DE10251918A1

DE10251918A1 - Inheritable integration of DNA into germ-line invertebrate cells, useful for large-scale production of transgenic insects, includes post-transformational removal of mobilizable elements to increase stability

Info

Publication number: DE10251918A1
Application number: DE2002151918
Authority: DE
Original assignee: Individual
Current assignee: Individual
Priority date: 2002-11-08
Filing date: 2002-11-08
Publication date: 2004-05-19
Also published as: WO2004044150A2; AU2003290660A1; WO2004044150A3; AU2003290660A8

Abstract

Method for generating an inheritable integration of DNA into the genome of germ-line and somatic cells of an invertebrate, where the integration contains homologous or heterologous DNA sequences and/or genes. Method for generating an inheritable integration of DNA into the genome of germ-line and somatic cells of an invertebrate, where the integration contains homologous or heterologous DNA sequences and/or genes. The new feature is that a post-transformational modification process is applied so that those DNA sequences of the integration that contain defined target sites for transposases and recombinases, and are derived originally from the transformation vector, are physically removed from the genome. An Independent claim is also included for genetically modified invertebrates produced by the new method.

Description

Die Erfindung bezieht sich auf neuartige methodische Vorgehensweisen zur Herstellung transgener Organismen (Transgenese). Der Schwerpunkt der Innovation beinhaltet technische Kunstgriffe zur Stabilisierung und sicheren Verankerung zuvor erfolgreich ins Zielgenom eingebrachter homologer oder heterologer DNS (im folgenden als Transgen bezeichnet). Hierzu wurden zwei Systeme an Transformationsvektoren entwickelt, die entweder Transposon-vermittelt oder Rekombinasevermittelt ein Transgen ins Zielgenom einschleusen und die Möglichkeit bieten, im Anschluß an die Keimbahntransformation mobilisierbare DNS-Bereiche zu entfernen. Stabile Transgen-Insertionen sind eine unverzichtbare Voraussetzung für die sichere Produktion gentechnisch modifizierter Organismen in großtechnischem Maßstab.The invention relates to new types methodical procedures for the production of transgenic organisms (Transgenesis). The focus of innovation includes technical Tricks for stabilization and secure anchoring previously successful homologous or heterologous DNA introduced into the target genome (in the following referred to as a transgene). Two systems of transformation vectors were used for this that either transposon-mediates or recombinase-mediates insert a transgene into the target genome and the possibility offer, following to remove the germline transformation of mobilizable DNA areas. Stable transgene insertions are an essential requirement for the safe production of genetically modified organisms in industrial scale Scale.

Der derzeitige Stand der Technik zur Herstellung transgener Insekten ist die Transposon-vermittelte Keimbahntransformation (KT), die auf der Mobilisierbarkeit von DNS-Transposons bzw. von diesen abgeleiteten Transformationsvektoren basiert. Den verschiedenen KT-Systemen ist folgendes Grundprinzip gemeinsam: Spender-DNS wird von einem Transgenvektor ins Genom des Zielorganismus (Keimbahnzellen) übertragen. Dieser Prozeß wird von einer Transposase (vom Helfervektor bereitsgestellt) katalysiert, welche Zielstellen der Spender-DNS erkennt und den von diesen Zielstellen eingeschlossenen Bereich ins Genom mobilisiert. Die Spender-DNS beinhaltet neben dem Transgen ein Transformationsmarkergen, dessen dominanter Phänotyp den Nachweis erfolgreicher KT ermöglicht.The current state of the art for the production of transgenic insects is the transposon-mediated germline transformation (KT), which are based on the mobilizability of DNA transposons or based on these derived transformation vectors. The different The following basic principle is common to KT systems: Donor DNS transferred from a transgene vector into the genome of the target organism (germline cells). This process will catalyzed by a transposase (provided by the helper vector), which destinations the donor DNS recognizes and those of these destinations included area mobilized into the genome. The donor DNS contains, in addition to the transgene, a transformation marker gene, the dominant phenotype enables the proof of successful KT.

Transposon-vermittelte KT-Methoden stehen heute für eine ganze Reihe von Insektenspezies zur Verfügung: P-Element-basierte Systeme haben die Genetik der Taufliege, Drosophila melanogaster, revolutioniert (1), konnten aber aufgrund der Abhängigkeit der P-Elemente von Drosophila-endogenen Wirtsfaktoren (2) nicht außerhalb drosophilider Insekten eingesetzt werden. Medizinisch oder ökonomisch bedeutsamere Insektenspezies wurden daher unter Verwendung wirtsunabhängiger „Breitband"-Transposontypen transformiert (3). Auf piggyBac-(4), Hermes-(5), Minos-(6) oder Mariner-(7) basierende Systeme der Transgenese stellen gegenwärtig die Technologieplattform zur gentechnischen Modifikation von Schad- und Nutzinsekten dar: Zu diesen zählen u.a. malariaübertragende anopheline oder culicine Mosquitos (8, 9), das Gelbfiebermosquito, Aedes aegypti (10, 11), die Mittelmeerfruchtfliege, Ceratitis capitata (12), oder der Seidenspinner, Bombyx mori (13). Das Anwendungspotential dieser Breitband-Transposons ist jedoch keineswegs auf Insekten beschränkt: Mariner-abgeleitete Transformationsvektoren integrierten stabil in der Keimbahn des Fadenwurms, Caenorhabditis elegans (14), des Zebrafisches, Danio rerio (15), und des Huhns, Gallus spp. (16).Transposon-mediated KT methods stand for today a whole range of insect species are available: P-element based systems have revolutionized the genetics of the fruit fly, Drosophila melanogaster (1), could, however, because of the addiction the P elements of Drosophila endogenous host factors (2) are not outside drosophilid insects are used. Medically or economically more significant insect species were therefore made using host-independent "broadband" transposon types transformed (3). On piggyBac- (4), Hermes- (5), Minos- (6) or Mariner (7) based systems of transgenesis are currently the Technology platform for the genetic modification of harmful and beneficial insects: These include malaria-transmitting anopheline or culicine mosquitos (8, 9), the yellow fever mosquito, Aedes aegypti (10, 11), the Mediterranean fruit fly, Ceratitis capitata (12), or the silk spinner, Bombyx mori (13). The application potential however, this broadband transposon is by no means insect limited: Mariner-derived Transformation vectors stably integrated in the germline of the Roundworm, Caenorhabditis elegans (14), Zebrafish, Danio rerio (15), and the chicken, Gallus spp. (16).

Zum Nachweis erfolgreicher KT sind sowohl spezies-spezifische als auch spezies-unabhängige Transformationsmarker etabliert worden (17). Letztere besitzen den Vorteil der Übertragbarkeit auf verschiedene Zielspezies und konstituieren sich aus einem evolutionär konservierten Promotor, der die Expression eines fluoreszierenden Markerproteingens steuert (GFP [Grün Fluoreszierendes Protein] und Derivate oder DsRed, (18)). Als konservierte Promotorelemente in spezies-unabhängigen Transformationsmarkergenen fanden der polyubiquitin-(19) sowie der „ 3xP3"-(20)-Promotor bislang weitestgehende Anwendung.To prove successful KT are both species-specific and species-independent transformation markers been established (17). The latter have the advantage of portability to different target species and are constituted from an evolutionarily conserved Promoter that expresses a fluorescent marker protein gene controls (GFP [green Fluorescent Protein] and derivatives or DsRed, (18)). As preserved Promoter elements in species-independent transformation marker genes So far, the polyubiquitin (19) and the "3xP3" (20) promoter have largely been found Application.

Eine Transposon-unabhängige Technik, um gerichtet Spender-DNS ins Genom von Zellen einzuführen, macht sich das Prinzip der ortsspezifischen Rekombination zunutze: Diese Methode basiert auf einem Rekombinase-Enzym und zwei korrespondierenden heterospezifischen Zielstellen. Nach Markierung des Genoms mit einer DNS-Kasette (i.d.R. ein Positiv-Negativ-Selektionsmarkersystem tragend), kann die Spender-DNS, welche von zur genomischen DNS-Kasette identischen heterospezifischen Zielstellen flankiert ist, Rekombinase-vermittelt gerichtet an den markierten Locus gebracht werden. Dieses Prinzip wird als Rekombinase-vermittelter Kasettenaustausch (engl. RMCE für recombinase mediated cassette exchange) bezeichnet (21, 22). Die Funktionalität der DNS-Kasettenaustauschsysteme wurde in verschiedenen Zelllinien (darunter auch murine embryonale Stammzellen) sowohl unter Verwendung der FLP-Rekombinase und heterospezifischer FRT-Zielstellen (23, 24, 25) als auch unter Verwendung der Cre-Rekombinase und heterospezifischer loxP-Zielstellen (26) demonstriert. RMCE fand bislang zur Generierung transgener Invertebraten-Organismen keine Anwendung und es sei an dieser Stelle darauf hingewiesen, daß sich (zumindest dem Autor zugängliche) Patentschriften ausdrücklich auf Vertebratenzellen oder Vertebratenorganismen beziehen (27).A transposon-independent technique to target donor DNA into the cell genome takes advantage of the principle of site-specific recombination: this Method is based on one recombinase enzyme and two corresponding ones heterospecific target locations. After marking the genome with a DNA cassette (usually carrying a positive-negative selection marker system), can the donor DNA, which is identical to the genomic DNA cassette flanked heterospecific target sites, recombinase-mediated brought to the marked locus. This principle is used as a recombinase-mediated cassette exchange (RMCE for recombinase mediated cassette exchange) (21, 22). The functionality of the DNS cartridge exchange systems has been found in various cell lines (including murine embryonic Stem cells) both using the FLP recombinase and heterospecific FRT targets (23, 24, 25) as well as using Cre recombinase and heterospecific loxP targets (26). RMCE has so far not found any to generate transgenic invertebrate organisms Application and it should be noted at this point that (at least patent documents accessible to the author expressly refer to vertebrate cells or vertebrate organisms (27).

