-OMe-rC; 2'-OMe-rG. The 2'-F modification is a modification different from the 2'-OMe modification.

Some typical modified nucleic acid sequences according to the present invention are shown in the examples. These examples are intended to be representative and not limiting.

Preferably, the nucleic acid may contain a modification and a second or additional modification that are individually and independently selected from the group consisting of a 2'-O-methyl modification and a 2'-E modification. The nucleic acid may contain a modification that is 2'-O-methyl (2'-OMe), which may be a first modification, and a second modification, which is 2'-F. The nucleic acid of the present invention may also contain a phosphorothioate modification and/or a deoxy modification, which may be present on or between the 2 or 3 terminal nucleotides of each or either end of each or both strands.

The present invention provides, as an additional aspect, a nucleic acid for inhibiting the expression of LPA in a cell, comprising the nucleotide sequence SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41 or 43, in which the nucleotides of the first strand are modified using a first modification on odd nucleotides and modified using a second modification on even nucleotides, and the nucleotides of the second

- 15 045986 chains are modified using a third modification on even nucleotides and modified using a fourth modification on odd nucleotides, wherein at least the first modification is different from the second modification, and the third modification is different from the fourth modification. The third and first modifications may be the same or different, the second and fourth modifications may be the same or different. The first and second modifications may be different from each other, and the third and fourth modifications may be different from each other.

The second strand may contain the nucleotide sequence SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42 or 44. The first strand nucleotides may be modified with a first modification on odd nucleotides and modified with a second modification on even nucleotides, and the second strand may be modified on odd nucleotides with a second modification and modified with a first modification on even nucleotides. The first modification may be 2'OMe, and the second modification may be 2'F. The first strand may comprise the nucleotide sequence of SEQ ID NO: 5 or SEQ ID NO: 9, and/or the second strand may contain the nucleotide sequence of SEQ ID NO: 6 or SEQ ID NO: 10. Modifications may be those presented in table. 1.

The nucleic acid disclosed herein, in which the nucleotides at positions 2 and 14 from the 5' end of the first strand are not modified with a 2'-O-methyl modification, and the nucleotide on the second strand, which corresponds to position 13 of the first strand, is not modified using 2'-Omethyl modification.

A nucleotide on the second strand that corresponds to a position on the first strand is suitably a nucleotide that pairs with said nucleotide on the first strand.

In one aspect, the nucleotide on the second strand that corresponds to position 13 of the first strand is a nucleotide that base pairs with position 13 of the first strand.

In one aspect, the nucleotide on the second strand that corresponds to position 11 of the first strand is a nucleotide that base pairs with position 11 of the first strand.

In one aspect, the nucleotide on the second strand that corresponds to position 12 of the first strand is a nucleotide that base pairs with position 12 of the first strand.

This nomenclature can be applied to other positions of the second circuit. For example, in a 19-mer nucleic acid that is double-stranded and blunt-ended, position 13 of the first strand will pair with position 7 of the second strand. Position 11 of the first chain will pair with position 9 of the second chain. This nomenclature can be applied to other positions of the second circuit.

The nucleotide that corresponds to position 13 of the first strand is suitably position 13 of the second strand, when counted 3' of the second strand, starting from the first nucleotide of the double-stranded region. Likewise, position 11 of the second strand is suitably the 11th nucleotide 3' of the second strand, starting from the first nucleotide of the double-stranded region. This nomenclature can be applied to other positions of the second circuit.

In one aspect, in the case of partial complementarity between the first and second strands, a nucleotide on the second strand that matches a position on the first strand may not necessarily form a base pair if that position is a position at which there is a mismatch, but the principle of nomenclature still applies.

Preferably, first and second strands are completely complementary throughout the duplex region (ignoring any overhanging regions) and there are no mismatches in the double-stranded nucleic acid region.

Also preferred are:

a nucleic acid disclosed herein, in which the nucleotides at positions 2 and 14 from the 5' end of the first strand are not modified with a 2'-O-methyl modification, and the nucleotide on the second strand, which corresponds to position 11 of the first strand, is not modified using 2'-Omethyl modification;

a nucleic acid disclosed herein, in which the nucleotides at positions 2 and 14 from the 5' end of the first strand are not modified with a 2'-O-methyl modification, and the nucleotides on the second strand that correspond to positions 11 and 13 of the first strand, not modified with 2'-O-methyl modification.

In one aspect, the nucleotide on the second strand that corresponds to position 12 of the first strand is not modified with a 2'-O-methyl modification. This restriction on the nucleic acid can be observed with any other restriction described in this application.

Thus, another aspect of the present invention is the nucleic acid disclosed herein, in which the nucleotides at positions 2 and 14 from the 5' end of the first strand are not modified with a 2'-O-methyl modification, and nucleotides on the second strand that correspond to positions 11-13 of the first chain, not modified using 2'-O-methyl modification.

The nucleic acid disclosed herein, wherein the nucleotides at positions 2 and 14 from the 5' end of the first strand are not modified with a 2'-O-methyl modification, and the nucleotides

- 16 045986 on the second chain, which correspond to position 11 or 13, or 11 and 13, or 11-13 of the first chain, are modified using a 2'-fluoro modification.

The nucleic acid disclosed herein, in which the nucleotides at positions 2 and 14 from the 5' end of the first strand are modified using a 2'-fluoro modification, and the nucleotides on the second strand that correspond to positions 11 or 13, or 11 and 13 , or 11-13 of the first chain, are not modified using the 2'-O-methyl modification.

The nucleic acid disclosed herein, in which the nucleotides at positions 2 and 14 from the 5' end of the first strand are modified using a 2'-fluoro modification, and the nucleotides at the second strand that correspond to positions 11, or 13, or 11 and 13 or preferably 11-13 of the first chain are modified using a 2'-fluoro modification. Preferably, in this embodiment, all even nucleotides of the first strand are modified with a 2-fluoro modification, and all odd nucleotides of the first strand are modified with a 2' O-methyl modification. In addition, nucleotides on the second strand other than those corresponding to position 11, or 13, or 11 and 13, or preferably 11-13 of the first strand, are modified with a 2 O-methyl modification. One advantage of such a nucleic acid is that it contains a relatively small amount of non-naturally occurring modified nucleotides, but is still capable of effectively inhibiting the target gene for long periods of time. Such a nucleic acid is easier to synthesize than corresponding nucleic acids with a large number of non-naturally occurring (2'F modified) nucleotides.

A nucleic acid disclosed herein in which more than 50% of the first and/or second strand nucleotides contain a 2'-O-methyl modification, e.g., more than 55%, 60%, 65%, 70%, 75%, 80%, or 85% or more of the first and/or second strands contain a 2'-O-methyl modification, preferably as measured as a percentage of the total nucleotides in both the first and second strands.

A nucleic acid disclosed herein in which more than 50% of the first and/or second strand nucleotides contain a naturally occurring modification of RNA, for example in which more than 55%, 60%, 65%, 70%, 75%, 80% or 85% or more of the first and/or second strands contain such modification, preferably as measured as a percentage of the total number of nucleotides of both first and second strands. Suitable natural modifications include, in addition to the 2-O'-methyl, other 2'-sugar modifications, in particular the 2'-H modification resulting in a DNA nucleotide.

A nucleic acid disclosed herein containing no more than 20%, e.g. no more than 15%, e.g. no more than 10%, of nucleotides that have 2'-modifications that are not 2'-methyl modifications, on the first and/or or second strands, preferably as measured as a percentage of the total number of nucleotides of both the first and second strands.

A nucleic acid disclosed herein containing no more than 20% (e.g., no more than 15% or no more than 10%) 2'-fluoro modifications on the first and/or second strands, preferably as measured as a percentage of the total nucleotides of both chains.

A nucleic acid disclosed herein in which all nucleotides are modified using a 2'-O-methyl modification, except positions 2 and 14 from the 5' end of the first strand and nucleotides on the second strand that correspond to position 11 or 13, or 11 and 13, or preferably 11-13 of the first chain. Preferably, nucleotides that are not modified with 2'-O-methyl are modified with fluorine at the 2' position.

Preferred is the nucleic acid disclosed herein in which all nucleotides of the nucleic acid are modified at the 2' sugar position. Preferably, these nucleotides are modified using a 2'-fluoro modification, which modification is not a 2'-O-methyl modification.

The nucleic acids of the present invention may contain one or more nucleotides modified at the 2' position using a 2'-H, and therefore containing a DNA nucleotide within the nucleic acid. The nucleic acids of the present invention may contain DNA nucleotides at positions 2 and/or 14 of the first strand, measured from the 5' end of the first strand. Nucleic acids may contain DNA nucleotides on the second strand that correspond to position 11 or 13, or 11 and 13, or 11-13 of the first strand.

In one aspect, there is no more than one DNA per nucleic acid of the present invention.

The nucleic acids of the present invention may contain one or more LNAnucleotides. The nucleic acids of the present invention may contain LNA nucleotides at positions 2 and/or 14 of the first strand, measured from the 5' end of the first strand. Nucleic acids may contain LNAs on the second strand that correspond to position 11 or 13, or 11 and 13, or 11-13 of the first strand.

In one aspect, the nucleic acid is modified on the first strand, preferably along the entire strand, with alternating 2'-O-methyl modifications and 2'-fluoro modifications, and positions 2 and 14 (starting at the 5' end) are modified using 2'- fluorine Preferably, the second strand is modified with 2'-fluoro modifications of nucleotides on the second strand that correspond to position 11 or 13, or 11 and 13, or

- 17 045986 preferably 11-13 of the first chain. Preferably, the second chain is modified with 2'-fluoro modifications at positions 11-13, counting from the 3' end, starting from the first position of the complementary (double-stranded) region, and the remaining modifications are natural modifications, preferably 2'0-methyl. At least in this case, the nucleic acid preferably has a blunt end, at least at the end, which is the 5-end of the first strand.

A second-strand nucleotide that is in a position corresponding to, for example, an even-numbered first-strand nucleotide is a second-strand nucleotide paired with an even-numbered first-strand nucleotide.

In one aspect of the nucleic acid, the second strand nucleotide/nucleotides at a position corresponding to nucleotide 11 or nucleotide 13, or nucleotides 11 and 13, or preferably nucleotides 11-13 of the first strand, are/are modified using a fourth modification. Preferably, all nucleotides of the second strand, except the nucleotide/nucleotides at the position corresponding to nucleotide 11 or nucleotide 13, or nucleotides 11 and 13, or preferably nucleotides 11-13 of the first strand, are/were modified using a third modification. Preferably, nucleotides 2 and 14 of the same nucleic acid, or preferably all even nucleotides of the first strand, are modified using a first modification. In addition or alternatively, the odd nucleotides of the first strand are modified using a second modification. The fourth modification is preferably different from the second modification and preferably different from the third modification, and the fourth modification is preferably the same as the first modification. The first and fourth modifications are preferably 2'OMe modifications, and the second and third modifications are preferably 2'-F modifications. The nucleotides on the first strand are numbered sequentially, starting with nucleotide number 1 at the 5' end of the first strand.

In one aspect of the nucleic acid, all even nucleotides of the first strand are modified using a first modification, all odd nucleotides of the first strand are modified using a second modification, all nucleotides of the second strand at positions corresponding to nucleotides 11-13 of the first strand are modified using a fourth modification, all nucleotides of the second strand, different from the nucleotides corresponding to nucleotides 11-13 of the first strand, are modified using a third modification, where the first and fourth modifications are 2'-F and the second and third modifications are 2'-OMe. The nucleotides on the first strand are numbered sequentially, starting with nucleotide number 1 at the 5' end of the first strand.

In one aspect of the nucleic acid, each of the first strand and second strand nucleotides is a modified nucleotide.

One aspect is a double-stranded nucleic acid for inhibiting the expression of LPA, preferably in a cell, wherein the nucleic acid comprises a first strand and a second strand, wherein the first strand sequence includes a sequence of at least 15 nucleotides differing by no more than 3 nucleotides from either sequence SEQ ID NO: 9, 5, 1, 3, 7, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41 or 43, preferably SEQ ID NO: 9, where all even nucleotides of the first chain are modified by the first modification, all odd nucleotides of the first chain are modified by the second modification, all nucleotides of the second chain in positions corresponding to nucleotides 11-13 of the first chain are modified by the fourth modification, all nucleotides of the second chain different from nucleotides corresponding to nucleotides 11-13 of the first strand are modified with a third modification, the first and fourth modifications being 2'-F and the second and third modifications being 2'-OMe.

In one aspect, nucleic acids that are siRNA molecules in which the nucleotides at positions 2 and 14 from the 5' end of the first strand are not modified using 2C-methyl modification, and the nucleic acid includes one or more or all of the following:

(i) an inverted nucleotide, preferably a 3'-3' linkage at the 3' end of the second strand;

(ii) one or more phosphodithioate linkages;

(iii) a second-strand nucleotide corresponding to position 11 or 13 of the first strand, unmodified with a 2'-O-methyl modification, preferably one or both of these positions containing a 2'-fluoro modification;

(iv) the nucleic acid contains at least 80% of all nucleotides containing a 2'-Omethyl modification;

(v) the nucleic acid contains no more than 20% of nucleotides that contain 2'-fluoro modifications.

The present invention also provides a nucleic acid disclosed herein, in which nucleotides at positions 2 and 14 from the 5' end of the first strand and nucleotides at positions 7 and/or 9 or 7-9 from the 5' end of the second strand are modified with using a 2'-fluoro modification, and at least 90% of the remaining nucleotides are 2'-O-methyl modified or contain another naturally occurring 2' modification.

Specific preferred examples for the 19-mer double-stranded nucleic acid

- 18 045986 you with blunt ends and without sticky ends are:

The nucleic acid disclosed herein, in which the nucleotides at positions 2 and 14 at the 5' end of the first strand are not modified with a 2'-O-methyl modification, and the nucleotide at position 7 at the 5' end of the second strand is not modified with using 2'-O-methyl modification.

The nucleic acid disclosed herein, in which the nucleotides at positions 2 and 14 at the 5' end of the first strand are not modified with a 2'-O-methyl modification, and the nucleotide at position 9 at the 5' end of the second strand is not modified with using 2'-O-methyl modification.

The nucleic acid disclosed herein, in which the nucleotides at positions 2 and 14 from the 5' end of the first strand are not modified with a 2'-O-methyl modification, and the nucleotides at positions 7 and 9 from the 5' end of the second strand are not modified using 2'-O-methyl modification.

The nucleic acid disclosed herein, in which the nucleotides at positions 2 and 14 from the 5' end of the first strand are not modified with a 2'-O-methyl modification, and the nucleotides at positions 7-9 from the 5' end of the second strand are not modified using 2'-O-methyl modification.

The nucleic acid disclosed herein, in which the nucleotides at positions 2 and 14 from the 5' end of the first strand are not modified with a 2'-O-methyl modification, and the nucleotides at positions 7 and/or 9, or 7-9 from The 5' ends of the second strand are modified using 2'-fluoro modification.

The nucleic acid disclosed herein, in which the nucleotides at positions 2 and 14 from the 5' end of the first strand are modified using a 2'-fluoro modification, and the nucleotides at positions 7 and/or 9, or 7-9 from the 5' The -ends of the second strand are not modified with a 2'-O-methyl modification.

The nucleic acid disclosed herein, in which the nucleotides at positions 2 and 14 from the 5' end of the first strand are modified using a 2'-fluoro modification, and the nucleotides at positions 7 and/or 9, or 7-9 from the 5' -ends of the second chain are modified using a 2'-fluoro modification.

A nucleic acid disclosed herein in which more than 50% of the first and/or second strand nucleotides contain a 2'-O-methyl modification, e.g., more than 55%, 60%, 65%, 70%, 75%, 80%, or 85% or more of the first and/or second strands contain a 2'-O-methyl modification, preferably as measured as a percentage of the total nucleotides of both first and second strands.

A nucleic acid disclosed herein, in which more than 50% of the first and/or second strand nucleotides contain a naturally occurring RNA modification, e.g., more than 55%, 60%, 65%, 70%, 75%, 80%, or 85% or more the first and/or second strands contain such modification, preferably as measured as a percentage of the total number of nucleotides of both first and second strands. Suitable natural modifications include, in addition to the 2-O'-methyl, other 2'-sugar modifications, in particular the 2'-H modification resulting in a DNA nucleotide.

A nucleic acid disclosed herein containing no more than 20%, e.g. no more than 15%, e.g. more than 10%, of nucleotides that contain 2'-modifications that are not 2'-methyl modifications, on the first and/or second strands, preferably as measured as a percentage of the total number of nucleotides of both the first and second strands.

A nucleic acid disclosed herein containing no more than 20% (e.g., no more than 15% or no more than 10%) 2'-fluoro modifications on the first and/or second strands, preferably as measured as a percentage of the total nucleotides of both chains.

Nucleic acid disclosed herein, in which all nucleotides are modified using a 2'-O-methyl modification, except positions 2 and 14 from the 5' end of the first strand and nucleotides at positions 7 and/or 9 from the 5' end second chain. Preferably, nucleotides that are not modified with 2'-O-methyl are modified with fluorine at the 2' position.

A nucleic acid disclosed herein in which all nucleotides are modified using a 2'-O-methyl modification, except positions 2 and 14 at the 5' end of the first strand and nucleotides at positions 7-9 at the 5' end of the second strand . Preferably, nucleotides that are not modified with 2'-O-methyl are modified with fluorine at the 2' position.

For a nucleic acid containing a 20 base pair duplex region, the second strand preferably does not contain a 2'-O-methyl group at nucleotides 8, 9 or 10, counted from the 5' end of the duplex, corresponding to positions 13, 12 and 11 of the first strand , respectively.

For a nucleic acid containing a 21 base pair duplex region, the second strand preferably does not contain a 2' O-methyl group at nucleotides 9 or 10 or 11, counted from the 5' end of the duplex, corresponding to positions 13, 12 and 11 of the first strand. respectively.

The nucleic acid of the present invention may include one or more phosphorothioate modifications at one or more ends of the first and/or second chain. Optionally, each or either end of the first strand may contain one, two or three phosphorothioate-modified nucleotides. Optionally, each or either end of the second strand may contain one, two or three phosphorothioate-modified nucleotides.

In one embodiment, the first chain may include at least one phosphorothioate

- 19 045986 (ps) communication.

In one embodiment, the first strand may further comprise a phosphorothioate linkage between two 3' terminal nucleotides or phosphorothioate linkages between three 3' terminal nucleotides.

In one embodiment, the bonds between other nucleotides in the first strand are phosphodiester bonds.

In one embodiment, the first chain may include more than 1 phosphorothioate bond.

In another embodiment, the second strand may comprise a phosphorothioate linkage between two 3' terminal nucleotides or a phosphorothioate linkage between three 3' terminal nucleotides.

In another further embodiment, the second strand may comprise a phosphorothioate linkage between two 5' terminal nucleotides or a phosphorothioate linkage between three 5' terminal nucleotides.

In one aspect, the nucleic acid contains one or more phosphodithioate linkages, such as 1, 2, 3 or 4 phosphodithioate linkages. Preferably there are up to 4 phosphodithioate bonds, one each at the 5' and 3' ends of the first and second chains.

The use of a phosphodithioate linkage in a nucleic acid according to the invention reduces the change in stereochemistry of a population of nucleic acid molecules compared to molecules containing a phosphothioate at the same position. The phosphothioate bond does introduce a chiral center, and it is difficult to control which non-bonding oxygen replaces the sulfur. The use of a phosphodithioate ensures that there is no chiral center in the bond and thus reduces or eliminates any variation in the population of nucleic acid molecules depending on the number of phosphodithioate and phosphothioate bonds used in the nucleic acid molecule.

In one aspect, the nucleic acid comprises a phosphorothioate linkage between each of the three 3' terminal nucleotides and/or between each of the three 5' terminal nucleotides on the first strand and/or between each of the three 3' terminal nucleotides and/or between each of the three 5'-terminal nucleotides of the second strand when there is no phosphodithioate bond at that end. The absence of a phosphodithioate bond at the end means that the bond between the two terminal nucleotides, or preferably between the three terminal nucleotides of the nucleic acid end in question, is a bond other than a phosphodithioate bond.

The present invention also provides a nucleic acid in accordance with any aspect of the present invention described herein, wherein the first strand of RNA has a terminal 5'-(E)-vinylphosphonate nucleotide, and the terminal 5'-(E)-vinylphosphonate nucleotide is connected to the second nucleothiome in the first chain via a phosphodiester bond. The first chain may include more than one phosphodiester bond. In one embodiment, the first strand may contain phosphodiester bonds between at least three 5' terminal nucleotides. In one embodiment, the first strand may contain phosphodiester bonds between at least four 5' terminal nucleotides.

In one embodiment, the first chain may comprise formula (IV): (νρ)-Ν(ρο)[Ν(ρο)] _η - (IV) wherein (vp)- is a 5'(E)-vinylphosphonate, N is a nucleotide, po is a phosphodiester bond, and n is from 1 to (total number of nucleotides in the first strand -2), wherein preferably n is from 1 to (total number of nucleotides in the first strand -3), more preferably n is from 1 to (total number of nucleotides in the first strand -4).

In one aspect, if the very first 5' nucleotide of the first strand is a nucleotide other than A or U, that nucleotide is replaced by A or U in the sequence. Preferably, if the very first 5' nucleotide of the first strand is a nucleotide other than U, that nucleotide is replaced by a U, and more preferably by a U with a 5' vinyl phosphonate in the sequence.

A terminal 5'-(E)-vinylphosphonate nucleotide is a nucleotide in which the natural phosphate group at the 5' end is replaced by an E-vinylphosphonate in which the bridging 5' oxygen atom of the terminal nucleotide of the 5' phosphorylated chain is replaced by a methynyl (-CH= ) group:

- 20 045986

at the 5' end at the 5' end

5'-(E)-Vinylphosphonate is a 5'-phosphate mimic. A biological mimic is a molecule that is capable of performing the same function as and is structurally very similar to the parent molecule it mimics.

In relation to the present invention, 5'(E)-vinylphosphonate mimics the function of normal 5'-phosphate, for example, providing efficient loading of RISC. In addition, due to its slightly modified structure, 5'(E)-vinylphosphonate is able to stabilize the 5'-terminal nucleotide, protecting it from dephosphorylation by enzymes such as phosphatases.

In one embodiment, the terminal 5'(E)-vinylphosphonate nucleotide is an RNA nucleotide.

