New! View global litigation for patent families

DE60126593T2 - Diagnose von mit apoptose assoziierten erkrankungen mittels ermittlung des methylierungszustandes von apoptose-assozierten genen - Google Patents

Diagnose von mit apoptose assoziierten erkrankungen mittels ermittlung des methylierungszustandes von apoptose-assozierten genen

Info

Publication number
DE60126593T2
DE60126593T2 DE2001626593 DE60126593T DE60126593T2 DE 60126593 T2 DE60126593 T2 DE 60126593T2 DE 2001626593 DE2001626593 DE 2001626593 DE 60126593 T DE60126593 T DE 60126593T DE 60126593 T2 DE60126593 T2 DE 60126593T2
Authority
DE
Grant status
Grant
Patent type
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
DE2001626593
Other languages
English (en)
Other versions
DE60126593D1 (de )
Inventor
Kurt Berlin
Alexander Olek
Christian Piepenbrock
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Epigenomics AG
Original Assignee
Epigenomics AG
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Grant date

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Hybridisation probes
    • C12Q1/6883Hybridisation probes for diseases caused by alterations of genetic material
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4702Regulators; Modulating activity
    • C07K14/4703Inhibitors; Suppressors
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/82Translation products from oncogenes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Hybridisation probes
    • C12Q1/6883Hybridisation probes for diseases caused by alterations of genetic material
    • C12Q1/6886Hybridisation probes for diseases caused by alterations of genetic material for cancer
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/154Methylation markers
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/156Polymorphic or mutational markers