Mit dem Stand der Technik verbundene ProblemeWith the booth problems related to technology

Transposon-basierte Vektoren haben sich als effiziente Werkzeuge zur Herstellung transgener Insekten für Forschungszwecke im Labormaßstab bewährt. Das dabei zugrundeliegende Mobilisierungsprinzip kann jedoch im industriellen Produktionsmaßstab gravierende Nachteile mit sich bringen, welche die Stabilität genomischer Transgen-Insertionen und, damit verbunden, Aspekte der Sicherheit potentiell freizusetzender gentechnisch veränderter Insekten betreffen.Have transposon based vectors themselves as efficient tools for producing transgenic insects for research purposes on a laboratory scale proven. The underlying principle of mobilization can, however industrial production scale bring serious disadvantages with it, the stability of genomic Transgene insertions and related safety aspects potentially releasing genetically modified insects.

Stabilität genomischer Transgen-Insertionen im industriellen ProduktionsmaßstabStability of genomic Transgenic insertions on an industrial scale

Transgene vermitteln dem transformierten Organismus einen Selektionsnachteil, zum einen aufgrund der Mutation am genomischen Transgen-Insertionslocus, zum anderen aufgrund der spezifisch von ihrer Nukleotidsequenz kodierten Gen-Produkte (Fälle, bei denen das Transgen selbst einen Positiv-Selektionsmarker darstellt, z.B. ein Pestizidresistenzgen, sind von dieser Feststellung ausgenommen). Der gentechnisch veränderte Organismus ist daher im Vergleich zum wildtypischen geschwächt und kann seine ursprüngliche Kompetitivität („fitness") nur durch Selektion gegen das Transgen wiedererlangen. Eine Möglichkeit des Transgenverlustes besteht in der Remobilisierung zu einem neuen genomischen Locus. Dies erfordert die Aktivität der zu den Zielstellen korrespondierenden Transposase. Zwar ist die im Prozeß der Keimbahntransformation eingesetzte Transposase in der Regel im Zielorganismus nicht genomisch kodiert, Kreuzreaktionen der Zielstellen mit artverwandten Transposasen sind jedoch möglich. Diese führten z.B. zu einer signifikanten Instabilität von Hermes-Transgen-Insertionen in hobo-haltigen Drosophila-Stämmen (28). Familien transposabler Elemente wie z.B. die mariner/Tel Superfamilie zählen viele Mitglieder (29), deren Kreuzmobilisierungspotential weitgehend unbekannt ist. Ein Herstellungsverfahren, das Remobilisierungen a priori ausschließt, ist daher wegen der gewährleisteten Transgen-Stabilität den heute verfügbaren KT-Methoden überlegen.Transgenes mediate the transformed Organism a selection disadvantage, on the one hand due to the mutation at the genomic transgene insertion locus, on the other hand due to the Gene products encoded specifically by their nucleotide sequence (cases in which the transgene itself is a positive selection marker, e.g. on Pesticide resistance genes are exempt from this finding). The genetically modified The organism is therefore weakened compared to the wild type can be its original competitivity ("Fitness") only by selection against regaining the transgene. A way of transgene loss consists in the remobilization to a new genomic locus. This requires activity the transposase corresponding to the target sites. Although is those in the process of Germline transformation transposase usually used in the target organism not genomically coded, cross-reactions of the target sites with related species However, transposases are possible. These led e.g. significant instability of Hermes transgene insertions in Drosophila strains containing hobo (28). Families of transposable elements such as the mariner / tel superfamily counting many members (29) whose cross-mobilization potential is largely is unknown. A manufacturing process called remobilizations excludes a priori, is therefore because of the guaranteed Transgene stability the ones available today Consider KT methods.

Untersuchungen zur Stabilität einer Transgen-Insertion bei der Insektenzucht in industriellem Maßstab liegen nach dem Erkenntnisstand des Autors bislang nicht vor. Stellvertretend dafür kann jedoch die Datenlage für klassisch genetisch selektierte und im industriellen Maßstab produzierte Insektenstämme betrachtet werden: So erwiesen sich z.B. Stämme der Mittelmeerfruchtfliege, die auf eine Translokation mit einem rezessiven Merkmal gezüchtet wurden (30) als nicht hinreichend stabil: Rekombinationsereignisse mit der Folge der Reversion des gezüchteten Merkmals traten mit einer Frequenz von 10^–3 – 10^–4 auf (31). Da das Merkmal dem Insekt einen selektiven Nachteil verleiht, setzten sich Reversionsereignisse im Zuchtstamm rasant durch und ließen diesen zusammenbrechen. Interessanterweise kam dieser Nachteil im kleinen Labormaßstab nicht zur Ausprägung, erwies sich dann aber bei der industriellen Anwendung als inakzeptabel. Erst erhebliche weitere Forschungsanstrengungen, die u.a. die Entwicklung eines aufwendigen (arbeits- und kostenintensiven) Qualitätssicherungs-Systems einschlossen (32), ermöglichten schließlich die erfolgreiche industrielle Zucht dieses Stammes im Produktionsmaßstab von 10⁶ – 10⁷ Individuen pro Woche (31).According to the author's knowledge, studies on the stability of a transgene insertion in insect breeding on an industrial scale have so far not been available. The data available for classically genetically selected and industrial-scale insect strains can be used as a representative example: strains of the Mediterranean fruit fly, which were bred for a translocation with a recessive trait (30), proved to be insufficiently stable: recombination events with the consequence of Reversion of the cultured trait occurred at a frequency of 10 ^-3 - 10 ^-4 (31). Since the trait gives the insect a selective disadvantage, reversion events in the breeding line quickly became established and caused them to collapse. Interestingly, this disadvantage did not occur on a small laboratory scale, but then turned out to be unacceptable in industrial use. Only considerable further research efforts, which included the development of a complex (labor and cost-intensive) quality assurance system (32), finally enabled the successful industrial breeding of this strain on a production scale of 10 ⁶ - 10 ⁷ individuals per week (31).

Sicherheitsaspekte bei der Freisetzung gentechnisch modifizierter Insektensafety aspects in the release of genetically modified insects

Die industrielle Anwendung der Transgentechnologie schließt ausdrücklich die Freisetzung gentechnisch modifizierter Insekten ein. Daher kommt der Sicherheitsthematik eine nicht zu unterschätzende Bedeutung zu (33). Sicherheit bedeutet in erster Linie, daß das Risiko der Transmission des Transgens auf andere pro- oder eukaryontische Spezies minimiert wird. Horizontaler Transgentransfer kann zwar per se nicht ausgeschlossen werden, da die Vielzahl an Mechanismen des Nukleinsäureaustauschs zwischen Spezies nicht hinreichend erforscht ist. Das Rest-Risiko dieser Transmissionsart ist jedoch um so geringer, je weniger mobile Transposon-DNA-Abschnitte im Anschluß an den Prozeß der KT im Genom zurückbleiben. Es ist die ausdrückliche Zielsetzung der in dieser Schrift offenbarten Transformationssysteme, einen wesentlichen Beitrag zur Minimierung dieses Rest-Risikos zu leisten. Dabei ist der Autor der festen Überzeugung, daß Transformationssysteme, die einen höheren Sicherheitsstandard gewährleisten, sich nicht nur durchsetzen werden, sondern sogar obligat werden für die Genehmigung kommerzieller Anwendungen auf diesem Gebiet, da ein erhöhter Sicherheitsstandard von regulatorischen Instanzen zur Norm erhoben werden wird.The industrial application of transgenic technology includes expressly the release of genetically modified insects. Hence comes the security issue is not to be underestimated (33). safety means primarily that Risk of transmission of the transgene to other pro- or eukaryotic Species is minimized. Horizontal transgene transfer can cannot be ruled out per se since the multitude of mechanisms of nucleic acid exchange has not been adequately researched between species. The rest of the risk however, the less mobile transposon DNA sections, the smaller this type of transmission in connection to the process of KT remain in the genome. It is the express one Objective of the transformation systems disclosed in this document, make a significant contribution to minimizing this residual risk Afford. The author is firmly convinced that transformation systems, the higher one Ensure safety standard, Not only will they prevail, they will even become mandatory for the Approval of commercial applications in this area since a increased Safety standard raised to standard by regulatory bodies will be.

Der Lösungsansatz: Post-transformationelle Immobilisierung von TransgenenThe solution: post-transformational Immobilization of transgenes