In one aspect, the nucleic acid:

(i) has a phosphorothioate bond between the three 3' terminal nucleotides and the three 5' terminal nucleotides of the first strand;

(ii) conjugated to a three-antennary ligand either at the 3' end of the nucleotide or at the 5' end of the second strand nucleotide;

(iii) has a phosphorothioate bond between the three terminal nucleotides of the second strand at the end opposite to that conjugated to the triantennary ligand; and (iv) all remaining bonds between the nucleotides of the first and/or second chain are phosphodiester bonds.

In one aspect, the nucleic acid:

(i) has a terminal 5'(E)-vinylphosphonate nucleotide at the 5' end of the first strand;

(ii) has a phosphorothioate bond between the three 3' terminal nucleotides on the first and second strand and between the three 5' terminal nucleotides on the second strand; and (iii) all remaining bonds between the nucleotides of the first and/or second chain are phosphodiester bonds.

In one aspect, the nucleic acid, which is preferably an siRNA, that inhibits LPA expression, preferably through RNAi, includes one or more or all of the following:

(i) modified nucleotide;

(ii) a modified nucleotide other than the 2'-OMe modified nucleotide at positions 2 and 14 from the 5' end of the first strand, preferably a 2'-F modified nucleotide;

(iii) each of the odd nucleotides of the first strand, numbered starting with one at the 5' end of the first strand, are 2'-OMe modified nucleotides;

(iv) each of the even nucleotides of the first strand, numbered starting with the first at the 5' end of the first strand, represents 2'-F modified nucleotides;

(v) the second strand nucleotide corresponding to position 11 or 13 of the first strand is modified using a modification other than a 2'-OMe modification, preferably one or both of these positions containing a 2'-F modification;

(vi) an inverted nucleotide, preferably a 3'-3' linkage at the 3' end of the second strand;

(vii) one or more phosphorothioate linkages;

(viii) one or more phosphodithioate linkages; and/or (ix) the first strand has a terminal 5'(E)-vinylphosphonate nucleotide at its 5' end, in which case the terminal 5'(E)-vinylphosphonate nucleotide is preferably uridine and is preferably linked to a second nucleotide in the first chains with phosphodiester bonds.

The nucleic acids of the present invention may contain one or more inverted nucleotides, for example, inverted thymidine or inverted adenine (eg, see Takei, et al., 2002. JBC 277 (26):23800-06).

In one aspect, the nucleic acid of the invention contains one or more inverted ribonucleotides, preferably an inverted adenine, using a 5'-5' linkage or a 3'-3' linkage, preferably a 3'-3' linkage at the 3' end second chain.

The nucleic acid of the present invention may contain an inverted RNA nucleotide at one or more ends of the chain. Such inverted nucleotides ensure the stability of the nucleic acid. Preferably, the nucleic acid contains at least an inverted nucleotide at one or more of the 3' end of at least one of the strands and/or the 5' end of the second strand. More preferably, the nucleic acid contains an inverted nucleotide at the 3' end of the second strand. Most preferably, the nucleic acid contains an inverted RNA nucleotide at the 3' end of the second strand, and this nucleotide is preferably an inverted A. The inverted nucleotide is preferably present at the end of the strand, not as a sticky end, but opposite the corresponding nucleotide on the other strand. Nucleic acid with this modification is stable and easy to synthesize.

Ligands.

The nucleic acid of the present invention may be conjugated to a ligand. Effective delivery of oligonucleotides, in particular double-stranded nucleic acids of the present invention, into cells in vivo is important and requires specific targeting and significant protection from the extracellular environment, in particular from serum proteins. One way to achieve specific targeting is by conjugating a ligand to a nucleic acid. The ligand helps target the nucleic acid to the desired target site. There is a need to conjugate appropriate ligands for target receptor molecules in order for target cells to take up the conjugated molecules through mechanisms such as various receptor-mediated endocytosis pathways or functionally similar processes.

One example is the asialoglycoprotein receptor (ASGP-R) complex, consisting of varying ratios of multimers of the membrane receptors ASGR1 and ASGR2, which is very abundant on hepatocytes and has high affinity for the GalNAc group described herein. US Pat. No. 5,885,968 provides one of the first disclosures of the use of three-antennary cluster glycosides as conjugated ligands. Conjugates having three GalNAc ligands and containing phosphate groups are known and described in Dubber et al. (Bioconjug. Chem. 2003 Jan-Feb;14(1):239-46). The ASGP-R complex exhibits a 50-fold higher affinity for N-acetyl-E-galactosylamine (GalNAc) compared to D-Gal.

The asialoglycoprotein receptor (ASGP-R) complex, which specifically recognizes the terminal β-galactosyl subunits of glycosylated proteins or other oligosaccharides (Weigel, P.H. et al., Biochim. Biophys. Acta. 2002 Sep 19; 1572(2-3):341-63), can be used to deliver a drug to liver hepatocytes expressing the receptor complex by covalently linking galactose or galactosamine to the drug (Ishibashi, S.; et al., J Biol. Chem. 1994 Nov 11;269(45):27803-6 ). In addition, binding affinity can be significantly increased by a multivalent effect, which can be achieved by repetition of the targeting group (Biessen E.A., et al., J Med Chem. 1995 Apr 28; 38(9):1538-46) .

The ASGP-R complex acts as an intermediary for the active uptake of glycoproteins containing terminal β-galactosyl into cellular endosomes. Thus, ASGPR is very suitable for targeted delivery of drug candidates conjugated to such ligands, such as nucleic acids, into receptor-expressing cells (Akinc et al., Mol Ther. 2010 Jul; 18(7):1357-64).

More generally, the ligand may contain a saccharide that is selected to have affinity for at least one type of receptor on the target cell. In particular, the receptor is located on the surface of the mammalian liver cell, for example, the hepatic asialoglycoprotein receptor complex described previously (ASGP-R).

The saccharide may be selected from N-acetylgalactosamine, mannose, galactose, glucose, glucosamine and fucose. The saccharide may be N-acetylgalactosamine (GalNAc).

Thus, a ligand for use in the present invention may contain (i) one or more N-acetylgalactosamine (GalNAc) groups and derivatives thereof, and (ii) a linker, wherein said linker conjugates GalNAc groups to a sequence defined in any of the preceding aspects. The linker may have a divalent, trivalent or tetravalent branched structure. Nucleotides may be modified as defined herein.

GalNAc refers to 2-acetylamino-2-deoxy-O-galactopyranose, commonly referred to in the literature as N-acetylgalactosamine. Reference to GalNAc or N-acetylgalactosamine includes both the β-form, 2-acetylamino-2-deoxy-α-O-galactopyranose, and the α-form, 2-acetylamino-2-deoxy-α-O-galactopyranose. Both the β-form, 2-acetylamino-2-deoxy-α-O-galactopyranose, and the α-form, 2-acetylamino-2-deoxy-α-O-galactopyranose, can be used interchangeably. Preferably, the compounds of the present invention contain the β-form, 2-acetylamino-2-deoxy-β-D-galactopyranose.

- 22 045986

Thus, the ligand may contain GalNAc.

The ligand may contain a compound of formula I: [8-X ¹ -P-X ² ]3-A-X ³ - (I) in which S is a saccharide, said saccharide being Nacetylgalactosamine;

X ¹ represents C ₃ -C ₆ -alkylene or (-CH ₂ -CH ₂ -O)m(-CH ₂ ) ₂ -, where m is 1, 2 or 3;

P is a phosphate or a modified phosphate (preferably thiophosphate);

X ² represents an alkylene or alkylene ether of the formula (-CH ₂ ) _p -O-CH ₂ -, where n=1-6;

A represents a branching element;

X ³ represents a bridge element;

wherein the nucleic acid in accordance with the present invention is conjugated to X ³ through a phosphate or modified phosphate (preferably thiophosphate).

In formula (I), branching element A branches into three to accommodate three saccharide ligands. The branching element is covalently attached to the remaining anchored portions of the ligand and nucleic acid. The branching element may contain a branched aliphatic group containing groups selected from alkyl, amide, disulfide, polyethylene glycol, ether, thioether and hydroxyamine groups. The branching element may contain groups selected from alkyl and ether groups.

Branch element A may have a structure selected from:

in which each A1 independently represents O, S, C=O or NH; and each n is independently an integer from 1 to 20. The branch element may have a structure selected from:

in which each A1 independently represents O, S, C=O or NH; and each n is independently an integer from 1 to 20. The branch element may have a structure selected from:

in which A1 represents O, S, C=O or NH; and each n is independently an integer between 1 and 20. A branch element may have the structure:

A branch element can have the structure:

- 23 045986

A branch element can have the structure:

Optionally, the branching element consists of only a carbon atom.

Part X ³ is a bridge element. The bridging element is linear and is covalently linked to the branching element and the nucleic acid.

X ³ may be selected from -C ₁ -C ₂₀ -alkylene-, -C ₂ -C ₂₀ -alkenylene-, alkylene ether of the formula -(C ₁ -C ₂₀ -alkylene)-O-(C ₁ -C ₂₀ - alkylene)-, -C(O)-C ₁ -C ₂₀ -αalkylene-, -C ₀ -C ₄ -alkylene(Cy)C ₀ -C ₄ -alkylene-, where Cy represents substituted or unsubstituted 5 or 6- membered cycloalkylene, arylene, heterocyclylene or heteroarylene ring, -C ₁ -C ₄ -αalkylene-NHC(O)-C ₁ -C ₄ -alkylene-, -C ₁ -C ₄ alkylene-C(O)NH-C ₁ - C ₄ -alkylene-, -C ₁ -C ₄ -alkylene-SC(O)-C ₁ -C ₄ -alkylene-, -C ₁ -C ₄ -alkylene-C(O)SC ₁ -C ₄ alkylene-, -C ₁ -C ₄ -alkylene-OC(O)-C ₁ -C ₄ -alkylene-, -C ₁ -C ₄ -alkylene-C(O)OC ₁ -C ₄ -alkylene- and -C ₁ -C ₆ -alkyleneS-SC ₁ -C ₆ -alkylene-.

X ³ may be an alkylene ether of the formula -(C1-C20-alkylene)-O-(C1-C20-alkylene)-. X ³ may be an alkylene ether of the formula -(C1-C ₂₀ -alkylene)-O-(C ₄ C ₂₀ -alkylene)-, wherein said (C ₄ -C ₂₀ -αalkylene) is linked to Z. X ³ may be selected from the group consisting of -CH2-O-C3H-, -CH2-O-C4H8-, -CH ₂ -OC ₆ H ₁₂ - and -CH2-O-C8H16-, in particular -CH2-O-C4H8- , -CH2-OC ₆ H ₁₂ - and -CH2-O-C8H16-, where in each case the -CH ₂ - group is connected to A.

The ligand may comprise a compound of formula (II):

[8-Х ¹ -Р-Х ² ]з-А-Х ³ - (II) in which S represents a saccharide;

X ¹ represents ^-^-alkylene or (-CH ₂ -CH ₂ -O)m(-CH ₂ ) ₂ -, where m is 1, 2 or 3;

P is a phosphate or a modified phosphate (preferably thiophosphate);

X ² represents ^-^-alkylene;

A represents a branching element selected from:

A ¹ = O, NH a ¹ = o, NH A ² = NH, CH ₂ , O p=1-4 p=1-4C

X ³ represents a bridge element;

wherein the nucleic acid in accordance with the present invention is conjugated to X ³ through a phosphate or modified phosphate (preferably thiophosphate).

Branch element A may have the structure:

where X ³ is attached to the nitrogen atom.

X ³ may be C1-C20 alkylene. Preferably X ³ is selected from the group consisting of -C3H ₆ -, -C ₄ H ₈ -, -C ₆ H ₁₂ - and -C ₈ H ₁₆ -, in particular -C ₄ H ₈ -, -C ₆ H ₁₂ - and -C ₈ H ₁₆ -.

The ligand may comprise a compound of formula (III):

in which S represents a saccharide;

X ¹ represents ^-^-alkylene or (-CH ₂ -CH ₂ -O) _m (-CH ₂ ) ₂ -, where m is 1, 2 or 3;

P is a phosphate or a modified phosphate (preferably thiophosphate);

X ² is an alkylene ether of the formula -C3H6-O-CH2-;

- 24 045986

A represents a branching element;

X ³ is an alkylene ether of the formula selected from the group consisting of -CH2-O-CH2-, -CH2-O-C2H4-, -CH2-O-C3H6-, -CH2-O-C4H8-, -CH2- O-C5H10-, CH2-O-C6H12-, -CH2-O-C7H14- and -CH2-O-C8H16-, in each case the -CH2- group is connected to A, and in this case X ³ is conjugated to the nucleic acid in accordance with the present invention using phosphate or modified phosphate (preferably thiophosphate).

The branching element may contain carbon. Preferably the branching element is carbon.

X ³ may be selected from the group consisting of -CH ₂ -O-C ₄ H ₈ -, -CH ₂ -O-C ₅ H ₁₀ -, -CH ₂ -O-C ₆ H ₁₂ -, -CH ₂ O -C ₇ H ₁₄ - and -CH2-O-C8H16-. Preferably X ³ is selected from the group consisting of -CH2-O-C4H8-, -CH2-OC6H12- and -CH2-O-C8H16.

For any of the above aspects, if P is a modified phosphate group, P may be represented as:

Y ¹

where Y1 and Y ² each independently represent =O, =S, -O ^- , -OH, -SH, -BH ₃ , -OCH2CO2, -OCH2CO2R ^x , -OCH2C(S)OR ^x and -OR ^x , where R ^x represents ^-^-alkyl and where ^- । indicates joining to the rest of the connection.

By modified phosphate is meant a phosphate group in which one or more of the non-bonding oxygen atoms have been replaced. Examples of modified phosphate groups include phosphorothioate, phosphoselenates, boranophosphates, boranophosphate esters, hydrogen phosphonates, phosphoamidates, alkyl or arylphosphonates, and phosphotriesters. In phosphodithioates, both non-bonding oxygen atoms are replaced by sulfur. One, each, or both of the non-bonding oxygen atoms in the phosphate group may independently be any of S, Se, B, C, H, N, or OR (R is alkyl or aryl).

Phosphate can also be modified by replacing the connecting oxygen atom with nitrogen (bridged phosphoamidates), sulfur (bridged phosphorothioates) and carbon (bridged methylene phosphonates). The substitution may occur at the terminal oxygen atom. It is possible to replace non-bonding oxygen atoms with nitrogen.

For example, Y1 may represent -OH and Y ² may represent =O or =S; or

Y ¹ may represent -O ^- and Y ² may represent =O or =S;

Y 1 may be =O and Y ² may be -CH3, -SH, -OR ^x or -BH3;

Y ¹ may represent =S and Y ² may represent -CH ₃ , OR ^x or -SH.

One skilled in the art will understand that in certain cases there will be delocalization between Y ¹ and Y ² .

Preferably, the modified phosphate group is a thiophosphate group. Thiophosphate groups include bithiophosphate (i.e., where Y1 is =S and Y ² is -S ^- ) and monothiophosphate (i.e., where Y1 is -O ^- and Y ² is =S, or where Y1 is =O and Y ² represents -S ^- ). Preferably P is monothiophosphate. The present inventors have discovered that conjugates having thiophosphate groups instead of phosphate groups have improved potency and duration of action in vivo.

P may also be ethyl phosphate (ie where Y1 is =O and ^Y2 is OCH2CH3).

The saccharide may be selected to have affinity for at least one type of receptor on the target cell. In particular, the receptor is located on the surface of mammalian liver cells, for example, the hepatic asialoglycoprotein receptor (ASGP-R) complex.

For any of the above aspects, the saccharide may be selected from N-acetyl with one or more of galactosamine, mannose, galactose, glucose, glucosamine and fructose. Typically, a ligand for use in the present invention may comprise N-acetylgalactosamine (GalNAc). Preferably, the compounds of the present invention may contain 3 ligands, each of which will preferably contain N-acetylgalactosamine.

GalNAc refers to 2-acetylamino-2-deoxy^-galactopyranose, commonly referred to in the literature as N-acetylgalactosamine. Reference to GalNAc or N-acetylgalactosamine includes both the β-form, 2-acetylamino-2-deoxy-α-galactopyranose, and the α-form, 2-acetylamino-2-deoxy-β-galactopyranose. In certain embodiments of the present invention, the β-form, 2-acetylamino-2-deoxy-β-galactopyranose, and the α-form, 2-acetylamino-2-deoxy-β-galactopyranose, can be used interchangeably. Preferably, the compounds of the present invention contain the β-form, 2-acetylamino-2-deoxy-β-O-galactopyranose.

2-acetylamino-2-deoxy-E-galactopyranose

2-acetylamino-2-deoxy-a-O-galactopyranose.

For any of the above compounds of formula (III), X ¹ may be (-CH2-CH2O)(-CH2)2-. X ¹ may be (-CH2-CH ₂ -O) ₂ (-CH ₂ ) ₂ -. X ¹ may be (-CH2CH2-O)3(-CH2)2-. Preferably X ¹ is (-CH2-CH ₂ -O) ₂ (-CH ₂ ) ₂ -. According to another embodiment, X ¹ represents ^-^-alkylene. X ¹ may be propylene. X ¹ may be butylene. X ¹ may be pentylene. X ¹ may be hexylene. Preferably, alkyl is linear alkylene. In particular, X ¹ may be butylene.

For compounds of formula (III), X ² is an alkylene ether of the formula -C3H6-OCH2-, i.e. C3 alkoxymethylene, or -CH2CH2CH2OCH2-.

- 26 045986

According to the present invention, one of the following structures:

proposed conjugated nucleic acid having

- 27 045986

- 28 045986

wherein Z is a nucleic acid as previously defined herein and is preferably conjugated to the 5' end of the second strand of the nucleic acid.

Preferably, the conjugated nucleic acid has the following structure:

where Z is a nucleic acid as previously defined herein and is preferably conjugated to the 5' end of the second strand.

A ligand of formula (I), (II) or (III) may be attached at the 3' end of the first (antisense) strand and/or at either of the 3' and/or 5' ends of the second (sense) strand. The nucleic acid may contain more than one ligand of formula (I), (II) or (III). However, one ligand of the formulas is preferred

- 29 045986 (I), (II) or (III), since one such ligand is sufficient to effectively target the nucleic acid to target cells. Preferably in this case, at least the last two, preferably at least the last three, and more preferably at least the last four nucleotides at the end of the nucleic acid to which the ligand is attached are linked by a phosphodiester bond.

Preferably, the 5' end of the first (antisense) strand is not attached to a ligand of formula (I), (II) or (III), since a ligand at this position could potentially interfere with the biological activity of the nucleic acid.

A nucleic acid with one ligand of formula (I), (II) or (III) at the 5' end of the chain has a simpler structure and is therefore less expensive to synthesize than a similar nucleic acid with a similar ligand at the 3' end. Thus, preferably, one ligand of any of formulas (I), (II) or (III) is covalently attached (conjugated thereto) to the 5' end of the second nucleic acid strand.

According to one embodiment of the present invention, the nucleic acid is conjugated to a ligand that contains a lipid, and more preferably to a ligand that contains cholesterol.

Alternatively, the nucleic acid of the present invention may be conjugated to a ligand of the following structure

The conjugate of the present invention may comprise any nucleic acid described herein conjugated to any ligand or ligands described herein.

The present invention also provides a conjugate for inhibiting LPA gene expression in a cell, wherein the conjugate comprises a nucleic acid moiety comprising a nucleic acid according to any aspect of the present invention, and at least one ligand moiety, wherein said nucleic acid moiety contains at least one duplex a region that contains at least a portion of a first RNA strand and at least a portion of a second RNA strand that is at least partially complementary to the first strand, wherein said first strand is at least partially complementary to at least a portion of the RNA transcribed from said LPA gene, said at least one part of the ligand contains a linker group, preferably a linker group derived from serinol, as well as a targeting ligand for targeting in vivo to cells and conjugated exclusively to the 3' and/or 5' ends of one or both RNA strands, wherein the 5' end of the first strand of RNA is not conjugated, and:

(i) the second RNA strand is conjugated at the 5' end to a targeting ligand, and wherein (a) the second RNA strand is also conjugated at the 3' end to the targeting ligand and the 3' end of the first RNA strand is not conjugated; or (b) the first RNA strand is conjugated at the 3' end to a targeting ligand and the 3' end of the second RNA strand is not conjugated; or (c) both the second strand RNA and the first strand RNA are also conjugated at the 3' ends to the targeting ligand; or (ii) both the second strand RNA and the first RNA strand are conjugated at the 3' ends to the targeting ligand and the 5' end of the second RNA strand is not conjugated.

Ligands may be monomeric or multimeric (eg, dimeric, trimeric, etc.).

It is acceptable when the ligands are monomeric and accordingly contain one targeting ligand group, for example one GalNAc group.

In another embodiment, the ligands may be dimeric ligands in which portions of the ligands contain two linker groups, such as linker groups derived from serinol or linker groups other than serinol, each of which is connected to one group of the targeting ligand.

The ligands may be trimeric ligands in which portions of the ligands contain three linker groups, such as serinol-derived linker groups or linker groups

- 30 045986 other than serinol, each of which is connected to one group of the targeting ligand.

Two or three serinol-derived linker groups can be connected in series, for example as shown below:

where n is 1 or 2 and Y is S or O.

Preferably the ligands are monomeric.

It is acceptable for the conjugated RNA strands to be conjugated to a targeting ligand through a linker group, including an additional linker, wherein said additional linker is or contains a saturated, straight or branched C ₁₁₅ alkyl chain, optionally one or more carbon atoms (e.g. 1 , 2 or 3 carbon atoms, is suitable when 1 or 2, in particular 1), is replaced by a heteroatom selected from O, N, S(O)p, where p is 0, 1 or 2 (for example, a CH ₂ group substituted with O or NH, or S, or SO2, or a -CH ₃ group at the end of the chain or on a branch is substituted with OH or NH2), and said chain is optionally substituted with one or more oxo groups (for example, 1-3, for example, 1 group).

It is acceptable when the linker group is a linker group derived from serinol.

The term serinol-derived linker moiety means a linker moiety containing the following structure:

HN

The O atom of this structure typically binds to the RNA strand, and the N atom typically binds to the targeting ligand.

It is more suitable when the additional linker contains a saturated straight chain C _1-15 alkyl chain in which one or more carbon atoms (for example, 1, 2 or 3 carbon atoms, is suitable when 1 or 2, in particular 1) is substituted ( s) an oxygen atom.

It is more suitable when the additional linker contains a PEG chain.

It is more suitable when the additional linker contains a saturated straight chain C _1-15 alkyl chain.