Description

  • Gebiet der Erfindung
  • [0001]
    Die nach den methodischen Entwicklungen der letzten Jahre in der Molekularbiologie gut studierten Beobachtungsebenen sind die Gene selbst, die Übersetzung dieser Gene in RNA und die daraus entstehenden Proteine. Wann im Laufe der Entwicklung eines Individuums welches Gen angeschaltet wird und wie Aktivieren und Inhibieren bestimmter Gene in bestimmten Zellen und Geweben gesteuert wird, ist mit Ausmaß und Charakter der Methylierung der Gene bzw. des Genoms korrelierbar. Insofern äußern sich pathogene Zustände in einem veränderten Methylierungsmuster einzelner Gene oder des Genoms.
  • [0002]
    Die vorliegende Erfindung betrifft Nukleinsäuren und ein Verfahren zur Diagnose von Erkrankungen, die mit dem genetischen und/oder epigenetischen Parametern von Genen, die mit Apoptose assoziiert sind, und insbesondere deren Methylierungsstatus, in Zusammenhang stehen.
  • Stand der Technik
  • [0003]
    Während der Embryogenese, der Gewebeerneuerung oder Metamorphose behalten multizelluläre eukaryotische Organismen ihre Fähigkeit bei, unerwünschte Zellen zu beseitigen. Diese Form von programmiertem Zelltod wird "Apoptose" genannt. Die Apoptose findet in Antwort auf eine Vielzahl von Stimuli statt, die biochemische Signalwege auslösen die zu einem charakteristischen Set von Prozessen führen, die im Zelltod resultieren.
  • [0004]
    Die Stimuli, die Apoptose auslösen, können die Spiegel von essentiellen Wachstumsfaktoren, die Behandlung mit Glucocorticoiden, Bestrahlung und die Aktivierung von bestimmten Rezeptoren einschließen. Diese lösen eine Vielzahl von biochemischen Signalwegen aus. Der "klassische" Signalweg besteht aus einer Liganden-Rezeptor-Interaktion, die die Aktivierung einer Protease auslöst. Dies führt zu der Freisetzung von Cytochrom C aus den Mitochondrien. Dieses aktiviert im Gegenzug eine Reihe von Proteasen, deren Wirkungen zu der Zerstörung von zellulären Strukturen führen.
  • [0005]
    Zum Beispiel schließt ein herkömmlicher Signalweg die Aktivierung von Caspase-8 durch Oligomerisierung an einem aktivierten Oberflächenrezeptor ein. Caspase-8 spaltet Bid, das die Freisetzung von Cytochrom C aus den Mitochondrien auslöst. Das Cytochrom C bewirkt, dass Apaf-1 mit Caspase-9 oligomerisiert. Die aktivierte Caspase-9 spaltet Procaspase-3, deren zwei Untereinheiten dann die aktive Protease bilden. Diese spaltet verschiedene Ziele, was zum Zelltod führt. Zelltod durch Apoptose ist durch Prozesse gekennzeichnet, in denen die Zelle kompakter wird, einer Blasenbildung an der Membranen auftritt, das Chromatin kondensiert wird und die DNA fragmentiert wird.
  • [0006]
    Die korrekte Kontrolle von Apoptose ist möglicherweise für alle höheren Organismen essentiell. Zum Beispiel sterben in dem Modell-Organismus C. elegans 131 der 1090 Zellen einen definierten Punkten des Lebenszyklus des Organismus. In Wirbeltieren wurde die Wichtigkeit der Apoptose durch die Verwendung von Knockout-Mausmodellen nachgewiesen. In Menschen wurden Apoptose-Signalwege mit einer Vielzahl von Erkrankungen in Zusammenhang gebracht, einschließlich neurodegenerativen Erkrankungen, Alterung und Krebs:
    • – HIV-Infektion; Badley et. al. "Mechanisms of HIV-associated lymphocyte apoptotis" Blood, Vol. 96; 2951-2964 (2000).
    • – Bloom Syndrom; Bischof et. al. "Selective cleavage of BLM, the Bloom syndrome protein, during apoptotic cell death." J Biol Chem 2001 Jan 11.
    • – Cardiomyopathie; Narula et. al. "Apoptosis in heart failure: release of cytochrome c from mitochondria and activation of caspase-3 in human cardiomyopathy" Proc Natl Acad Sci U S A.; 96:8144-8149 (1999).
    • – Familiäre Alzheimer-Erkrankung; Simian et. al. Presenilin-1 P264L Knock-In Mutation: Differential Effects on Aβ Production, Amyloid Deposition, and Neuronal Vulnerability The Journal of Neuroscience, 20(23):8717-8726 (1999).
    • – Alterung; Schindowski et. al. "Age-related changes of apoptotic cell death in human lymphocytes." Neurobiol Aging 2000 Sep-Oct; 21(5):661-70.
    • – Herpes Simplex Virus Infektion; Perng et. al. "Virus-Induced Neuronal Apoptosis Blocked by the Herpes Simplex Virus Latency-Associated Transcript" Science 287:1500-1503 (2000).
    • – Renale Ischämie; Yuexian et. al. "Downregulation of the calpain inhibitor protein calpastatin by caspases during renal ischemia-reperfusion" Am. J. Physiol. 279:509-517.
    • – Amyotrophe Lateralsklerose; Li et. al. "Functional Role of Caspase-1 and Caspase-3 in an ALS Transgenic Mouse Model" Science 288 (5464); 335-339 (2000).
    • – Brustkrebs; Sierra et. al. "Bcl-2 with loss of apoptosis allows accumulation of genetic alterations: a pathway to metastatic progression in human breast cancer." Int J Cancer. 2000 Mar 20; 89(2):142-7.
  • [0007]
    Die Komplexitäten der Signalwege, die zu Apoptose führen, ermöglichen viele Mechanismen, durch die diese umgeleitet werden können. Zusätzlich zu genomischen Mutationen wurde die epigenetische Kontrolle von Genen mit Unterbrechungen in Apoptose-Signalwegen in Zusammenhang gebracht. Der epigenetische Parameter, der am besten charakterisiert wurde, DNA-Methylierung, wurde als ein Schlüsselfaktor bei der Resistenz von Tumoren auf Chemotherapie impliziert. Es wurde gezeigt (Soengas et al „Inactivation of the apoptosis effector Apaf-1 in malignant melanoma" Nature 409; 207-211; 2001), das in malignen Melanomen Unterbrechungen in dem Apoptose-Signalweg einer Stummschaltung des Apaf-1 Gens zugeordnet werden konnten.
  • [0008]
    Die Identifizierung von Methylierung von Apoptosegenen als ein Faktor bei der Tumor-Malignität öffnet die Möglichkeit zur Erzeugung von alternativen Verfahren zur Behandlung. Methylierungs-basierte Therapien könnten beträchtliche Vorteile über augenblickliche Verfahren der Behandlung, wie z. B. Chemotherapie, Chirurgie und Radiotherapie haben. Sie können sogar, wie durch Soengas et al gezeigt, ein Mittel zur Behandlung von Tumoren zur Verfügung stellen, die gegenüber herkömmlichen Behandlungen resistent sind. Zusätzlich zu der Entwicklung von Methylierungs-spezifischen Therapien haben Experimente mit Min-Mäusen gezeigt, daß die Inhibierung von DNA Methylierung die Tumorinitiation unterdrücken kann (Laird et. al. 'Suppression of intestinal neoplasia by DNA hypomethylation' Cell 81; 197-205 1995). Weiterhin kann die DNA-Methylierungsanalyse neue Mittel zur Tumordia gnose zur Verfügung stellen, wie durch Rosas et. al. 'Promoter hypermethylation patterns of p16, O6-methylguanine-DNA-methyltransferase, and death-associated protein kinase in tumors and saliva of head and neck cancer patients. 'Cancer Res 2001 Feb 1; 61(3):939-42 vorgeschlagen.
  • [0009]
    5-Methylcytosin ist die häufigste kovalent modifizierte Base in der DNA eukaryontischer Zellen. Sie spielt beispielsweise eine Rolle in der Regulation der Transkription, beim genetischen Imprinting und in der Tumorgenese. Die Identifizierung von 5-Methylcytosin als Bestandteil genetischer Information ist daher von erheblichem Interesse. 5-Methylcytosin-Positionen können jedoch nicht durch Sequenzierung identifiziert werden, da 5-Methylcytosin das gleiche Basenpaarungsverhalten aufweist wie Cytosin. Darüber hinaus geht bei einer PCR-Amplifikation die epigenetische Information, welche die 5-Methylcytosine tragen, vollständig verloren.
  • [0010]
    Eine relativ neue und die mittlerweile am häufigsten angewandte Methode zur Untersuchung von DNA auf 5-Methylcytosin beruht auf der spezifischen Reaktion von Bisulfit mit Cytosin, das nach anschließender alkalischer Hydrolyse in Uracil umgewandelt wird, welches in seinem Basenpaarungsverhalten dem Thymidin entspricht. 5-Methylcytosin wird dagegen unter diesen Bedingungen nicht modifiziert. Damit wird die ursprüngliche DNA so umgewandelt, dass Methylcytosin, welches ursprünglich durch sein Hybridisierungsverhalten vom Cytosin nicht unterschieden werden kann, jetzt durch "normale" molekularbiologische Techniken als einzig verbliebenes Cytosin beispielsweise durch Amplifikation und Hybridisierung oder Sequenzierung nachgewiesen werden kann. Alle diese Techniken beruhen auf Basenpaarung, welche jetzt voll ausgenutzt wird. Der Stand der Technik, was die Empfindlichkeit betrifft, wird durch ein Verfahren definiert, welches die zu untersuchende DNA in einer Agarose-Matrix einschließt, dadurch die Diffusion und Renaturierung der DNA (Bisulfit reagiert nur an einzelsträngiger DNA) verhindert und alle Fällungs- und Reinigungsschritte durch schnelle Dialyse ersetzt (Olek A, Oswald J, Walter J. A modified and improved method for bisulphite based cytosine methylation analysis. Nucleic Acids Res. 1996 Dec 15; 24(24):5064-6). Mit dieser Methode können einzelne Zellen untersucht werden, was das Potential der Methode veranschaulicht. Allerdings werden bisher nur einzelne Regionen bis etwa 3000 Basenpaare Länge untersucht, eine globale Untersuchung von Zellen auf Tausenden von möglichen Methylierungsanalysen ist nicht möglich. Allerdings kann auch dieses Verfahren keine sehr klei nen Fragmente aus geringen Probenmengen zuverlässig analysieren. Diese gehen trotz Diffusionsschutz durch die Matrix verloren.
  • [0011]
    Eine Übersicht über die weiteren bekannten Möglichkeiten, 5-Methylcytosine nachzuweisen, kann aus dem folgenden Übersichtsartikel entnommen werden: Rein, T., DePamphilis, M. L., Zorbas, H., Nucleic Acids Res. 1998, 26, 2255.
  • [0012]
    Katzenellenbogen et al, "Hypermethylation of the DAP-kinase CpG island is a common alteration in B-cell malignancies" Blood Vol. 93 No. 12; 4347-53 beschreiben die MSP basierte Analyse der ersten 525 bp Region von der Transkriptionsstartstelle. Die Promotormethylierung wurde in B-Zell-malignen Erkrankungen beobachtet.
  • [0013]
    Die Bisulfit-Technik wird bisher bis auf wenige Ausnahmen (z.B. Zeschnigk M, Lich C, Buiting K, Doerfler W, Horsthemke B. A single-tube PCR test for the diagnosis of Angelman and Prader-Willi syndrome based on allelic methylation differences at the SNRPN locus. Eur J Hum Genet. 1997 Mar-Apr; 5(2):94-8) nur in der Forschung angewendet. Immer aber werden kurze, spezifische Stücke eines bekannten Gens nach einer Bisulfit-Behandlung amplifiziert und entweder komplett sequenziert (Olek A, Walter J. The pre-implantation ontogeny of the H19 methylation imprint. Nat Genet. 1997 Nov; 17(3):275-6) oder einzelne Cytosin-Positionen durch eine "Primer-Extension-Reaktion" (Gonzalgo ML, Jones PA. Rapid quantitation of methylation differences at specific sites using methylation-sensitive single nucleotide primer extension (Ms-SNuPE). Nucleic Acids Res. 1997 Jun 15; 25(12):2529-31, WO 95/00669) oder einen Enzymschnitt (Xiong Z, Laird PW. COBRA: a sensitive and quantitative DNA methylation assay. Nucleic Acids Res. 1997 Jun 15; 25(12):2532-4) nachgewiesen. Zudem ist auch der Nachweis durch Hybridisierung beschrieben worden (Olek et al., WO 99/28498).
  • [0014]
    Weitere Publikationen, die sich mit der Anwendung der Bisulfit-Technik zum Methylierungsnachweis bei einzelnen Genen befassen, sind: Grigg G, Clark S. Sequencing 5-methylcytosine residues in genomic DNA. Bioessays. 1994 Jun; 16(6):431-6, 431; Zeschnigk M, Schmitz B, Dittrich B, Buiting K, Horsthemke B, Doerfler W. Imprinted segments in the human genome: different DNA methylation patterns in the Prader-Willi/Angelman syndrome region as determined by the genomic sequencing method. Hum Mol Genet. 1997 Mar; 6(3):387-95; Feil R, Charlton J, Bird AP, Walter J, Reik W. Methylation analysis on individual chromosomes: improved protocol for bisulphite genomic sequencing. Nucleic Acids Res. 1994 Feb 25; 22(4):695-6; Martin V, Ribieras S, Song-Wang X, Rio MC, Dante R. Genomic sequencing indicates a correlation between DNA hypomethylation in the 5' region of the pS2 gene and its expression in human breast cancer cell lines. Gene. 1995 May 19; 157(1-2):261-4; WO 97/46705, WO 95/15373 und WO 97/45560.
  • [0015]
    Eine Übersicht über den Stand der Technik in der Oligomer Array Herstellung läßt sich aus einer im Januar 1999 erschienenen Sonderausgabe von Nature Genetics (Nature Genetics Supplement, Volume 21, January 1999) und der dort zitierten Literatur entnehmen.
  • [0016]
    Für die Abtastung eines immobilisierten DNA-Arrays werden vielfach fluoreszenzmarkierte Sonden verwendet. Besonders geeignet für Fluoreszenzmarkierungen ist das einfache Anbringen von Cy3 und Cy5 Farbstoffen am 5'-OH der jeweiligen Sonde. Der Nachweis der Fluoreszenz der hybridisierten Sonden erfolgt beispielsweise über ein Konfokalmikroskop. Die Farbstoffe Cy3 und Cy5 sind, neben vielen anderen, kommerziell erhältlich.
  • [0017]
    Matrix-assistierte Laser Desorptions/Ionisations-Massenspektrometrie (MALDI-TOF) ist eine sehr leistungsfähige Entwicklung für die Analyse von Biomolekülen (Karas M, Hillenkamp F. Laser desorption ionization of proteins with molecular masses exceeding 10,000 daltons. Anal Chem. 1988 Oct 15; 60(20):2299-301). Ein Analyt wird in eine lichtabsorbierende Matrix eingebettet. Durch einen kurzen Laserpuls wird die Matrix verdampft und das Analytmolekül so unfragmentiert in die Gasphase befördert. Durch Stöße mit Matrixmolekülen wird die Ionisation des Analyten erreicht. Eine angelegte Spannung beschleunigt die Ionen in ein feldfreies Flugrohr. Auf Grund ihrer verschiedenen Massen werden Ionen unterschiedlich stark beschleunigt. Kleinere Ionen erreichen den Detektor früher als größere.
  • [0018]