Aus den dargelegten Nachteilen des Stands der Technik ergibt sich die Notwendigkeit der Neukonzipierung und Optimierung von KT-Systemen mit der Zielsetzung, eine stabile Verankerung von Transgen-DNS im Ziel-Genom zu ermöglichen. Die Herausforderung besteht also darin, ein Transformationssystem dergestalt zu konstruieren, daß eine Remobilisierung zuvor genomisch integrierter Transgene effizient unterbunden wird. Die hier offenbarte Grundidee ist, die intakten, das Transgen flankierenden Transposase-Zielstellen post-transformationell zu entfernen. Im folgenden werden zwei Ausgestaltungen beschrieben, welche i.) Veränderungen der im Genom der Zielspezies integrierten Transgen-DNS zulassen; ii.) Veränderungen ermöglichen, die zur post-transformationellen Inaktivierung (mindestens) einer Zielstelle führen und iii.) diese Inaktivierung über physikalische Entfernung der Zielstellen-DNS-Sequenz aus dem Genom des transformierten Organismus vermitteln. Die erste hier offenbarte Ausgestaltung, als „konditional exzisionskompetente Transformationsvektoren (1)" bezeichnet, basiert auf einem Transformationsvektor, der zusätzlich zu den gegenwärtig verwendeten eine von entgegengesetzten Rekombinase-Zielstellen eingerahmte Transposon-Halbseite trägt: TransposonR'. Nach einer dem Stand der Technik entsprechenden Transposon-vermittelten KT (Schritt 1 in 1) und der Identifikation einer genomischen Transgen-Insertion wird die TransposonR'-DNS Rekombinase-vermittelt invertiert (Schritt 2 in 1). Diese Inversion ordnet die Halbseite zur stromabwärts liegenden Halbseite TransposonL dergestalt an, daß die zu den Zielstellen korrespondierende Transposase den von diesen Zielstellen eingeschlossenen DNS-Bereich remobilisieren kann. Erfolgreiche Transposase-vermittelte Remobilisierung und physikalische Deletion des Bereichs zwischen TransposonR' und TransposonL (Schritt 3 in 1) werden durch den Verlust des zweiten Transformationsmarkers (schräg gestrichelt markiert in 1) indiziert. Die Präsenz des ersten Transformationsmarkers (grau punktiert in 1) hingegen stellt sicher, daß eine mögliche Nebenreaktion, die Remobilisierung des gesamten Transgenkonstruktes (zwischen TransposonR und TransposonL), nicht stattgefunden hat. Im Ergebnis liegt eine Transgen-Insertion vor, die lediglich von einer einzigen Transposonhalbseite flankiert ist und infolgedessen immobilisiert und hinsichtlich enzymatischer Transposaseaktivität resistent gemacht worden ist.The disadvantages of the prior art set out necessitate the need to redesign and optimize KT systems with the aim of permitting stable anchoring of transgene DNA in the target genome. The challenge is to construct a transformation system in such a way that the remobilization of previously genomically integrated transgenes is efficiently prevented. The basic idea disclosed here is to remove the intact transposase target sites flanking the transgene post-transformationally. Two configurations are described below, which i.) Allow changes in the transgene DNA integrated in the genome of the target species; ii.) enable changes which lead to post-transformational inactivation of (at least) one target site and iii.) mediate this inactivation by physically removing the target site DNA sequence from the genome of the transformed organism. The first embodiment disclosed here, as "conditional excision-competent transformation vectors ( 1 ) ", is based on a transformation vector which, in addition to those currently used, bears a transposon half framed by opposite recombinase target sites: Trans posonR '. According to a transposon-mediated KT corresponding to the state of the art (step 1 in 1 ) and the identification of a genomic transgene insertion, the TransposonR'-DNA recombinase-mediated is inverted (step 2 in 1 ). This inversion arranges the half-side to the downstream half-side TransposonL such that the transposase corresponding to the target sites can remobilize the DNA region enclosed by these target sites. Successful transposase-mediated remobilization and physical deletion of the area between TransposonR 'and TransposonL (step 3 in 1 ) are marked by the loss of the second transformation marker (diagonally dashed in 1 ) indicated. The presence of the first transformation marker (dotted gray in 1 ), on the other hand, ensures that a possible side reaction, the remobilization of the entire transgene construct (between TransposonR and TransposonL), has not occurred. The result is a transgene insertion which is flanked only by a single half of the transposon and has consequently been immobilized and made resistant to enzymatic transposase activity.

Von dieser Ausgestaltung in den Einzelschritten grundsätzlich verschieden aber im Ergebnis sehr ähnlich ist ein Rekombinase-vermitteltes KT-System, das hier als „RMCE mit anschließender Transposondeletion (2)" bezeichnet wird. Hierbei wird die eigentliche KT nicht Transposase-, sondern Rekombinase-vermittelt durchgeführt, indem eine zu den heterospezifischen Zielstellen korrespondierende Rekombinase einen DNS-Kasettenaustausch vornimmt: Eine erfolgreiche Reaktion wird durch den Austausch von Transformationsmarker 1 (grau punktiert in 2) gegen Transformationsmarker 2 (schräg gestrichelt markiert in 2) indiziert, wobei lediglich das offene Leseraster der beiden Markergene ausgetauscht wird (Schritt 1 in 2). Dies ist insofern bedeutsam, da das Markergen im RMCE-Donorplasmid promotorlos ist und infolgedessen genomische Integrationsereignisse des Donors, die nicht auf Kasettenaustausch beruhen (Nebenreaktionen), unerkannt bleiben. Ein als „Zielsteuerungssequenz" bezeichneter zwischen Akzeptor und Donor identischer DNS-Bereich erhöht die Effizienz der Paarung zwischen Akzeptor und Donor-DNS und damit die Wahrscheinlichkeit des RMCE. Dieses Prinzip, Transgene via RMCE effizient in das Genom von Zellen einzuschleusen, stellt eine völlig neuartige Methodik der Keimbahntransformation von Invertebraten dar und geht erheblich über den Stand bisher beschriebener RMCE-Technik (23, 24, 25) hinaus. Da über die Akzeptorkasette auch eine Transposon-Halbseitensequenz, TransposonR', einrekombiniert wird, wird nach erfolgtem DNS-Kasettenaustausch eine „internes" Transposon rekonstituiert, das ähnlich oben beschriebener Methodik Transposasevermittelt mobilisiert werden kann (Schritt 2 in 2). Im Ergebnis liegt auch hier eine immobilisierte und daher stabile Transgen-Insertion vor.A recombinase-mediated KT system is fundamentally different from this configuration in the individual steps, but the result is very similar. 2 ) ". The actual KT is not transposase-mediated, but rather recombinase-mediated, in that a recombinase corresponding to the heterospecific target sites carries out a DNA cassette exchange: A successful reaction is achieved by exchanging transformation marker 1 (dotted gray in 2 ) against transformation marker 2 (diagonally dashed marked in 2 ) is indicated, whereby only the open reading frame of the two marker genes is exchanged (step 1 in 2 ). This is important because the marker gene in the RMCE donor plasmid is promoterless and, as a result, genomic integration events of the donor that are not based on cassette exchange (side reactions) remain undetected. A DNA region called the “targeting sequence” which is identical between the acceptor and donor increases the efficiency of the pairing between acceptor and donor DNA and thus the probability of RMCE. This principle of efficiently introducing transgenes into the genome of cells via RMCE represents a completely new kind The method of germline transformation of invertebrates and goes far beyond the state of the RMCE technology described previously (23, 24, 25). Since a transposon half-side sequence, TransposonR ', is also recombined via the acceptor cassette, a " internal "transposon reconstituted, which can be mobilized mediated similarly to the methodology described above (step 2 in 2 ). As a result, there is also an immobilized and therefore stable transgene insertion.

Beispiel 1: Konditional exzisionskompetente TransformationsvektorenExample 1: Conditional excision-competent transformation vectors

Der Aufbau des konditional exzisionskompetenten Transformationsvektors, pBac_STBL, sowie die experimentellen Schritte sind schematisch in 3 dargestellt. Der Vektor pBac_STBL wurde basierend auf dem Transposontyp „piggyBac" (34) konstruiert. Klassische piggyBac-Transformationsvektoren (35, 36, 37) konstituieren sich aus piggyBac-Halbseiten oder Teilen davon, die ein Transformationsmarkergen sowie Klonierstellen für zu inserierende Transgen-DNS beinhalten. Als entscheidendes neu hinzugefügtes Merkmal trägt pBac STBL eine weitere piggyBacR'-Halbseite, die von entgegengesetzt-orientierten FRT (Flp Recombinase Target)-Zielstellen eingeschlossenen ist (siehe 3). piggyBacR' ist entgegengesetzt zur stromaufwärts liegenden piggyBacR-Halbseite orientiert, so daß eine Mobilisierung mit den außen liegenden piggyBac Enden mechanistisch nicht möglich sein sollte. Zudem enthält der Transformationsvektor zur Insertion von Transgen-DNS die Klonierstellen für die seltenen oktamerspezifischen Restriktionsenzyme AscI und FseI. pBac_STBL ist mit zwei universellen Transformationsmarkergenen (38, 17) ausgestattet, von denen das eine (3xP3-EYFP; markiert „1" in 3) stromaufwärts der AscI/FseI-Klonierstellen und das andere (3xP3-DsRed; markiert „ 2" in 3) stromabwärts der FRT-Zielstellen liegt. Im folgenden sind die Details der Klonierungsschritte des finalen Transformationsvektors pBac STBL, zurückverfolgbar auf bereits publizierte Plasmide, offenbart:The structure of the conditional excision-competent transformation vector, pBac_STBL, and the experimental steps are shown schematically in 3 shown. The vector pBac_STBL was constructed based on the transposon type "piggyBac" (34). Classic piggyBac transformation vectors (35, 36, 37) are composed of piggyBac half pages or parts thereof which contain a transformation marker gene and cloning sites for transgene DNA to be inserted. As a crucial newly added feature, pBac STBL has another piggyBacR 'half-page, which is enclosed by oppositely-oriented FRT (Flp Recombinase Target) target sites (see 3 ). piggyBacR 'is oriented opposite to the upstream side of the piggyBacR, so that mobilization with the outer ends of the piggyBac should not be mechanically possible. In addition, the transformation vector for the insertion of transgene DNA contains the cloning sites for the rare octamer-specific restriction enzymes AscI and FseI. pBac_STBL is equipped with two universal transformation marker genes (38, 17), one of which (3xP3-EYFP; marks "1" in 3 ) upstream of the AscI / FseI cloning sites and the other (3xP3-DsRed; marked "2" in 3 ) is downstream of the FRT targets. The details of the cloning steps of the final transformation vector pBac STBL, traceable to plasmids that have already been published, are disclosed below:

pSL-3xP3-DsRedaf:pSL-3xP3-DsRedaf:

Im Plasmid pSL-3xP3-EGFPaf (36) wurde über SalI-NotI der kodierende Bereich für EGFP (0,7 kb) ausgeschnitten und das offene Leseraster von DsRed (0.8 kb), erhalten über SalI-NotI-Restriktion aus pDsRed l-1 (Clontech, Palo Alto, CA), kloniert.In the plasmid pSL-3xP3-EGFPaf (36), SalI-NotI the coding area for EGFP (0.7 kb) cut out and the open reading frame from DsRed (0.8 kb), received from SalI-NotI restriction from pDsRed l-1 (Clontech, Palo Alto, CA), cloned.

