DE102007024382A1

DE102007024382A1 - Diagnosing a neurodegenerative disease comprises the gene expression level of a specified marker in a biological sample

Info

Publication number: DE102007024382A1
Application number: DE102007024382A
Authority: DE
Inventors: Georg Prof. Dr. med. Auburger; Suzana Gispert Dr. rer. nat. Sánchez
Original assignee: Goethe Universitaet Frankfurt am Main
Current assignee: Goethe Universitaet Frankfurt am Main
Priority date: 2007-05-23
Filing date: 2007-05-23
Publication date: 2008-11-27

Abstract

Diagnosing a neurodegenerative disease comprises the gene expression level of a marker in a biological sample. The marker is SNCA, IGSF4, WNT5A, ODZ2, CPXM2, ANGPT1 or HTRA3. Independent claims are also included for: (1) use of a marker as above to predict the progression of a neurodegenerative disease; (2) kit for diagnosing a neurodegenerative disease, comprising a molecule (I) with which the gene expression level of a marker as above can be dectected; (3) antibody for specific detection of a marker as above.

Description

Die Erfindung betrifft ein Verfahren zur Diagnose einer neurodegenerativen Erkrankung. Weiterhin betrifft die Erfindung die Verwendung eines Markers zur Diagnose einer neurodegenerativen Erkrankung und die Verwendung eines Markers zur Vorhersage des Verlaufs einer neurodegenerativen Erkrankung. Weiterhin betrifft die Erfindung einen Kit zur Diagnose einer neurodegenerativen Erkrankung, Antikörper zum spezifischen Nachweis eines derartigen Markers, sowie die Verwendung eines derartigen Antikörpers.The The invention relates to a method for the diagnosis of a neurodegenerative Illness. Furthermore, the invention relates to the use of a Markers for the diagnosis of a neurodegenerative disease and its use a marker for predicting the course of a neurodegenerative Illness. Furthermore, the invention relates to a kit for diagnosis a neurodegenerative disease, antibodies for specific detection Such a marker, as well as the use of such a marker Antibody.

Neurodegenerative Erkrankungen, wie beispielsweise Morbus Parkinson oder Morbus Alzheimer sind eine häufige Ursache für Immobilität und Demenz im Alter. Für den behandelnden Arzt stellt sich dabei häufig das Problem, das Vorliegen einer neurodegenerativen Erkrankung bei einem Patienten zweifelsfrei feststellen zu können. Bisher erfolgt die Diagnose einer derartigen neurodegenerativen Erkrankung auf der Grundlage einer phänomeno-logischen Befundung des Patienten. Dabei basiert die Diagnose insbesondere auf Tests für motorische und kognitive Kompetenz. Dementsprechend ist die Diagnose mit einer gewissen Subjektivität verbunden, wodurch es in der Praxis zu Fehldiagnosen bzw. der Nichtdiagnostizierung von neurodegenerativen Erkrankungen kommt.neurodegenerative Diseases such as Parkinson's disease or Alzheimer's disease are a common cause of immobility and dementia in old age. For the attending physician arises often the problem, the presence of a neurodegenerative Disease in a patient to determine beyond doubt. So far, the diagnosis of such a neurodegenerative Disease on the basis of a phenomeno-logical Findings of the patient. The diagnosis is based in particular on tests for motor and cognitive competence. Accordingly is the diagnosis associated with a certain subjectivity, which makes it in practice to misdiagnosis or the Nichtdiagnostizierung comes from neurodegenerative diseases.

Eine zweifelsfreie Diagnose einer neurodegenerativen Erkrankung bleibt leider häufig dem Pathologen vorbehalten.A unequivocal diagnosis of a neurodegenerative disease remains unfortunately often reserved for the pathologist.

Im Stand der Technik sind keine Labormarker bekannt, die eine objektive Diagnose einer neurodegenerativen Erkrankung, insbesondere einer nicht erblich bedingten neurodegenerativen Erkrankung bei einem Patienten zu dessen Lebzeiten ermöglichen.in the The prior art does not disclose laboratory markers that are objective Diagnosis of a neurodegenerative disease, especially one non-hereditary neurodegenerative disease in a patient to enable during his lifetime.

Demgemäß lag der vorliegenden Erfindung die Aufgabe zugrunde, die Diagnose einer möglichen degenerativen Erkrankung bei einem Individuum objektiv zu ermöglichen, ohne dabei einen größeren invasiven Eingriff vornehmen zu müssen.Accordingly, lay The present invention, the object of the diagnosis of a possible degenerative disease in an individual to enable objectively without losing a bigger one to have to perform invasive surgery.

Diese Aufgabe wird durch das erfindungsgemäße Verfahren zur Diagnose einer degenerativen Erkrankung gelöst. Dabei umfasst das Verfahren die folgenden Schritte:

a) Zunächst wird eine Probe biologischen Materials bereitgestellt, die von einem zu untersuchenden Individuum stammt.
b) Dann wird die Stärke der Genexpression mindestens eines Markers in dem biologischen Material bestimmt. Dabei ist der Marker ausgewählt aus der Gruppe bestehend aus SNCA (α-Synuclein, synuclein), IGSF4 (syncam), WNT5A, ODZ2 (Teneurin-2), CPXM2 (carboxypeptidase-2), ANGPT1 und HTRA3.