    MALDI-TOF Spektrometrie eignet sich ausgezeichnet zur Analyse von Peptiden und Proteinen. Die Analyse von Nukleinsäuren ist etwas schwieriger (Gut I G, Beck S. DNA and Matrix Assisted Laser Desorption Ionization Mass Spectrometry. Cunent Innovations and Future Trends. 1995, 1; 147-57). Für Nukleinsäuren ist die Empfindlichkeit etwa 100 mal schlechter als für Peptide und nimmt mit zunehmender Fragmentgröße überproportional ab. Für Nukleinsäuren, die ein vielfach negativ geladenes Rückgrat haben, ist der Ionisationsprozeß durch die Matrix wesentlich ineffizienter. In der MALDI-TOF Spektrometrie spielt die Wahl der Matrix eine eminent wichtige Rolle. Für die Desorption von Peptiden sind einige sehr leistungsfähige Matrizes gefunden worden, die eine sehr feine Kristallisation ergeben. Für DNA gibt es zwar mittlerweile einige ansprechende Matrizes, jedoch wurde dadurch der Empfindlichkeitsunterschied nicht verringert. Der Empfindlichkeitsunterschied kann verringert werden, indem die DNA chemisch so modifiziert wird, dass sie einem Peptid ähnlicher wird. Phosphorothioatnukleinsäuren, bei denen die gewöhnlichen Phosphate des Rückgrats durch Thiophosphate substituiert sind, lassen sich durch einfache Alkylierungschemie in eine ladungsneutrale DNA umwandeln (Gut IG, Beck S. A procedure for selective DNA alkylation and detection by mass spectrometry. Nucleic Acids Res. 1995 Apr 25; 23(8):1367-73). Die Kopplung eines "charge tags" an diese modifizierte DNA resultiert in der Steigerung der Empfindlichkeit um den gleichen Betrag, wie er für Peptide gefunden wird. Ein weiterer Vorteil von "charge tagging" ist die erhöhte Stabilität der Analyse gegen Verunreinigungen, die den Nachweis unmodifizierter Substrate stark erschweren.
  • [0019]
    Genomische DNA wird durch Standardmethoden aus DNA von Zell-, Gewebe- oder sonstigen Versuchsproben gewonnen. Diese Standardmethodik findet sich in Referenzen wie Fritsch und Maniatis Hrsg., Molecular Cloning: A Laboratory Manual, 1989.
  • Beschreibung
  • [0020]
    Es ist die Aufgabe der vorliegenden Erfindung, ein Amplifikat einer DNA von Genen zur Verfügung zu stellen, die mit Apoptose assoziiert sind, sowie ein Verfahren, welches sich zur Diagnose von genetischen und epigenetischen Parametern von Genen, die mit Apoptose assoziiert sind, eignet. Der Erfindung liegt die Erkenntnis zugrunde, daß genetische und epigenetische Parameter und insbesondere die Cytosin-Methylierungsmuster von Genen, die mit Apoptose assoziiert sind, zur Diagnose von mit Apoptose assoziierten Erkrankungen besonders eignen.
  • [0021]
    Diese Aufgabe wird erfindungsgemäß durch ein Nukleinsäureamplifikat wie in Anspruch 14 beansprucht gelöst. In der Tabelle sind nach den aufgelisteten Gen-Bezeichnungen die jeweiligen Datenbanknummern (Zugangsnummern) angegeben, die die dazugehörigen Gensequenzen als einmalig definieren. GenBank am National Institute of Health wurde als die zu Grunde liegende Datenbank unter der Internet Adresse www.ncbi.nlm.nih.gov verwendet.
  • [0022]
    Die chemisch modifizierte Nukleinsäure konnte bisher nicht in Zusammenhang mit der Ermittlung von genetischen und epigenetische Parametern gebracht werden.
  • [0023]
    Die vorliegende Erfindung beschreibt weiter ein Oligonukleotid oder Oligomer zur Detektion des Cytosin-Methylierungszustandes in chemisch vorbehandelter DNA, enthaltend mindestens eine Basensequenz mit einer Länge von mindestens 13 Nukleotiden gelöst, die an eine chemisch vorbehandelte DNA von Genen, die mit Apoptose assoziiert sind gemäß einer der Seq. ID No. 73 bis Seq. ID No. 74 und dazu komplementären Sequenzen hybridisiert. Die Oligomersonden wie beschrieben stellen wichtige und effektive Werkzeuge dar, welche die Ermittlung der genetischen und epigenetischen Parameter von Genen, die mit Apoptose assoziiert sind, zum ersten mal ermöglichen. Bevorzugterweise umfaßt die Basensequenz der Oligomere mindestens ein CpG Dinukleotid. Die Sonden können auch in Form einer PNA (Peptide Nucleic Acid) vorliegen, die besonders bevorzugte Paarungseigenschaften aufweist. Besonders bevorzugt sind Oligonukleotide wie beschrieben, bei denen das Cytosin des CpG Dinukleotids das 5.-9. Nukleotid vom 5'-Ende des 13 mers ist, im Falle von PNA-Oligomeren ist es bevorzugt, daß das Cytosin des CpG Dinukleotids das 4.-6. Nukleotid vom 5'-Ende des 9 mers ist.
  • [0024]
    Die Oligomere wie beschreiben werden normalerweise in sogenannten Sets eingesetzt, die für jedes der CpG Dinukleotide eine der Sequenzen der Seq. ID No. 73 bis Seq. ID No. 74 und dazu komplementären Sequenzen mindestens ein Oligomer umfassen. Bevorzugt ist ein Set, das für jedes der CpG Dinukleotide aus einer der Seq ID No. 73 bis Seq ID No. 74 und dazu komplementären Sequenzen mindestens ein Oligomer umfaßt.
  • [0025]
    Darüber hinaus beschreibt die Erfindung ein Set von mindestens zwei Oligonukleotiden zur Verfügung, die als sogenannte "Primer-Oligonukleotide" zur Amplifikation von DNA-Sequenzen einer der Seq. ID No. 73 bis Seq. ID No. 74 und dazu komplementärer Sequenzen davon eingesetzt werden können.
  • [0026]
    Im Falle der Sets von Oligonukleotiden wie beschrieben ist es bevorzugt, daß mindestens ein Oligonukleotid an eine Festphase gebunden ist.
  • [0027]
    Die vorliegende Erfindung beschreibt weiterhin einen Satz von mindestens 10 n (Oligonukleotiden und/oder PNA-Oligomeren), die zur Detektion des Cytosin- Methylierungszustandes in chemisch vorbehandelter genomischer DNA (Seq. ID No. 73 bis Seq. ID No. 74 und dazu komplementären Sequenzen) dienen. Mit diesen Sonden ist die Diagnose von genetischen und epigenetischen Parametern von Genen, die mit Apoptose assoziiert sind, möglich. Das Set von Oligomeren kann auch zum Nachweis von Single Nucleotide Polymorphismen (SNPs) in der chemisch vorbehandelten DNA von Genen, die mit Apoptose assoziiert sind gemäß einer der Seq. ID No. 73 bis Seq. ID No. 74 und dazu komplementären Sequenzen verwendet werden.
  • [0028]
    Erfindungsgemäß ist es bevorzugt, daß eine von der Erfindung zur Verfügung gestellte Anordnung aus unterschiedlichen Oligonukleotiden und/oder PNA-Oligomeren (ein sogenanntes "Array") ebenfalls an eine Festphase gebunden vorliegt. Dieses Array von unterschiedlichen Oligonukleotid- und/oder PNA-Oligomersequenzen kann dadurch gekennzeichnet sein, dass es auf der Festphase in Form eines rechtwinkligen oder hexagonalen Gitters angeordnet ist. Bevorzugterweise besteht die Festphasenoberfläche aus Silizium, Glas, Polystyrol, Aluminium, Stahl, Eisen, Kupfer, Nickel, Silber oder Gold. Möglich sind jedoch auch Nitrocellulose sowie Kunststoffe wie zum Beispiel Nylon, die in Form von Kugeln oder auch als Harz-Matrizes vorliegen können.
  • [0029]
    Daher wird weiter ein Verfahren zur Herstellung eines auf einem Trägermaterial fixierten Arrays zur Analyse in Zusammenhang mit Apoptose assoziierten Erkrankungen, bei dem mindestens ein Oligomer wie beschrieben an eine feste Phase gekoppelt wird. Verfahren zur Herstellung von solchen Arrays sind zum Beispiel aus der US 5,744,305 mittels Festphasenchemie und photolabilen Schutzgruppen bekannt.
  • [0030]
    Ein weiterer Gegenstand der Erfindung betrifft die Verwendung eines DNA-Chips zur Analyse von in Zusammenhang mit Apoptose stehenden Erkrankungen gemäß Anspruch 17. DNA-Chips sind zum Beispiel aus der US 5,837,832 bekannt.
  • [0031]
    Darüber hinaus wird auch ein Kit beschrieben, das zum Beispiel aus einer Bisulfit enthaltenden Reagenz, einem Satz von Primeroligonukleotiden umfassend mindestens zwei Oligonukleotide, deren Sequenzen jeweils mindestens einen 18 Basenpaaren langen Abschnitt der im Anhang aufgeführten Basensequenzen (Seq. ID No. 73 bis Seq. ID No. 74 und dazu komplementären Sequenzen), Oligonukleotiden und/oder PNA-Oligomeren sowie einer Anleitung zur Durchführung und Auswertung des beschriebenen Verfahrens bestehen kann. Ein Kit im Sinne wie beschrieben kann jedoch auch nur Teile der vorgenannten Bestandteile enthalten.
  • [0032]
    Die Erfindung stellt weiterhin ein Verfahren zur Ermittlung von genetischen und/oder epigenetischen Parametern, die für die Diagnose von Erkrankungen brauchbar sind, die mit Apoptose assoziiert sind, durch Analyse von Cytosin-Methylierungen und Single Nucleotide Polymorphismen zur Verfügung, das folgende Schritte umfaßt:
    In einem ersten Verfahrensschritt wird eine genomische DNA-Probe derart chemisch behandelt, daß an der 5'-Position unmethylierte Cytosinbasen in Uracil, Thymin oder eine andere vom Hybridisierungsverhalten her dem Cytosin unähnliche Base umgewandelt werden. Dies wird im folgenden unter "chemischer Vorbehandlung" verstanden.
  • [0033]
    Die zu analysierende genomische DNA wird bevorzugt aus den üblichen Quellen für DNA erhalten, wie Zellen oder Zellbestandteilen, zum Beispiel Zellinien, Biopsien, Blut, Sputum, Stuhl, Urin, Gehirn-Rückenmarks-Flüssigkeit, in Paraffin eingebettetes Gewebe, beispielsweise Gewebe von Augen, Darm, Niere, Hirn, Herz, Prostata, Lunge, Brust oder Leber, histologische Objektträger oder Kombinationen davon.
  • [0034]
    Bevorzugt wird dazu die oben beschriebene Behandlung genomischer DNA mit Bisulfit (Hydrogensulfit, Disulfit) und anschließender alkalischer Hydrolyse angewendet, die zu einer Umwandlung nicht methylierter Cytosin-Nukleobasen in Uracil oder eine andere vom Basenpaarungsverhalten her dem Cytosin unähnliche Base führt.
  • [0035]
    Aus dieser chemisch vorbehandelten genomischen DNA werden Fragmente unter Verwendung von Sätzen von Primer-Oligonukleotiden wie beschrieben und einer bevorzugterweise hitzestabilen Polymerase amplifiziert. Aus statistischen und praktikablen Erwägungen werden bevorzugterweise mehr als zehn unterschiedliche Fragmente amplifiziert, die 100-2000 Basenpaare lang sind. Die Amplifikation von mehreren DNA-Abschnitten kann simultan in ein und demselben Reaktionsgefäß durchgeführt werden. Üblicherweise wird die Amplifikation mittels der Polymerasekettenreaktion (PCR) durchgeführt.
  • [0036]
    Der Satz von Primer-Oligonukleotiden umfaßt bevorzugterweise mindestens zwei Oligonukleotide, deren Sequenzen jeweils revers komplementär oder identisch zu einem minde stens 18 Basenpaare langen Abschnitt der im Anhang (Seq. ID No. 73 bis Seq. ID No. 74 und dazu komplementären Sequenzen und dazu komplementären Sequenzen) aufgelisteten Basensequenzen sind. Die Primer-Oligonukleotide sind vorzugsweise dadurch gekennzeichnet, daß sie kein CpG Dinukleotid enthalten.
  • [0037]
    Erfindungsgemäß bevorzugt ist es, daß bei der Amplifikation mindestens ein Primer-Oligonukleotid an eine Festphase gebunden ist. Die unterschiedlichen Oligonukleotid und/oder PNA-Oligomersequenzen können auf einer ebenen Festphase in Form eines rechtwinkligen oder hexagonalen Gitters angeordnet sein, wobei die Festphasenoberfläche bevorzugt aus Silizium, Glas, Polystyrol, Aluminium, Stahl, Eisen, Kupfer, Nickel, Silber oder Gold besteht, wobei auch andere Materialien, wie Nitrocellulose oder Kunststoffe verwendet werden können.
  • [0038]
    Die mittels der Amplifikation erhaltenen Fragmente können eine direkt oder indirekt nachweisbare Markierung tragen. Bevorzugt sind Markierungen in Form von Fluoreszenzmarkierungen, Radionukliden oder ablösbaren Molekülfragmenten mit typischer Masse, die in einem Massenspektrometer nachgewiesen werden können, wobei bevorzugt ist, daß die erzeugten Fragmente zur besseren Detektierbarkeit im Massenspektrometer eine einzelne positive oder negative Nettoladung aufweisen. Der Nachweis kann mittels Matrix assistierter Laser Desorptions/Ionisations Massenspektrometrie (MALDI) oder mittels Elektrospray Massenspektrometrie (ESI) durchgeführt und visualisiert werden.
  • [0039]
    Die im zweiten Verfahrensschritt erhaltenen Amplifikate werden anschließend an einen Satz von Oligonukleotiden und/oder PNA- Sonden der oder an ein Array hybridisiert. Die Hybridisierung erfolgt dabei auf die unten angegebene Art und Weise. Der bei der Hybridisierung verwendete Satz besteht bevorzugterweise aus mindestens 10 Oligonukleotid oder PNA-Oligomer Sonden. Die Amplifikate dienen dabei als Sonden, die an vorher an einer Festphase gebundene Oligonukleotide hybridisieren. Die nicht hybridisierten Fragmente werden anschließend entfernt. Die besagten Oligonukleotide umfassen mindestens eine Basensequenz mit einer Länge von 13 Nukleotiden, die revers komplementär oder identisch zu einem Abschnitt der im Anhang aufgeführten Basensequenzen ist, der mindestens ein CpG Dinukleotid enthält. Das Cytosin des CpG Dinukleotids ist das 5. bis 9. Nukleotid vom 5'-Ende des 13 mers aus betrachtet. Für jedes CpG Dinukleotid ist ein Oligonukleotid vorhanden. Die besagten PNA-Oligomere umfassen mindestens eine Basensequenz mit einer Länge von 9 Nukleo tiden, die revers komplementär oder identisch zu einem Abschnitt der im Anhang aufgeführten Basensequenzen ist, der mindestens ein CpG Dinukleotid enthält. Das Cytosin des CpG Dinukleotids ist das 4. bis 6. Nukleotid vom 5'-Ende des 9 mers aus gesehen. Für jedes CpG Dinukleotid ist ein Oligonukleotid vorhanden.
  • [0040]
    Im vierten Verfahrensschritt entfernt man die nicht hybridisierten Amplifikate.
  • [0041]
    Im letzten Verfahrensschritt detektiert man die hybridisierten Amplifikate. Dabei ist bevorzugt, daß an den Amplifikaten angebrachte Markierungen an jeder Position der Festphase, an der sich eine Oligonukleotidsequenz befindet, identifizierbar sind.
  • [0042]
    Erfindungsgemäß bevorzugt ist es, daß die Markierungen der Amplifikate Fluoreszenzmarkierungen, Radionuklide oder ablösbare Molekülfragmente mit typischer Masse sind, die in einem Massenspektrometer nachgewiesen werden können. Der Nachweis der Amplifikate, Fragmente der Amplifikate oder zu den Amplifikaten komplementäre Sonden im Massenspektrometer ist bevorzugt, wobei man die Detektion mittels Matrix assistierter Laser Desorptions/Ionisations Massenspektrometrie (MALDI) oder mittels Elektrospray Massenspektrometrie (ESI) durchführen und visualisieren kann.
  • [0043]
    Zur besseren Detektierbarkeit im Massenspektrometer können die erzeugten Fragmente eine einzelne positive oder negative Nettoladung aufweisen. Bevorzugt wird das vorgenannte Verfahren zur Ermittlung von genetischen und/oder epigenetischen Parametern von Genen, die mit Apoptose assoziiert sind, verwendet.
  • [0044]
    Die Oligomere wie beschrieben oder Arrays derselben sowie ein Kit wie beschrieben sollen zur Diagnose einer mit Apoptose assoziierten Krankheit durch Analyse von Methylierungsmustern von Genen, die mit Apoptose assoziiert sind, verwendet werden. Erfindungsgemäß bevorzugt ist die Verwendung des Verfahrens zur Diagnose bedeutender genetischer und/oder epigenetischer Parameter innerhalb von Genen, die mit Apoptose assoziiert sind.