pSLfaFRTfa:pSLfaFRTfa:

Die FRT-Sequenz (90 bp) wurde über SalI-Asp718 aus pSL>AB> (39) präpariert und in das mit XhoI-Asp718 geschnittene Plasmid pSLfa1180fa (36) kloniert. Die FRT-Sequenz entspricht dabei dem Substrat der Flp-Rekombinase nach (40):
TTGAAGTTCCTATTCCGAAGTTCCTATTCTCTAGAAAGTATAGGAACTTCAGAGCGCTTTTGAAGCTThe FRT sequence (90 bp) was prepared from SalS-Asp718 from pSL>AB> (39) and included in the XhoI-Asp718 cut plasmid pSLfa1180fa (36) cloned. The FRT sequence corresponds to the substrate of the Flp recombinase according to (40):
TTGAAGTTCCTATTCCGAAGTTCCTATTCTCTAGAAAGTATAGGAACTTCAGAGCGCTTTTGAAGCT

pSL-3xP3-DsRed-FRT:pSL-3xP3-DsRed-FRT:

Das Plasmid pSLfaFRTfa wurde durch EcoRI-Asp718-Restriktion geöffnet. An diese Stelle wurde das EcoRI-BsiWI-Fragment (1,0 kb) aus pSL-3xP3-DsRedaf kloniert, das das DsRed-Leseraster unter 3xP3-Promotorkontrolle enthält.The plasmid pSLfaFRTfa was by EcoRI-Asp718 restriction opened. At this point the EcoRI-BsiWI fragment (1.0 kb) from pSL-3xP3-DsRedaf cloned that the DsRed reading frame under 3xP3 promoter control contains.

pSL-3xP3-DsRed-FRT-FRT:pSL-3xP3-DsRed-FRT FRT:

In das Plasmid pSL-3xP3-DsRed-FRT, geöffnet mit BfrI-SpeI, wurde das BfrI-SpeI nachgeschnittene PCR-Amplifikat der FRT-Sequenz (template: pSL>AB>; Oligonukleotid-Primer: CH_FRT_F 5'-GAGCTTAAGGGTACCCGGGGATCTTG-3' und CH_FRT_R 5'-GACTAGTCGATATCTAGGGCCGCCTAGCTTC-3') eingefügt. In diesem Vektor sind beide FRT-Sequenzen entgegengesetzt zueinander orientiert.In the plasmid pSL-3xP3-DsRed-FRT, open with BfrI-SpeI, the BfrI-SpeI was trimmed PCR amplificate the FRT sequence (template: pSL> AB>; oligonucleotide primer: CH_FRT_F 5'-GAGCTTAAGGGTACCCGGGGATCTTG-3 'and CH_FRT_R 5'-GACTAGTCGATATCTAGGGCCGCCTAGCTTC-3') added. In this Both FRT sequences are vector oriented opposite to each other.

pSL-3xP3-DsRed-FRT-pBacR'-FRT:pSL-3xP3-DsRed-FRT FRT pBacR':

Die 3' Halbseite der piggyBac Transposon-DNS, pBacR, wurde als 1,3 kb HpaI-EcoRV-Fragment aus dem Plasmid p3E1.2 (34) präpariert und in den mit EcoRV geöffneten Vektor pSL-3xP3-DsRed-FRT-FRT eingefügt. Die Insertion wurde in der Orientierung gewählt, in der die inserierte Halbseite entgegengesetzt zum DsRed-Leseraster steht. Eine EcoRV-Schnittstelle entsteht wieder am 5'-Ende der Insertionsstelle.The 3 'half page of the piggyBac transposon DNA, pBacR was generated as a 1.3 kb HpaI-EcoRV fragment from plasmid p3E1.2 (34) prepared and in those opened with EcoRV Vector pSL-3xP3-DsRed-FRT-FRT inserted. The insertion was chosen in the orientation in which the inserted Half page opposite to the DsRed reading frame. An EcoRV interface arises again at the 5 'end the insertion point.

pBac STBL:pBac STBL:

In den mit BglII geöffneten (Schnittstelle mit Klenow-Enzym aufgefüllt) universellen Transformationsvektor pBac-3xP3-EYFPaf (36) wurde das 2,7 kb EcoRI-BfrI-Fragment (beide Schnittstellen aufgefüllt) aus dem Plasmid pSL-3xP3-DsRed-FRT-pBacR'-FRT eingesetzt. Die Insertion wurde in der Orientierung gewählt, in der das DsRed-Gen entgegengesetzt zur Leserichtung des EYFP-Gens steht. In diesem Vektor steht die zusätzlich eingefügte, zweite piggyBac-Halbseite, pBacR', in entgegengesetzter Orientierung zur stromaufwärts des EYFP-Gens liegenden pBacR-Sequenz (siehe 3).In the universal transformation vector pBac-3xP3-EYFPaf (36) opened with BglII (interface filled with Klenow enzyme) (2.7), the 2.7 kb EcoRI-BfrI fragment (both interfaces filled) from the plasmid pSL-3xP3-DsRed-FRT- pBacR'-FRT used. The insertion was chosen in the orientation in which the DsRed gene is opposite to the reading direction of the EYFP gene. In this vector, the additionally inserted, second piggyBac half-page, pBacR ', is in the opposite orientation to the pBacR sequence located upstream of the EYFP gene (see 3 ).

Da in pBac_STBL beide Transformationsmarkergene mit entgegengesetzt orientierten SV40polyA-Sequenzen ausgestattet sind, ist die Plasmidamplifikation im Wirt E. coli erschwert. Daher wurden in hier nicht weiter beschriebenen Varianten des finalen Vektors die SV40polyA-Sequenz des EYFP-Gens gegen polyA-Sequenzen anderer Gene ausgetauscht.Because in pBac_STBL both transformation marker genes are equipped with oppositely oriented SV40polyA sequences Plasmid amplification in the host E. coli is difficult. Therefore in Variants of the final vector not further described here SV40polyA sequence of the EYFP gene exchanged for polyA sequences of other genes.

Helferplasmid:helper:

Das zur KT mit pBac_STBL verwendete Helferplasmid, phspBac ist publiziert in (35).The one used for KT with pBac_STBL Helper plasmid, phspBac is published in (35).

Experimentelle Schritte zur Transgenimmobilisierung (siehe 1 und 3)Experimental steps for transgene immobilization (see 1 and 3 )

a.) Keimbahntransformation von pBac STBL (Schritt 1 in 1 und 3)a.) Germ line transformation of pBac STBL (step 1 in 1 and 3 )

Der von piggyBacR und piggyBacL-Enden eingeschlossene DNS-Bereich in pBac_STBL (bzw. Transgen-beladener Derivate dieses Vektors) wird mittels piggyBac-vermittelter Keimbahntransformation (35, 36) ungerichtet im Drosophila-Genom (in Zellen der Keimbahn) integriert.That of piggyBacR and piggyBacL ends included DNS area in pBac_STBL (or transgene-laden Derivatives of this vector) is by means of piggyBac-mediated germline transformation (35, 36) undirected in the Drosophila genome (in germline cells) integrated.

b.) Flp-Rekombinase-induzierte Inversion (Schritt 2 in 1 und 3)b.) Flp recombinase-induced inversion (step 2 in 1 and 3 )

Genomische Transgen-Insertionen sind aufgrund der EYFP und DsRed-Augenfluoreszenz identifizierbar (36, 17). Der Etablierung bzgl. der Transgen-Insertion homozygoter Drosophila-Linien schließt sich der Schritt der Flp-Rekombinase-induzierten Inversion des von entgegengesetztorientierten FRTs eingeschlossenen DNS-Bereichs an: Dies kann durch Einkreuzen des β2t-FLP-Stammes geschehen (41), der die Flp-Rekombinase während der Spermatogenese exprimiert. Auf alternative Möglichkeiten dieses Schrittes, z.B. die Verwendung von hsp70-FLP bzw. hsFLP-Stämmen (41) oder von Khsp82-FLP-Stämmen oder die Mikroinjektion des Flp-Rekombinasekodierende Plasmids pKhsp82-FLP (siehe S. 11) in Präblastodermembryonen der bzgl. der Transgen-Insertion homozygot etablierten Linien sei explizit hingewiesen. Das Inversionsereignis selbst kann aufgrund der Markerausstattung der pBac_STBL-Vektoren nicht identifiziert werden, jedoch ist aufgrund der hohen Flp-Rekombinase-Aktivität die Einstellung eines statistischen Gleichgewichts zwischen Ausgangszustand und Inversion anzunehmen.Genomic transgene insertions can be identified based on EYFP and DsRed eye fluorescence (36, 17). The establishment of the transgene insertion of homozygous Drosophila lines is followed by the step of flp recombinase-induced inversion of the DNA region enclosed by oppositely oriented FRTs: this can be done by crossing in the β2t-FLP strain (41), which is the Flp recombinase expressed during spermatogenesis. On alternative possibilities of this step, e.g. the use of hsp70-FLP or hsFLP strains (41) or of Khsp82-FLP strains or the microinjection of the flp recombinase-encoding plasmid pKhsp82-FLP (see p. 11) in pre-blastodermembryons of the resp. the transgene insertion of homozygously established lines is explicitly pointed out. The inversion event itself cannot be identified due to the marker configuration of the pBac_STBL vectors, but is on assuming the establishment of a statistical equilibrium between initial state and inversion due to the high Flp recombinase activity.

c.) piggyBac-Transposase induzierte Deletion (Schritt 3 in 1 und 2)c.) piggyBac transposase induced deletion (step 3 in 1 and 2 )