It is more suitable when the additional linker contains a saturated straight chain C _1-6 alkyl chain.

It is more suitable when the additional linker contains a saturated straight-chain C ₄ or C ₆ alkyl chain, for example a C ₄ alkyl chain.

According to an embodiment of the present invention, the first strand of RNA is a compound of formula (X):

in which b is 0 or 1; and the second RNA strand is a compound of formula (XI):

in which c and d are independently equal to 0 or 1;

Z1 and _Z2 are the RNA portions of the first and second strands of RNA, respectively;

Y represents O or S;

n is 0, 1, 2 or 3; And

L1 represents the linker to which the ligand is attached;

and at the same time b + c + d is equal to 2 or 3.

- 31 045986

It is acceptable when the first RNA strand is a compound of formula (XV)

in which b is 0 or 1; and the second RNA strand is a compound of formula (XVI):

with L_l d (XVI);

in which c and d are independently equal to 0 or 1;

in which Z ₁ and Z2 represent RNA parts of the first and second strands of RNA, respectively;

Y represents O or S;

R ₁ represents H or methyl;

n is 0, 1, 2 or 3; And

L is the same or different in formulas (XV) and (XVI) and is selected from the group consisting of

- (CH2)r-C(O)-, where r=2-12;

- (CH2-CH2-O)s-CH2-C(O)-, where s=1-5;

- (CH ₂ ) _t -CO-NH-(CH ₂ ) _t -NH-C(O)-, where t is independently 1-5;

- (CH ₂ ) _u -CO-NH-(CH ₂ ) _u -C(O)-, where u is independently 1-5; And

- (CH2) _v -NH-C(O)-, where v is 2-12; and wherein the terminal C(O) (if present) is attached to the NH group; and at the same time b + c + d is equal to 2 or 3.

It is acceptable when the first RNA strand is a compound of formula (XII):

in which b is 0 or 1; and the second RNA strand is a compound of formula (XIII):

in which c and d are independently equal to 0 or 1;

Z1 and Z2 are the RNA portions of the first and second strands of RNA, respectively;

Y represents O or S;

n is 0, 1, 2 or 3; And

L2 is the same or different in formulas (XII) and (XIII) and is the same or different in the groups enclosed in brackets with the subscript b, c and d, and is selected from the group consisting of:

- 32 045986

n is 0 and L2 is:

ι H '4 .GalNAc ' F \t and the terminal OH group is absent, so that the following group is formed:

Y

II:

GalNAc—L O—P—O-E\ / I ।

HN—F I

HE ;

where F represents saturated branched or unbranched (eg straight-chain) C ₁ . ₈ alkyl (eg C ₁ . ₆ alkyl) chain in which one of the carbon atoms is optionally replaced by an oxygen atom, provided that said oxygen atom is separated from another heteroatom (eg an O or N atom) by at least 2 carbon atoms;

L is the same or different in formulas (XII) and (XIII) and is selected from the group consisting of:

- (CH2)r-C(O)-, where r=2-12;

- (CH2-CH2-O)s-CH2-C(O)-, where s=1-5;

- (CH2) _t -CO-NH-(CH2) _t -NH-C(O)-, where t is independently 1-5;

- (CH ₂ ) _u -CO-NH-(CH ₂ ) _u -C(O)-, where u is independently 1-5; And

- (CH ₂ ) _v -NH-C(O)-, where v is 2-12; and wherein the terminal C(O) (if present) is attached to the NH group;

and at the same time b + c + d is equal to 2 or 3.

In any of the above formulas in which GalNAc is present, GalNAc may be replaced by any other targeting ligand, such as those mentioned herein.

It is acceptable when b is 0, c is 1 and d is 1; b is 1, c is 0 and d is 1; b is 1, c is 1 and d is 0; or b is 1, c is 1 and d is 1.

It is more acceptable when b is 0, c is 1 and d is 1; b is 1, c is 0 and d is 1; or b is 1, c is 1 and d is 1.

It is most acceptable when b is 0, c is 1 and d is 1.

In one embodiment of the present invention, Y is O. In another embodiment, Y is S.

In one embodiment of the present invention, Ri is H or methyl. In one embodiment of the present invention, R1 is H. In another embodiment of the present invention, _R1 is methyl.

In one embodiment of the present invention, n is 0, 1, 2, or 3. It is acceptable when n is 0.

According to one embodiment of the present invention, L is selected from the group consisting of:

- (CH2)r-C(O)-, where r=2-12;

- (CH2-CH2-O)s-CH2-C(O)-, where s=1-5;

- (CH ₂ ) _t -CO-NH-(CH ₂ ) _t -NH-C(O)-, where t is independently 1-5;

- (CH2)u-CO-NH-(CH2)u-C(O)-, where u is independently 1-5; And

- (CH ₂ ) _v -NH-C(O)-, where v is 2-12;

in this case, the terminal C(O) is attached to the NH group.

It is acceptable when L is -(CH ₂ ) _r -C(O)-, where r=2-12. Is acceptable when r=2-6. It is more acceptable when r=4 or 6, for example 4.

Is acceptable when L is:

Exemplary F groups include (CH ₂ ) _1-6 , for example (CH ₂ ) _1-4 , for example CH ₂ , (CH ₂ ) ₄ , (CH ₂ ) ₅ or (CH ₂ ) ₆ , or CH ₂ O( CH ₂ ) _2-3 , for example, CH ₂ O(CH ₂ ) CH ₃ . Is acceptable when L2 is:

- 33 045986

Is acceptable when L2 is:

Is acceptable when L2 is:

Is acceptable when L2 is:

Is acceptable when n is 0 and L2 is:

and the terminal OH group is missing, so that the following group is formed:

where Y is defined elsewhere in this application.

Typically, L2 within a group enclosed in parentheses with subscript b, c, and d is the same. L2 may be the same or different in groups enclosed in brackets with subscripts b, c and d. In an embodiment, the L2 in the group enclosed in brackets with index c is the same as the L2 in the group enclosed in parentheses with index d. According to one embodiment of the present invention, the L2 in the group enclosed by the index c is different from the _L2 in the group enclosed by the index d. According to one embodiment of the present invention, L ₂ in the group bracketed by the subscripts b, c and d is the same, for example when the linker group is a linker group derived from serinol.

Serinol-derived linker groups can be based on serinol with any stereochemistry, i.e. come from an L-serine isomer, a D-serine isomer, a racemic serine or another serinol-GalNAc group of isomers. In a preferred aspect of the present (SerGN) has the following stereochemistry:

those. is based on a ^)-serinolamidite or ^)-serinolesuccinate solid supported building block derived from the L-serine isomer.

originating from serinol originating from serinol

Linker fragments,

Linker fragments,

Building blocks of (&)-serinol

- 34 045986

According to one embodiment of the present invention, the target cells are hepatocytes.

In one aspect, a nucleic acid is provided for inhibiting the expression of LPA in a cell, comprising at least one duplex region that contains at least a portion of a first strand and at least a portion of a second strand that is at least partially complementary to the first strand, wherein said first strand the strand is at least partially complementary to at least a portion of the RNA transcribed from the LPA gene, wherein said first strand contains a nucleotide sequence selected from the following sequences: SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41 or 43, wherein the nucleic acid is conjugated to a ligand. The second strand may contain the nucleotide sequence SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42 or 44. The first and/or second chain nucleotides may be modified as described herein.

Preferably, the nucleic acid comprises SEQ ID NO: 5 or SEQ ID NO: 9 and SEQ ID NO: 6 or SEQ ID NO: 10 conjugated to a ligand of formula (I) (provided above), said ligand being conjugated to the described nucleic acid, and wherein the first strand is modified using 2'-OMe modification on odd nucleotides and modified using 2'-F on even nucleotides, and the second strand is modified using 2'-OMe on even nucleotides and modified using 2'-F on odd nucleotides nucleotides.

In particular, a nucleic acid is provided wherein the first strand contains or preferably consists of SEQ ID NO: 165 and the second strand optionally contains or preferably consists of SEQ ID NO: 163. The nucleic acid may further be conjugated to a ligand. Even more preferably, a nucleic acid is provided wherein the first strand contains or preferably consists of SEQ ID NO: 165 and the second strand optionally contains or preferably consists of SEQ ID NO: 164. Most preferably, an siRNA is provided which consists of SEQ ID NO: 165 and SEQ ID NO: 164. One aspect of the present invention is conjugate 21.

Compositions, uses and methods

The present invention also provides pharmaceutical compositions containing a nucleic acid or conjugated nucleic acid according to the present invention. Pharmaceutical compositions can be used as drugs or as diagnostic agents, alone or in combination with other agents. For example, one or more nucleic acid conjugates of the present invention can be combined with a delivery vehicle (eg, liposomes) and/or excipients such as carriers, diluents. Other agents such as preservatives and stabilizers may also be added. Methods for delivering nucleic acids are known in the art and known to one skilled in the art.

The present invention also includes a pharmaceutical composition containing one or more nucleic acids or conjugated nucleic acids in accordance with the present invention in a physiologically/pharmaceutically acceptable excipient such as a stabilizer, preservative, diluent, buffer and the like.

The pharmaceutical composition may be a sterile injectable aqueous suspension or solution, or may be in lyophilized form, or may be attached, absorbed or incorporated into or into any other suitable galenic vehicle such as dragees, tablets, capsules, nanoparticles, gels, tablets, granules or similar structures.

One aspect relates to a double-stranded nucleic acid that is capable of inhibiting the expression of LPA, preferably in a cell, for use as a drug.

A further aspect of the invention relates to a nucleic acid or conjugated nucleic acid according to the invention or to a pharmaceutical composition containing a nucleic acid or conjugated nucleic acid according to the invention, for use in the treatment of a disease, disorder or syndrome, preferably a disease, disorder or syndrome associated with elevated levels of Lp(a)-containing particles. Treatment may be aimed at preventing and/or reducing the risk of and/or treating stroke, atherosclerosis, thrombosis or cardiovascular diseases such as coronary heart disease or aortic stenosis, and any other disease or pathology associated with elevated Lp(a) levels )-containing particles. Treatment may be aimed at preventing and/or reducing the risk of and/or treating atherosclerotic cardiovascular disease, atherosclerotic cerebrovascular disease, hyperlipidemia and dyslipidemia, preferably when the disease is associated with elevated levels of Lp(a)-containing particles. Treatment may be aimed at preventing and/or reducing the risk of and/or treating calcific aortic stenosis, ischemic stroke, coronary artery disease, peripheral arterial disease, abdominal aortic aneurysm, heart failure secondary to ischemic cardiomyopathy, or familial hypercholesterolemia, preferably , when the disease is associated with elevated levels of Lp(a)-containing particles. Preferably, treatment is aimed at preventing and/or reducing

- 35 045986 risk of occurrence and/or treatment of aortic stenosis, such as calcified aortic stenosis, or familial hypercholesterolemia, preferably in each of these cases where the disease or disorder is associated with increased levels of Lp(a)-containing particles. The desired serum level of Lp(a)-containing particles is generally described as below 14 mg/dL. The elevated level of Lp(a)-containing particles is at least 14, preferably at least 20, more preferably at least 30, more preferably at least 40, and most preferably at least 50 mg/dL Lp(a)-containing particles in the subject's serum.

The present invention also includes a pharmaceutical composition containing one or more nucleic acids or conjugated nucleic acids in accordance with the present invention in a physiologically/pharmaceutically acceptable excipient such as a stabilizer, preservative, diluent, buffer and the like.

The terms Lp(a)-containing particles and Lp(a) particles are used interchangeably throughout this application.

The pharmaceutical compositions and drugs of the present invention can be administered to a mammalian subject at a pharmaceutically effective dose. The mammal may be selected from human, non-human primate, monkey or arboreal primate, dog, cat, horse, bovine, pig, goat, sheep, mouse, rat, hamster, hedgehog and guinea pig or other suitable species. Based on this, in this application, the wording LPA or LPA refers to a nucleic acid or protein in any of the above species, if expressed naturally or artificially therein, but preferably this wording refers to human nucleic acids or proteins. The nucleic acid or conjugated nucleic acid of the present invention can also be administered for use in combination with other therapeutic compounds, either administered separately or simultaneously, for example, as a combination unit dose. The additional therapeutic agent may be selected from the group consisting of an oligonucleotide, a small molecule, a monoclonal antibody, a polyclonal antibody, and a peptide. Molecular conjugation with other biologically active molecular species such as peptides, cellular or artificial ligands, or small and large molecules is also possible.

Dosage levels for the drug and pharmaceutical compositions of the present invention can be determined by those skilled in the art through standard experimentation. According to one embodiment of the present invention, a unit dose may contain from about 0.01 mg/kg to about 100 mg/kg body weight of nucleic acid or conjugated nucleic acid. In another embodiment, the dose may be from 10 mg/kg to 25 mg/kg body weight, or from 1 mg/kg to 10 mg/kg body weight, or from 0.05 mg/kg to 5 mg/kg body weight, or from 0.1 mg/kg to 5 mg/kg body weight, or from 0.1 mg/kg to 1 mg/kg body weight, or from 0.1 mg/kg to 0.5 mg/kg body weight, or from 0.5 mg/kg to 1 mg/kg body weight. In another embodiment, the dose may be from about 0.5 mg/kg to about 10 mg/kg body weight, or from about 0.6 mg/kg to about 8 mg/kg body weight, or from about 0.7 mg/kg to about 5 mg/kg body weight, or from about 0.8 mg/kg to about 4 mg/kg body weight, or from about 0.9 mg/kg to about 3.5 mg/kg body weight, or from about 1 mg/kg to about 3 mg/kg body weight, or about 1 mg/kg body weight, or about 3 mg/kg body weight, where about a deviation of up to 30%, preferably up to 20%, more preferably up to 10% , but still more preferably up to 5% and most preferably 0% of the specified value. Dosage levels can also be calculated using other parameters, such as, for example, body surface area. The nucleic acid described herein may be capable of inhibiting the expression of LPA. The nucleic acid described herein may be capable of partially inhibiting the expression of LPA. Inhibition can be complete, i.e. 0% compared to the expression level of LPA in the absence of the nucleic acid according to the present invention. Inhibition of LPA expression can be partial, i.e. it may be 15%, 20%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95% or intermediate values of LPA expression in the absence of the nucleic acid according to the present invention. Inhibition may last for 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 7 weeks, 8 weeks, 10 weeks, 11 weeks, 12 weeks, 13 weeks, 14 weeks, or up to 3 months when administered to a subject such as a patient -Human. The nucleic acid or conjugated nucleic acid of the present invention, or compositions containing it, can be administered in a regimen comprising once or twice weekly, every week, every two weeks, every three weeks, every four weeks, every five weeks, every six weeks, every seven weeks or every eight weeks, or in different dosing frequency regimens, such as combinations of the above intervals. The nucleic acid may be administered subcutaneously, intravenously, or any other route of administration such as oral, rectal, or intraperitoneal, preferably subcutaneous.

In cells and/or subjects treated with or receiving a nucleic acid or conjugated nucleic acid according to the present invention, LPA expression may be inhibited relative to untreated cells and/or subjects by an amount ranging from 15% to

- 36 045986

100%, but at least approximately 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 100% or intermediate values. The level of inhibition may provide treatment for a disease associated with LPA expression or overexpression, or may serve to further study the functions and physiological roles of the LPA gene product.

A further aspect of the present invention relates to a nucleic acid or conjugated nucleic acid according to the present invention for the preparation of a medicament for the treatment of a disease, disorder or syndromes, such as those listed above, or additional pathologies associated with elevated Lp(a) levels, or when additional therapeutic approaches where inhibition of LPA expression is desired.

The present invention also includes a method of treating or preventing a disease, disorder or syndrome, such as those listed above, comprising administering a pharmaceutical composition containing a nucleic acid or conjugated nucleic acid described herein to an individual in need of treatment (to improve such pathologies). ). The nucleic acid composition can be administered on a schedule including treatments twice a week, once a week, every two weeks, every three weeks, every four weeks, every five weeks, every six weeks, every seven weeks or every eight weeks or at intervals administration more than once every eight weeks, or in schedules with different dosing frequencies, such as combinations of the above intervals. The nucleic acid or conjugated nucleic acid may be intended for subcutaneous or intravenous administration or other routes of administration such as oral, rectal or intraperitoneal. Preferably, the nucleic acid or conjugated nucleic acid is administered subcutaneously.

The nucleic acid or conjugated nucleic acid of the present invention can be produced using conventional methods in the art, including chemical synthesis or expression of the nucleic acid under both in vitro (eg, interrupted transcription) and in vivo conditions. For example, using solid-phase chemical synthesis or using a nucleic acid-based expression vector, including viral derivatives or partially or fully synthetic expression systems. In one embodiment of the present invention, an expression vector can be used to produce a nucleic acid of the present invention in vitro, within an intermediate host organism or cell type, within an intermediate or terminal organism, or within a desired target cell. Methods for obtaining (synthesis or enzymatic transcription) of nucleic acid described in this application are known to specialists in the art.

All features of nucleic acids can be combined with all other aspects of the invention described in this application.

The present invention also provides unmodified sequences of all modified sequences disclosed herein.

The present invention will be further described with reference to the following non-limiting drawings and examples.

Blueprints

In fig. Figure 1 shows the results of a screen for an unconjugated siRNA molecule to inhibit LPA mRNA expression in human RT-4 cells.

In fig. 2A and 2B show the dose-dependent response of unconjugated LPA-targeting siRNA molecules to LPA mRNA expression in human RT-4 cells.

In fig. Figure 3 shows the inhibition of LPA mRNA expression in primary human and cynomolgus macaque hepatocytes by varying doses of GalNAc-L1 LPA-1038-conjugated siRNA molecules delivered via receptor-mediated uptake.

In fig. 4 shows typical examples of LPA mRNA silencing by the indicated L6-conjugated GalNAc siRNAs in primary human hepatocytes delivered by receptor-mediated uptake.

In fig. 5 shows the synthesis of A0268, which is a single-stranded oligonucleotide conjugated at the 3' end to mono-GalNAc and is the starting material for the synthesis of conjugate 1 and conjugate 3. (ps) denotes a phosphorothioate bond.

In fig. 6 shows the synthesis of A0006, which is a single-stranded oligonucleotide conjugated at the 5' end to a three-antennary GalNAc, used for the synthesis of reference conjugate 4. (ps) denotes a phosphorothioate bond.

In fig. 7 illustrates the determination of TTR shutdown in vitro. In particular, in FIG. 7A shows in vitro determination of TTR silencing using reference conjugates (RC) 1 and 3, as well as the untreated UT control; in fig. 7B shows in vitro determination of TTR silencing using reference conjugates (RC) 2 and 3, as well as the untreated UT control; and in fig. Figure 7C shows in vitro detection of TTR silencing by conjugates 1, 2 and 3, as well as by RC3 and the untreated UT control. Reference conjugates 1 and 2 are comparison conjugates. Reference conjugate 3 is a non-targeting GalNAc

- 37 045986 siRNA, and untreated (UT) represents untreated cells. Both RC3 and UT are negative controls. mRNA levels were normalized against PtenII.

In fig. 8 shows the time course of serum TTR in n=4 cohorts of C57BL/6 mice 7, 14 and 27 days after treatment with 1 mg/kg SC -conjugates 1-3, reference conjugates (RC) 1, 2 and 4 and individuals with simulated processing (FSB).

In fig. 9 shows the synthesis of oligonucleotides from oligonucleotide precursors conjugated to GalNAc at the 3' and 5' ends (such as the XO385B-prcc compound).

In fig. 10 shows an equal dose-dependent shutdown response for siRNA targeting LPA with two separate GalNAc elements conjugated to the second strand, compared to a three-antennary GalNAc element 5' of the second strand, in primary cynomolgus hepatocytes.

In fig. 11 illustrates the determination of TTR shutdown in vitro. In particular, in FIG. 11A shows in vitro determination of TTR silencing with conjugates 4, 5, 6 and 2 compared to Luc (reference conjugate 3) as well as the untreated UT control; in fig. 11B shows the in vitro determination of TTR silencing with conjugates 7 and 2 compared to Luc (reference conjugate 3) as well as the untreated UT control. Luc or reference conjugate 3 (RC3) represents non-targeting GalNAc siRNA, and untreated (UT) represents untreated cells. Both RC3 and UT are negative controls. The mRNA level was normalized against PtenII.

In fig. 12 illustrates the determination of TTR shutdown in vitro. In particular, in FIG. 12A shows in vitro determination of TTR silencing with conjugates 8, 9, 10, 11 and 2 compared to Luc (reference conjugate 3) as well as the untreated UT control; in fig. 12B shows the in vitro determination of TTR silencing with conjugates 12 and 2 compared to Luc (reference conjugate 3) as well as the untreated UT control. Luc or reference conjugate 3 represents non-targeting GalNAc siRNA, and untreated (UT) represents untreated cells. Both RC3 and UT are negative controls. The mRNA level was normalized against PtenII.

In fig. 13 illustrates the determination of LPA mRNA silencing in vitro using conjugate 19 compared to controls. Ctr represents non-targeting GalNAc siRNA, and untreated (UT) represents untreated cells. Both Ctr and UT are negative controls. The mRNA level was normalized against ACTB.

In fig. 14 shows the time course of liver Aldh2 mRNA levels in cohorts of n=6 C57BL/6 mice 14, 28 and 42 days after treatment with 1 mg/kg subcutaneous administration of conjugate 15, reference conjugate (RC) 6 and sham-treated individuals ( FSB). The mRNA level was normalized against Pten.

In fig. 15 shows the time course of liver Aldh2 mRNA levels in cohorts of n=6 C57BL/6 mice 14, 28 and 42 days after treatment with 1 mg/kg subcutaneous administration of conjugate 16, reference conjugate (RC) 7 and sham-treated individuals ( FSB). The mRNA level was normalized against Pten.

In fig. 16 shows the time course of liver Tmprss6 mRNA levels in cohorts of c57BL/6 n=6 mice 14, 28 and 42 days after treatment with 1 mg/kg subcutaneous administration of conjugate 18, reference conjugate (RC) 8 and sham-treated individuals ( FSB). The mRNA level was normalized against Pten.

In fig. 17 shows the serum stability of conjugates 4, 5, 6, 7 and 2, as well as untreated control (UT) at 37°C for 3 days.

In fig. 18 shows the serum stability of conjugates 8, 9, 10, 11, 12 and 2, as well as the untreated control (UT) at 37°C for 3 days.

In fig. Figure 19 shows the reduction of LPA mRNA in primary human hepatocytes using Conjugate 21.