  • [0045]
    Das erfindungsgemäße Verfahren wird zum Beispiel der Diagnose von soliden Tumoren und Krebsarten verwendet.
  • [0046]
    Die Nukleinsäuren der Seq. ID No. 73 bis Seq. ID No. 74 und dazu komplementäre Sequenzen können für die Diagnose von genetischen und/oder epigenetischen Parametern von Genen, die mit Apoptose assoziiert sind, verwendet werden.
  • [0047]
    Auch beschrieben wird ein Verfahren zur Herstellung eines Diagnostikums und/oder Therapeutikums zur Diagnose von Krankheiten, die mit Apoptose assoziiert sind durch Analyse von Methylierungsmustern von Genen, die mit Apoptose assoziiert sind, wobei das Diagnostikum und/oder das Therapeutikum dadurch gekennzeichnet ist, daß mindestens eine Nukleinsäure wie beschrieben, gegebenenfalls zusammen mit geeigneten Zusatz- und Hilfsstoffen zu dessen Herstellung verwendet wird.
  • [0048]
    Die vorliegende Beschreibung betrifft weiter ein Diagnostikum und/oder Therapeutikum für Krankheiten, die mit Apoptose assoziiert sind, durch Analyse von Methylierungsmustern von Genen, die mit Apoptose assoziiert sind, wobei das Diagnostikum und/oder Therapeutikum dadurch gekennzeichnet ist, daß es mindestens eine Nukleinsäure wie beschrieben, gegebenenfalls zusammen mit geeigneten Zusatz- und Hilfsstoffen enthält.
  • [0049]
    Die vorliegende Erfindung betrifft weiterhin die Diagnose nachteiliger Ereignisse für Patienten oder Individuen, bei dem die mittels der Erfindung erhaltenen bedeutenden genetischen und/oder epigenetischen Parameter innerhalb von Genen, die mit Apoptose assoziiert sind mit einem anderen Satz genetischen und/oder epigenetischen Parameter verglichen werden können und die so erhaltenen Unterschiede als Basis für eine Diagnose und/oder Prognose nachteiliger Ereignisse für Patienten oder Individuen dienen.
  • [0050]
    Unter dem Begriff „Hybridisierung" im Sinne der vorliegenden Erfindung ist eine Bindung unter Ausbildung einer Duplex-Struktur eines Oligonukleotids an eine vollständig komplementäre Sequenz im Sinne der Watson-Crick Basenpaarungen in der Proben DNA zu verstehen. Unter „stringenten Hybridisierungsbedingungen" sind solche Bedingungen zu verstehen, bei denen eine Hybridisierung bei 60°C in 2,5 × SSC-Puffer, gefolgt von mehreren Waschschritten bei 37°C in einer geringeren Pufferkonzentration erfolgt und stabil bleibt.
  • [0051]
    Mit dem Begriff "funktionelle Varianten" sind alle DNA-Sequenzen bezeichnet, die komplementär zu einer DNA-Sequenz sind, die unter stringenten Bedingungen mit der Referenzse quenz hybridisieren und eine zu dem entsprechenden erfindungsgemäßen Polypeptid ähnliche Aktivität aufweisen.
  • [0052]
    "Genetische Parameter" im Sinne dieser Erfindung sind Mutationen und Polymorphismen von Genen, die mit Apoptose assoziiert sind und zu deren Regulation weiterhin erforderlicher Sequenzen. Insbesondere sind als Mutationen Insertionen, Deletionen, Punktmutationen, Inversionen und Polymorphismen und besonders bevorzugt SNPs (Single Nucleotide Polymorphisms) zu bezeichnen.
  • [0053]
    „Epigenetische Parameter" im Sinne dieser Erfindung sind insbesondere Cytosin-Methylierungen und weitere chemische Modifikationen von DNA-Basen von Genen, die mit Apoptose assoziiert sind und zu deren Regulation weiterhin erforderliche Sequenzen. Weitere epigenetische Parameter sind beispielsweise die Acetylierung von Histonen, die jedoch mit dem beschriebenen Verfahren nicht direkt analysiert werden kann, sondern wiederum mit der DNA-Methylierung korreliert.
  • [0054]
    Die Erfindung soll nun im folgenden auf Basis der Sequenzen und Beispiele unter bezug auf die beigefügte Figur weiter verdeutlicht werden, ohne daß die Erfindung hierauf eingeschränkt wird.
  • 1
  • [0055]
    1 zeigte die Hybridisierung von Fluoreszenz-markierten Amplifikaten an ein Oberflächen-gebundenes Oligonukleotid. Probe I stammt von gesundem Gewebe und Probe II stammt von pilocytischem Astrocytoma(Tumor)-Gewebe. Die Fluoreszenz an einem Punkt zeigt die Hybridisierung des Amplifikats an. Die Hybridisierung an ein CG Oligonukleotid zeigt an, daß die Methylierung an der Cytosin-Position analysiert wird, die Hybridisierung an ein TG Oligonukleotid zeigt an, daß keine Methylierung an der Cytosin-Position analysiert wird.
  • Sequenz ID Nos. 1 bis 74
  • [0056]
    Sequenzen, die ungerade Sequenznummern haben (z.B., Seq. ID No. 1, 3, 5, ...) zeigen in jedem Fall Sequenzen der chemisch vorbehandelten genomischen DNAs von verschiedenen Genen, die mit Apoptose assoziiert sind. Sequenzen, die gerade Sequenznummern aufweisen (z.B., Seq. ID No. 2, 4, 6, ...) zeigen in jedem Fall Sequenzen der chemisch vorbehandelten genomischen DNAs von verschiedenen Genen, die mit Apoptose assoziiert sind, die komplementär zu den voranstehenden Sequenzen sind (z.B., die komplementäre Sequenz zu Seq. ID No. 1 ist Seq. ID No. 2, die komplementäre Sequenz zu Seq. ID No. 3 ist Seq. ID No. 4, usw.)
  • Seq ID No. 75 bis Seq. ID No. 78
  • [0057]
    Seq. ID No. 75 bis Seq. ID No. 78 zeigen die Sequenzen von Oligonukleotiden, die in Beispiel 1 verwendet werden.
  • [0058]
    Das folgende Beispiel betrifft ein Fragment eines Gens, das mit Apoptose assoziiert ist, in diesem Fall "Death-associated Protein 1" (DAPK1), worin eine spezifische CG-Position auf ihren Methylierungsstatus hin analysiert wird.
  • [0059]
    Beispiel 1: Methylierungsanalyse in dem mit Apoptose assoziierten Gen DAPK1Das folgende Beispiel betrifft ein Fragment des Gens DAPKI, worin eine spezifische CG-Position auf ihren Methylierungsstatus hin analysiert wird.
  • [0060]
    Im ersten Schritt wird eine genomische Sequenz unter Verwendung von Bisulfit (Hydrogensulfit, Disulfit) derart behandelt, daß alle nicht an der 5-Position der Base methylierten Cytosine so verändert werden, daß eine hinsichtlich dem Basenpaarungsverhalten unterschiedliche Base entsteht, während die in 5-Position methylierten Cytosine unverändert bleiben.
  • [0061]
    Wird für die Reaktion Bisulfit verwendet, so findet an den nicht methylierten Cytosinbasen eine Addition statt. Zudem müssen ein denaturierendes Reagenz oder Lösungsmittel sowie ein Radikalfänger zugegen sein. Eine anschließende alkalische Hydrolyse führt dann zur Umwandlung von nicht methylierten Cytosin-Nukleobasen in Uracil. Chemisch umgewandelte DNA (Sequence ID Nos. 73 und 74) dient dann dazu, methylierte Cytosine nachzuweisen. Im zweiten Verfahrensschritt verdünnt man die behandelte DNA-Probe mit Wasser oder einer wässrigen Lösung. Bevorzugt wird anschließend eine Desulfonierung der DNA (10-30 min, 90-100°C) bei alkalischem pH-Wert durchgeführt. Im dritten Schritt des Verfahrens amplifiziert man die DNA-Probe in einer Polymerasekettenreaktion, bevorzugt mit einer hitzebeständigen DNA-Polymerase. Im vorliegenden Fall werden Cytosine des Gens DAPKI analysiert. Dazu wird mit den spezifischen Primeroligonukleotiden ATTAATATTATGTAAAGTGA (Seq. ID No. 75) und CTTACAACCATTCACCCACA (Seq. ID No. 76) ein definiertes Fragment der Länge 465 bp amplifiziert. Dieses Amplifikat dient als Probe, die an ein vorher an einer Festphase gebundenes Oligonukleotid unter Ausbildung einer Duplexstruktur hybridisiert, beispielsweise GTTATATCGTGGAGGATA (Seq. ID No. 76), wobei sich das nachzuweisende Cytosin an Position 135 des Amplifikats befindet. Der Nachweis des Hybridisierungsprodukts beruht auf Cy3 und Cy5 fluoreszenzmarkierten Primer-Oligonukleotiden, die für die Amplifikation verwendet wurden. Nur wenn in der Bisulfit behandelten DNA an dieser Stelle ein methyliertes Cytosin vorgelegen hat, kommt es zu einer Hybridisierungsreaktion der amplifizierten DNA mit dem Oligonukleotid. Somit kann der Methylierungsstatus des jeweiligen zu untersuchenden Cytosins über das Hybridisierungsprodukt abgeleitet werden.
  • [0062]
    Um den Methylierungsstatus der Position zu überprüfen, wird eine Probe des Amplifikats weiterhin an ein anderes Oligonukleotid hybridisiert, das vorher an eine feste Phase gebunden wurde. Dieses Oligonukleotid ist identisch zu dem Oligonukleotid, das vorher benutzt wurde, um den Methylierungsstatus der Probe zu analysieren, mit der Ausnahme der fraglichen Position. An der zu analysierenden Position umfaßt das Oligonukleotid eine Thymin-Base, im Gegensatz zu einer Cytosin-Base d.h. die Sequenz GTTATATTGTGGAGGATA (Seq. ID No. 78). Daher findet die Hybridisierungsreaktion nur statt, falls ein nicht-methyliertes Cytosin an der zu analysierenden Positionen vorhanden ist. Das Verfahren wurde an zwei Zellproben aus 2 Patienten durchgeführt, wobei Probe 1 aus normalem gesunden Gewebe und Probe 2 aus einer pilocytischem Astrocytoma Tumorprobe stammte.
  • [0063]
    Aus den Ergebnissen (siehe 1) kann gesehen werden, daß Probe I ein Gemisch von sowohl methylierten und nicht-methylierten Zellen an der Position des Amplifikats enthielt, wohingegen Probe 2 nur methylierte Zellen an Position 135 des Amplifikats enthielt.
  • Beispiel 2: Diagnose von mit Apoptose assoziierten Erkrankungen
  • [0064]
    Um einen Bezug der Methylierungsmuster zu einer der mit Apoptose assoziierten Erkrankungen herzustellen, bedarf es zunächst der Untersuchung der DNA-Methylierungsmuster einer Gruppe von erkrankten und einer Gruppe von gesunden Personen. Diese Untersuchungen werden zum Beispiel analog dem Beispiel 1 durchgeführt. Die so erhaltenen Ergebnisse werden in einer Datenbank abgespeichert und die CpG Dinukleotide identifiziert, die zwischen den beiden Gruppen unterschiedlich methyliert sind. Dies kann durch Bestimmung einzelner CpG Methylierungsraten erfolgen, wie dies z. B. durch Sequenzieren relativ ungenau oder aber durch eine Methylierungs-sensitive "Primer-Extension-Reaktion" sehr genau möglich ist.
  • [0065]
    Auch gleichzeitige Analyse des gesamten Methylierungsstatus ist möglich, und die Muster können z.B. mittels Clustering-Analysen, die z.B. durch einen Rechner durchgeführt werden können, verglichen werden.
  • [0066]
    Nachfolgend ist es möglich, untersuchte Patienten einer bestimmten Therapiegruppe zuzuordnen und diese Patienten gezielt mit einer individualisierten Therapie zu behandeln.
  • [0067]
    Beispiel 2 kann zum Beispiel für die folgenden Erkrankungen durchgeführt werden: HIV-Infektion, Bloom Syndrom, Cardiopathie, Alterung, neurodegenerativer Erkrankungen, Herpes simplex Virusinfektion, renaler Ischämie, Amyotropher Lateralsklerose, soliden Tumoren und Krebsarten.
    Figure 00170001
    Sequenzprotokoll
    Figure 00180001
    Figure 00190001
    Figure 00200001
    Figure 00210001
    Figure 00220001
    Figure 00230001
    Figure 00240001
    Figure 00250001
    Figure 00260001
    Figure 00270001
    Figure 00280001
    Figure 00290001
    Figure 00300001
    Figure 00310001
    Figure 00320001
    Figure 00330001
    Figure 00340001
    Figure 00350001
    Figure 00360001
    Figure 00370001
    Figure 00380001
    Figure 00390001
    Figure 00400001
    Figure 00410001
    Figure 00420001
    Figure 00430001
    Figure 00440001
    Figure 00450001
    Figure 00460001
    Figure 00470001
    Figure 00480001
    Figure 00490001
    Figure 00500001
    Figure 00510001
    Figure 00520001
    Figure 00530001
    Figure 00540001
    Figure 00550001
    Figure 00560001
    Figure 00570001
    Figure 00580001
    Figure 00590001
    Figure 00600001
    Figure 00610001
    Figure 00620001
    Figure 00630001
    Figure 00640001
    Figure 00650001
    Figure 00660001
    Figure 00670001
    Figure 00680001
    Figure 00690001
    Figure 00700001
    Figure 00710001
    Figure 00720001
    Figure 00730001
    Figure 00740001
    Figure 00750001
    Figure 00760001
    Figure 00770001
    Figure 00780001
    Figure 00790001
    Figure 00800001
    Figure 00810001
    Figure 00820001
    Figure 00830001
    Figure 00840001
    Figure 00850001
    Figure 00860001
    Figure 00870001
    Figure 00880001
    Figure 00890001
    Figure 00900001
    Figure 00910001
    Figure 00920001
    Figure 00930001
    Figure 00940001
    Figure 00950001
    Figure 00960001
    Figure 00970001
    Figure 00980001
    Figure 00990001
    Figure 01000001
    Figure 01010001
    Figure 01020001
    Figure 01030001
    Figure 01040001
    Figure 01050001
    Figure 01060001
    Figure 01070001
    Figure 01080001
    Figure 01090001
    Figure 01100001
    Figure 01110001
    Figure 01120001
    Figure 01130001
    Figure 01140001
    Figure 01150001
    Figure 01160001
    Figure 01170001
    Figure 01180001
    Figure 01190001
    Figure 01200001
    Figure 01210001
    Figure 01220001
    Figure 01230001
    Figure 01240001
    Figure 01250001
    Figure 01260001
    Figure 01270001
    Figure 01280001
    Figure 01290001
    Figure 01300001
    Figure 01310001
    Figure 01320001
    Figure 01330001
    Figure 01340001
    Figure 01350001
    Figure 01360001
    Figure 01370001
    Figure 01380001
    Figure 01390001
    Figure 01400001
    Figure 01410001
    Figure 01420001
    Figure 01430001
    Figure 01440001
    Figure 01450001
    Figure 01460001
    Figure 01470001
    Figure 01480001
    Figure 01490001
    Figure 01500001
    Figure 01510001
    Figure 01520001
    Figure 01530001
    Figure 01540001
    Figure 01550001
    Figure 01560001
    Figure 01570001
    Figure 01580001
    Figure 01590001
    Figure 01600001
    Figure 01610001
    Figure 01620001
    Figure 01630001
    Figure 01640001
    Figure 01650001
    Figure 01660001
    Figure 01670001
    Figure 01680001
    Figure 01690001
    Figure 01700001
    Figure 01710001
    Figure 01720001
    Figure 01730001
    Figure 01740001
    Figure 01750001
    Figure 01760001
    Figure 01770001
    Figure 01780001
    Figure 01790001
    Figure 01800001
    Figure 01810001
    Figure 01820001
    Figure 01830001
    Figure 01840001
    Figure 01850001
    Figure 01860001
    Figure 01870001
    Figure 01880001
    Figure 01890001
    Figure 01900001
    Figure 01910001
    Figure 01920001
    Figure 01930001
    Figure 01940001
    Figure 01950001
    Figure 01960001
    Figure 01970001
    Figure 01980001
    Figure 01990001
    Figure 02000001