Linien mit potentiell invertierten Transgen-Insertionen werden mit einem piggyBac-Transposaseexprimierenden, sog. „Jumpstarter"-Stamm gekreuzt. Hierzu eignet sich z.B. der Drosophila Stamm Her{3xP3-ECFP, αtub-piggyBacK10} (42). Nachkommen dieser Kreuzung, die sowohl EYFP/DsRed-(indikativ für pBac_STBL) als auch ECFP-Augenfluoreszenz (indikativ für den Jumpstarter) zeigen, werden einzeln ausgekreuzt.Lines with potentially inverted Transgene insertions are performed with a piggyBac transposase expressing so-called "Jumpstarter" strain crossed. For this, e.g. the Drosophila strain Her {3xP3-ECFP, αtub-piggyBacK10} (42). Descendants of this cross that both EYFP / DsRed- (indicative of pBac_STBL) as well as ECFP eye fluorescence (indicative of the jump starter), are crossed out individually.

d.) Identifizierung immobilisierter Transgen-DNAd.) Identification of immobilized Transgene DNA

ECFP^– Nachkommen (Selektion gegen den Jumpstarter) dieser Einzelkreuzungen werden auf das Vorhandensein von EYFP-Fluoreszenz bei gleichzeitiger Abwesenheit von DsRed-Fluoreszenz hin analysiert. Individuen mit einem Exzisionsereignis (EYFP⁺ aber DsRed^–) können dann weiter untersucht werden: Mittels inverser PCR wird bestätigt, daß tatsächlich nur der rekonstituierte Transposonbereich (zwischen pBacR' und pBacL, siehe 3) durch die piggyBac-Transposase entfernt worden ist, mittels erneuter Konfrontation mit piggyBac-Transposase kann die Stabilität der Insertion getestet werden.ECFP ^- offspring (selection against the JumpStarter) of these single junctions are analyzed for the presence of EYFP fluorescence in the simultaneous absence of DsRed fluorescence. Individuals with an excision event (EYFP ⁺ but DsRed ^- ) can then be examined further: by means of inverse PCR, it is confirmed that only the reconstituted transposon region (between pBacR 'and pBacL, see 3 ) by which piggyBac transposase has been removed, the stability of the insertion can be tested by confrontation with piggyBac transposase.

Beispiel 2: RMCE mit anschließender TransposonexzisionExample 2: RMCE with subsequent transposon excision

Der Aufbau der RMCE-Vektoren (Donor und Akzeptor) sowie die experimentellen Schritte sind schematisch in 4 dargestellt. Der RMCE-Akzeptorvektor, pBac{3xP3-FRT-ECFP-linotte-FRT3}, ist ein piggyBac-basierter Transformationsvektor, der als neu hinzugefügtes Merkmal eine DNS-Austauschkasette enthält. Diese Kasette baut sich aus zwei gleich-orientierten aber heterospezifischen FRT-Zielstellen auf (FRT und FRT3 entsprechend F und F3 nach (23)), die das ECFP-offene Leseraster und eine Zielsteuerungssequenz einrahmen. Als Zielsteuerungssequenz wurde das 1,6 kb genomische HindIII-Fragment des Drosophila linotte-Locus gewählt, welches als „Köder" für die Anlagerung von DNS-Duplexen mit gleicher Sequenz fungiert (43). Die Positionierung einer FRT-Zielstelle zwischen 3xP3-Promotor und dem Start der ECFP-kodierenden Region interferiert nicht mit der Expression des 3xP3-ECFP-Gens (44). Der RMCE-Donorvektor hingegen, pSL-FRT-EYFP-pBacR'-3xP3-DsRed-linotte-FRT3, enthält die einzurekombinierende DNS-Kasette aus heterospezifischen FRT-Zielstellen, die das EYFP-offene Leseraster (promotorlos!), die piggyBacR'-Halbseite, das Transformationsmarkergen 3xP3-DsRed sowie die zum RMCE-Akezeptor identische linotte-Zielsteuerungssequenz einrahmen. Der RMCE-Donorvektor ist ein Kloniervektor auf Basis des pSLfa1180fa (36), der, abgesehen von der piggyBacR'-Sequenz, keine Transposonsequenzen enthält. AscI/FseI-Klonierstellen zur Insertion von Transgenen sind stromaufwärts der piggyBacR'-Sequenz eingefügt.The structure of the RMCE vectors (donor and acceptor) and the experimental steps are shown schematically in 4 shown. The RMCE acceptor vector, pBac {3xP3-FRT-ECFP-linotte-FRT3}, is a piggyBac-based transformation vector which contains a DNA exchange cassette as a newly added feature. This cassette is made up of two identically oriented but heterospecific FRT target locations (FRT and FRT3 corresponding to F and F3 according to (23)), which frame the ECFP-open reading frame and a targeting sequence. The 1.6 kb genomic HindIII fragment of the Drosophila linotte locus was chosen as the targeting sequence, which acts as a "bait" for the attachment of DNA duplexes with the same sequence (43). The positioning of an FRT target site between the 3xP3 promoter and the start of the ECFP-coding region does not interfere with the expression of the 3xP3-ECFP gene (44), whereas the RMCE donor vector, pSL-FRT-EYFP-pBacR'-3xP3-DsRed-linotte-FRT3, contains the DNA to be recombined Cassette of heterospecific FRT target sites, which frame the EYFP open reading frame (without a promoter!), The piggyBacR 'half page, the transformation marker gene 3xP3-DsRed and the linotte targeting sequence identical to the RMCE acceptor. The RMCE donor vector is a cloning vector based on of the pSLfa1180fa (36), which, apart from the piggyBacR 'sequence, contains no transposon sequences .. AscI / FseI cloning sites for inserting transgenes are inserted upstream of the piggyBacR' sequence.

Anwendungspotential der RMCE-Technologie in Invertebratenapplication potential the RMCE technology in invertebrates

Die in dieser Schrift für einen Invertebraten-Organismus (Drosophila melanogaster) etablierte DNS-Kasettenaustausch-Technologie stellt ein äußerst vielseitiges Werkzeug dar, das über das hier fixierte Ziel der Immobilisierung von Transgenen hinausgehend Anwendungspotential besitzt: RMCE ermöglicht generell in Invertebraten, DNS-Kasetten, die Transgene tragen, gezielt an einen genomischen Locus einzusetzen. Dieser Locus ist durch die genomische RMCE-Akzeptorintegration definiert und kann molekular und hinsichtlich des lokalen Gen-Expressionsmusters (Aktivität von regulatorischen Elementen an diesem Locus) vor dem RMCE-Experiment charakterisiert werden. Somit besteht die Möglichkeit, sich unter vielen verschiedenen bzgl. des RMCE-Akzeptors transgenen Linien diejenige auszuwählen, welche das für den jeweiligen Anwendungszweck geeignetste Expressionsmuster hat (hinsichtlich Stärke, Zelltyp- und Entwicklungsstadien-Spezifität). Der Kasettenaustausch kann darüber hinaus repetitiv vorgenommen werden, d.h. eine Transgenkasette in einem Insektenstamm mit bestimmtem genetischen Hintergrund kann wiederholt gegen eine weitere Transgenkasette, ausgetauscht werden. Zudem können über diese Technologie verschiedene Transgene an denselben Locus gebracht werden. Dies ermöglicht komparative Studien verschiedener Transgene im gleichen genomischen Kontext unter Ausschluß von Positionseffekten.The one in this writing Invertebrate organism (Drosophila melanogaster) established DNA cassette exchange technology represents an extremely versatile Tool that is about going beyond the goal of immobilizing transgenes set here Has application potential: RMCE generally enables invertebrates DNA cassettes that carry transgenes target a genomic Use locus. This locus is through the genomic RMCE acceptor integration defined and can be molecular and in terms of the local gene expression pattern (Activity of regulatory elements at this locus) before the RMCE experiment be characterized. So there is an opportunity to look at many different lines transgenic with respect to the RMCE acceptor select which that for has the most suitable expression pattern for the respective application (in terms of strength, Cell type and development stage specificity). The cassette exchange can about that be carried out repetitively, i.e. a transgenic cassette in an insect strain with a specific genetic background repeated for another transgene cassette. You can also use this Technology different transgenes are brought to the same locus. this makes possible comparative studies of different transgenes in the same genomic Context excluding Positional effects.

Im folgenden sind die Details der Klonierungsschritte der RMCE-Vektoren, zurückverfolgbar auf bereits publizierte Plasmide, offenbart:The following are the details of the Cloning steps of the RMCE vectors, traceable to already published ones Plasmids revealed:

Klonierung des RMCE-Akzeptorvektors:Cloning the RMCE acceptor vector:

pSL-3xP3-FRT-ECFPaf:pSL-3xP3 FRT ECFPaf:

Das die FRT-Sequenz enthaltende 90 bp SalI-Asp718 Fragment wurde aus dem Plasmid pSL>AB> (39) isoliert und in das mit SalI-Asp718 geschnittene Plasmid pSL-3xP3-ECFPaf (36) eingesetzt. Die FRT-Sequenz entspricht dabei dem Substrat der Flp-Rekombinase nach (40):
TTGAAPGTTCCTATTCCGAAGTTCCTATTCTCTAGAAAGTATAGGAACTTCAGAGCGCTTTTGAAGCTThe 90 bp SalI-Asp718 fragment containing the FRT sequence was isolated from the plasmid pSL>AB> (39) and inserted into the plasmid pSL-3xP3-ECFPaf (36) cut with SalI-Asp718. The FRT sequence corresponds to the substrate of the Flp recombinase according to (40):
TTGAAPGTTCCTATTCCGAAGTTCCTATTCTCTAGAAAGTATAGGAACTTCAGAGCGCTTTTGAAGCT

pBac {3xP3-FRT-ECFPaf}:pBac {3xP3-FRT-ECFPaf}:

Das 1,3 kb EcoRI-NruI Fragment wurde aus dem Plasmid pSL-3xP3-FRT-ECFPaf isoliert und nach Auffüllen der Schnittstellen in das Plasmid p3E1.2 (34) eingesetzt, das mit HpaI geschnitten wurde.The 1.3 kb EcoRI-NruI fragment was isolated from the plasmid pSL-3xP3-FRT-ECFPaf and after filling the Interfaces in the plasmid p3E1.2 (34) used with HpaI was cut.

pBac{3xP3-FRT-ECFP-linotte-FRT3}, finaler RMCE-Akzeptorvektor:pBac {3xP3 FRT ECFP linotte-FRT3} final RMCE acceptor vector:

Das Plasmid pBac {3xP3-FRT-ECFPaf} wurde mit AscI-BglII geöffnet. In diesen linearisierten Vektor wurden kloniert:The plasmid pBac {3xP3-FRT-ECFPaf} was opened with AscI-BglII. The following were cloned into this linearized vector:

i.) the PCR amplificate cut with AscI-Asp718 of the 1.6 kb HindIII genomic linotte fragment (43). The "template" was genomic DNA from Drosophila melanogaster, strain OregonR used and as oligonucleotide primers: CH_lioFwd (5'-TTGGCGCGCCAAAAGCTTCTGTCTCTCTTTCTG-3 ') and CH_lioRev (5'-CGGGGTACCCCAAGCTTATTAGAGTAGTATTCTTC-3 ') and
ii.) the one cut with Asp718-BglII and obtained via mutagenic PCR Amplificate of the FRT3 sequence.