In fig. Figure 20 shows the reduction of LPA mRNA in primary cynomolgus monkey hepatocytes by Conjugate 21.

In fig. 21 shows that Conjugate 21 does not affect the level of expression of the APOB gene.

In fig. 22 shows that Conjugate 21 does not affect the expression level of the PLG gene.

In fig. Figure 23 shows the inhibition time of serum Lp(a) for 29 days in cynomolgus monkeys using different doses of conjugate 21.

In fig. 24 shows a dose-response curve of conjugate 21 showing a decrease in serum Lp(a) on day 29 in a cynomolgus monkey.

- 38 045986

Examples

The numbering mentioned in each example is specific to the example mentioned.

Example 1.

The amounts of modified and conjugated siRNA molecules used for functional examples are given in this application.

LPA-1038 derivatives:

GalNAc-LPA-1038-Ll

First chain (SEQ ID NO: 119, based on SEQ ID NO: 5)

OMeA-(ps)-FU-(ps)-OMeA-FA-OMeC-FU-OMeC-FU-OMeG-FU-OMeC-FC-OMeAFU-OMeU-FA-OMeC-(ps)-FC-(ps)- OMeA 3'

Second Circuit (SEQ ID NO: 120, based on SEQ ID NO: 6)

5'[ST23 (ps)]3 long triple (ps)FU-OMeG-FG-OMeU-FA-OMeA-FU-OMeGFG-OMeA-FC-OMeA-FG-OMeA-FG-OMeU-FU-(ps)- OMeA-(ps)-FU 3'

GalNAc-LPA-1038-L6

First Strain (SEQ ID NO: 121, based on SEQ ID NO: 5)

OMeA-(ps)-FU-(ps)-OMeA-FA-OMeC-FU-OMeC-FU-OMeG-FU-OMeC-FC-OMeAFU-OMeU-F A-OMeC-(ps)-FC-(ps) -OMeA 3'

Second chain (SEQ Ш NO: 122, based on SEQ Ш NO: 6)

5'[ST23 (ps)]3 ST43 (ps)FU-OMeG-FG-OMeU-FA-OMeA-FU-OMeG-FG-OMeA-FCOMeA-FG-OMeA-FG-OMeU-FU-(ps)-OMeA -(ps)-FU 3'

FN (N=A, C, G, U) stands for 2'-fluoro, 2'-deoxynucleosides

OMeN (N=A, C, G, U) stands for 2'-O-methylnucleosides (ps) stands for phosphorothioate bond

ST23 and ST43 are shown below.

An additional example are derivatives of LPA 1041:

GalNAc-LPA-1041-Ll

First chain (SEQ Ш NO: 123, based on SEQ Ш NO: 9)

5' OMeA-(ps)-FU-(ps)-OMeA-FA-OMeC-FU-OMeC-FU-OMeG-FU-OMeC-FCOMeA-FU-OMeU-FA-OMeC-(ps)-FC-(ps )-OMeG 3'

Second chain (SEQ Ш NO: 124, based on SEQ Ш NO: 10)

5'[ST23 (ps)]3 long triple (ps) FC-OMeG-FG-OMeU-FA-OMeA-FU-OMeGFG-OMeA-FC-OMeA-FG-OMeA-FG-OMeU-FU-(ps)- OMeA-(ps)-FU 3'

GalNAc-LPA-1041-L6

First chain (SEQ Ш NO: 125, based on SEQ Ш NO: 9)

5' OMeA-(ps)-FU-(ps)-OMeA-FA-OMeC-FU-OMeC-FU-OMeG-FU-OMeC-FCOMeA-FU-OMeU-FA-OMeC-(ps)-FC-(ps )-OMeG 3'

Second chain (SEQ Ш NO: 126, based on SEQ Ш NO: 10)

5'[ST23 (ps)]3 ST43 (ps) FC-OMeG-FG-OMeU-FA-OMeA-FU-OMeG-FG-OMeA-FCOMeA-FG-OMeA-FG-OMeU-FU-(ps)-OMeA -(ps)-FU 3'

FN (N=A, C, G, U) stands for 2'-fluoro, 2'-deoxynucleosides

OMeN (N=A, C, G, U) stands for 2'-O-methylnucleosides (ps) stands for phosphorothioate bond

All oligonucleotides were either obtained from commercial oligonucleotide manufacturers (Biospring, Frankfurt, Germany, or RiboBio, Guangzhou, Guangdong, China) or synthesized on an AKTA oligopilot synthesizer (in-house) using standard phosphoamidite reactions. A commercially available solid support and 2'-O-methyl-RNA phosphoamidites, 2'-fluoro-DNA were used

- 39 045986 phosphoamidites (all with standard protection) and commercially available long triple phosphoamidite (Glen research). The synthesis was performed using 0.1 M solutions of phosphoamidite in dry acetonitrile, and benzylthiotetrazole (BTT) (0.3 M in acetonitrile) was used as an activator. All other reagents were commercially available standard reagents.

Conjugation of the appropriate GalNAc synthon (eg, ST23, ST41, or ST43) was accomplished by binding the appropriate phosphoamidite to the 5' end of the oligochain under standard phosphoamidite binding conditions. Phosphothioates were introduced using standard commercially available thiolation reagents (EDITH, Link technologies).

Single strands were cleaved from CPG using methylamine (40% aq) and the resulting crude oligonucleotide was purified by ion exchange chromatography (Resource Q, 6 mL, GE Healthcare) on an AKTA Pure HPLC system using a sodium chloride gradient. Product-containing fractions were pooled, desalted on a gel permeation chromatography column (Zetadex, EMP Biotech) and lyophilized.

For renaturation, equimolar amounts of the corresponding single chains were dissolved in water and heated to 80°C for 5 min. After gradual cooling to room temperature, the resulting duplex was lyophilized.

The sequences of the obtained nucleic acids (miRNAs) are given in Table. 1 below.

Table 1

Unconjugated nucleic acid sequences tested for inhibition of LPA mRNA expression. The sequences and the modification profile used are indicated.

SEQ Ш NO: Ident. siRNA Chain Subsequence Modifications 1 LPA-1014 first chain 5'ucguauaacaauaaggggc 3' 5381616272616284847 2 second chain 5'gccccuuauuguuauacga 3' 4737351615451616382 3 LPA-1024 first chain 5'gauaacucuguccauuacc 3' 8252635354537251637 4 second chain 5'gguaauggacagaguuauc 3' 4816254827282815253 5 LPA-1038 first chain 5' auaacucuguccaauuacca 3' 6162717181736152736 6 second chain 5'ugguaauggacagaguuau 3' 1845261846364645161 7 LPA-1040 first chain 5'uaacucuguccaauuaccgu 3' 5263535453725163745 8 second chain 5'acgguaauggacagaguua 3' 2748162548272828152 9 LPA-1041 first chain 5'auaacucuguccaauuaccg 3' 6162717181736152738

- 40 045986

10 second chain 5'cgguaauggacagaguuau 3' 3845261846364645161 And LPA-1055 first chain 5'agaaugugccucgauaacu 3' 6462545473538252635 12 second chain 5'aguuaucgaggcacauucu 3' 2815253828472725171 13 LPA-1057 first chain 5' auaacucuguccaucacca 3' 6162717181736172736 14 second chain 5'uggugaggacagaguuau 3' 1845461846364645161 15 LPA-1058 first chain 5'auaacucuguccaucaccu 3' 6162717181736172735 16 second chain 5' aggugaggacagaguuau 3' 2845461846364645161 17 LPA-1061 first chain 5'uaacucucucccaauuaccau 3' 5263535453725163725 18 second chain 5'augguaauggacagaguua 3' 2548162548272828152 19 LPA-1086 first chain 5'augugccuugauaacucug 3' 6181837154616271718 20 second chain 5'cagaguuaucaaggcacau 3' 3646451617264836361 21 LPA-1099 first chain 5'aguuggugcugcuucagaa 3' 6451845471835172826 22 second chain 5'uucugaagcagcaccaacu 3' 1535462836472736271 23 LPA-1102 first chain 5'aauaaggggcugccacagg 3' 6252648483547363648 24 second chain 5'ccugggcagccccuuauu 3' 3718184728373715251 25 LPA-1116 first chain 5'uaacucuguccaucaccau 3' 5263535453725363725 26 second chain 5' auggugaggacagaguua 3' 2548182548272828152 27 LPA-1127 first chain 5'augagccucgauaacucug 3' 6182837174616271718 28 second chain 5'cagaguuaucgaggcucau 3' 3646451617464835361 29 LPA-1128 first chain 5'aaugagccucgauaacucu 3' 6254647353825263535 thirty second chain 5'agaguuaucgaggcucauu 3' 2828152538284717251 31 LPA-1141 first chain 5'aaugcuuccaggacauuuc 3' 6254715372846361517 32 second chain 5'gaaauguccuggaagcauu 3' 4626181735482647251 33 LPA-1151 first chain 5'acagugguggagaaugugc 3' 6364548184646254547 34 second chain 5'gcacauucucccaccacugu 3' 4727251717363727181 35 LPA-1171 first chain 5'guaugugccucgauaacuc 3' 8161818371746162717 36 second chain 5'gaguuaucgaggcacauaac 3' 4645161746483636163 37 LPA-1177 first chain 5'ucgauaacucuguccauca 3' 5382526353545372536 38 second chain 5'ugaggacagaguuaucga 3' 1825482728281525382 39 LPA-1189 first chain 5'ugucacuggacauuguguc 3' 5453635482725181817 40 second chain 5'gacacaauguccagugaca 3' 4636362545372818272 41 LPA-1244 first chain 5'cugggauccaugguguaac 3' 7184825372548181627 42 second chain 5'guuacaccauggaucccag 3' 4516363725482537364 43 LPA-1248 first chain 5'agaugaccaagcuuggcag 3' 6461827362835184728 44 second chain 5'cugccaagcuuggucaucu 3' 3547362835184536171

Table 1. Nucleotide modifications are indicated by the following numbers (column 4), 1=2'F-dU, 2=2'F-dA, 3=2'F-dC, 4=2'F-dG, 5=2'- OMe-rU; 6=2'-OMe-rA; 7=2'-OMe-rC; 8=2'-OMe-rG.

Table 2. Sequences of the LPA, APOB, beta-actin, and Pten qPCR amplicon sets used to measure mRNA levels are shown below.

- 41 045986

table 2

Gene View Sequences SEQ ID NO: LPA: (upper) Human 5' AAGTGTCCTTGGCGACGTCC 3' 45 LPA: (lower) 5' CCTGGACTGTGGGGCTTT 3' 46 LPA: (probe) 5' CTGTTTCTGAACAAGCACCAACGGAGC 3' 47 LPA (upper) Cynomolgus macaque 5' GTGTCCTCGCAACGTCCA 3' 48 LPA (lower) 5' GACCCCGGGGCTTTG 3' 49 LPA (probe) 5'TGGCTGTTTCTGAACAAGCACAATGG 3' 50 AROV (upper) Human 5' TCATTCCTTCCCCCAAAGAGACC 3' 51 AROV (lower) 5' CACCTCCGTTTTGGTGGTAGAG 3' 52 AROV (probe) 5' CAAGCTGCTCAGTGGAGGCAACACATTA 3' 53 Beta actin (top) Human 5' GCATGGGTCAGAAGGATTCCTAT 3' 54 Beta actin (bottom) 5' TGTAGAAGGTGTGGTGCCAGATT 3' 55 Beta actin (probe) 5' TCGAGCACGGCATCGTCACCAA 3' 56 Beta actin (top) Cynomolgus macaque 5'AAGGCCAACCGCGAGAAG 3' 57 Beta actin (bottom) 5'AGAGCGTACAGGGACAGCA 3' 58 Beta actin 5' TGAGACCTTCAACACCCCAGCCATGTAC 59 (probe) 3' PPIB (upper) Human 5'AGATGTAGGCCGGGTGATCTTT 3' 60 PPIB (lower) 5' GTAGCCAAATCCTTTCTCTCCTGT 3' 61 PPIB (probe) 5' TGTTCCAAAACAGTGGATAATTTTGTGGCC 3' 62

Example 2. Screening of unconjugated siRNA molecules (Table 1) for inhibition of LPA mRNA expression in human RT-4 cells.

Liposomal transfection complexes were prepared in triplicate at a ratio of 1.5 μl RNAiMax (ThermoFisher)/80 pmol of the indicated siRNA molecules. The complex was diluted to the indicated concentrations of 2.5 nM and 25 nM, respectively (values are presented in pairs as lighter and darker gray bars). Human bladder transitional papilloma RT4 cells endogenously expressing LPA were seeded at a density of 125,000 cells per well in a 24-well format on top of pre-plated transfection complexes (reverse transfection) at the indicated concentration. 24 h after transfection, total RNA was isolated using the Spin Cell Mini Kit 250 (Stratec). LPA mRNA levels were determined by quantitative real-time PCR against PPIB mRNA expression in the corresponding samples as a constitutive gene transcript. Values were normalized to the amount of LPA mRNA detected in untreated cells (intraplate). A non-silencing siRNA compound was transfected as an additional control. Means and standard deviations (SD) of normalized triplicates are presented. The results are shown in Fig. 1.

- 42 045986

Example 3. Dose-dependent response of unconjugated LPA-targeting siRNA compounds on LPA mRNA expression in human RT-4 cells.

RT4 human bladder transitional papilloma cells were reverse transfected as described above (Example 2) and treated at the indicated concentration (ranging from 100 nM to 0.2 nM) with various unconjugated siRNA compounds (Table 1) as noted . 24 h after transfection, total RNA was isolated using the Spin Cell Mini Kit 250 (Stratec). LPA mRNA levels were determined by real-time qPCR relative to PPIB mRNA expression in the corresponding samples as a constitutive gene transcript. Values were normalized to the amount of LPA mRNA detected in untreated cells. Bars represent residual LPA mRNA expression for each data point. The results are shown in Fig. 2.

Example 4 Inhibition of LPA mRNA expression in primary human and cynomolgus hepatocytes by varying doses of GalNAc-L1 LPA-1038-conjugated siRNA molecule delivered by receptor-mediated uptake.

Primary hepatocytes (ThermoFisher) were plated on collagen-coated 96-well plates at a density of 45,000 cells per well (cynomolgus monkey) and 30,000 cells per well (human). GalNAc-L1-conjugated LPA-1038 was added at the indicated concentrations (nM) immediately after plating. 24 h after siRNA treatment, total RNA was isolated using the InviTrap RNA cell HTS kit (Stratec) for 96-well plate. LPA mRNA levels were determined by real-time qPCR relative to actin (cynomolgus) or APOB (human) mRNA levels in the corresponding samples as the constitutive gene transcript. Values were normalized to LPA expression in untreated cells. The means and standard deviations of normalized triplicate residual LPA mRNA levels are shown as black bars. The results are shown in Fig. 3.

Example 5 Silencing of LPA mRNA in primary human hepatocytes by various indicated L6-GalNAc-conjugated siRNAs in primary human hepatocytes after receptor-mediated delivery.

Primary human hepatocytes (ThermoFisher) were seeded onto collagen-coated 96-well plates at 30,000 cells per well (96-well format). GalNAc-L6-conjugated siRNAs, including a non-silencing control, were added at the two indicated concentrations immediately after cell seeding. 24 h after siRNA treatment, total RNA was isolated using the InviTrap RNA cell HTS kit (Stratec) for 96-well plate. LPA mRNA expression levels were determined by real-time qPCR against APOB mRNA as the constitutive gene transcript. Values were normalized to LPA mRNA expression in untreated cells, and residual LPA mRNA levels are presented in pairs as bars (100 nM black bars, 20 nM gray bars). The means and standard deviations of the normalized triplicates are shown in Figs. 4.

Example 6. Determination of TTR shutdown in vitro for various GalNAc TTR siRNA conjugates.

Primary mouse hepatocytes were seeded in collagen pre-coated 96-well plates (Thermo Fisher Scientific, catalog number A1142803) at a cell density of 30,000 cells per well and treated with siRNA conjugates at concentrations that ranged from 10 nM to 0.0001 nM. At 24 h post-treatment, cells were lysed and RNA was extracted using InviTrap® RNA Cell HTS 96/C24x96 Prep Kits (Stratec, catalog no. 7061300400) according to the manufacturer's protocol. TTR transcript and constitutive gene (PtenII) mRNA levels were quantified using TaqMan assay.

Target gene expression in primary mouse hepatocytes 24 hours after treatment with the conjugates of the present invention, conjugates 1-3, showed that target gene expression decreased with increasing conjugate dose compared to negative controls (see UT bar and reference conjugate 3) , as shown in Fig. 7. This indicates that the first strand binds to the target gene, which reduces gene expression. In fig. 7 also shows the target gene expression levels for reference conjugates 1 and 2, which act as comparison conjugates. As follows from a comparison of the data presented in Fig. 7A and 7C, and 7B and 7C, the conjugates of the present invention (conjugates 1-3) reduce target gene expression compared to reference conjugates 1 and 2. The most effective conjugate at 0.01 nM appears to be conjugate 2 The most effective conjugate at 0.1 nM, 0.5 nM, 1 nM and 10 nM appears to be conjugate 3.

Example 7. Temporal dynamics of serum TTR in mice under in vivo conditions.

c57BL/6 mice were treated with 1 mg/kg siRNA conjugates subcutaneously on day 0. Serum samples were collected on days 7, 14, and 27 by collecting blood from the orbital sinus and stored at −20°C until analysis. Serum TTR quantification was performed using a mouse prealbumin ELISA (ALPCO, 41-PALMS/lot 22, 2008003B) according to the manufacturer's protocol (sample dilution 1:8000 or 1:800).

- 43 045986

Results for the time course of serum TTR in n=4 cohorts of C57BL/6 mice 7, 14 and 27 days after treatment with 1 mg/kg subcutaneous administration of conjugates 1-3, reference conjugates 1, 2 and 4 and in individuals with sham processing (FSB) are shown in Fig. 8. As evidenced by the data in FIG. 8, the conjugates of the present invention are particularly effective in reducing target gene expression compared to the negative control (PBS) and reference conjugates 1, 2 and in particular reference conjugate 4. Conjugates 2 and 3 are also more effective than reference conjugates 1. 2 and 4. The most effective conjugate is conjugate 2. Thus, the dosage level of conjugate 3 can be expected to be approximately three times lower to achieve a similar initial off-off and will also result in a longer off-off duration compared to the reference conjugate 4.

More specifically, in wild-type mice, conjugate 2 resulted in a 3-fold decrease in serum target protein levels on day seven and a 4-fold decrease in serum target protein levels on day 27 compared to the reference conjugate 4 at an equimolar dose. In addition, conjugate 2 resulted in an 85% reduction in serum target protein levels at day 27 after a single injection, compared to a 36% reduction with an equimolar amount of reference conjugate 4.

Example 8. Equal dose-dependent knockout for siRNA targeting LPA with two separate GalNAc elements conjugated to the second strand compared to a three-antennary GalNAc element at 5' of the second strand in primary cynomolgus hepatocytes.

The miRNAs are modified using alternating 2′-OMe/2′-F and each contains two phosphorothioate (PS) internucleotide linkages at its two 5′ and 3′ internucleotide linkages. In conjugate 19, each serinol-GalNAc element is attached via a PS bond to the 5' and 3' of the second strand. In conjugate 20, the two terminal 5' internal nucleotides of the second strand are phosphodiesters, and a three-antennary GalNAc linker is attached via a PS bond to this end.

Dose-dependent silencing of LPA in primary cynomolgus monkey hepatocytes was assessed 24 h after treatment with 100, 20, 4, 0.8, 0.16, 0.032, and 0.006 nM siRNA. The reference control is design 2, the non-targeting control is called Cte. The transcript ct value for each treatment group was normalized to the ct value of the constitutive ACTB gene transcript (Act) and to untreated hepatocytes called ut (AAct).

The data is shown in Fig. 10.

Material and methods.

siRNA.

SEQ ID NO: Name Series Chain Subsequence 135 Conjugate 19 KHOZ 73 Х0373А mA (ps) fU (ps) mA fA mC fU mC fU mG fU mC fC mA fU mU fA mC (ps) fC (ps) mG 136 Х0373В Ser(GN) (ps) fC (ps) mG (ps) fG mU fA mA fU mG fG mA fC mA fG mA fG mU fU (ps) mA (ps) fU (ps) Ser(GN) 135 Reference conjugate 9 STS20041L6 STS2041A mA (ps) fU (ps) mA fA mC fU mC fU mG fU mC fC mA fU mU fA mC (ps) fC (ps) mG 137 STS2041B ST23 (ps) ST23 (ps) ST23 (ps) C6XLT (ps) fC mG fG mU fA mA fU mG fG mA fC mA fG mA fG mU fU (ps) mA (ps) fU 138 Conjugate Reference 5 (CTR) X0125 Х0125А mC (ps) fU (ps) mU fA mC fU mC fU mC fG mC fC mC fA mA fG mC (ps) fG (ps) mA 139 Х0125В [(ST23) (ps)] ₃ (C6XLT) (ps) fU mC fG mC fU mU fG mG fG mC fG mA fG mA fG mU fA (ps) mA (ps) fG

- 44 045986

Signature.

mA, mU, mC, mG 2'-O-methyl RNA fA, fU, fC, fG 2'-deoxy-2'-fluoro-RNA (ps) phosphorothioate (po) phosphodiester

Primer.

SEQ Ш NO

Straight GTGTCCTCGCAACGTCCA 48 LPA Reverse GACCCCGGGGCTTTG 49 Probe BHQ1 -TGGCTGTTTCTGAAC AAGC ACC AATGG-F AM 140 Straight GCATGGGTCAGAAGGATTCCTAT 54 ASTV Reverse TGTAGAAGGTGTGGTGCCAGATT 55 Probe BHQ 1 -TCGAGC ACGGC ATCGTC ACC AA-VIC 141 General methods

Experiments in in vitro conditions.

Primary mouse hepatocytes (Thermo Scientific: GIBCO lot no. MC798) were thawed and cryopreservation medium was replaced with Williams E medium supplemented with 5% fetal bovine serum (FBS), 1 μM dexamethasone, 2 mM GlutaMax, 1% PenStrep, 4 mg/ml human recombinant insulin, 15 mM Hepes. The cell density was adjusted to 250,000 cells per 1 ml. 100 μl per well of this cell suspension was seeded into collagen-pre-coated 96-well plates. The test article was pre-diluted in the same medium (5-fold concentrated) for each concentration, and 25 μl of this pre-diluted siRNA or medium alone was added to the cells. Cells were cultured at 37°C and 5% CO ₂ . 24 h after treatment, the supernatant was removed, and the cells were washed in cold PBS and 250 μl of RNA lysis buffer S (Stratec) was added. After 15 min of incubation at room temperature, the plates were stored at −80°C until RNA extraction according to the manufacturer's protocol.