Claims (18)

  1. Verfahren zur Ermittlung von genetischen und/oder epigenetischen Parametern, die für die Diagnose von bestehenden Erkrankungen oder der Prädisposition für spezifische Erkrankungen geeignet sind, durch analysieren von Cytosinmethylierungen, dadurch gekennzeichnet, dass die folgenden Schritte durchgeführt werden: a) in einer genomischen DNA Probe werden Cytosinbasen, die an der 5-Position nicht methyliert sind, durch chemische Behandlung mittels einer Lösung eines Bisulfits, Hydrogensulfits oder Disulfits, zu Uracil oder einer anderen Base, die hinsichtlich ihres Hybridisierungsverhaltens von Cytosin unähnlich ist umgewandelt; b) Fragmente der chemisch vorbehandelten genomischen DNA Probe werden unter der Verwendung eines Sets von mindestens zwei Primeroligonukleotiden und einer Polymerase amplifiziert, wobei die Oligomere in jedem Fall mindestens eine Basensequenz mit einer Länge von mindestens 9 Nukleotiden umfassen, die an eine chemisch vorbehandelte DNA eines Gens, das mit Apoptose assoziiert ist, nach einer der Seq ID Nrn. 73 oder 74 und dazu komplementären Sequenzen, hybridisiert oder dazu identisch ist, c) die Amplifikate werden an ein Set von mindestens zwei Oligonukleotiden und/oder PNA Sonden hybridisiert, die in jedem Fall eine Basensequenz umfassen, die eine Länge von mindestens 9 Nukleotiden aufweisen, die an eine chemisch vorbehandelte DNA eines Gens, das mit Apoptose assoziiert ist nach einer der Seq ID Nrn. 73 oder 74 und dazu komplementären Sequenzen oder andererseits an eine Anordnung dieser Oligonukleotide und/oder PNA Sonden hybridisiert oder dazu identisch ist; und d) die hybridisierten Amplifikate werden anschließend nachgewiesen.
  2. Verfahren nach Anspruch 1, wobei die Amplifikation der chemisch vorbehandelten genomischen DNA unter der Verwendung von Sets von Primeroligonukleotiden und einer Polymerase auf eine Weise durchgeführt wird, dass die Amplifikate einen nachweisbaren Marker tragen.
  3. Verfahren nach Anspruch 1 oder 2, weiter umfassend den Schritt von hybridisieren der Amplifikate an ein Set von Oligomeren (Oligonukleotide und/oder PNA Sonden) oder an eine Anordnung, wobei die Basensequenz der Oligomere mindestens ein CpG Dinukleotid einschließt.
  4. Verfahren nach Anspruch 3, dadurch gekennzeichnet, dass das Cytosin des CpG Dinukleotids im mittleren Drittel des Oligomers lokalisiert ist.
  5. Verfahren nach einem der Ansprüche 1 bis 4, wobei ein Set an Oligomeren verwendet wird, umfassend Oligomere zum Nachweis des Methylierungszustands aller CpG Dinukleotide innerhalb einer der Sequenzen nach Seq. ID Nrn. 73 oder 74, und dazu komplementären Sequenzen.
  6. Verfahren nach einem der Ansprüche 1 bis 5, dadurch gekennzeichnet, dass mehr als zehn verschiedene Fragmente mit einer Länge von 100-2000 Basenpaaren amplifiziert werden.
  7. Verfahren nach einem der Ansprüche 1 bis 6, dadurch gekennzeichnet, dass die Amplifikation von mehreren DNA Segmenten in einem Reaktionsgefäß durchgeführt wird.
  8. Verfahren nach einem der Ansprüche 1 bis 7, dadurch gekennzeichnet, dass die Polymerase eine Hitze-resistente DNA Polymerase ist, und wobei die Amplifikation bevorzugt mittels der Polymerase-Kettenreaktion (PCR) durchgeführt wird.
  9. Verfahren nach einem der Ansprüche 2 bis 7, dadurch gekennzeichnet, dass die Marker der Amplifikate ausgewählt sind aus der Gruppe von Fluoreszenmarkern, Radionukliden und ablösbaren Molekülfragmenten, die eine typische Masse aufweisen, die in einem Massenspektrometer nachgewiesen wird.
  10. Verfahren nach Anspruch 9, dadurch gekennzeichnet, dass die hergestellten Fragmente eine einzelne positive oder negative Nettoladung für eine bessere Nachweisbarkeit in einem Massenspektrometer aufweisen.
  11. Verfahren nach Anspruch 9 oder 10, dadurch gekennzeichnet, dass die Amplifikate oder Fragmente der Amplifikate in einem Massenspektrometer nachgewiesen werden, wobei der Nachweis bevorzugt mittels Matrix-unterstützter Laserdesorptions-/Ionisierungs- Massenspektrometrie (MALDI) oder unter der Verwendung von Elektronenspray-Massenspektrometrie (ESI) durchgeführt und visualisiert wird.
  12. Verfahren nach einem der Ansprüche 1 bis 11, dadurch gekennzeichnet, dass die genomische DNA aus Zellen oder zellulären Komponenten, die DNA enthalten, erhalten wird, wobei Quellen an DNA zum Beispiel umfassen, Zelllinien, Biopsien, Blut, Sputum, Stuhl, Urin, cerebrospinale Flüssigkeit, Gewebe eingebettet in Paraffin, wie zum Beispiel Gewebe von Augen, Darm, Niere, Hirn, Herz, Prostata, Lunge, Brust oder Leber, histologische Objektträger und alle mögliche Kombinationen davon.
  13. Verfahren nach einem der Ansprüche 1 bis 12, weiter umfassend den Schritt von Durchführen einer Diagnose einer Erkrankung ausgewählt aus soliden Tumoren und Krebs.
  14. Nukleinsäureamplifikat, hergestellt durch a) chemische Umwandlung von Cytosinbasen, die an der 5-Position nicht methyliert sind, in Uracil oder eine andere Base, die im Hinblick auf ihr Hybridisierungsverhalten von Cytosine unähnlich ist, in einer genomischen DNA-Probe mittels einer Lösung eines Bisulfits, Hydrogensulfits oder Disulfits und anschließender alkalischer Hydrolyse, und b) PCR-Amplifikation von Fragmenten aus der vorbehandelten genomischen DNA unter der Verwendung von mindestens zwei Primeroligonukleotiden und einer Polymerase, wobei die Primeroligonukleotide eine Basensequenz umfassen, die eine Länge von mindestens 18 Nukleotiden aufweist, die revers komplementär oder identisch ist zu einer chemisch vorbehandelten DNA eines Gens, das mit Apoptose assoziiert ist nach einer der Seq ID Nrn. 73 oder 74 und dazu komplementärer Sequenzen, wobei die Fragmente eine Länge von 100-2000 Basenpaaren aufweisen.
  15. Nukleinsäure nach Anspruch 14, die einen nachweisbaren Marker trägt.
  16. Nukleinsäure nach Anspruch 14 oder 15 zur Verwendung in der Diagnose von Erkrankungen.
  17. Verwendung einer Anordnung eines Sets von mindestens zwei verschiedenen Oligomeren (Array), die in jedem Fall eine Basensequenz umfassen, die eine Länge von mindestens 9 Nukleotiden aufweist, die identisch ist zu einer chemisch vorbehandelten DNA eines Gens, das mit Apoptose assoziiert ist nach einer der Seq ID Nrn. 73 oder 74 oder dazu komplementären Sequenzen, fixiert an ein Trägermaterial zur Analyse von Erkrankungen, die mit dem Methylierungszustand der CpG Dinukleotide einer der Seq. ID Nr. 73 oder Seq. ID Nr. 74 oder dazu komplementärer Sequenzen assoziiert sind.
  18. Verwendung einer Anordnung nach Anspruch 17 in einem Verfahren zur Diagnose von soliden Tumoren und Krebs nach Anspruch 13.
DE2001626593 2000-04-06 2001-04-06 Diagnose von mit apoptose assoziierten erkrankungen mittels ermittlung des methylierungszustandes von apoptose-assozierten genen Active DE60126593T2 (de)