Als template wurde das Plasmid pSL>AB> (39) verwendet und als Oligonukleotidprimer CH_F3Fwd (5'-TTGGCGCGCCAAGGGGTACCCGGGGATCTTG-3') und CH_F3Rev (5'-CCGCTCGAGCGGAAGATCTGAAGTTCCTATACTATTTGAAGAATAG-3').The plasmid pSL> AB> (39) was used as the template and as the oligonucleotide primer CH_F3Fwd (5'-TTGGCGCGCCAAGGGGTACCCGGGGATCTTG-3 ') and CH_F3Rev (5'-CCGCTCGAGCGGAAGATCTGAAGTTCCTATACTATTTGAAGAATAG-3').

Die FRT3-Sequenz entspricht der F3-Sequenz in (23):
TTGAAGTTCCTATTCCGAAGTTCCTATTCTtcAaAtAGTATAGGAACTTCAGAGCGCThe FRT3 sequence corresponds to the F3 sequence in (23):
TTGAAGTTCCTATTCCGAAGTTCCTATTCTtcAaAtAGTATAGGAACTTCAGAGCGC

Klonierung des RMCE-DonorvektorsCloning of the RMCE donor vector

pSL-3xP3-FRT-EYFPaf:pSL-3xP3 FRT EYFPaf:

Analog zu pSL-3xP3-FRT-ECFPaf aber durch Klonierung in pSL-3xP3-EYFPaf (36).Analogous to pSL-3xP3-FRT-ECFPaf but by cloning in pSL-3xP3-EYFPaf (36).

pSL-FRT-EYFPafpSL FRT EYFPaf

sAus dem Plasmid pSL-3xP3-FRT-EYFPaf wurde mit EcoRI-BamHI der 3xP3-Promotor herausgeschnitten, die überstehenden Enden aufgefüllt und der Vektor religiert.sFrom the plasmid pSL-3xP3-FRT-EYFPaf the 3xP3 promoter was excised with EcoRI-BamHI, the supernatants Padded ends and the vector is religious.

pSL-FRT-EYFP-linotte-FRT3:pSL FRT EYFP linotte-FRT3:

Das 1,7 kb AscI-BglII (beide Enden aufgefüllt)-Fragment aus pBac {3xP3-FRT-ECFP-linotte-FRT3} wurde in den mit NruI geöffneten Vektor pSL-FRT-EYFPaf eingesetzt. Die Orientierung wurde derart gewählt, daß die Zielstellen FRT und FRT3 maximalen Abstand zueinander einnehmen.The 1.7 kb AscI-BglII (both ends filled) fragment from pBac {3xP3-FRT-ECFP-linotte-FRT3} was opened in the with NruI Vector pSL-FRT-EYFPaf used. The orientation became like this chosen that the target sites FRT and FRT3 are at a maximum distance from each other.

pBac {3xP3-DsRedaf}pBac {3xP3-DsRedaf}

Das 1,2 kb EcoRI (Ende aufgefüllt)-NruI Fragment wurde aus pSL-3xP3-DsRedaf präpariert und in das Plasmid p3E1.2 (34) kloniert, das mit HpaI-BglII (Ende aufgefüllt) geschnitten wurde.The 1.2 kb EcoRI (end filled) RuI Fragment was prepared from pSL-3xP3-DsRedaf and into the plasmid p3E1.2 (34) cloned, cut with HpaI-BglII (end filled) has been.

pSL-FRT-EYFP-pBacR-3xP3-DsRed-linotte-FRT3, finaler RMCE-Donorvektor:pSL FRT EYFP pBacR-3xP3-DsRed linotte-FRT3, final RMCE donor vector:

Das 2,5 kb EcoRV-AscI (Enden aufgefüllt) Fragment wurde aus pBac{3xP3-DsRedaf} präpariert und in das Plasmid pSL-FRT-EYFP-linotte-FRT3 kloniert, das mit EcoRI (Enden aufgefüllt) geöffnet wurde.The 2.5 kb EcoRV-AscI (padded ends) fragment was prepared from pBac {3xP3-DsRedaf} and cloned into the plasmid pSL-FRT-EYFP-linotte-FRT3, which was labeled with EcoRI (Ends filled) open has been.

Plasmidale Flp-Rekombinase-QuellePlasmidale Flp recombinase source

pKhsp82-FLP:pKhsp82-FLP:

Das das Flp-Rekombinase-offene Leseraster und die 3' regulatorische Sequenz des adh-Gens enthaltende 2,2 kb Asp718-XbaI Fragment wurde aus dem Konstrukt pFL124 (Geschenk von G. Struhl) isoliert und die Schnittstellen aufgefüllt. Das Fragment wurde anschließend in das mit BamHI (Enden aufgefüllt) linearisierte Konstrukt pKhsp82 (Geschenk von P. Atkinson) kloniert.That is the Flp recombinase open reading frame and the 3 'regulatory Sequence of the 2.2 kb Asp718-XbaI fragment containing adh gene isolated from the construct pFL124 (gift from G. Struhl) and the Interfaces filled up. The fragment was subsequently into that with BamHI (ends filled) cloned linearized construct pKhsp82 (gift from P. Atkinson).

Helferplasmid:helper:

Das zur KT des RMCE-Akzeptors verwendete Helferplasmid, phspBac, ist publiziert in (35).The one used for the KT of the RMCE acceptor Helper plasmid, phspBac, is published in (35).

Effizienz des DNS-Kasettenaustauschs (RMCE) im Genom von Drosophila melanogasterEfficiency of DNS cartridge exchange (RMCE) in the Drosophila melanogaster genome

Die zentrale Voraussetzung für die praktische Anwendung eines RMCE-basierten KT-Systems zur Immobilisierung von Transgenen ist eine Effizienz des DNS-Kasettenaustausch in der Größenordnung der konventionellen KT, bei der Transgeninsertionen unter 10³-10⁴ F₁-Nachkommen identifizierbar sind. Da bisherige Versuche zum DNS-Kasettenaustausch in Zellkultur unter Selektionsbedingungen durchgeführt wurden (21, 22), ist die Effizienz im Drosophila-System ohne Selektionsbedingungen schwer vorherzusagen. Daher wurde ein Pilotexperiment durchgeführt: In Präblastodermembryonen von vier bzgl. des RMCE-Akzeptors, pBae{3xP3-FRT-ECFP-linotte-FRT3}, homozygot transgenen Drosophila melanogaster Linien (ECFP-Augenfluoreszenz) wurden die Zwischenstufe des RMCE-Donorvektors, pSL-FRT-EYFP-linotte-FRT3, sowie das Flp-Rekombinase-exprimierende Plasmid, pKhsp82-FLP, injiziert. Die finale Konzentration im Injektionsmix betrug 500 ng/μl für den RMCE-Donor und 300 ng/μl für pKhsp82-FLP. Insgesamt wurden ca. 3000 Drosophila-Embryonen injiziert, dem Zehnfachen einer üblichen piggyBac-vermittelten KT entsprechend. Der Erfolg des DNS-Kasettenaustauschs wird in der ersten Filialgeneration durch den Wechsel der Augenfluoreszenz von ECFP nach EYFP indiziert. Die Ergebnisse sind in Tab. 1 zusammengestellt:The central prerequisite for the practical application of an RMCE-based KT system for immobilizing transgenes is the efficiency of the DNA cassette exchange in the order of magnitude of conventional KT, in which transgene insertions under 10 ³ -10 ⁴ F ₁ progeny can be identified. Since previous attempts to exchange DNA cassettes in cell culture were carried out under selection conditions (21, 22), the efficiency in the Drosophila system is difficult to predict without selection conditions. A pilot experiment was therefore carried out: In pre-blastodermembryons of four with respect to the RMCE acceptor, pBae {3xP3-FRT-ECFP-linotte-FRT3}, homozygous transgenic Drosophila melanogaster lines (ECFP eye fluorescence), the intermediate stage of the RMCE donor vector, pSL FRT-EYFP-linotte-FRT3, and the Flp recombinase-expressing plasmid, pKhsp82-FLP, were injected. The final concentration in the injection mix was 500 ng / μl for the RMCE donor and 300 ng / μl for pKhsp82-FLP. A total of approximately 3000 Drosophila embryos were injected, corresponding to ten times the usual piggyBac-mediated KT. The success of the DNA cassette exchange is indicated in the first branch generation by the change in eye fluorescence from ECFP to EYFP. The results are summarized in Tab. 1:

Definiert man die DNS-Kasettenaustausch-Effizienz analog zur Transformationseffizienz mit Transposon-basierten Vektoren als Verhältnis der Ansätze in F₁ mit Austauschereignissen (hier: EYFP+) zur Gesamtzahl der Ansätze, so liegt diese im Durchschnitt bei 25 %. Dies entspricht der Drosophila KT-Effizienz mit piggyBac, Hermes oder Minos-basierten Transformationsvektoren. Mit diesem Pilotexperiment konnte der Nachweis erbracht werden, daß die wesentliche Voraussetzung für RMCE-basierte KT-Systeme, nämlich eine hohe Kasettenaustausch-Effizienz, gegeben ist.If one defines the DNA cassette exchange efficiency analogously to the transformation efficiency with transposon-based vectors as the ratio of the approaches in F ₁ with exchange events (here: EYFP +) to the total number of approaches, this is on average 25%. This corresponds to the Drosophila KT efficiency with piggyBac, Hermes or Minos-based transformation vectors. This pilot experiment was able to demonstrate that the essential prerequisite for RMCE-based KT systems, namely high cassette exchange efficiency, is met.