TaqMan assay.

For the mTTR&PTEN Multiplex TaqMan assay, 10 μl of isolated RNA for each treatment group was mixed with 10 μl of a common PCR reaction mixture (TAKYON low Rox) containing 600 nM mTTR primer, 400 nM ApoB primer, and 200 nM of each probe, plus 0.5 Euroscript II RT polymerase units with 0.2 units. RNase inhibitor. The TaqMan assay was performed in a 384-well plate with a 10 min RT step at 48°C, a 3 min initial denaturation at 95°C, and 40 cycles of 95°C for 10 s and 60°C for 1 min. The primers contain two of BHQ1, FAM and YY, one at each end of the sequence.

For the TMPRSS6&ApoB Multiplex TaqMan assay, 10 μl of isolated RNA for each treatment group was mixed with 10 μl of a common PCR reaction mixture (TAKYON low Rox) containing 800 nM TMPRSS6 primer, 100 nM ApoB primer, and 200 nM of each probe, plus 0.5 Euroscript II RT polymerase units with 0.2 units. RNase inhibitor. The TaqMan assay was performed in a 384-well plate with a 10 min RT step at 48°C, a 3 min initial denaturation at 95°C, and 40 cycles of 95°C for 10 s and 60°C for 1 min.

Experiments in in vivo conditions.

To compare the in vivo efficacy of different siRNA conjugates, 1 mg/kg siRNA dissolved in PBS was injected subcutaneously into the scapula region of C57BL/6 mice. Cohorts of n=6 were treated with siRNA targeting Aldh2 or Tmprss6 on day 1 and sacrificed at selected time points post-treatment. Liver samples were snap frozen in liquid nitrogen and stored at −80°C until RNA extraction using the InviTrap Spin Tissue RNA Mini Kit (Stratec) according to the manufacturer's instructions. The transcript levels of Aldh2, Tmprss6 and Pten were then quantified as described above.

Stability analysis in tritosomes.

To examine RNase stability in the endosomal/lysosomal compartment of liver cells in vitro, siRNA was incubated for 0 h, 4 h, 24 h, or 72 h in Sprague Dawley rat liver tritosomes (Tebu-Bio, catalog number R0610.LT, lot : 1610405, pH: 7.4, 2.827 units/ml). To simulate an acidified environment, tritosomes were mixed in a ratio of 1:10 with a low pH buffer (1.5 M acetic acid, 1.5 M sodium acetate, pH = 4.75). 30 µl of acidified tritosomes. Then, 10 μl of siRNA (20 μM) was mixed and incubated for the indicated time points at 37°C. After incubation, RNA was isolated using Clarity OTX starter kit cartridges

- 45 045986 (Phenomenex, catalog number KSO-8494) in accordance with the manufacturer's protocol for biological fluids. Lyophilized RNA was reconstituted in 30 μL H2O, mixed with 4× loading buffer, and 5 μL loaded onto a 20% TBE-polyacrylamide electrophoresis gel (PAGE) for separation in a qualitative semiquantitative analysis. PAGE was performed at 120 V for 2 h, and RNA was visualized by ethidium bromide staining followed by digital imaging using a Biorad imaging system.

Example 9. Synthesis of conjugates.

Exemplary compounds were synthesized in accordance with the methods described below and methods known to one skilled in the art. Assembly of the oligonucleotide chain and linker building blocks was performed using solid-phase synthesis using phosphoamidite methodology. GalNAc conjugation was accomplished by forming a peptide bond between a GalNAc-carboxylic acid building block and a preassembled and purified oligonucleotide containing the required amount of attached amino-modified linker building blocks.

Synthesis, deprotection, and purification of oligonucleotides were performed according to standard procedures known in the art.

All oligonucleotides were synthesized on an AKTA oligopilot synthesizer using standard phosphoamidite reactions. We used a commercially available solid support and 2'-O-methyl-RNA phosphoamidites, 2'-fluoro, 2'-deoxy-RNA phosphoamidites (all with standard protection, ChemGenes, LinkTech) and the commercially available 3'-amino modifier TFA-amino -C-6-lcaa-CPG 500 A (Chemgenes), Fmoc-amino-DMT-C-7-CE-phosphoamidite (GlyC3Am), 3'-amino modifier C-3-lcaa-CPG 500 A (C3Am), Fmoc-amino-DMT-C-3-CED-phosphoamidite (C3Am) and TFA-amino-C-6-CED-phosphoamidite (C6Am) (Chemgenes), 3'-amino C7 CPG modifier (C7Am) (Glen Research) , non-nucleoside TFA amino phosphoamidite (Pip), non-nucleoside TFA amino solid support (PipAm) (AM Chemicals). Peracetylated galactosamine 8 is available commercially.

Auxiliary reagents were purchased from EMP Biotech. The synthesis was performed using a 0.1 M solution of phosphoamidite in dry acetonitrile, and benzylthiotetrazole (BTT) (0.3 M in acetonitrile) was used as an activator. The binding time was 15 min. The cycle Cap/OX/Cap or Cap/Thio/Cap (Cap: Ac ₂ O/NMI/lutidine/acetonitrile, oxidizing agent: 0.1 M I2 in pyridine/H ₂ O) was used. Phosphothioates were introduced using a standard commercially available thiolation reagent (EDITH, Link technologies). Cleavage of DMT was carried out by treatment with 3% dichloroacetic acid in toluene. After completion of the programmed synthesis cycles, washes with diethylamine (DEA) were performed. All oligonucleotides were synthesized in DMT-off mode.

Attachment of the serinol-derived linker group was accomplished using either base-loaded (S)-DMT-serinol(TFA)-succinate-lcaa-CPG 10 or (S)-DMTserinol(TFA)phosphoamidite 7 (synthesis was performed as described in Hoevelmann et al. (2016)). Trihantane GalNAc clusters (ST23/C4XLT) were introduced by sequential coupling of the corresponding tripling amidite derivatives (C4XLT-phos) followed by the addition of GalNAc amidite (ST23phos).

Attachment of amino-modified groups (non-serinol linkers) was accomplished by using either an appropriate commercially available amino-modified CPG building block or amidite.

Single chains were cleaved from CPG by treatment with 40% aq. methylamine. The resulting crude oligonucleotide was purified by ion exchange chromatography (Resource Q, 6 mL, GE Healthcare) on an AKTA Pure HPLC system using a sodium chloride gradient. Product-containing fractions were pooled, desalted on a gel permeation chromatography column (Zetadex, EMP Biotech) and lyophilized.

Individual single chains were dissolved at a concentration of 60 OD/ml in H2O. Both solutions of individual oligonucleotides were added together to the reaction vessel. Titration was performed to facilitate reaction monitoring. The first chain was added at a 25% excess over the second chain, as determined by UV absorbance at 260 nm. The reaction mixture was heated to 80°C for 5 min and then slowly cooled to room temperature. The formation of the double chain was monitored by the formation of ion pairs using reverse phase HPLC. Based on the UV area of the residual single chain, the required amount of the second chain was calculated and added to the reaction mixture. The reaction mixture was again heated to 80°C and slowly cooled to room temperature. This procedure was repeated until less than 10% of the residual single chain was detected.

Synthesis of compounds 2-10.

Compounds 2-5 and (S)-DMT-serinol(TFA)-phosphoamidite 7 were synthesized according to published methods (Hoevelmann et al. Chem. Sci., 2016,7, 128-135).

^)-4-(3-(bis-(4-Methoxyphenyl)(phenyl)methoxy)-2-(2,2,2-trifluoroacetamido)propoxy)-4-oxobutanoic acid (6).

Succinic anhydride was added to a solution of 5 in pyridine, followed by DMAP. The resulting mixture

- 46 045986 stirred at room temperature overnight. All starting material was consumed as assessed by TLC. The reaction was concentrated. The crude material was subjected to silica gel chromatography using a gradient of 0 to 5% methanol in DCM (+1% triethylamine) to give 1.33 g of 6 (yield=38%). m/z (ESI ^- ): 588.2 (100%), (calculated for C30H29F3NO8 ^- [M-H] ^- 588.6), 1H-NMR: (400 MHz, CDCl3) δ [ppm]=7.94 (d, 1H, NH), 7.39-7.36 (m, 2H, CHaryl), 7.29-7.25 (m, 7H, CHaryl), 6.826.79 (m, 4H, CHaryl), 4 .51-4.47 (m, 1H), 4.31-4.24 (m, 2H), 3.77 (s, 6H, 2xDMTr-OMe), 3.66-3.60 (m, 16H, HNEt3 ⁺ ), 3.26-3.25 (m, 2H), 2.97-2.81 (m, 20H, NEt3), 2.50-2.41 (4H, m), 1.48-1 .45 (m, 26H, HNEt ₃ ⁺ ), 1.241.18 (m, 29H, NEt ₃ ).

(S)-DMT-Serinol(TFA)-succinate-lcaa-CPG (10).

(S)-DMT-Serinol(TFA)-succinate (159 mg, 270 µmol) and HBTU (113 mg, 299 µmol) were dissolved in CH3CN (10 ml). Diisopropylethylamine (DIPEA, 94 μl, 540 μmol) was added to the solution and the mixture was stirred for 2 minutes, followed by the addition of native amino-lcaa-CPG (500 A, 3 g, amine content: 136 μmol/g). The suspension was shaken gently at room temperature on a wrist shaker for 16 hours, then filtered and washed with DCM and EtOH. The solid support was dried in vacuum for 2 hours. Unreacted amines on the support were capped by stirring with acetic anhydride/lutidine-methylimidazole at room temperature. Washing the substrate was repeated as described above. The solid was dried in vacuo to obtain solid support 10 (3 g, loading 26 μmol/g).

GalNAc synthon (9).

Synthesis of GalNAc synthon 9 was performed as described in Nair et al. J. Am. Chem. Soc, 2014, 136 (49), pp. 16958-16961, with 46% yield over two stages.

Characteristic data correspond to published data.

Synthesis of oligonucleotides.

All single-stranded oligonucleotides were synthesized according to the reaction conditions described above and in FIG. 5 and 6, and presented in table. 3 and 4.

All finished single chain products were analyzed by LC-HPLC to confirm their purity. Purity is expressed as % FLP (% Full Length Product), which is the percentage of UV area under the signal of a given product in the UV LC-HPLC analysis curve of the finished product. The identity of the corresponding single-stranded products (unmodified, amino-modified precursors, or GalNAc-conjugated oligonucleotides) was confirmed by LC/MS analysis.

Table 3 Single-stranded unconjugated oligonucleotides

Product(s) Name Calculated Installed %FLP they say weight they say weight (OH- (ESI-) HPLC) A0002 STS16001A 6943.3 Yes 6943.0 Yes 86.6% A0006 STS16001BL4 8387.5 Yes 8387.5 Yes 94.1% A0114 STS22006A 6143.8 Yes 6143.7 Yes 94.3% A0115 STS22006BL1 7855.1 Yes 7855.1 Yes 92.8% JSC 122 STS22009A 6260.9 Yes 6260.6 Yes 92.8% JSC 123 STS22009BL1 7783.0 Yes 7782.9 Yes 87.1% A0130 STS18001A 6259.9 Yes 6259.8 Yes 76.5% A0131 STS18001BL4 7813.2 Yes 7813.1 Yes 74.3% A0220 STS16001B-5'lxNH2 6982.2 Yes 6982.1 Yes 95.7% A0237 STS16001A 6943.3 Yes 6943.3 Yes 95.6% A0244 STS16001BV1 6845.2 Yes 6844.9 Yes 98.2% A0264 STS16001AV4-3'lxNH2 7112.4 Yes 7112.2 Yes 95.4% A0329 STS16001BV6-3'5'lxNH2 7183.3 Yes 7183.2 Yes 88.8% A0560 STS16001A 6943.3 Yes 6943.3 Yes 96.7% A0541 STS16001BVl-3'5'NH2 7151.3 Yes 7151.0 Yes 85.6% A0547 STS16001BV16-3'5'NH2 7119.3 Yes 7119.1 Yes 89.9% A0617 STS16001BV20-3'5'NH2 7087,ZDa 7086.7 Yes 90.1% A0619 STS16001BVl-3'5'2xNH2 7521.3 Yes 7521.3 Yes 93.4% A0680 STS16001A 6943.3 Yes 6942.9 Yes 91.2%

- 47 045986

A0514 STS22006A 6143.8 Yes 6143.7 Yes 94.6% A0516 STS22009BV11-3'5'NH2 6665.0 Yes 6664.8 Yes 87.0% A0517 STS22009BV11-3'5'NH2 6593.0 Yes 6593.0 Yes 86.0% A0521 STS12009BVl-3'5'NH2 6437.7 Yes 6437.8 Yes 91.1% AOHOZ STS12209BL4 7665.0 Yes 7664.9 Yes 90.4% A0304 STS12209A 6393.1 Yes 6392.9 Yes 77.6% A0319 STS22009A 6260.9 Yes 6260.5 Yes 86.9% A0353 STS12009A 6416.1 Yes 6416.1 Yes 94.1% A0216 STS17001A 6178.8 Yes 6178.7 Yes 87.2% A0217 STS17001BL6 7937.2 Yes 7937.2 Yes 78.3%

5'1xNH2 indicates the position (5' end) and number (1xNH2) of free amino groups derived from serinol that are available for conjugation. For example, 1x3'NH2 on A0264 means that there is a free amino group that can react with GalNAc synthon 9 at the 3' end of the A0264 chain. 3'5'1xNH2 means that there is one free amino group derived from serinol that can react with GalNAc linker 9 at the 3' end and 5' end of the chain.

Table 4 Single-stranded oligonucleotides with 5' and 3' modifications

Product Name 5'-mod. Z'-mod. Calculated mol. weight At the established pier. weight (ESI-) %FLP (AHHPLC) A0561 STS16001BV1- SbAt 3'5'lxNH2 GlyC3Am 7267.5 Yes 7267.5 Yes 66.7% A0563 STS16001BV1- SZat 3'5ΊχΝΗ2 SZAT 7183.4 Yes 7183.1 Yes 75.1% A0651 STS16001BV1- SbAt 3'5ΊχΝΗ2 S7At 7265.6 Yes 7265.2 Yes 99.6% А0653 STS16001BV1- GlyC3Am 3'5'lxNH2 GlyC3Am 7299.5 Yes 7299.3 Yes 88.1% А0655 STS16001BV1- PipAm 3'5'lxNH2 PipAm 7517.7 Yes 7517.5 Yes 89.8%

Likewise, 3'5'1 xNH ₂ refers to the position (3' and 5' end) and number (1xNH ₂ each) of free amino groups that are available for conjugation. For example, 3'5'1 xNH ₂ on A0561 means there are 2 free amino groups (1 at the 3' end and 1 at the 5' end) that can react with GalNAc synthon 9 at the 3' end of the A0561 chain.

Synthesis of some conjugates and reference conjugates 1-2.

Conjugation of the GalNAc synthon (9) was accomplished by binding to the amino functional group of the serinol of the corresponding oligonucleotide chain 11 using a coupling reagent to form a peptide bond. Thus, the corresponding amino-modified precursor molecule 11 was dissolved in _H2O (500 OD/ml) and DMSO (DMSO/H2O, 2/1, v/v) was added, followed by DIPEA (2.5% of the total volume ). In a separate reaction vessel, pre-activation of GalN(Ac4)-C4 acid (9) was performed using 2 eq. (per amino functional group in the amino-modified precursor of oligonucleotide 11) carboxylic acid component with 2 eq. HBTU in the presence of 8 eq. DIPEA in DMSO. After 2 min, preactivated compound 9 was added to the solution of the corresponding amino-modified precursor molecule. After 30 min, the progress of the reaction was monitored using LC/MS or LC-HPLC. After completion of the conjugation reaction, the crude product was precipitated by the addition of 10xiPrOH and 0.1x2 M NaCl and collected by centrifugation and decantation. To release the acetylated hydroxyl groups in the GalNAc groups, the resulting precipitate was dissolved in 40% MeNH ₂ (1 ml at 500 OD) and after 15 min at room temperature diluted in H2O (1:10), and finally repurified by anion exchange and gel permeation chromatography and lyophilized to obtain the final product 12 (Table 5).

- 48 045986

Table 5

Single-stranded GalNAc-conjugated oligonucleotides

Product (12) Original material Name Calculated mol. weight Installed pier mass (ESI-) %FLP (AHPLC) A0241 A0220 STS16001BL20 7285.5 Yes 7285.3 Yes 91.8% A0268 A0264 STS 16001AV4L33 7415.7 Yes 7415.4 Yes 96.9% AOZZO A0329 STS16001BV6L42 7789.8 Yes 7789.8 Yes 95.5% A0544 A0541 STS16001BV1L75 7757.9 Yes 7757.7 Yes 93.3% A0550 A0547 STS16001BV16L42 7725.9 Yes 7725.7 Yes 88.5% A0620 A0617 STS16001BV20L75 7693.91 Yes 7693.2 Yes 90.9% A0622 A0619 STS16001BV1L94 8734.3 Yes 8734.6 Yes 82.9% A0519 A0516 STS22006BV11L42 7271.7 Yes 7271.7 Yes 90.0% A0520 A0517 STS22009BV11L42 7199.6 Yes 7199.7 Yes 92.9% A0522 A0521 STS12009BV1L42 7044.4 Yes 7044.4 Yes 96.0% A0603 A0602 STS20041BV1L42 7280.7 Yes 7280.4 Yes 93.4%

Synthesis of some conjugates according to the present invention.

Conjugation of the GalNAc synthon (9) was accomplished by binding to the amino functional group of the corresponding oligonucleotide chain 14 using a coupling reagent to form a peptide bond. Thus, the corresponding amino-modified precursor molecule 14 was dissolved in H2O (500 OD/ml) and DMSO (DMSO/H2O, 2/1, v/v) was added, followed by DIPEA (2.5% of the total volume). In a separate reaction vessel, pre-activation of GalN(Ac4)-C4 acid (9) was performed using 2 eq. (per amino functional group in the amino-modified precursor of oligonucleotide 14) carboxylic acid component with 2 eq. HBTU in the presence of 8 eq. DIPEA in DMSO. After 2 min, preactivated compound 9 was added to the solution of the corresponding amino-modified precursor molecule. After 30 min, the progress of the reaction was monitored using LC/MS or LC-HPLC. After completion of the conjugation reaction, the crude product was precipitated by the addition of 10xiPrOH and 0.1x2 M NaCl and collected by centrifugation and decantation. To release the acetylated hydroxyl groups in the GalNAc groups, the resulting precipitate was dissolved in 40% MeNH ₂ (1 ml at 500 OD) and after 15 min at room temperature diluted in H2O (1:10), and finally repurified by anion exchange and gel permeation chromatography and lyophilized to obtain the final product 15 (Table 6).

Table 6

Single-stranded GalNAc-conjugated oligonucleotides

Product (15) Original material Name Calculated mol. weight At the established pier. mass (ESI-) %FLP (AHPLC) A0562 A0561 STS16001BV1L87 7874.2 Yes 7874.0 Yes 82.7% A0564 A0563 STS16001BV1L88 7790.0 Yes 7789.4 Yes 90.4% A0652 A0651 STS16001BV1L96 7872.2 Yes 7871.8 Yes 94.6% A0654 A0653 STS16001BV1L97 7906.2 Yes 7905.6 Yes 89.9% A0656 A0655 STS16001BV1L98 8124.3 Yes 8124.0 Yes 93.6%

Double chain formation.

Double chains were prepared according to the methods described above.

Double chain purity is expressed as % double chain, which is the percentage of UV area under the signal of a given product in the UV curve of the IP-RP-HPLC analysis (Table 7).

- 49 045986

Table 7

Nucleic acid conjugates

Product Source materials Name % double chain First chain Second chain Reference A0237 A0241 STS16001L20 97.7% conjugate 1 Reference A0268 A0244 STS16001L33 97.8% conjugate 2 Reference A0130 A0131 STS18001L4 96.8% conjugate 3 Reference A0002 A0006 STS16001L4 90.1% conjugate 4 Reference A0216 A0217 STS17001L6 88.4% conjugate 5 Conjugate 1 A0268 A0241 STS16001L24 96.0% Conjugate 2 A0237 AOZZO STS16001V1L42 98.5% Conjugate 3 A0268 AOZZO STS16001V1L43 98.2% Conjugate 4 A0560 A0544 STS16001V1L75 92.5% Conjugate 5 A0560 AO55O STS 16001 Vl 6L42 95.3% Conjugate 6 A0237 A0620 STS16001V20L75 97.8% Conjugate 7 A0237 A0622 STS16001V1L94 93.7% Conjugate 8 A0680 A0652 STS16001V1L96 98.4% Conjugate 9 A0680 A0654 STS16001V1L97 95.8% Conjugate 10 A0680 A0656 STS16001V1L98 97.6% Conjugate 11 A0560 A0564 STS16001V1L88 95.0% Conjugate 12 A0237 A0562 STS16001V1L87 96.8% Conjugate 13 A0114 A0115 STS22006L1 85.6% Conjugate 14 JSC 122 JSC 123 STS22009L1 96.4% Conjugate 15 A0514 A0519 STS22006V11L42 98.6% Conjugate 16 A0319 A0520 STS22009V11L42 97.0% Conjugate 17 A0304 AOHOZ STS12209L4 93.0% Conjugate 18 A0353 A0522 STS12009V1L42 98.0% Conjugate 19 A0601 A0603 STS20041BL42 97.6%

Sequences

Modification designations for the following sequences:

f is 2'-fluoro-2'-deoxyribonucleotide or 2'-fluororibonucleotide (the terms are interchangeable);

m is 2'-O-methylribonucleotide;

(ps) denotes a phosphorothioate bond;

FAM=6-carboxyfluorescein;

BHQ=Black Hole Quencher 1;

YY=Yakima Yellow.

Definitions

Ser(GN) is a building block of GalNAc-C4 attached to a serinol-derived linker group:

ABOUT

- 50 045986 where O--- represents a bond between an oxygen atom and, for example, H, a phosphodiester bond or a phosphorothioate bond. GN represents:

C4XLT is:

C6XLT is:

ST23 is:

The synthesis of phosphoamidite derivatives C4XLT (C4XLT-phos), C6XLT (C6XLT-phos), as well as ST23 (ST23-phos) can be performed as described in WO 2017/174657. C4XLT-phos:

C6XLT-phos:

ST23-phos:

where G=H (before conjugation) or G=GN (after conjugation).