Priority Applications (9)

Application Number Priority Date Filing Date Title
DE2000119058 DE10019058A1 (de) 2000-04-06 2000-04-06 Detektion von Variationen des DNA-Methylierungsprofils
DE10019058 2000-04-06
DE10019173 2000-04-07
DE10019173 2000-04-07
DE2000132529 DE10032529A1 (de) 2000-06-30 2000-06-30 Diagnose von bedeutenden genetischen Parametern innerhalb des Major Histocompatibility Complex (MHC)
DE10032529 2000-06-30
DE10043826 2000-09-01
DE10043826 2000-09-01
PCT/EP2001/003969 WO2001077164A3 (en) 2000-04-06 2001-04-06 Diagnosis of diseases associated with apoptosis by means of assessing the methylation status of genes associated with apoptosis

Publications (1)

Publication Number Publication Date
DE60126593T2 true DE60126593T2 (de) 2007-10-31

Family

ID=27437807

Family Applications (2)

Application Number Title Priority Date Filing Date
DE2001626593 Expired - Fee Related DE60126593D1 (de) 2000-04-06 2001-04-06 Diagnose von mit apoptose assoziierten erkrankungen mittels ermittlung des methylierungszustandes von apoptose-assozierten genen
DE2001626593 Active DE60126593T2 (de) 2000-04-06 2001-04-06 Diagnose von mit apoptose assoziierten erkrankungen mittels ermittlung des methylierungszustandes von apoptose-assozierten genen

Family Applications Before (1)

Application Number Title Priority Date Filing Date
DE2001626593 Expired - Fee Related DE60126593D1 (de) 2000-04-06 2001-04-06 Diagnose von mit apoptose assoziierten erkrankungen mittels ermittlung des methylierungszustandes von apoptose-assozierten genen

Country Status (5)

Country Link
US (7) US20030148327A1 (de)
EP (9) EP1268861A2 (de)
JP (3) JP2003531589A (de)
DE (2) DE60126593D1 (de)
WO (8) WO2001076451A3 (de)