Experimentelle Schritte zur Transgenimmobilisierung (siehe 2 und 4)Experimental steps for transgene immobilization (see 2 and 4 )

a.) Keimbahntransformation des RMCE-Akzeptorvektors (nicht gezeigt in 2 und 4)a.) germline transformation of the RMCE acceptor vector (not shown in 2 and 4 )

pBac{3xP3-FRT-ECFP-linotte-FRT3} wird mittels piggyBac-vermittelter Keimbahntransformation (35, 36) ungerichtet im Drosophila-Genom (in Zellen der Keimbahn) integriert. Der KT schließt sich die Etablierung bzgl. des Akzeptors homozygoter transgener Linien an.pBac {3xP3 FRT ECFP linotte-FRT3} is achieved by means of piggyBac-mediated germline transformation (35, 36) undirected integrated in the Drosophila genome (in germline cells). The KT closes the establishment of the acceptor homozygous transgenic Lines.

b.) Gerichteter DNS-Kasettenaustausch (RMCE, Schritt 1 in 2 und 4)b.) Directed DNS cassette exchange (RMCE, step 1 in 2 and 4 )

Analog zum oben beschriebenen Pilotexperiment wird das Donorkonstrukt, pSL-FRT-EYFP-pBacR-3xP3-DsRed-linotte-FRT3, oder Transgen-beladene Derivate dieses Vektors zusammen mit dem Flp-Rekombinase exprimierenden Plasmid koinjiziert in bzgl. des Akzeptors homozygot transgene Embryonen. Überlebende Männchen werden ausgekreuzt und die Nachkommenschaft (F₁-Generation) auf das Auftreten von Individuen mit vorhandener EYFP-(markiert „1" in 4) und DsRed-(markiert „ 2" in 4) bei gleichzeitigem Fehlen von ECFP- (markiert „ 3" in 4) – Augenfluoreszenz durchgemustert. Dieses Fluoreszenzmuster indiziert einen erfolgreichen DNS-Kasettenaustausch.Analogous to the pilot experiment described above, the donor construct, pSL-FRT-EYFP-pBacR-3xP3-DsRed-linotte-FRT3, or transgene-loaded derivatives of this vector together with the plasmid expressing Flp recombinase are co-injected into the acceptor homozygous transgenic embryos. Surviving males are crossed out and the offspring (F ₁ generation) for the appearance of individuals with existing EYFP- (marked "1" in 4 ) and DsRed- (marked "2" in 4 ) in the absence of ECFP- (marked "3" in 4 ) - Eye fluorescence screened. This fluorescence pattern indicates a successful DNA cassette exchange.

c.) piggyBac-Transposase induzierte Deletion (Schritt 2 in 2 und 4)c.) piggyBac transposase induced deletion (step 2 in 2 and 4 )

Nach dem Kasettenaustausch liegt ein rekonstituiertes internes piggyBac-Transposon vor, das piggyBac-Transposase-vermittelt remobilisiert werden kann (vgl. S.8, Schritt c.)). Die erfolgreiche Remobilisierung wird durch den Verlust des DsRed-Transformationsmarkergens (markiert „ 2" in 4) angezeigt: Nachkommen mit einer immobilisierten Transgen-Insertion zeigen ausschließlich EYFP-(markiert „1" in 4)-Fluoreszenz. Abschließend können die physikalische Deletion des Transposons auf molekularer Ebene über inverse PCR und die Stabilität der Insertion durch erneutes Einkreuzen von piggyBac-Transposase bestätigt werden.After the cassette exchange, there is a reconstituted internal piggyBac transposon that can be remobilized via piggyBac transposase (see p.8, step c.)). Successful remobilization is indicated by the loss of the DsRed transformation marker gene (marked "2" in 4 ) is shown: Offspring with an immobilized transgene insert only show EYFP- (marked "1" in 4 )-Fluorescence. Finally, the physical deletion of the transposon at the molecular level can be confirmed by inverse PCR and the stability of the insertion by crossing piggyBac transposase again.

Vorteile der ErfindungAdvantages of invention

Die Vorteile beider KT-Systeme gegenüber konventionellen liegen auf der Hand: Aufgrund der physikalischen Deletion transponierbarer DNS-Abschnitte, sind Transposase-vermittelte Kreuzmobilisierungsereignisse mechanistisch ausgeschlossen. Gegenüber konventionellen Transgen-Insertionen weist eine dergestalt immobilisierte Insertion eine erhöhte Stabilität auf. Des weiteren betrifft der post-transformationelle Modifikationsprozeß in beiden Ausgestaltungen der Erfindung nur den DNS-Bereich des Transgenvektors und hat ansonsten keinerlei Veränderung im Genom zur Folge. Zudem werden am Modifikationsprozeß beteiligte DNS-Werkzeuge (Transformationsmarker, Transposase- oder Rekombinase-Zielstellen) im letzten experimentellen Schritt (siehe Schritt 3 in 1 und Schritt 2 in 2) größtenteils wieder entfernt, so daß final keine durch Transposasen oder Rekombinasen mobilisierbaren Bereiche im Genom zurückbleiben. Die konkrete Ausgestaltung der hier offenbarten KT-Systeme ist weder von der Natur des verwendeten Transposontyps, noch von der Natur der Transformationsmarkergene, noch von der Natur des ortsspezifischen Rekombinationssystems, noch von der Natur der Zielsteuerungssequenz abhängig. Darüberhinaus besitzen beide Ausgestaltungsbeispiele generelles Anwendungspotential in Invertebraten-, insbesondere in Arthropodenspezies, da ausschließlich spezies-unabhängige Komponenten (Breitband-Transposons, universelle Transformationsmarker, heterologe ortsspezifische Rekombinationssysteme) verwendet werden.The advantages of both KT systems compared to conventional ones are obvious: Due to the physical deletion of transposable DNA sections, transposase-mediated cross-mobilization events are mechanistically excluded. Compared to conventional transgene insertions, an immobilized insert of this type has increased stability. Furthermore, the post-transformational modification process in both embodiments of the invention relates only to the DNA region of the transgene vector and does not otherwise result in any change in the genome. In addition, DNA tools involved in the modification process (transformation markers, transposase or recombinase target sites) are used in the last experimental step (see step 3 in 1 and step 2 in 2 ) mostly removed again, so that finally no areas mobilizable by transposases or recombinases remain in the genome. The specific design of the KT systems disclosed here does not depend on the nature of the type of transposon used, nor on the nature of the transformation marker genes, nor on the nature of the site-specific recombination system, nor on the nature of the targeting sequence. Furthermore, both design examples have general application potential in invertebrate, in particular in arthropod species, since only species-independent components (broadband transposons, universal transformation markers, heterologous site-specific recombination systems) are used.