- 51 045986

Conjugate 1

Antisense ijenb-STS16001AL33 (SEQ ID NO: 127)

5' mU (ps) fU (ps) mA fU mA fG mA fG mC fA mA fG mA fA mC fA mC fU mG (ps) fU (ps) mU (ps) Ser(GN) 3'

Semantic ijenb-STS16001BL20 (SEQ Ш NO: 128)

5' Ser(GN) (ps) fA mA fC mA fG mU fG mU fU mC fU mU fG mC fU mC fU mA fU (ps) mA (ps) fA 3'

Conjugate 2

Antisense strand-8Т816001 A (SEQ ID NO: 129) mU (ps) fU (ps) mA fU mA fG mA fG mC fA mA fG mA fA mC fA mC fU mG (ps) fU (ps) mU

Semantic ijenb-STS16001BVlL42 (SEQ ID NO: 130)

Ser(GN) (ps) fA (ps) mA (ps) fC mA fG mU fG mU fU mC fU mU fG mC fU mC fU mA fU (ps) mA (ps) fA (ps) Ser(GN)

Conjugate 3

Antisense ijenb-STS16001AL33 (SEQ ID NO: 127)

5' mU (ps) fU (ps) mA fU mA fG mA fG mC fA mA fG mA fA mC fA mC fU mG (ps) fU (ps) mU (ps) Ser(GN) 3'

Semantic rienb-STS16001BVlL42 (SEQ ID NO: 130)

5' Ser(GN) (ps) fA (ps) mA (ps) fC mA fG mU fG mU fU mC fU mU fG mC fU mC fU mA fU (ps) mA (ps) fA (ps) Ser(GN) 3 '

Conjugate 4

Antisense ijenb-STS16001A (SEQ ID NO: 129) mU (ps) fU (ps) mA fU mA fG mA fG mC fA mA fG mA fA mC fA mC fU mG (ps) fU (ps) mU

Sense ₄ enb-STS16001BVlL75 (SEQ ID NO: 142)

5' Ser(GN) fA (ps) mA (ps) fC mA fG mU fG mU fU mC fU mU fG mC fU mC fU mA fU (ps) mA (ps) fA Ser(GN) 3'

Conjugate 5

Antisense ijenb-STS16001A (SEQ ID NO: 129) mU (ps) fU (ps) mA fU mA fG mA fG mC fA mA fG mA fA mC fA mC fU mG (ps) fU (ps) mU

Semantic rienb-STS16001BV16L42 (SEQ ID NO: 143)

5' Ser(GN) (ps) fA mA fC mA fG mU fG mU fU mC fU mU fG mC fU mC fU mA fU mA fA (ps) Ser(GN) 3'

Conjugate 6

Antisense ijenb-STS16001A (SEQ ID NO: 129) mU (ps) fU (ps) mA fU mA fG mA fG mC fA mA fG mA fA mC fA mC fU mG (ps) fU (ps) mU

Sense ₄ enb-STS16001BV20L75 (SEQ ID NO: 144)

5' Ser(GN) fA mA fC mA fG mU fG mU fU mC fU mU fG mC fU mC fU mA fU mA fA Ser(GN) 3'

Conjugate 7

Antisense ijenb-(SEQ ID NO: 129) mU (ps) fU (ps) mA fU mA fG mA fG mC fA mA fG mA fA mC fA mC fU mG (ps) fU (ps) mU

Sense ₄ enb-STS16001BVlL94 (SEQ ID NO: 145)

- 52 045986

5' Ser(GN) (ps) Ser(GN) (ps) fA (ps) mA (ps) fC mA fG mU fG mU fU mC fU mU fG mC fU mC fU mA fU (ps) mA (ps) fA ( ps) Ser(GN) (ps) Ser(GN) 3'

Conjugate 8

Antisense ijenb-STS16001A (SEQ Ш NO: 129)

5' mU (ps) fU (ps) mA fU mA fG mA fG mC fA mA fG mA fA mC fA mC fU mG (ps) fU (ps) mU 3'

Semantic uenb-STS16001VlBL96 (SEQ ID NO: 146)

5' C6Am(GN) (ps) fA (ps) mA (ps) fC mA fG mU fG mU fU mC fU mU fG mC fU mC fU mA fU (ps) mA (ps) fA (ps) C7Am(GN) 3 '

Conjugate 9

Antisense ijenb-STS16001A (SEQ ID NO: 129)

5' mU (ps) fU (ps) mA fU mA fG mA fG mC fA mA fG mA fA mC fA mC fU mG (ps) fU (ps) mU 3'

Semantic uenb-STS16001VlBL97 (SEQ ID NO: 147)

5' GlyC3 Am(GN) (ps) fA (ps) mA (ps) fC mA fG mU fG mU fU mC fU mU fG mC fU mC fU mA fU (ps) mA (ps) fA (ps) GlyC3Am(GN) 3'

Conjugate 10

Antisense ijenb-STS16001A (SEQ ID NO: 129)

5' mU (ps) fU (ps) mA fU mA fG mA fG mC fA mA fG mA fA mC fA mC fU mG (ps) fU (ps) mU 3'

Semantic Chain (SEQ ID NO: 148)

5' PipAm(GN) (ps) fA (ps) mA (ps) fC mA fG mU fG mU fU mC fU mU fG mC fU mC fU mA fU (ps) mA (ps) fA (ps) PipAm(GN) 3 '

Conjugate 11

Antisense strand-8T816001A (SEQ ID NO: 129)

5' mU (ps) fU (ps) mA fU mA fG mA fG mC fA mA fG mA fA mC fA mC fU mG (ps) fU (ps) mU 3'

Sense ₄ enb-STS16001VlBL88 (SEQ ID NO: 149)

5' C3Am(GN) (ps) fA (ps) mA (ps) fC mA fG mU fG mU fU mC fU mU fG mC fU mC fU mA fU (ps) mA (ps) fA (ps) C3Am(GN) 3 '

Conjugate 12

Antisense strand-8T816001A (SEQ ID NO: 129)

5' mU (ps) fU (ps) mA fU mA fG mA fG mC fA mA fG mA fA mC fA mC fU mG (ps) fU (ps) mU 3'

- 53 045986

Semantic uenb-STS16001VlBL87 (SEQ Ш NO: 150)

5' C6Am(GN) (ps) fA (ps) mA (ps) fC mA fG mU fG mU fU mC fU mU fG mC fU mC fU mA fU (ps) mA (ps) fA (ps) GlyC3Am(GN) 3 '

Conjugate 15

Antisense strand (SEQ Ш NO: 151) mU (ps) fC (ps) mU fU mC fU mU fA mA fA mC fU mG fA mG fU mU (ps) fU (ps) mC

Semantic Chain (SEQ ID NO: 152)

Ser(GN) (ps) fG (ps) mA (ps) fA mA fC mU fC mA fG mU fU mU fA mA fG mA fA (ps) mG (ps) fA (ps) Ser(GN)

Conjugate 16

Antisense strand (SEQ ID NO: 153) mA (ps) fU (ps) mG fU mA fG mC fC mG fA mG fG mA fU mC fU mU (ps) fC (ps) mU

Semantic Chain (SEQ ID NO: 154)

Ser(GN) (ps) fA (ps) mG (ps) fA mA fG mA fU mC fC mU fC mG fG mC fU mA fC (ps) mA (ps) fU (ps) Ser(GN)

Conjugate 18

Antisense strand (SEQ ID NO: 155) mA (ps) fA (ps) mC fC mA fG mA fA mG fA mA fG mC fA mG fG mU (ps) fG (ps) mA

Semantic Chain (SEQ ID NO: 156)

Ser(GN) (ps) fU (ps) mC (ps) fA mC fC mU fG mC fU mU fC mU fU mC fU mG fG (ps) mU (ps) fU (ps) Ser(GN)

Conjugate 19

Antisense strand (SEQ ID NO: 135) mA (ps) fU (ps) mA fA mC fU mC fU mG fU mC fC mA fU mU fA mC (ps) fC (ps) mG

Semantic Chain (SEQ ID NO: 136)

Ser(GN) (ps) fC (ps) mG (ps) fG mU fA mA fU mG fG mA fC mA fG mA fG mU fU (ps) mA (ps) fU (ps) Ser(GN)

Reference conjugate 1

Antisense strand-8Т816001А (SEQ ID NO: 129) mU (ps) fU (ps) mA fU mA fG mA fG mC fA mA fG mA fA mC fA mC fU mG (ps) fU (ps) mU

Sense nenb-STS16001BL20 (SEQ ID NO: 128)

- 54 045986

Ser(GN) (ps) fA mA fC mA fG mU fG mU fU mC fU mU fG mC fU mC fU mA fU (ps) mA (ps) fA

Reference conjugate 2

Antisense ijenb-STS16001AL33 (SEQ Ш NO: 127) mU (ps) fU (ps) mA fU mA fG mA fG mC fA mA fG mA fA mC fA mC fU mG (ps) fU (ps) mU (ps) Ser(GN )

Sense circuit-STS 1600IBVI (SEQ Ш NO: 157) fA (ps) mA (ps) fC mA fG mU fG mU fU mC fU mU fG mC fU mC fU mA fU (ps) mA (ps) fA

Reference conjugate 3 - “Luc”

Antisense strand-STSlSOOlA (A0130, SEQ Ш NO: 132) mU (ps) fC (ps) mG fA mA fG mU fA mU fU mC fC mG fC mG fU mA (ps) fC (ps) mG Sense strand-STS 18001BL4 ( A0131, SEQ ID NO: 133)

[(ST23) (ps)] ₃ C4XLT (ps) fC mG fU mA fC mG fC mG fG mA fA mU fA mC fU mU fC (ps) mG (ps) fA

Reference conjugate 4

Antisense strand-8Т816001АЭЗЗ (SEQ ID NO: 127) mU (ps) fU (ps) mA fU mA fG mA fG mC fA mA fG mA fA mC fA mC fU mG (ps) fU (ps) mU

Sense Circuit - STS 16001BL4 (SEQ ID NO: 134)

5'[(ST23) (ps)] ₃ C4XLT(ps) fA (ps) mA (ps) fC mA fG mU fG mUfU mC fU mU fG mC fU mC fU mA fU (ps) mA (ps) fA

Reference conjugate 5 - “Ctr”

Antisense strand (SEQ ID NO: 138) mC (ps) fU (ps) mU fA mC fU mC fU mC fG mC fC mC fA mA fG mC (ps) fG (ps) mA

Semantic Chain (SEQ ID NO: 139)

[(ST23) (ps)]3 (C6XLT) (ps) fU mC fG mC fU mU fG mG fG mC fG mA fG mA fG mU fA (ps) mA (ps) fG

Reference conjugate 6

Antisense strand (SEQ ID NO: 151) mU (ps) fC (ps) mU fU mC fU mU fA mA fA mC fU mG fA mG fU mU (ps) fU (ps) mC

Semantic Chain (SEQ ID NO: 158)

[ST23 (ps)]3 Itrb (ps) fG mA fA mA fC mU fC mA fG mU fU mU fA mA fG mA fA (ps) mG (ps) fA

- 55 045986

Reference conjugate 7

Antisense strand (SEQ Ш NO: 153) mA (ps) fU (ps) mG fU mA fG mC fC mG fA mG fG mA fU mC fU mU (ps) fC (ps) mU

Semantic Chain (SEQ ID NO: 159)

[ST23 (ps)]3 Itrb (ps) fA mG fA mA fG mA fU mC fC mU fC mG fG mC fU mA fC (ps) mA (ps) fU

Reference conjugate 8

Antisense strand (SEQ ID NO: 160) mU (ps) fA (ps) mC fC mA fG mA fA mG fA mA fG mC fA mG fG mU (ps) fG (ps) mA

Semantic Chain (SEQ ID NO: 161)

[ST23 (ps)]3 ST41 (ps)fU mC fA mC fC mU fG mC fU mU fC mU fU mC fU mG fG (ps) mU (ps) fA

Reference conjugate 9

Antisense strand (SEQ ID NO: 135) mA (ps) fU (ps) mA fA mC fU mC fU mG fU mC fC mA fU mU fA mC (ps) fC (ps) mG

Semantic Chain (SEQ ID NO: 162)

[ST23 (ps)]3 C6XLT (ps) fC mG fG mU fA mA fU mG fG mA fC mA fG mA fG mU fU (ps) mA (ps) fU

Example 10. Determination of TTR shutdown in vitro for various GalNAc TTR siRNA conjugates.

Conjugates 4-7.

The method described above under the heading In Vitro Experiments in the General Methods section was used.

Expression of the target gene in primary murine hepatocytes 24 hours after treatment with 0.01 nM, 0.1 nM, 0.5 nM, 1 nM and 10 nM of the conjugates of the present invention, conjugates 4-7, showed that the expression of the target gene decreases with increasing conjugate dose compared to negative controls (see bar UT and Luc [reference conjugate 3]), as shown in FIG. 11. This indicates that the first strand binds to the target gene, reducing gene expression.

In vitro data indicate that in the case of one or two serinol-derived linker groups provided at the 5' and 3' ends of the sense strand in conjugates 4-7, the number of phosphorothioate (PS) linkages between the terminal nucleotide and linker, and/or between the three terminal nucleotides in the sense strand can be changed while maintaining the effectiveness of reducing target gene expression.

Conjugates 8-12 and 19.

The method described above under the heading In Vitro Experiments in the General Methods section was used.

Expression of the target gene in primary murine hepatocytes 24 hours after treatment with 0.01 nM, 0.1 nM, 0.5 nM, 1 nM and 10 nM of the conjugates of the present invention, conjugates 8-12, showed that the expression of the target gene decreases with increasing conjugate dose compared to negative controls (see bar UT and Luc [reference conjugate 3]), as shown in FIG. 12. This indicates that the first strand binds to the target gene, which reduces gene expression. In particular, conjugates 8, 9, 10, and 11 appear to be comparable to or superior to conjugate 2, which was previously shown to be the most effective conjugate at 0.01 nM.

Conjugate 19 was also shown to reduce target gene expression compared to negative controls (see bar UT and Ctr, which is a non-targeting siRNA and is also called reference conjugate 5), as shown in FIG. 13. This indicates that the first strand binds to the target gene, which reduces gene expression.

In vitro data for conjugates 8-12 and 19 indicate that a number of structurally distinct linkers that are conjugated at both ends of the sense strand are effective in reducing target gene expression. Conjugates 8-12 and 19 reduce target gene expression more effectively than Luc, which is reference conjugate 3 (for conjugates 8-12), Ctr, which is reference conjugate 5 (for conjugate 19), and untreated control.

- 56 045986

Example 11. Temporal dynamics of serum Ttr, Aldh2 and Tmprss6 in mice under in vivo conditions.

Conjugates 15-18.

The method described above under the heading In Vivo Experiments in the General Methods section was used.

Results for the time course of serum Aldh2 in n=6 cohorts of C57BL/6 mice on days 14, 28 and 42 following treatment with 1 mg/kg subcutaneous administration of conjugates 15 and 16, reference conjugates 6 and 7, and sham-treated individuals ( FSB) are shown in Fig. 14 and 15. Data in Figs. 14 and 15 indicate that the conjugates of the present invention are particularly effective in reducing target gene expression compared to the negative control (PBS) and reference conjugates 6 and 7, respectively.

Results for the time course of serum Tmprss6 in n=6 c57BL/6 mouse cohorts on days 14, 28 and 42 post-treatment with 1 mg/kg SC of conjugate 18, reference conjugate 8 and sham-treated (PBS) individuals are shown in fig. 16. Data in FIG. 16 indicate that the conjugates of the present invention are particularly effective in reducing target gene expression compared to the negative control (PBS) and reference conjugate 8.

Overall, the data obtained in vivo demonstrate that various exemplary linkers that are conjugated at both ends of the second strand are effective in reducing target gene expression in vivo. The location of the linker improves the performance of the conjugates in vivo compared to the control three-antennary GalNAc linker at the 5' end of the second strand (reference conjugates 6, 7 and 8).

Example 12 Stability studies in serum.

The method described above under the heading Tritosome Stability Assay in the General Methods section was used.

In fig. 17 shows the results of serum stability studies for conjugates 2, 4, 5, 6 and 7. FIG. Figure 18 shows the serum stability of conjugates 2, 8, 9, 10, 11 and 12.

All tested conjugates according to the present invention are more stable in serum compared to the control.

Each of all conjugates tested contains one GalNAc linker element at the 5' end and another at the 3' end of the second strand. The siRNAs are modified using alternating 2′-OMe/2′-F and each contain two phosphorothioate (PS) internucleotide linkages at their 5′ and 3′ terminal two internucleotide linkages unless otherwise noted.

In conjugate 4, the serinol-GalNAc elements are attached via a phosphodiester bond. In conjugate 5, the serinol-GalNAc elements are conjugated by PS, while all internucleotide bonds in the second strand are phosphodiester. In conjugate 6, the second strand does not contain PS. In conjugate 7, two serinol-GalNAc units are attached to each end of the second strand and to each other via PS bonds at their respective ends. In conjugate 8, a C.'6 amino modifier at the 5' and a C7 amino modifier at the 3' end of the second strand were used to attach the ligand. In conjugate 9, Gly-C3-amino modifiers were used as linkers for conjugation to both ends of the second chain, piperidyl-amino modifiers were used in conjugate 10, C3-α-amino modifiers were used in conjugate 11, and serinol-GalNAc elements were used in conjugate 2 . In conjugate 2, both terminal internucleotide bonds as well as the nucleotide-serinol bonds are PS. In conjugate 12, a C6 amino modifier at the 5' and a GlyC3 amino modifier at the 3' end of the second strand were used to attach the ligand. Ut denotes the untreated sample to which other samples were normalized. Luc denotes the luciferase-targeting siRNA (reference conjugate 3) that was used as a non-targeting control and which does not reduce target mRNA levels.

The data shows that in the case of a serinol-derived linker group provided at the 5' and 3' ends of the sense strand, the number of phosphorothioate (PS) bonds between the terminal nucleotide and the linker, and/or between the three terminal nucleotides in the sense strand can be varied, maintaining stability in serum.

Example 13.

Primary human (Lot Hu1823) and cynomolgus (Lot CY367) hepatocytes and media were obtained from Life Technologies. As described by the manufacturer, primary hepatocytes were thawed and placed in plating medium consisting of Williams E medium (Life Technologies) supplemented with 5% fetal bovine serum, 1 μM dexamethasone in DMSO (DMSO final concentration = 0.01%), and 3.6 % v/v Thaw/Inoculate Mix-A (Thermo Fisher Scientific, CM3000).

Primary human hepatocytes were seeded into 9-well plates coated with collagen I (Life Technologies) at a density of 30,000 cells per well. Cynomolgus hepatocytes were seeded at a density of 45,000 cells per well. Conjugate 21 and control siRNA conjugated to GalNAc were serially diluted 5-fold over a concentration range of 0.006–100 nM and added immediately after plating to the plating medium. The plates were then incubated at 37°C under 5% CO2 for 24 hours. Cells were then lysed and RNA isolated using the method described below.

- 57 045986

Sequence of conjugate 21

Antisense strand - conjugate 21 (SEQ GO NO: 165)

5' mA (ps) fU (ps) mA fA mC fU mC fU mG fU mC fC mA fU mU fA mC (ps) fC (ps) mG3'

Sense Circuit - STS16001BL20 (SEQ ID NO: 164)

5' [ST23 (ps)]3 C6XLT (ps) mC mG mG mU mA mA fU fG fG mA mC mA mG mA mG mU mU (ps) mA (ps) mU 3'

Total RNA was extracted using the InviTrap HTS 96-well kit (Stratec Molecular GmbH, Berlin, Germany) according to the manufacturer's instructions with the following modifications to the protocol: After the final washing step, the plates were centrifuged at 6000 rpm for twenty minutes. The RNA binding plate was then placed on top of the elution plate, and the RNA was eluted in two cycles of adding 30 μl of elution buffer and incubating for two minutes at room temperature, followed by centrifugation at 1000 rpm for one minute. The last elution step was performed by centrifugation at 1700 g (4000 rpm) for 3 min. RNA was stored at -80°C.

Ten μl of RNA solution was used for gene expression analysis by quantitative reverse transcription polymerase chain reaction (RT-qPCR) performed using amplicon kits/sequences for LPA, ASTB (Eurogentec Deutschland GmbH, Cologne, Germany), APB and PLG (BioTez GmbH, Berlin, Germany).

RT-qPCR reactions were performed using ABI StepOne Plus (Applied Biosystems, part of Thermo Fisher Scientific, MA, USA) using standard RT-PCR protocols (48°C for 30 min, 95°C for 10 min, 40 cycles at 95°C 15 s, then 60°C 1 min).

In primary hepatocytes, LPA and PLG assays were performed in single-plex assays (primers: 300 nM, probe: 100 nM). APOB (200 nM) and ASTB (300 nM) were performed in a multiplex assay by adding 100 nM of each probe to the standard mixture.

Data were calculated using the comparative computed tomography method, also known as ^AACt method 2 (Livak and Schmittgen, 2001 and Schmittgen and Livak, 2008). Here, the amount of APOB, LPA, or PLG mRNA normalized to the endogenous ACTB standard relative to the calibration standard (untreated triplicate control) is given by

Unless otherwise stated, all values presented in the example refer to the mean ± standard deviation. _IC50 values were calculated using a sigmoidal 4-parameter dose response curve in GraphPad Prism 7.

In fig. 19 shows suppression of LPA mRNA by conjugate 21 via receptor-mediated uptake into primary human hepatocytes 24 hours after siRNA treatment (IC ₅₀ =3.6 nM). LPA mRNA expression levels were normalized to ACTB and relative to cells treated with a non-targeting siRNA control measured by RT-qPCR. Data are presented as the mean ± standard deviation of one experiment. In fig. 20 shows silencing of LPA mRNA by conjugate 21 via receptor-mediated uptake into primary cynomolgus hepatocytes 24 hours after siRNA treatment (IC ₅₀ =0.7 nM). LPA mRNA expression levels were normalized to ACTB and relative to cells treated with a non-targeting siRNA control measured by RT-qPCR. Data are presented as the mean ± standard deviation of one experiment.