Families Citing this family (66)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6780982B2 (en) 1996-07-12 2004-08-24 Third Wave Technologies, Inc. Charge tags and the separation of nucleic acid molecules
US6818404B2 (en) 1997-10-23 2004-11-16 Exact Sciences Corporation Methods for detecting hypermethylated nucleic acid in heterogeneous biological samples
US8076063B2 (en) 2000-02-07 2011-12-13 Illumina, Inc. Multiplexed methylation detection methods
US7955794B2 (en) 2000-09-21 2011-06-07 Illumina, Inc. Multiplex nucleic acid reactions
US20030148327A1 (en) * 2000-04-06 2003-08-07 Alexander Olek Diagnosis of diseases associated with metastasis
WO2001093902A3 (en) * 2000-06-07 2002-04-18 Biosynexus Inc Immunostimulatory rna/dna hybrid molecules
US20040023230A1 (en) * 2000-06-30 2004-02-05 Alexander Olek Method and nucleic acids for pharmacogenomic methylation analysis
EP1337662A4 (de) * 2000-11-13 2004-09-08 Human Genetic Signatures Pty Nachweis methylierter dna-moleküle
DE10128508A1 (de) 2001-06-14 2003-02-06 Epigenomics Ag Verfahren und Nukleinsäuren für die Differenzierung von Prostata-Tumoren
US7582420B2 (en) 2001-07-12 2009-09-01 Illumina, Inc. Multiplex nucleic acid reactions
WO2003031932A3 (en) 2001-10-05 2006-10-19 Univ Case Western Reserve Methods and compositions for detecting colon cancers
JP2003144172A (ja) * 2001-11-16 2003-05-20 Nisshinbo Ind Inc メチル化検出用オリゴヌクレオチド固定化基板
US20110151438A9 (en) * 2001-11-19 2011-06-23 Affymetrix, Inc. Methods of Analysis of Methylation
DE10161625A1 (de) * 2001-12-14 2003-07-10 Epigenomics Ag Verfahren und Nukleinsäuren für die Analyse einer Lungenzell-Zellteilungsstörung
EP1497462A4 (de) * 2002-03-07 2007-11-07 Univ Johns Hopkins Med Genomischer screen auf epigenetisch stumm gemachte krebsassoziierte gene
EP1344832A1 (de) * 2002-03-15 2003-09-17 Epigenomics AG Verfahren und Nukleinsäuren zur Analyse der Methylierung im Melastatin-Gen
WO2003083107A1 (en) * 2002-03-25 2003-10-09 The Board Of Trustees Of The University Of Arkansas Cpg retrieval of dna from formalin-fixed pathology specimen for promoter methylation analysis
JP2005532067A (ja) * 2002-07-03 2005-10-27 コーリー ファーマシューティカル グループ,インコーポレイテッド 刺激性免疫応答用の核酸組成物
US7807803B2 (en) 2002-07-03 2010-10-05 Coley Pharmaceutical Group, Inc. Nucleic acid compositions for stimulating immune responses
US20040053880A1 (en) 2002-07-03 2004-03-18 Coley Pharmaceutical Group, Inc. Nucleic acid compositions for stimulating immune responses
EP1554407B1 (de) * 2002-10-01 2009-07-29 Epigenomics AG Verfahren für die behandlung von proliferativen erkrankungen von brustzellen
DE60331852D1 (de) * 2002-12-02 2010-05-06 Illumina Cambridge Ltd Bestimmung der methylierung von nukleinsäuresequenzen
DE10304219B3 (de) * 2003-01-30 2004-08-19 Epigenomics Ag Verfahren zum Nachweis von Cytosin-Methylierungsmustern mit hoher Sensitivität
WO2004070062A3 (en) * 2003-02-04 2004-11-18 Eugene Brown Compositions and methods for diagnosing and treating cancers
US8168777B2 (en) 2004-04-29 2012-05-01 Human Genetic Signatures Pty. Ltd. Bisulphite reagent treatment of nucleic acid
US20050009059A1 (en) * 2003-05-07 2005-01-13 Affymetrix, Inc. Analysis of methylation status using oligonucleotide arrays
DE602004028478D1 (de) 2003-06-17 2010-09-16 Human Genetic Signatures Pty Verfahren zur genomamplifikation
US7485420B2 (en) * 2003-08-14 2009-02-03 Case Western Reserve University Methods and compositions for detecting colon cancers
US8415100B2 (en) 2003-08-14 2013-04-09 Case Western Reserve University Methods and compositions for detecting gastrointestinal and other cancers
DE10338308B4 (de) 2003-08-15 2006-10-19 Epigenomics Ag Verfahren zum Nachweis von Cytosin-Methylierungen in DNA
DE602004018801D1 (de) 2003-09-04 2009-02-12 Human Genetic Signatures Pty Nukleinsäurenachweistest
EP1689885B1 (de) * 2003-10-20 2012-10-17 St Vincent's Hospital Sydney Limited Beurteilung der Veranlagung eine Krebskrankheit zu bekommen mittels quantitativer Bestimmung der Methylierung in normalen Zellen von gesunden Menschen
WO2005054517A3 (en) * 2003-12-01 2006-02-16 Susan Cottrell Methods and nucleic acids for the analysis of gene expression associated with the development of prostate cell proliferative disorders
EP1561821B1 (de) 2003-12-11 2011-02-16 Epigenomics AG Marker zur Prognose der Reaktion auf Therapie bzw. der Überlebensrate von Brustkrebspatienten
US20050196792A1 (en) * 2004-02-13 2005-09-08 Affymetrix, Inc. Analysis of methylation status using nucleic acid arrays
DK1794173T3 (da) 2004-09-10 2010-10-25 Human Genetic Signatures Pty Amplifikationsblokker indeholdende interkalaterende nukleinsyrer (INA) indeholdende interkalaterende pseudonukleotider (IPN)
KR20060026595A (ko) 2004-09-21 2006-03-24 (주)지노믹트리 제한효소와 dna 칩을 이용한 프로모터의 메틸화 검출방법
KR100617649B1 (ko) * 2004-09-24 2006-09-04 (주)지노믹트리 대장암 특이적 발현감소 유전자의 메틸화된 프로모터를 함유하는 암 진단용 조성물 및 그 용도
ES2399054T3 (es) 2004-12-03 2013-03-25 Human Genetic Signatures Pty Ltd Métodos para simplificar ácidos nucleicos microbianos mediante modificación química de citosinas
US20060134650A1 (en) * 2004-12-21 2006-06-22 Illumina, Inc. Methylation-sensitive restriction enzyme endonuclease method of whole genome methylation analysis
WO2006088978A1 (en) 2005-02-16 2006-08-24 Epigenomics, Inc. Method for determining the methylation pattern of a polynucleic acid
WO2006113770A1 (en) 2005-04-15 2006-10-26 Epigenomics Ag A method for providing dna fragments derived from a remote sample
WO2006111586B1 (es) * 2005-04-20 2007-01-11 Proyecto Biomedicina Cima Sl Procedimiento para la determinación in vitro del grado de metilación del promotor de line-1
WO2006125267A1 (en) 2005-05-26 2006-11-30 Human Genetic Signatures Pty Ltd Isothermal strand displacement amplification using primers containing a non-regular base
US20060292585A1 (en) * 2005-06-24 2006-12-28 Affymetrix, Inc. Analysis of methylation using nucleic acid arrays
WO2007030882A1 (en) 2005-09-14 2007-03-22 Human Genetic Signatures Pty Ltd Assay for a health state
US7465544B2 (en) * 2006-01-11 2008-12-16 Wisconsin Alumni Research Foundation Synthetic cofactor analogs of S-adenosylmethionine as ligatable probes of biological methylation and methods for their use
US7695913B2 (en) 2006-01-11 2010-04-13 Genomic Health, Inc. Gene expression markers for colorectal cancer prognosis
DE602007014278D1 (de) * 2006-02-28 2011-06-16 Charite Universitaetsmedizin Nachweis und Qualitätskontrolle von Regulator-T-Zellen mittels DNA-Methylierungsanalyse des FoxP3-Gens
US7901882B2 (en) * 2006-03-31 2011-03-08 Affymetrix, Inc. Analysis of methylation using nucleic acid arrays
EP2471951A1 (de) * 2006-05-02 2012-07-04 University of Southhampton Vorhersage der kognitiven Entwicklung durch Genmethylierungsanalyse
US8084734B2 (en) * 2006-05-26 2011-12-27 The George Washington University Laser desorption ionization and peptide sequencing on laser induced silicon microcolumn arrays
WO2008096146A1 (en) 2007-02-07 2008-08-14 Solexa Limited Preparation of templates for methylation analysis
EP2644711A3 (de) * 2007-10-23 2013-12-11 Clinical Genomics Pty Ltd Verfahren zur Diagnose von Neoplasmen - II
EP2215250B1 (de) 2007-11-27 2013-02-27 Human Genetic Signatures Pty Ltd Enzyme zur amplifikation und zum kopieren bisulphit-modifizierter nukleinsäuren
EP2660337B1 (de) 2008-07-15 2016-09-14 Epigenomics AG Verfahren zur Vorhersage der Therapieprognose von Brustkrebs durch Analyse der Genmethylierung
EP2340314B8 (de) 2008-10-22 2015-02-18 Illumina, Inc. Erhaltung von informationen in verbindung mit genomischer dna-methylierung
US8110796B2 (en) 2009-01-17 2012-02-07 The George Washington University Nanophotonic production, modulation and switching of ions by silicon microcolumn arrays
US9490113B2 (en) * 2009-04-07 2016-11-08 The George Washington University Tailored nanopost arrays (NAPA) for laser desorption ionization in mass spectrometry
EP2470673B1 (de) 2009-08-28 2014-07-30 Cellular Dynamics International, Inc. Identifizierung von genetischen variationen bei betroffenem gewebe
US20140221229A1 (en) * 2011-04-28 2014-08-07 New York University Genomic signatures of metastasis in prostate cancer
KR20140064918A (ko) 2011-09-07 2014-05-28 휴먼 제네틱 시그너처스 피티와이 엘티디 분자 검출 분석법
EP2821487B1 (de) * 2012-02-29 2016-10-26 Sysmex Corporation Verfahren zur bestimmung des vorhandenseins oder nichtvorhandenseins von krebszellen aus einem hepatozellulären karzinom sowie bestimmungsmarker und kit
KR101302173B1 (ko) 2012-12-07 2013-08-30 이화여자대학교 산학협력단 Hmox1 유전자의 메틸화 변화를 이용한 알츠하이머 질환의 진단용 조성물 및 이를 이용한 알츠하이머 질환의 진단방법
US20140274757A1 (en) 2013-03-14 2014-09-18 Marie K. Kirby Differential Methylation Level of CpG Loci That Are Determinative of a Biochemical Reoccurrence of Prostate Cancer
CN106460050A (zh) * 2014-04-28 2017-02-22 西格马-奥尔德里奇有限责任公司 使用靶向核酸内切酶进行哺乳动物基因组的表观遗传修饰