Verzeichnis zitierter DruckschriftenDirectory cited publications

1. Engels, W.R. (1996). P elements in Drosophila. Curr. Top. Microbiol. Immunol. 204, 103-123.
2. Rio, D.C. & Ruby, G.M. (1988). Identification and purification of a Drosophila protein that binds to the terminal 31 base pair inverted repeats of the P transposable element. Proc. Natl. Acad. Sci. USA 85, 8929-8933.
3. Atkinson, P.W. & James, A.A. (2002). Germline transformants spreading out to many insect species. Adv. Genet. 47, 49-86.
4. United States Patent No. US 6,218,185 B1
5. United States Patent No. US 5,614,398
6. European Patent No. EP 0 955 364 A3
7. Patent Cooperation Treaty PCT WO 99/09817
8. Catteruccia, F., Nolan, T., Loukeris, T.G., Blass, C., Savakis, C., Kafatos, F.C. & Crisanti, A. (2000). Stable germline transformation of the malaria mosquito Anopheles stephensi. Nature 405, 959-962.
9. Allen, M.L., O'Brochta, D.A., Atkinson, P.W. & Levesque, C. S. (2001). Stable, germ-line transformation of Culex quinquefasciatus (Diptera: Culicidae). J. Med. Entomol. 38, 701-710.
10. Coates J.C., Jasinskiene, N., Miyashiro, L. & James, A.A. (1998). Mariner transposition and transformation of the yellow fever mosquito, Aedes aegypti. Proc. Natl. Acad. Sci. USA 95, 3748-3751.
11. Jasinskiene, N., Coates, C.J., Benedict, M.Q., Cornel, A.J., Rafferty, C.S., James, A.A. & Collins, F. H. (1998). Stable transformation of the yellow fever mosquito, Aedes aegypti, with the Hermes element from the housefly. Proc. Natl. Acad. Sci. USA 95, 3743.3747.
12. Loukeris, G.T., Livadaras, I., Arca, B, Zabalou, S. & Savakis, C. (1995). Gene transfer into the Medfly, Ceratitis capitata, with a Drosophila hydei transposable element. Science 270, 2002-2005.
13. Tamura, T. et al. (2000). Germline transformation of the silkworm Bombyx mori L. using a piggyBac transposon-derived vector. Nat. Biotechnol. 18, 81-84.
14. Bessereau, J.-L., Wright, A., Williams, D.C., Schuske, K., Davis, M.W. & Jorgensen, E. M. (2001). Mobilization of a Drosophila transposon in the Caenorhabditis elegans germ line. Nature 413, 70-74.
15. Fadool J.M., Hartl, D.L. & Dowling, J.E. (1998). Transposition of the marine element from Drosophila mauritiana in zebrafish. Proc. Natl. Acad. Sci. USA 95, 5182.5186.
16. Sherman, A., Dawson, A., Mather, C., Gilhooley, N., Li, Y., Mitchell, R., Finnegan, D. & Sang, H. (1998). Transposition of the Drosophila element mariner into the chicken germ line. Nat. Biotechnol. 16, 1050-1053.
17. Horn, C., Schmid, B.G.M., Pogoda, F.S. & Wimmer, E.A. (2002). Fluorescent transformation markers for insect transgenesis. Insect Biochem. Mol. Biol. 32, 1221-1235.
18. for the patent situation of GFP and derivatives and DsRed see www.clontech.com.
19. Patent Cooperation Treaty PCT WO 01/14537 A1
20. Patent Cooperation Treaty PCT WO 01/12667 A1
21. Baer, A. & Bode, J. (2001). Coping with kinetic and thermodynamic barriers: RMCE, an efficient strategy for the targeted integration of transgenes. Curr Opin Biotechnol. 12, 473-480.
22. Kolb, A.F. (2002). Genome engineering using site-specific recombinases. Cloning stem cells. 4, 65-80.
23. Schlake, T. & Bode, J. (1994). Use of mutated FLP recognition target (FRT) sites for the exchange of expression cassettes at defined chromosomal loci. Biochemistry 33, 12746-12751.
24. Seibler, J., Schübeler, D., Fiering, S, Groudine, M. & Bode, J. (1998). DNA cassette exchange in ES cells mediated by Flp recombinase: an efficient strategy for repeated modification of tagged loci by marker-free constructs. Biochemistry 37, 6229-6234.
25. European Patent No. EP 0 939 120 A1 ,
26. Kolb, A.F. (2001). Selection-marker-free modification of the murine beta-casein gene using a lox2272 [correction of lox2722] site. Anal biochem. 290, 260-271.
27. See claims # 1-11 in EP 0 939 120 A1 ,
28. Sundararajan, P., Atkinson, P.W. & O'Brochta, D.A. (1999). Transposable element interactions in insects: crossmobilization of hobo and Hermes. Insect Mol. Biol. 8, 359-368.
29. Hartl, D.L., Lohe, A.R. & Lozovskaya, HE. (1997). Modern thoughts on an ancyent marinere: function, evolution, regulation. Annu. Rev. Genet. 31, 337-358
30. Franz, G., Gencheva, E. & Kerremans, Ph. (1994). Improved stability of genetic sex-separation strains for the mediterranean fruit fly, ceratitis capitata. Genome 37, 72-82.
31. Franz, G. (2002). Transgenic arthropods and the sterile insect technique. in preparation.
32. Fisher, K. & Caceres, C. (2000). A filter rearing system for mass reared medfly, pp. 543-550 in Area-wide control of fruit flies and other insect pests, ed .: Tan, K.H., Penerbit Universiti Sains Malaysia, Penang, Malaysia.
33. Tappeser, B. & Baier, A. (2000). Transgenic arthropods. Genetic Engineering Newsletter - Special Issue 4th ed .: Öko-Institut, Institute for applied ecology e.V., Freiburg, Berlin, Darmstadt, Germany.
34. Cary, L.C., Goebel, M., Corsaro, B.G., Wang, H.G., Rosen, E. & Fraser, M.J. (1989). Transposon mutagenesis of baculoviruses: analysis of Trichoplusia ni transposon IFP2 insertions within the FP-locus of nuclear polyhedrosis viruses. Virology 172, 156-169.
35. Handler, A.M. & Harrell, R.A. (1999). Germline transformation of Drosophila melanogaster with the piggyBac transposon vector. Insect Mol. Biol. 8, 449-457.
36. Horn, C. & Wimmer, E.A. (2000). A versatile vector set for animal transgenesis. Dev. Genes Evol. 210, 630-637.
37. Handler, A.M. (2002). Use of the piggyBac transposon for germ-line transformation of insects. Insect Biochem. Mol. Biol. 32, 1211-1220.
38. Horn, C., Jaunich, B. & Wimmer, E.A. (2000). Highly sensitive, fluorescent transformation marker for Drosophila transgenesis. Dev. Genes Evol. 210, 623-629.
39. Wimmer, E.A., Cohen, S.M., Jäckle, H. & Desplan, C. (1997). Buttonhead does not contribute to a combinatorial code proposed for Drosophila head development. Development 124, 1509-1517.
40. Jayaram M. (1985). Two-micrometer circle site-specific recombination: The minimal substrate and the possible role of flanking sequences. Proc. Natl. Acad. Sci. USA 82, 5875-5879.
41. Golic, M.M., Rong, Y.S., Petersen, R.B., Lindquist, S.L. & Golic, K.G. (1997). FLP-mediated DNA mobilization to specific target sites in Drosophila chromosomes. Nucleic Acids Res. 25, 3665-3671.
42. Horn, C., Offen, N., Nystedt, S., Häcker, U. & Wimmer, E.A. (2003). piggyBao-based insertional mutagenesis and enhancer detection as a tool for functional insect genomics. in press
43. Taillebourg, E. & Dura, J.M. (1999). A novel mechanism for P element homing in Drosophila. Proc. Natl. Acad. Sci. USA 96, 6856-6861.
44. Horn, C. (1999). Development of universal transformation vectors for genetic manipulation of insects. Diploma thesis, University of Bayreuth.

Claims

A method of generating contains a heritable integration of DNA in the genome of germ-line cells and the genome of the somatic cells of an invertebrate organism, said integration homologous or heterologous DNA sequences or homologous or heterologous genes (transgenes) or the combination of both, characterized in that that by means of a post-transformational modification process of the said integration following a germline transformation, DNA sequences which have defined target sites for transposase or recombinase enzymes and which originate from the transformation vector are physically removed from said genome.

The method according to claim 1, characterized in that in Course of said modification process, mediated by the Effect of a site-specific recombinase, a transposase mobilizable DNS area is reconstituted. The reconstituted DNS realm consists of two transposon half pages, TransposonL and TransposonR, the functional DNA sequences like a transformation marker or include a recombinase target site and the inverted terminal Repeat sequences as target sites of the corresponding transposase wear in an order that a Transposase-controlled excision is made possible.

The method according to claim 1, characterized in that generation said DNA integration a DNA cassette exchange in the genome of The organism's germline cells includes the following steps: a.) Integration of a first DNS cassette (DNS acceptor cassette) on one chromosomal locus of the genome of said cells, the DNA acceptor cassette, flanked by a wild-type recombinase target site at one End and a modified heterospecific recombinase target site at the other end, a transformation marker gene for labeling and a DNA sequence for attaching homologous DNA sequences to the carries chromosomal locus (targeting sequence), b.) Establishment regarding the DNA acceptor cassette homozygous transgenic lines of the organism c.) Exchange of said DNA acceptor cassette for one to be recombined second DNS cassette, mediated by the effect of a site-specific Recombinase, with the DNA donor cassette on a circular vector is localized and one or more transgenes and a transposon half-page wearing, through the same recombinase target sites as in said DNA acceptor cassette are flanked and further characterized by that after DNS cassette exchange is a transposase-mobilizable range of DNA is reconstituted, which, mediated by the effect of the the corresponding transposase, mobilized and to be physically removed from the genome of said cells can.

The method according to claims 1 to 3, characterized in that this said site-specific recombination system the Flp / FRT (Flp: = Flp recombinase and FRT: = Flp recombinase targets) or that Cre / loxP (Cre: = Cre recombinase / loxP: = Cre recombinase targets) are.

The method according to claims 1, 3 and 4, characterized in that that the said wild-type recombinase target site in the DNA acceptor cassette between promoter (including regulatory DNA sequences) and is located in the open reading frame of the transformation marker gene and the one following the wild-type recombinase target site in the DNA donor cassette Transformation marker gene is without a promoter.

The method according to claims 1 and 3 to 5, thereby characterized that the said wild-type recombinase target site is an FRT or a is loxP target and said heterospecific recombinase target an FRT or loxP target mutant is.

The method according to claims 1 to 3 and 5, thereby characterized that said Transformation marker genes emerge from an evolutionarily conserved one Promoter and a phenotypic dominant marker gene for assemble a fluorescent protein.

The method according to claims 1 to 3, characterized in that said Transposon types and corresponding transposases one of the broadband transposons piggyBac, Hermes, Minos or Mariner are.

The method according to claims 1 and 3, characterized in that said targeting sequence the germline transformation vectors containing them with significantly increased probability can target the chromosomal locus of the parent gene of the targeting sequence

The method according to claims 1, 3 and 9, characterized in that said Targeting Sequence the sequence or parts of the sequence of the Drosophila melanogaster linotte gene or genes homologous to it.

Genetically modified Invertebrate organisms that by a method according to claims 1 to 10 were manufactured.

A genetically modified organism according to the patent claim 10, characterized in that the organism is an insect and has been selected from the following group of insects: Aedes aegypti, Aedes albopictus, Anopheles gambiae, Anopheles stephensi, Glossina spp., Lucilia cuprina, Dacus dorsalis, Dacus oleae, Dacus cucurbitae, Dacus zonatus, Ceratitis capitata, Ceratitis rosa, Aleurocanthus woglumi, Rhagoletis cerasi, Bactrocera tryoni, Anastrepha suspensa, Solenopis richteri, Solenopis invicta, Lymantria dispar, Cydia pomonella, Euproctis chrysorrhoea, Cochliomyia hominivorax, Chrysomyia bezziana, Anthonomous grandis, Enallagma hageni, Libellula luctuosa and Tryporyza incertulas Popilla japonica, Graphognatus spp., Drosophila melanogaster.