This object is achieved by the method according to the invention for the diagnosis of a degenerative disease. The method comprises the following steps:

a) First, a sample of biological material is provided which originates from an individual to be examined.
b) Then the level of gene expression of at least one marker in the biological material is determined. The marker is selected from the group consisting of SNCA (α-synuclein, synuclein), IGSF4 (syncam), WNT5A, ODZ2 (teneurin-2), CPXM2 (carboxypeptidase-2), ANGPT1 and HTRA3.

In einer vorteilhaften Ausgestaltung der Erfindung erfolgt die Durchführung des Verfahrens unter gleichzeitiger Bestimmung der Stärke der Genexpression mehrerer der genannten Marker. Die Bestimmung der Marker kann insbesondere zusammen mit den Markern CLU und/oder SEPT6 erfolgen.In an advantageous embodiment of the invention, the implementation is carried out of the method with simultaneous determination of the starch the gene expression of several of the mentioned markers. The determination of Marker can be used in particular together with the markers CLU and / or SEPT6 respectively.

Zur quantitativen Bestimmung der Stärke der Genexpression eines Markers ist es besonders vorteilhaft, dass der erhaltene Messwert mit einem Referenzwert verglichen wird. Dazu ist ein geeigneter Standard heranzuziehen, etwa eine Probe biologischen Materials von einem gesunden oder kranken Individuum. Wenn die vorliegende Erfindung beispielsweise als Einzelzell-Polymerase-Kettenreaktion ausgestaltet ist, ist eine Absolutbestimmung des Messwertes ausreichend; eine Referenz ist dann nicht erforderlich.to quantitative determination of the strength of gene expression Markers it is particularly advantageous that the obtained reading is compared with a reference value. This is a suitable Standard, for example, a sample of biological material from a healthy or sick individual. When the present invention For example, designed as a single cell polymerase chain reaction is, an absolute determination of the measured value is sufficient; a Reference is not required.

Im Rahmen des vorliegenden Verfahrens ist es besonders vorteilhaft, dass die Probe biologischen Materials mittels einer Biopsie aus dem Körper eines Individuums, insbesondere eines Patienten entnommen wird. Dabei kann die Biopsie beispielsweise eine Hautbiopsie, eine Nervenbiopsie oder eine Skelettmuskelbiopsie sein.in the It is particularly advantageous in the context of the present process that the sample of biological material by means of a biopsy out the body of an individual, in particular a patient is removed. The biopsy may include, for example, a skin biopsy, a nerve biopsy or a skeletal muscle biopsy.

In einer bevorzugten Ausgestaltung der Erfindung wird eine Nervenbiopsie an einem leicht zugänglichen Nerven des zu untersuchenden Individuums durchgeführt, wie beispielsweise am Nervus suralis, der sich lateral von der Achillessehne hinter den lateralen Knöchel und um diesen herum zum lateralen Fußrand erstreckt. Aufgrund seiner oberflächlichen, leicht zugänglichen Lokalisation bietet er einem Arzt die Möglichkeit, ohne signifikante nachteilige Effekte für den Patienten an einem Nerv eines Individuums eine Biopsie durchzuführen.In A preferred embodiment of the invention is a nerve biopsy on an easily accessible nerve of the examined Individual performed, such as on the nerve suralis extending laterally from the Achilles tendon behind the lateral Ankle and around it to the lateral foot edge extends. Because of its superficial, easily accessible Localization he offers a doctor the opportunity without significant adverse effects for the patient at one Nerve of an individual to perform a biopsy.

In einer bevorzugten Ausführungsform des erfindungsgemäßen Verfahrens weist die Probe biologischen Materials Hautzellen, insbesondere Fibroblasten, Adipozyten und Keratino zyten auf. Die nachfolgende Bestimmung der Stärke der Genexpression mindestens eines der genannten Marker wird dann an diesen Hautzellen, beispielsweise Fibroblasten vorgenommen. Zu diesem Zweck können die Fibroblasten auch in Kultur genommen werden. Verfahren zur Herstellung von Primärkulturen sind dem Fachmann bekannt. Vorteilhafterweise können diese Kulturen in einer weiteren Ausgestaltung der Erfindung auch dazu verwendet werden, um Medikamente auf ihren Einfluss auf eine neurodegenerative Erkrankung zu untersuchen.In a preferred embodiment of the method according to the invention, the sample of biological material has skin cells, in particular fibroblasts, adipocytes and keratinocytes. The following Determination of the level of gene expression of at least one of said markers is then carried out on these skin cells, for example fibroblasts. For this purpose, the fibroblasts can also be cultivated. Methods of producing primary cultures are known to those skilled in the art. Advantageously, in a further embodiment of the invention, these cultures can also be used to study drugs for their influence on a neurodegenerative disease.