In fig. 21 shows silencing of APB mRNA by conjugate 21 via receptor-mediated uptake into primary human hepatocytes 24 hours after siRNA treatment. APOB mRNA expression levels were normalized to ACTB and relative to cells treated with a non-targeting siRNA control measured by RT-qPCR. Data are presented as the mean ± standard deviation of one experiment.

In fig. 22 shows suppression of PLG mRNA by conjugate 21 via receptor-mediated uptake into primary human hepatocytes 24 hours after siRNA treatment. PLG mRNA expression levels were normalized to ACTB and relative to cells treated with a non-targeting siRNA control measured by RT-qPCR. Data are presented as the mean ± standard deviation of one experiment.

Conjugate 21 provides a high level of inhibition of LPA mRNA without affecting the levels of APB and PLG mRNA.

- 58 045986

Example 14.

To test the in vivo efficacy of conjugate 21, male cynomolgus monkeys were used to conduct a pharmacodynamic study. The animals were divided into 4 groups of 3 animals per group. Before dosing, serum was prepared to establish baseline Lp(a) levels for each animal. On day 1, conjugate 21 was prepared in 0.9% saline and each animal received a single dose of conjugate 21 at 0.1, 0.3, 1.0, and 3.0 mg/kg.

Serial samples were collected over 29 days and Lp(a) levels were measured using ELISA (Mercodia, Catalog No. 10-1106-01 Lot: 27736; Uppsala, Sweden). All values were normalized to baseline values for each individual predose animal and presented as a percentage of baseline (FIG. 23). Doses of 1.0 and 3.0 mg/kg showed a marked reduction in serum Lp(a) levels (69.4 and 77.3% at 29 days, respectively). The dose-dependent effect results in an ED ₅₀ dose of 0.56 mg/kg (Fig. 24). These data indicate that a significant and sustained reduction in serum Lp(a) levels is achieved with a single dose of conjugate 21. Based on these data, dosing can be expected to be infrequent, no more than once every two months.

Summary of the invention

The following is a summary of the invention.

1. A nucleic acid for inhibiting the expression of LPA in a cell, comprising at least one duplex region that contains at least a portion of a first strand and at least a portion of a second strand that is at least partially complementary to the first strand, wherein said first strand is at least is at least partially complementary to at least a portion of the RNA transcribed from the LPA gene, wherein said first strand contains a nucleotide sequence selected from the following sequences: SEQ ID NO: 9, 5, 1, 3, 7, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41 or 43.

2. The nucleic acid of claim 1, wherein said first strand contains the nucleotide sequence of SEQ ID NO: 9, and optionally, said second strand contains the nucleotide sequence of SEQ ID NO: 10; or wherein said first strand contains the nucleotide sequence of SEQ ID NO: 5, and optionally said second strand contains the nucleotide sequence of SEQ ID NO: 6.

3. A nucleic acid for inhibiting the expression of LPA in a cell, comprising at least one duplex region that contains at least a portion of a first strand and at least a portion of a second strand that is at least partially complementary to the first strand, wherein said first strand is at least is at least partially complementary to at least a portion of the RNA transcribed from the LPA gene, wherein said first strand contains a nucleotide sequence selected from the following sequences: SEQ ID NO: 9 or 5.

4. A nucleic acid as defined in any of the preceding claims, wherein each said first strand and/or said second strand is between 17 and 35 nucleotides in length.

5. A nucleic acid as claimed in any one of the preceding claims, wherein the at least one duplex region consists of 17-25, preferably 19-25, consecutive nucleotide base pairs.

6. A nucleic acid as claimed in any of the preceding claims, wherein the nucleic acid:

a) has a blunt end at both ends; or

b) has a sticky end on one end and a blunt end on the other; or

c) has a sticky end on both ends.

7. A nucleic acid as claimed in any of the preceding claims, wherein one or more nucleotides on the first and/or second strand are modified to form modified nucleotides.

8. A nucleic acid as claimed in any of the preceding claims, wherein the nucleic acid comprises a phosphorothioate bond between one, two or three 3' nucleotides and/or 5' nucleotides of one or both ends of the first and/or second strand.

9. A nucleic acid as claimed in any one of the preceding claims, wherein the nucleic acid is conjugated to a ligand.

10. The nucleic acid of claim 9, wherein the ligand contains (i) one or more N-acetylgalactosamine (GalNAc) groups or derivatives thereof, and (ii) a linker, wherein the linker conjugates to at least one GalNAc group or derivative thereof to form a nucleic acid .

11. Nucleic acid according to any of statements 9-10, characterized in that said nucleic acid is conjugated to a ligand containing a compound of formula (I):

wherein S is a saccharide, preferably said saccharide being N-acetylgalactosamine;

X ¹ represents C3-C ₆ -alkylene or (-CH ₂ -CH ₂ -O) _m (-CH ₂ ) ₂ -, where m is 1, 2 or 3;

P is a phosphate or a modified phosphate, preferably a thiophosphate;

- 59 045986

X ² represents an alkylene or alkylene ether of the formula (-CH ₂ )nO-CH ₂ -, where n=1-6;

A represents a branching element;

X ³ represents a bridge element;

wherein the nucleic acid according to any of statements 1-8 is conjugated to X ³ through a phosphate or modified phosphate, preferably a thiophosphate.

12. Nucleic acid according to any of statements 9-10, characterized in that said first strand of RNA is a compound of formula (X):

in which b is 0 or 1; and said second RNA strand is a compound of formula (XI):

in which c and d are independently equal to 0 or 1;

Z ₁ and Z ₂ represent RNA portions of said first and second RNA strands, respectively;

Y represents O or S;

n is 0, 1, 2 or 3; And

L1 represents the linker to which the ligand is attached; and at the same time b + c + d is equal to 2 or 3.

13. A nucleic acid for inhibiting the expression of LPA in a cell, comprising at least one duplex region that contains at least a portion of a first strand and at least a portion of a second strand that is at least partially complementary to said first strand, wherein said first strand is at least partially complementary to said first strand. is at least partially complementary to at least a portion of the RNA transcribed from the LPA gene, wherein said first strand contains and preferably consists of the nucleotide sequence of SEQ ID NO: 9, and optionally said second strand contains and preferably consists of the nucleotide sequence of SEQ ID NO: : 10.

14. Nucleic acid according to statement 13, characterized in that said nucleic acid is conjugated to a ligand and has the following structure: it

J.®

S where Z is a Claim 13 nucleic acid and is preferably conjugated to the 5' end of the second strand.

15. The nucleic acid according to claim 14, characterized in that said nucleic acid contains two phosphorothioate bonds between each of the three 3' terminal and between each of the three 5' terminal nucleotides on said first strand and two phosphorothioate bonds between the three 3' terminal nucleotides - end of said second strand, and wherein said ligand is conjugated to the 5' end of said second strand.

- 60 045986

16. Nucleic acid according to claim 13, characterized in that said nucleic acid is conjugated to a ligand, wherein said first RNA strand is a compound of formula (XV):

in which b is 0 or 1; and said second RNA strand is a compound of formula (XVI):

(XVI);

in which c and d are independently equal to 0 or 1;

wherein Z1 and Z2 represent RNA parts of said first and second RNA strands, respectively;

Y represents O or S;

R ₁ represents H or methyl;

n is 0, 1, 2 or 3; And

L is the same or different in formulas (XV) and (XVI) and is selected from the group consisting of:

- (CH ₂ )q, where q=2-12;

- (CH2)r-C(O)-, where r=2-12;

- (CH2-CH2-O)s-CH2-C(O)-, where s=1-5;

- (CH ₂ ) _t -CO-NH-(CH ₂ )t-NH-C(O)-, where t independently represents 1-5;

- (CH ₂ ) _u -CO-NH-(CH ₂ ) _u -C(O)-, where u independently represents 1-5; And

- (CH ₂ ) _v -NH-C(O)-, where v represents 2-12; and wherein the terminal C(O), if present, is attached to the NH group;

and at the same time b + c + d is equal to 2 or 3.

17. Nucleic acid according to any one of claims 13-16, containing the sequence and modifications presented below.

SEQ Ш NO: Subsequence Modifications 9 5' AUAACUCUGUCCAUUACCG 3 6162717181736152738 10 5' CGGUAAUGGACAGAGUUAU 3' 3845261846364645161

where specific modifications are indicated by numbers

1=2'F-dU,

2=2'F-dA,

3=2'F-dC,

4=2'F-dG,

5=2'-OMe-rU; 6=2'-OMe-rA; 7=2'-OMe-rC; 8=2'-OMe-rG.

18. Nucleic acid according to any of statements 13-16, characterized in that the nucleotides at positions 2 and 14 from the 5'-end of the first strand are modified with a 2'-fluoro modification, and the nucleotides on the second strand that correspond to position 11, or 13, or 11 and 13, or 11-13 of the first chain are modified with a 2'-fluoro modification.

19. A composition containing a nucleic acid according to any of statements 1-18 and optionally a delivery vehicle, and/or a physiologically acceptable excipient, and/or a carrier, and/or a diluent, and/or a buffer, and/or a preservative, for use as a medicine, preferably for preventing or treating or reducing the risk of a disease or pathology, wherein the disease or pathology is preferably a cardiovascular disease, wherein the cardiovascular disease is preferably a stroke, atherosclerosis

- 61 045986 sclerosis, thrombosis, coronary heart disease or aortic stenosis and/or any other disease or pathology associated with elevated levels of Lp(a)-containing particles.

20. A pharmaceutical composition containing a nucleic acid according to any of statements 1-18 and further containing a delivery vehicle, preferably liposomes, and/or a physiologically acceptable excipient and/or a carrier and/or a diluent.

21. The use of a nucleic acid according to any of claims 1-18 or a pharmaceutical composition according to claim 20 for preventing or treating or reducing the risk of a disease or pathology, wherein the disease or pathology is preferably a cardiovascular disease, wherein the cardiovascular disease is preferably a stroke, atherosclerosis, thrombosis, coronary heart disease or aortic stenosis and any other disease or pathology associated with elevated levels of Lp(a)-containing particles.

22. A method of preventing or treating a disease, disorder or syndrome, comprising administering a composition comprising a nucleic acid according to any of claims 1-18 or a composition according to claims 19-20 to an individual in need of treatment, wherein preferably the nucleic acid or composition is administered to the subject subcutaneously, intravenously or using any other route of administration such as oral, rectal or intraperitoneal.

Summary table of sequences

SEQ ID NO Name Sequence (5'-3') Unmodified sequence analogue (5'-3') 1 LPA-1014 first chain UCUAUAACAAUAAGGGGC UCUAUAACAAUAAGGGGC 2 LPA-1014 second chain GCCCCUUAUUGUUAUACGA GCCCCUUAUUGUUAUACGA 3 LPA-1024 first chain GAUAACUCUGUCCAUUACC GAUAACUCUGUCCAUUACC 4 LPA-1024 second chain GGUAAUGGACAGAGUUAUC GGUAAUGGACAGAGUUAUC 5 LPA-1038 first chain AUAACUCUGUCCAUUACCA AUAACUCUGUCCAUUACCA 6 LPA-1038 second chain UGGUAAUGGACAGAGUUAU UGGUAAUGGACAGAGUUAU 7 LPA-1040 first chain UAACUCUGUCCAUUACCGU UAACUCUGUCCAUUACCGU 8 LPA-1040 second chain ACGGUAAUGGACAGAGUUA ACGGUAAUGGACAGAGUUA 9 LPA-1041 first chain AUAACUCUGUCCAUUACCG AUAACUCUGUCCAUUACCG 10 LPA-1041 second chain CGGUAAUGGACAGAGUUAU CGGUAAUGGACAGAGUUAU AND LPA-1055 first chain AGAAUGUGCCUCGAUAACU AGAAUGUGCCUCGAUAACU 12 LPA-1055 second chain AGUUAUCGAGGCACAUUCU AGUUAUCGAGGCACAUUCU 13 LPA-1057 first chain AUAACUCUGUCCAUCACCA AUAACUCUGUCCAUCACCA 14 LPA-1057 second chain UGGUGAUGGACAGAGUUAU UGGUGAUGGACAGAGUUAU 15 LPA-1058 AUAACUCUGUCCAUCACCU AUAACUCUGUCCAUCACCU

- 62 045986

first chain 16 LPA-105 8 second chain AGGUGAUGGACAGAGUUAU AGGUGAUGGACAGAGUUAU 17 LPA-1061 first chain UAACUCUGUCCAUUACCAU UAACUCUGUCCAUUACCAU 18 LPA-1061 second chain AUGGUAAUGGACAGAGUUA AUGGUAAUGGACAGAGUUA 19 LPA-1086 first chain AUGUGCCUUGAUAACUCUG AUGUGCCUUGAUAACUCUG 20 LPA-1086 second chain CAGAGUUAUCAAGGCACAU CAGAGUUAUCAAGGCACAU 21 LPA-1099 first chain AGUUGGUGCUGCUUCAGAA AGUUGGUGCUGCUUCAGAA 22 LPA-1099 second chain UUCUGAAGCAGCACCACU UUCUGAAGCAGCACCACU 23 LPA-1102 first chain AAUAAGGGGCUGCCACAGG AAUAAGGGGCUGCCACAGG 24 LPA-1102 second chain CCUGUGGCAGCCCCUUAUU CCUGUGGCAGCCCCUUAUU 25 LPA-1116 first chain UAACUCUGUCCAUCACCAU UAACUCUGUCCAUCACCAU 26 LPA-1116 second chain AUGGUGAUGGACAGAGUUA AUGGUGAUGGACAGAGUUA 27 LPA-1127 first chain AUGAGCCUCGAUAACUCUG AUGAGCCUCGAUAACUCUG 28 LPA-1127 second chain CAGAGUUAUCGAGGCUCAU CAGAGUUAUCGAGGCUCAU 29 LPA-1128 first chain AAUGAGCCUCGAUAACUCU AAUGAGCCUCGAUAACUCU thirty LPA-1128 second chain AGAGUUAUCGAGGCUCAUU AGAGUUAUCGAGGCUCAUU 31 LPA-1141 first chain AAUGCUUCCAGGACAUUUC AAUGCUUCCAGGACAUUUC 32 LPA-1141 GAAAUGUCCUGGAAGCAUU GAAAUGUCCUGGAAGCAUU

- 63 045986

second chain 33 LPA-1151 first chain ACAGUGGUGGAGAAUGUGC ACAGUGGUGGAGAAUGUGC 34 LPA-1151 second chain GCACAUUCUCCCACCACUGU GCACAUUCUCCCACCACUGU 35 LPA-1171 first chain GUAUGUGCCUCGAUAACUC GUAUGUGCCUCGAUAACUC 36 LPA-1171 second chain GAGUUAUCGAGGCACAUAC GAGUUAUCGAGGCACAUAC 37 LPA-1177 first chain UCGAUAACUCUGUCCAUCA UCGAUAACUCUGUCCAUCA 38 LPA-1177 second chain UGAUGGACAGAGUUAUCGA UGAUGGACAGAGUUAUCGA 39 LPA-1189 first chain UGUCACUGGACAUUGUGUC UGUCACUGGACAUUGUGUC 40 LPA-1189 second chain GACACAAUGUCCAGUGACA GACACAAUGUCCAGUGACA 41 LPA-1244 first chain CUGGGAUCCAUGGGUGUAAC CUGGGAUCCAUGGGUGUAAC 42 LPA-1244 second chain GUUACACCAUGGAUCCCAG GUUACACCAUGGAUCCCAG 43 LPA-1248 first chain AGAUGACCAAAGCUUGGCAG AGAUGACCAAAGCUUGGCAG 44 LPA-1248 second chain CUGCCAAGCUUGGUCAUCU CUGCCAAGCUUGGUCAUCU 45 LPA: (upper) person AAGTGTCCTTGGCGACGTCC AAGTGTCCTTGGCGACGTCC 46 LPA: (lower) person CCTGGACTGTGGGGCTTT CCTGGACTGTGGGGCTTT 47 LPA: (probe) person CTGTTTCTGAAGCACCAAC GGAGC CTGTTTCTGAACAAGCACCAA CGGAGC 48 LPA GTGTCCTCGCAACGTCCA GTGTCCTCGCAACGTCCA

- 64 045986

(upper) Javanese macaques 49 LPA (lower) cynomolgus macaque GACCCCGGGGCTTTG GACCCCGGGGCTTTG 50 LPA (probe) cynomolgus macaque TGGCTGTTTCTGAACAAGCACC AATGG TGGCTGTTTCTGAACAAGCAC CAATGG 51 AROV (upper) person TCATTCCTTCCCCCAAAGAGACC TCATTCCTTCCCCCAAAGAGAC WITH 52 AROV (lower) person CACCTCCGTTTTGGTGGTAGAG CACCTCCGTTTTGGTGGTAGA G 53 AROV (probe) person CAAGCTGCTCAGTGGAGGCAA SASATTA CAAGCTGCTCAGTGGAGGCAA SASATTA 54 beta actin (top) human GCATGGGTCAGAAGGATTCCT AT GCATGGGTCAGAAGGATTCCT AT 55 beta actin (lower) human TGTAGAAGGTGTGGTGCCAGA TT TGTAGAAGGTGTGGTGCCAGA TT 56 beta actin (probe) human TCGAGCACGGCATCGTCACCA A TCGAGCACGGCATCGTCACCA A 57 beta actin (upper) Javanese macaques AAGGCCAACCGCGAGAAG AAGGCCAACCGCGAGAAG 58 beta actin (lower) cynomolgus macaque AGAGGCGTACAGGGACAGCA AGAGGCGTACAGGGACAGCA

- 65 045986

59 beta actin (probe) cynomolgus monkey TGAGACCTTCAACACCCCAGCC ATGTAC TGAGACCTTCAACACCCCAGC CATGTAC 60 PPIB (upper) person AGATGTAGGCCGGGGTGATCTTT AGATGTAGGCCGGGTGATCTT T 61 PPIB (lower) person GTAGCCAAATCCTTTCTCTCCT GT GTAGCCAAATCCTTTCTCTCCT GT 62 PPIB (probe) man TGTTCCAAAACAGTGGATAAT TTTGTGGCC TGTTCCAAAACAGTGGATAA TTTTGTGGCC 63 LPA: (upper) person AAGTGTCCTTGGCGACGTCC AAGTGTCCTTGGCGACGTCC 64 LPA: (lower) person CCTGGACTGTGGGGCTTT CCTGGACTGTGGGGCTTT 65 LPA: (probe) person CTGTTTCTGAAGCACCAAC GGAGC CTGTTTCTGAACAAGCACCAA CGGAGC 66 LPA (top) cynomolgus macaque GTGTCCTCGCAACGTCCA GTGTCCTCGCAACGTCCA 67 LPA (lower) cynomolgus macaque GACCCCGGGGCTTTG GACCCCGGGGCTTTG 68 LPA (probe) cynomolgus macaque TGGCTGTTTCTGAACAAGCACC AATGG TGGCTGTTTCTGAACAAGCAC CAATGG 69 AROV (upper) person TCATTCCTTCCCCCAAAGAGACC TCATTCCTTCCCCCAAAGAGAC C 70 AROV CACCTCCGTTTTGGTGGTAGAG CACCTCCGTTTTGGTGGTAGA

- 66 045986

(bottom) man G 71 AROV (probe) person CAAGCTGCTCAGTGGAGGCAA SASATTA CAAGCTGCTCAGTGGAGGCAA SASATTA 72 beta actin (top) human GCATGGGTCAGAAGGATTCCT AT GCATGGGTCAGAAGGATTCCT AT 73 beta actin (lower) human TGTAGAAGGTGTGGTGCCAGA TT TGTAGAAGGTGTGGTGCCAGA TT 74 beta actin (probe) human TCGAGCACGGCATCGTCACCA A TCGAGCACGGCATCGTCACCA A 75 Modified SEQ Ш NO: 1 5381616272616284847 UCUAUAACAAUAAGGGGC 76 Modified SEQ Ш NO: 2 4737351615451616382 GCCCCUUAUUGUUAUACGA 77 Modified SEQ Ш NO: 3 8252635354537251637 GAUAACUCUGUCCAUUACC 78 Modified SEQ Ш NO: 4 4816254827282815253 GGUAAUGGACAGAGUUAUC 79 Modified SEQ Ш NO: 5 6162717181736152736 AUAACUCUGUCCAUUACCA 80 Modified SEQ Ш NO: 6 1845261846364645161 UGGUAAUGGACAGAGUUAU 81 Modified SEQ Ш NO: 7 5263535453725163745 UAACUCUGUCCAUUACCGU

- 67 045986

82 Modified SEQ Ш NO: 8 2748162548272828152 ACGGUAAUGGACAGAGUUA 83 Modified SEQ Ш NO: 9 6162717181736152738 AUAACUCUGUCCAUUACCG 84 Modified SEQ Ш NO: 10 3845261846364645161 CGGUAAUGGACAGAGUUAU 85 Modified SEQ Ш NO: И 6462545473538252635 AGAAUGUGCCUCGAUAACU 86 Modified SEQ Ш NO: 12 2815253828472725171 AGUUAUCGAGGCACAUUCU 87 Modified SEQ Ш NO: 13 6162717181736172736 AUAACUCUGUCCAUCACCA 88 Modified SEQ Ш NO: 14 1845461846364645161 UGGUGAUGGACAGAGUUAU 89 Modified SEQ Ш NO: 15 6162717181736172735 AUAACUCUGUCCAUCACCU 90 Modified SEQ Ш NO: 16 2845461846364645161 AGGUGAUGGACAGAGUUAU 91 Modified SEQ Ш NO: 17 5263535453725163725 UAACUCUGUCCAUUACCAU 92 Modified SEQ Ш NO: 18 2548162548272828152 AUGGUAAUGGACAGAGUUA 93 Modified 6181837154616271718 AUGUGCCUUGAUAACUCUG

- 68 045986

anna SEQ Ш NO: 19 94 Modified SEQ Ш NO: 20 3646451617264836361 CAGAGUUAUCAAGGCACAU 95 Modified SEQ Ш NO: 21 6451845471835172826 AGUUGGUGCUGCUUCAGAA 96 Modified SEQ Ш NO: 22 1535462836472736271 UUCUGAAGCAGCACCACU 97 Modified SEQ Ш NO: 23 6252648483547363648 AAUAAGGGGCUGCCACAGG 98 Modified SEQ Ш NO: 24 3718184728373715251 CCUGUGGCAGCCCCUUAUU 99 Modified SEQ Ш NO: 25 5263535453725363725 UAACUCUGUCCAUCACCAU 100 Modified SEQ Ш NO: 26 2548182548272828152 AUGGUGAUGGACAGAGUUA 101 Modified SEQ Ш NO: 27 6182837174616271718 AUGAGCCUCGAUAACUCUG 102 Modified SEQ Ш NO: 28 3646451617464835361 CAGAGUUAUCGAGGCUCAU 103 Modified SEQ Ш NO: 29 6254647353825263535 AAUGAGCCUCGAUAACUCU 104 Modified SEQ Ш 2828152538284717251 AGAGUUAUCGAGGCUCAUU