Family Cites Families (27)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5744101A (en) * 1989-06-07 1998-04-28 Affymax Technologies N.V. Photolabile nucleoside protecting groups
US5474796A (en) * 1991-09-04 1995-12-12 Protogene Laboratories, Inc. Method and apparatus for conducting an array of chemical reactions on a support surface
EP0969103A3 (de) 1993-06-22 2004-01-02 Baylor College Of Medicine Nukleinsäure-Sequenzanalyse durch die Methode der parallelen Primerextension
US5837832A (en) 1993-06-25 1998-11-17 Affymetrix, Inc. Arrays of nucleic acid probes on biological chips
DE69433180D1 (de) * 1993-10-26 2003-10-30 Affymetrix Inc Felder von nukleinsaeuresonden auf biologischen chips
JPH09506253A (ja) 1993-11-30 1997-06-24 マクギル・ユニヴァーシティ Dnaメチルトランスフェラーゼの阻害
US5858661A (en) * 1995-05-16 1999-01-12 Ramot-University Authority For Applied Research And Industrial Development Ataxia-telangiectasia gene and its genomic organization
US5871917A (en) 1996-05-31 1999-02-16 North Shore University Hospital Research Corp. Identification of differentially methylated and mutated nucleic acids
US6017704A (en) 1996-06-03 2000-01-25 The Johns Hopkins University School Of Medicine Method of detection of methylated nucleic acid using agents which modify unmethylated cytosine and distinguishing modified methylated and non-methylated nucleic acids
US6251594B1 (en) * 1997-06-09 2001-06-26 Usc/Norris Comprehensive Cancer Ctr. Cancer diagnostic method based upon DNA methylation differences
DE19750172C1 (de) * 1997-11-12 1998-10-01 Deutsches Krebsforsch DNA mit Promotor-Aktivität für Zellzyklus-Gen
DE19754482A1 (de) * 1997-11-27 1999-07-01 Epigenomics Gmbh Verfahren zur Herstellung komplexer DNA-Methylierungs-Fingerabdrücke
EP1036202B1 (de) * 1997-12-05 2002-05-02 Max-Planck-Gesellschaft Zur Förderung Der Wissenschaften E.V. Verfahren zur identifikation von nucleinsäuren durch matrix-assistierte laser desorptions/ionisations massenspektrometrie
US6255293B1 (en) * 1998-07-24 2001-07-03 Yeda Research And Development Co., Ltd. Prevention of metastasis with 5-aza-2′-deoxycytidine
DE19905082C1 (de) * 1999-01-29 2000-05-18 Epigenomics Gmbh Verfahren zur Identifikation von Cytosin-Methylierungsmustern in genomischen DNA-Proben
US6331393B1 (en) * 1999-05-14 2001-12-18 University Of Southern California Process for high-throughput DNA methylation analysis
US6783933B1 (en) * 1999-09-15 2004-08-31 The Johns Hopkins University School Of Medicine CACNA1G polynucleotide, polypeptide and methods of use therefor
US7332275B2 (en) * 1999-10-13 2008-02-19 Sequenom, Inc. Methods for detecting methylated nucleotides
US20040029123A1 (en) * 2000-03-15 2004-02-12 Alexander Olek Diagnosis of diseases associated with the cell cycle
US20030148327A1 (en) 2000-04-06 2003-08-07 Alexander Olek Diagnosis of diseases associated with metastasis
US20040023230A1 (en) 2000-06-30 2004-02-05 Alexander Olek Method and nucleic acids for pharmacogenomic methylation analysis
DE10037769A1 (de) 2000-08-03 2002-02-21 Epigenomics Gmbh Diagnose von mit CD24 assoziierten Krankheiten
US6812339B1 (en) * 2000-09-08 2004-11-02 Applera Corporation Polymorphisms in known genes associated with human disease, methods of detection and uses thereof
DE10054972A1 (de) 2000-11-06 2002-06-06 Epigenomics Ag Diagnose von mit humos assoziierten Krankheiten
DE10054974A1 (de) 2000-11-06 2002-06-06 Epigenomics Ag Diagnose von mit Cdk4 assoziierten Krankheiten
DE10128508A1 (de) * 2001-06-14 2003-02-06 Epigenomics Ag Verfahren und Nukleinsäuren für die Differenzierung von Prostata-Tumoren
WO2003004696A3 (en) * 2001-07-02 2004-11-04 Epigenomics Ag A distributed system for epigenetic based prediction of complex phenotypes

Also Published As

Publication number Publication date Type
EP1274865A2 (de) 2003-01-15 application
WO2001081622A2 (en) 2001-11-01 application
WO2001077377A8 (en) 2002-02-28 application
WO2001077378A3 (en) 2002-10-17 application
US20040067491A1 (en) 2004-04-08 application
WO2001081622A8 (en) 2002-05-16 application
EP1278893A2 (de) 2003-01-29 application
JP2003531589A (ja) 2003-10-28 application
WO2001077377A2 (en) 2001-10-18 application
WO2001077376A2 (en) 2001-10-18 application
WO2001077164A8 (en) 2002-03-21 application
WO2001077164A2 (en) 2001-10-18 application
WO2001077375A2 (en) 2001-10-18 application
EP1274865B1 (de) 2007-02-14 grant
DE60126593D1 (de) 2007-03-29 grant
US20030162194A1 (en) 2003-08-28 application
EP1274866A2 (de) 2003-01-15 application
EP1370685A2 (de) 2003-12-17 application
US20050282157A1 (en) 2005-12-22 application
WO2001081622A3 (en) 2003-09-04 application
EP2014776A3 (de) 2009-04-01 application
US7195870B2 (en) 2007-03-27 grant
WO2001076451A3 (en) 2003-09-04 application
EP1360319A2 (de) 2003-11-12 application
EP1272670A2 (de) 2003-01-08 application
EP1268857A2 (de) 2003-01-02 application
US20030148326A1 (en) 2003-08-07 application
WO2001076451A9 (en) 2002-08-08 application
EP2014776A2 (de) 2009-01-14 application
WO2001092565A3 (en) 2002-09-06 application
JP2003534780A (ja) 2003-11-25 application
WO2001077375A8 (en) 2002-10-24 application
WO2001076451A2 (en) 2001-10-18 application
US20040076956A1 (en) 2004-04-22 application
US20030148327A1 (en) 2003-08-07 application
WO2001092565A2 (en) 2001-12-06 application
WO2001077376A3 (en) 2002-08-08 application
WO2001077164A3 (en) 2002-06-20 application
US20030082609A1 (en) 2003-05-01 application
WO2001077376A8 (en) 2002-03-21 application
JP2004508807A (ja) 2004-03-25 application
WO2001092565A8 (en) 2002-05-30 application
WO2001077375A3 (en) 2002-06-27 application
WO2001077378A2 (en) 2001-10-18 application
EP1268861A2 (de) 2003-01-02 application
WO2001077377A3 (en) 2002-07-11 application

Similar Documents

Publication Publication Date Title
Boström et al. Mutation of the PTEN (MMAC1) tumor suppressor gene in a subset of glioblastomas but not in meningiomas with loss of chromosome arm 10q
Bamshad et al. Mutations in human TBX3 alter limb, apocrine and genital development in ulnar-mammary syndrome
Pigny et al. Human mucin genes assigned to 11p15. 5: identification and organization of a cluster of genes
Nuell et al. Prohibitin, an evolutionarily conserved intracellular protein that blocks DNA synthesis in normal fibroblasts and HeLa cells.
Sklar et al. Family-based association study of 76 candidate genes in bipolar disorder: BDNF is a potential risk locus
Spritz et al. Dominant negative and loss of function mutations of the c-kit (mast/stem cell growth factor receptor) proto-oncogene in human piebaldism.
Xu et al. The neurofibromatosis type 1 gene encodes a protein related to GAP
Asher et al. Disruption of the architectural factor HMGI-C: DNA-binding AT hook motifs fused in lipomas to distinct transcriptional regulatory domains
Castilla et al. Mutations in the BRCA1 gene in families with early-onset breast and ovarian cancer
Putnam et al. Fibrillin–2 (FBN2) mutations result in the Marfan–like disorder, congenital contractural arachnodactyly
Komiya et al. Allelic losses at loci on chromosome 10 are associated with metastasis and progression of human prostate cancer
Ichii et al. Inactivation of both APC alleles in an early stage of colon adenomas in a patient with familial adenomatous polyposis (FAP)
Bunge et al. Molecular analysis and genetic mapping of the rhodopsin gene in families with autosomal dominant retinitis pigmentosa
Mori et al. Somatic mutations of the APC gene in colorectal tumors: mutation cluster region in the APC gene
van der Schroeff et al. Ras oncogene mutations in basal cell carcinomas and squamous cell carcinomas of human skin.
Kubota et al. Retinoblastoma gene mutations in primary human prostate cancer
Haber et al. An internal deletion within an 11p13 zinc finger gene contributes to the development of Wilms' tumor
Fairweather et al. Mutations in the connexin 32 gene in X-linked dominant Charcot-Marie-Tooth disease (CMTX1)
Hall et al. Closing in on a breast cancer gene on chromosome 17q.
De Raedt et al. Elevated risk for MPNST in NF1 microdeletion patients
Nishimura et al. A spectrum of FOXC1 mutations suggests gene dosage as a mechanism for developmental defects of the anterior chamber of the eye
Nakamura et al. p53 gene mutations associated with anaplastic transformation of human thyroid carcinomas
Kaghad et al. Monoallelically expressed gene related to p53 at 1p36, a region frequently deleted in neuroblastoma and other human cancers
Howells et al. Proenkephalin mRNA in rat heart
O'Sullivan et al. Activating point mutations of the gsp oncogene in human thyroid adenomas