- 69 045986

NO: 30 105 Modified SEQ Ш NO: 31 6254715372846361517 AAUGCUUCCAGGACAUUUC 106 Modified SEQ Ш NO: 32 4626181735482647251 GAAAUGUCCUGGAAGCAUU 107 Modified SEQ Ш NO: 33 6364548184646254547 ACAGUGGUGGAGAAUGUGC 108 Modified SEQ Ш NO: 34 4727251717363727181 GCACAUUCUCCCACCACUGU 109 Modified SEQ Ш NO: 35 8161818371746162717 GUAUGUGCCCUCGAUAACUC 110 Modified SEQ Ш NO: 36 4645161746483636163 GAGUUAUCGAGGCACAUAC 111 Modified SEQ Ш NO: 37 5382526353545372536 UCGAUAACUCUGUCCAUCA 112 Modified SEQ Ш NO: 38 1825482728281525382 UGAUGGACAGAGUUAUCGA FROM Modified SEQ Ш NO: 39 5453635482725181817 UGUCACUGGACAUUGUGUC 114 Modified SEQ Ш NO: 40 4636362545372818272 GACACAAUGUCCAGUGACA 115 Modified SEQ Ш NO: 41 7184825372548181627 CUGGGAUCCAUGGGUGUAAC

- 70 045986

116 Modified SEQ Ш NO: 42 4516363725482537364 GUUACACCAUGGAUCCCAG 117 Modified SEQ Ш NO: 43 6461827362835184728 AGAUGACCAAAGCUUGGCAG 118 Modified SEQ Ш NO: 44 3547362835184536171 CUGCCAAGCUUGGUCAUCU 119 GalNAc-LPA- 1038-L1 first chain OMeA-(ps)-FU-(ps)-OMeA-FA- OMeC-FU-OMeC-FU-OMeG-FU- OMeC-FC-OMeA-FU-OMeU-FA- OMeC-(ps)-FC-(ps)-OMeA AUAACUCUGUCCAUUACCA 120 GalNAc-LPA- 1038-L1 second circuit [ST23 (ps)]3 long trebler (ps)FUOMeG-FG-OMeU-FA-OMeA-FUOMeG-FG-OMeA-FC-OMeA-FGOMeA-FG-OMeU-FU-(ps)-OMeA(ps)-FU UGGUAAUGGACAGAGUUAU 121 GalNAc-LPA- 1038-L6 first chain OMeA-(ps)-FU-(ps)-OMeA-FA- OMeC-FU-OMeC-FU-OMeG-FU- OMeC-FC-OMeA-FU-OMeU-FA- OMeC-(ps)-FC-(ps)-OMeA AUAACUCUGUCCAUUACCA 122 GalNAc-LPA- 1038-L6 second chain [ST23 (ps)]3 ST43 (ps)FU-OMeGFG-OMeU-FA-OMeA-FU-OMeGFG-OMeA-FC-OMeA-FG-OMeAFG-OMeU-FU-(ps)-OMeA-(ps)-FU UGGUAAUGGACAGAGUUAU 123 GalNAc-LPA- 1041-L1 first chain OMeA-(ps)-FU-(ps)-OMeA-FAOMeC-FU-OMeC-FU-OMeG-FUOMeC-FC-OMeA-FU-OMeU-FAOMeC-(ps)-FC-(ps)-OMeG AUAACUCUGUCCAUUACCG 124 GalNAc-LPA- 1041-L1 second circuit [ST23 (ps)]3 long trebler (ps) FCOMeG-FG-OMeU-FA-OMeA-FUOMeG-FG-OMeA-FC-OMeA-FGOMeA-FG-OMeU-FU-(ps)-OMeA- CGGUAAUGGACAGAGUUAU

- 71 045986

(ps)-FU 125 GalNAc-LPA- 1041-L6 first chain OMeA-(ps)-FU-(ps)-OMeA-FA- OMeC-FU-OMeC-FU-OMeG-FU- OMeC-FC-OMeA-FU-OMeU-FA- OMeC-(ps)-FC-(ps)-OMeG AUAACUCUGUCCAUUACCG 126 GalNAc-LPA- 1041-L6 second chain [ST23 (ps)]3 ST43 (ps) FC-OMeGFG-OMeU-FA-OMeA-FU-OMeGFG-OMeA-FC-OMeA-FG-OMeAFG-OMeU-FU-(ps)-OMeA-(ps)-FU CGGUAAUGGACAGAGUUAU 127 STS16001AL3 mU (ps) fU (ps) mA fU mA fG mA fG mC fA mA fG mA fA mC fA mC fU mG (ps) fU (ps) mU (ps) Ser(GN) UUAUAGAGCAAGAACACUGU U 128 STS16001BL2 0 Ser(GN) (ps) fA mA fC mA fG mU fG mU fU mC fU mU fG mC fU mC fU mA fU (ps) mA (ps) fA AACAGUGUUCUUGCUCUAUA A 129 STS16001A mU (ps) fU (ps) mA fU mA fG mA fG mC fA mA fG mA fA mC fA mC fU mG (ps) fU (ps) mU UUAUAGAGCAAGAACACUGU U 130 STS16001BV1 L42 Ser(GN) (ps) fA (ps) mA (ps) fC mA fG mU fG mU fU mC fU mU fG mC fU mC fU mA fU (ps) mA (ps) fA (ps) Ser(GN) AACAGUGUUCUUGCUCUAUA A 131 STS16001V1B fA (ps) mA (ps) fC mA fG mU fG mU fU mC fU mU fG mC fU mC fU mA fU (ps) mA (ps) fA AACAGUGUUCUUGCUCUAUA A 132 STS18001A mU (ps) fC (ps) mG fA mA fG mU fA mU fU mC fC mG fC mG fU mA (ps) fC (ps) mG UCGAAGUAUUCCGCGUACG 133 STS18001BL4 [(ST23) (ps)] ₃ C4XLT (ps) fC mG fU mA fC mG fC mG fG mA fA mU fA mC fU mU fC (ps) mG (ps) fA CGUACGCGGAAUACUUCGA 134 STS16001BL4 [(ST23) (ps)]3 C4XLT(ps)fA (ps) mA (ps) fC mA fG mU fG mU fU mC fU mU fG mC fU mC fU mA fU AACAGUGUUCUUGCUCUAUA A

- 72 045986

(ps) mA (ps) fA 135 X0373A mA (ps) fU (ps) mA fA mC fU mC fU mG fU mC fC mA fU mU fA mC (ps) fC (ps) mG AUAACUCUGUCCAUUACCG 136 X0373B Ser(GN) (ps) fC (ps) mG (ps) fG mU fA mA fU mG fG mA fC mA fG mA fG mU fU (ps) mA (ps) fU (ps) Ser(GN) CGGUAAUGGACAGAGUUAU 137 STS2041B ST23 (ps) ST23 (ps) ST23 (ps) C6XLT (ps) fC mG fG mU fA mA fU mG fG mA fC mA fG mA fG mU fU (ps) mA (ps) fU CGGUAAUGGACAGAGUUAU 138 X0125A mC (ps) fU (ps) mU fA mC fU mC fU mC fG mC fC mC fA mA fG mC (ps) fG (ps) mA CUUACUCUCGCCCAAGCGA 139 X0125B [(ST23) (ps)] ₃ (C6XLT) (ps) fU mC fG mC fU mU fG mG fG mC fG mA fG mA fG mU fA (ps) mA (ps) fG UCGCUUGGGCGAGAGUAAG 140 Probe based on SEQ ID NO: 50 BHQ1- TGGCTGTTTCTGAACAAGCACC AATGG-FAM TGGCTGTTTCTGAACAAGCAC CAATGG 141 Probe based on SEQ ID NO: 56 BHQ1- TCGAGCACGGCATCGTCACCA A-VIC TCGAGCACGGCATCGTCACCA A 142 STS16001BV1 L75 Ser(GN) fA (ps) mA (ps) fC mA fG mU fG mU fU mC fU mU fG mC fU mC fU mA fU (ps) mA (ps) fA Ser(GN) AACAGUGUUCUUGCUCUAUA A 143 STS16001BV1 6L42 Ser(GN) (ps) fA mA fC mA fG mU fG mU fU mC fU mU fG mC fU mC fU mA fU mA fA (ps) Ser(GN) AACAGUGUUCUUGCUCUAUA A 144 STS16001BV2 0L75 Ser(GN) fA mA fC mA fG mU fG mU fU mC fU mU fG mC fU mC fU mA fU mA fA Ser(GN) AACAGUGUUCUUGCUCUAUA A

- 73 045986

145 STS16001BV1 L94 Ser(GN) (ps) Ser(GN) (ps) fA (ps) mA (ps) fC mA fG mU fG mU fU mC fU mU fG mC fU mC fU mA fU (ps) mA (ps) fA (ps) Ser(GN) (ps) Ser(GN) AACAGUGUUCUUGCUCUAUA A 146 STS16001V1B L96 C6Am(GN) (ps) fA (ps) mA (ps) fC mA fG mU fG mU fU mC fU mU fG mC fU mC fU mA fU (ps) mA (ps) fA (ps) C7Am(GN) AACAGUGUUCUUGCUCUAUA A 147 STS16001V1B L97 GlyC3Am(GN) (ps) fA (ps) mA (ps) fC mA fG mU fG mU fU mC fU mU fG mC fU mC fU mA fU (ps) mA (ps) fA (ps) GlyC3Am(GN) AACAGUGUUCUUGCUCUAUA A 148 Conjugate 10 second chain PipAm(GN) (ps) fA (ps) mA (ps) fC mA fG mU fG mU fU mC fU mU fG mC fU mC fU mA fU (ps) mA (ps) fA (ps) PipAm(GN) AACAGUGUUCUUGCUCUAUA A 149 STS16001V1B L88 C3Am(GN) (ps) fA (ps) mA (ps) fC mA fG mU fG mU fU mC fU mU fG mC fU mC fU mA fU (ps) mA (ps) fA (ps) C3Am(GN) AACAGUGUUCUUGCUCUAUA A 150 STS16001V1B L87 C6Am(GN) (ps) fA (ps) mA (ps) fC mA fG mU fG mU fU mC fU mU fG mC fU mC fU mA fU (ps) mA (ps) fA (ps) GlyC3 Am(GN) AACAGUGUUCUUGCUCUAUA A 151 Conjugate 15 antisense chain mU (ps) fC (ps) mU fU mC fU mU fA mA fA mC fU mG fA mG fU mU (ps) fU (ps) mC UCUUCUUAAACUGAGUUUC 152 Conjugate 15 sense strand Ser(GN) (ps) fG (ps) mA (ps) fA mA fC mU fC mA fG mU fU mU fA mA fG mA fA (ps) mG (ps) fA (ps) Ser(GN) GAAACUCAGUUUAAGAAGA 153 Antisense conjugate 16 mA (ps) fU (ps) mG fU mA fG mC fC mG fA mG fG mA fU mC fU mU AUGUAGCCGAGGAUCUUCU

- 74 045986

I'm a chain (ps) fC (ps) mU 154 Conjugate 16 antisense chain Ser(GN) (ps) fA (ps) mG (ps) fA mA fG mA fU mC fC mU fC mG fG mC fU mA fC (ps) mA (ps) fU (ps) Ser(GN) AGAAGAUCCUCGGCUACAU 155 Conjugate 18 antisense chain mA (ps) fA (ps) mC fC mA fG mA fA mG fA mA fG mC fA mG fG mU (ps) fG (ps) mA AACCAGAAGAAGCAGGUGA 156 Conjugate 18 sense strand Ser(GN) (ps) fU (ps) mC (ps) fA mC fC mU fG mC fU mU fC mU fU mC fU mG fG (ps) mU (ps) fU (ps) Ser(GN) UCACCUGCUUCUUCUGGUU 157 STS16001BV1 fA (ps) mA (ps) fC mA fG mU fG mU fU mC fU mU fG mC fU mC fU mA fU (ps) mA (ps) fA AACAGUGUUCUUGCUCUAUA A 158 Reference conjugate 6 sense strand [ST23 (ps)]3 Itrb (ps) fG mA fA mA fC mU fC mA fG mU fU mU fA mA fG mA fA (ps) mG (ps) fA GAAACUCAGUUUAAGAAGA 159 Reference conjugate 7 sense strand [ST23 (ps)]3 Itrb (ps) fA mG fA mA fG mA fU mC fC mU fC mG fG mC fU mA fC (ps) mA (ps) fU AGAAGAUCCUCGGCUACAU 160 Reference conjugate 8 antisense chain mU (ps) fA (ps) mC fC mA fG mA fA mG fA mA fG mC fA mG fG mU (ps) fG (ps) mA UACCAGAGAAGCAGGUGA 161 Reference conjugate 8 sense chain [ST23 (ps)]3 ST41 (ps)fUmC fA mC fC mU fG mC fU mU fC mU fU mC fU mG fG (ps) mU (ps) fA UCACUGCUUCUUCUGGUA 162 Reference conjugate 9 sense [ST23 (ps)]3 C6XLT (ps) fC mG fG mU fA mA fU mG fG mA fC mA fG mA fG mU fU (ps) mA (ps) fU CGGUAAUGGACAGAGUUAU chain 163 Conjugate 21 sense strands without ligand mC mG mG mU mA mA fU fG fG mA mC mA mG mA mG mU mU (ps) mA (ps) mU CGGUAAUGGACAGAGUUAU 164 Conjugate 21 sense strands [ST23 (ps)]3 C6XLT (ps) mC mG mG mU mA mA fU fG fG mA mC mA mG mA mG mU mU (ps) mA (ps) mU CGGUAAUGGACAGAGUUAU 165 Conjugate 21 antisense chain mA (ps) fU (ps) mA fA mC fU mC fU mG fU mC fC mA fU mU fA mC (ps) fC (ps) mG AUAACUCUGUCCAUUACCG

One sequence can have more than one name. In these cases, one of these names is listed in the sequence summary table.

If the RNA sequence contains specific linkers and/or modified bonds, then

- 75 045986 ki as (ps) and [ST23 (ps)]3 ST41 (ps), etc., they are optional parts of the sequence, but are the preferred implementation of this sequence.

The following abbreviations may be used, particularly in the sequences listed.

Abbreviation Meaning 1 2'F-dU 2 2'F-dA 3 2'F-dC 4 2'F-dG 5 2'OMe-rU 6 2'OMe-rA 7 2'OMe-rC 8 2'OMe-rG mA, mU, mC, mG, ОМеА, OMeU, ОМеС, OMeG 2'OMe PHK 2'-OMe 2'-O-Methyl modification fA, fU, fC, fG 2' deoxy-2'-R RNA nucleotides

- 76 045986

2'-F, 2'-fluorine, 2' fluorine 2'-fluorine modification (ps) phosphorothioate (vp) Vinyl-(E)-phosphoronate ivA, ivC, ivU, ivG Inverted RNA (З'-З ¹ ) FAM 6-carboxyfluorescein BHQ Extinguisher Black Hole 1 ST23 Oas Oas NHAc° ST41/C4XLT 'Ό— . G O ST43 (or C6XLT) '-ABOUT-... ST43-phos/C6XLT-phos DMTix/-x. . ^{0 0} 1 1 P. ₀ ^CN Long triple l/ltrb/S TK S (phosphoramidite) ^/^/ ^0DMT NCT---- ---''---\^ _Q Ν(/Ργ) ₂ \--- ^ODMT Ser(GN) OH OH UX--o HoX^^>X-O^^\^\x.O NHAc f N.H. ,--° Ser(GN) (phosphoramidite) NHAc II ABOUT C3Am(GN) /Οχ GalNAc N.H. ,0. ,- GlyC3Am(GN) GalNAc XL ,,-

- 77 045986

C6Am(GN) C7Am(GN) PipAm(GN) [ST23 (ps)]3 C4XLT (ps) = [ST23 (ps)]3 ST41 (ps) = L4 OH OH Ho4<o A NHAc \ 0 O=PS® 1 0^ o _x / o >' Il / ZOPO--' OH ^x o \ o 1 Θ O=pS 0 OH /— ^/ /^? ^0H Q—/ AcHN-/f~\ __/ Z-0 OH Ad-po^ έ ^Θ [ST23 (ps)]3 C6XLT (ps) = [ST23 (ps)]3 ST43 (ps) = L6 he OH ^H0 M-0 A nhac 0 l Θ OPS 1 °^Ί 0 / l—Q O !---' II / -opo— ^z OH S 0 l Θ O=PS 0 _Z OH __/ <0 OH ^o 0 r 1 0 OP-0^ s®

Claims (17)

1. A nucleic acid for inhibiting LPA expression in a cell, comprising at least one duplex region that contains at least a portion of a first strand and at least a portion of a second strand that is at least partially complementary to said first strand, wherein said first strand is at least partially complementary to at least a portion of the RNA transcribed from the LPA gene, wherein said first strand contains a nucleotide sequence 5' mA (ps) fU (ps) mA fA mC fU mC fU mG fU mC fC mA fU mU fA mC (ps) fC (ps) mG 3' (SEQ ID NO: 165), and wherein said second strand contains a nucleotide subsequence 5‘ mC mG mG mU mA mA fU fG fG mA mC mA mG mA mG mU mU (ps) mA (ps) mU 3‘(SEQ ID NO: 163); wherein fA, fC, fG and fU denote 2'-deoxy-2'-fluoro ribonucleotides; mA, mC, mG and mU denote 2'-O-methyl ribonucleotides and (ps) denotes phosphorothioate bond. 2. Nucleic acid according to claim 1, characterized in that said first chain consists of a nucleotide sequence 5' mA (ps) fU (ps) mA fA mC fU mC fU mG fU mC fC mA fU mU fA mC (ps) fC (ps) mG 3' (SEQ ID NO: 165), with fA, fC, fG and fU stands for 2'-deoxy-2'-fluoro ribonucleotides; mA, mC, mG and mU denote 2'-O-methyl ribonucleotides and (ps) denotes phosphorothioate bond. 3. Nucleic acid according to claim 1 or 2, characterized in that said second chain consists of a nucleotide sequence 5‘ mC mG mG mU mA mA fU fG fG mA mC mA mG mA mG mU mU (ps) mA (ps) mU 3‘(SEQ ID NO: 163); wherein fA, fC, fG and fU denote 2'-deoxy-2'-fluoro ribonucleotides; mA, mC, mG and mU denote 2'-O-methyl ribonucleotides and (ps) denotes phosphorothioate bond. 4. A nucleic acid according to any of the preceding claims, characterized in that said nucleic acid is conjugated to a ligand. 5. Nucleic acid according to claim 4, characterized in that said ligand contains: (i) one or more N-acetylgalactosamine (GalNAc) groups or derivatives thereof and (ii) a linker, wherein said linker provides conjugation of at least one GalNAc group or at least one derivative thereof with said nucleic acid. 6. Nucleic acid according to claim 4, characterized in that said nucleic acid is conjugated to a ligand containing a compound of formula (I) [SX ¹ -PX ² ] ₃ -AX ³ - (I) in which S is a saccharide; X ¹ represents ^-^-alkylene or (-CH ₂ -CH ₂ -O) _m (-CH ₂ ) ₂ -, where m is 1, 2 or 3; P is phosphate or modified phosphate; X ² represents an alkylene or alkylene ether of the formula (- CH ₂ )n- O- CH ₂ -, where n=1-6; A represents a branching element; X ³ represents a bridge element; wherein the nucleic acid according to any one of claims. 1 -4 is conjugated to X ³ via a phosphate or modified phosphate. 7. Nucleic acid according to claim 6, characterized in that said saccharide (S) is N-acetylgalactosamine. 8. Nucleic acid according to claim 6 or 7, characterized in that the modified phosphate is a thiophosphate. 9. Nucleic acid according to claims 6-8, characterized in that said nucleic acid is conjugated to X ³ through the 5' end of the second strand. - 79 045986 10. Nucleic acid according to claim 4, characterized in that said nucleic acid is conjugated to a ligand and has the following structure: where Z represents a nucleic acid according to any one of claims 1-3. 11. Nucleic acid according to claim 10, characterized in that said ligand is conjugated to the 5' end of the second strand. 12. Nucleic acid according to any one of claims 4-11, characterized in that said second chain contains a nucleotide sequence 5' [ST23 (ps)]3 C6XLT (ps) mC mG mG mU mA mA fU fG fG mA mC mA mG mA mG mU mU (ps) mA (ps) mU 3' (SEQ ID NO: 164); wherein fA, fC, fG and fU denote 2'-deoxy-2'-fluoro ribonucleotides; mA, mC, mG and mU indicate 2'-O-methyl ribonucleotides; and (ps) denotes a phosphorothioate bond; And [ST23 (ps)]3 C6XLT (ps) indicates 13. Nucleic acid according to claim 12, wherein said second chain consists of a nucleotide sequence 5' [ST23 (ps)]3 C6XLT (ps) mC mG mG mU mA mA fU fG fG mA mC mA mG mA mG mU mU (ps) mA (ps) mU 3‘ (SEQ ID NO: 164); wherein fA, fC, fG and fU denote 2'-deoxy-2'-fluoro ribonucleotides; mA, mC, mG and mU indicate 2'-O-methyl ribonucleotides; and (ps) denotes a phosphorothioate bond; And [ST23 (ps)]3 C6XLT (ps) indicates - 80 045986 14. A pharmaceutical composition containing the nucleic acid according to any one of claims 1 to 13 in an effective amount and further containing at least one of a delivery vehicle, a physiologically acceptable excipient, a carrier and a diluent. 15. Use of a nucleic acid according to any one of claims 1 to 13 or a pharmaceutical composition according to claim 14 for the prevention or treatment or reduction of the risk of a disease or pathology. 16. Use according to claim 15, characterized in that said disease or pathology is a cardiovascular disease. 17. The use of claim 16, wherein said cardiovascular disease is stroke, atherosclerosis, thrombosis, coronary heart disease or aortic stenosis or any other disease or pathology that is associated with elevated levels of Lp(a) particles.