Die Probe biologischen Materials stammt vorteilhafter Weise aus einer Epithelzellentnahme. Derartige Epithelzellen können in nicht-invasiver Weise mittels einer Mundspülung gewonnen werden. So lassen sich leicht Mund-, Wangen- oder Schleimhaut-Epitelzellen zur Verwendung im erfindungsgemäßen Verfahren gewinnen.The Sample biological material comes advantageously from a Epithelzellentnahme. Such epithelial cells can be found in obtained non-invasively by means of a mouthwash become. This makes it easy to open oral, cheek or mucosal epithelial cells for use in the process of the invention win.

Der Schritt der Bestimmung der Stärke der Genexpression mindestens eines der genannten Marker umfasst sowohl die Bestimmung auf RNA-Ebene als auch auf Proteinebene. So kann die Genexpressionsstärke durch quantitative Bestimmung der mRNA des jeweiligen Markers erfolgen. Geeignete Methoden zur Bestimmung der Häufigkeit einer bestimmten mRNA sind dem Fachmann bekannt. Vorteilhafterweise kann sie beispielsweise mittels quantitativer PCR, Chipanalyse (Microarrayanalyse), in-situ Hybridisierung und/oder Northemblot erfolgen.Of the Step of determining the level of gene expression at least one of the mentioned markers comprises both the determination at the RNA level as well as at the protein level. So can the gene expression strength by quantitative determination of the mRNA of the respective marker. Suitable methods for determining the frequency of a certain mRNA are known in the art. Advantageously, can for example, by means of quantitative PCR, chip analysis (microarray analysis), In situ hybridization and / or Northemblot done.

Alternativ kann die Bestimmung der Genexpressionsstärke auch durch eine Messung des jeweiligen Markerproteins erfolgen. Dafür geeignete Methoden sind dem Fachmann ebenfalls bekannt und umfassen beispielsweise Westernblotting, Immunhistochemie und/oder ELISA.alternative The determination of gene expression can also be done by a measurement of the respective marker protein take place. Therefore suitable methods are also known to the person skilled in the art and comprise For example, Western blotting, immunohistochemistry and / or ELISA.

Für einen bestimmten Marker kann eine Untersuchung auf mRNA-Ebene bevorzugt sein. So kann SNCA aufgrund der geringen Proteinkonzentration häufig besser als mRNA nachgewiesen werden.For a particular marker may be preferred at mRNA level be. For example, SNCA is often due to the low protein concentration be detected better than mRNA.

Wie sich auf den in den Beispielen genannten Ergebnissen ergibt, ist das erfindungsgemäße Verfahren zur Diagnose einer Reihe von neurodegenerativen Erkrankungen einzusetzen. So ist das erfindungsgemäße Verfahren zur Diagnose sowohl des familiären als auch des sporadischen Morbus Parkinson, des Morbus Alzheimer, der durch Kleinhirnde generation verursachten Ataxie und der auf eine Degeneration des Rückmarks zurückzuführenden Spastizität einsetzbar.As is based on the results mentioned in the examples, is the inventive method for diagnosing a Range of neurodegenerative diseases. That's how it is inventive method for diagnosis both familial and sporadic Parkinson's disease, of Alzheimer's disease, which caused by cerebellar degeneration Ataxia and attributable to degeneration of the spinal cord Spasticity can be used.

Im Falles des M. Parkinson wird für SNCA auf mRNA Ebene eine erhöhte Transkription gemessen, während sich für IGSF4, ODZ2, WNT5A und CPXM2 eine Modifizierung der jeweiligen Transkripte ergibt. Insbesondere wurde in Fibroblasten eine Verringerung für IGSF4, ODZ2, WNT5A und CPXM2 beobachten, im Gehirn hingegen eine Erhöhung (siehe Beispiele unter Verweis auf die Figuren). Veränderungen von IGSF4, ODZ2, WNT5A und CPXM2 können auch auf Proteinebene nachgewiesen werden.in the Case of M. Parkinson becomes SNCA at mRNA level one increased transcription measured while up for IGSF4, ODZ2, WNT5A and CPXM2 are a modification of the respective transcripts results. In particular, a reduction in fibroblasts was reported for IGSF4, ODZ2, WNT5A and CPXM2 observe, whereas in the brain one Increase (see examples with reference to the figures). Changes of IGSF4, ODZ2, WNT5A and CPXM2 can also be detected at the protein level.

Die oben beschriebenen Veränderungen treten sowohl bei der late-onset als auch bei der early-onset Parkinson Erkrankung sowie dem M. Alzheimer auf. Wie aus den unten gezeigten Ergebnissen gefolgert werden kann, sind derartige Veränderungen allgemein für neurodegenerative Erkrankungen indikativ.The Changes described above occur both in the late-onset as well as in early-onset Parkinson's disease as well the M. Alzheimer on. As deduced from the results shown below can be, such changes are generally for neurodegenerative diseases indicative.

Das oben genannte Problem wird gleichfalls durch die Verwendung eines Markers zur Diagnose einer neurodegenerativen Erkrankung gelöst, wobei der Marker ausgewählt ist aus einer Gruppe, die aus SNCA, IGSF4, WNT5A, ODZ2, CPXM2, ANGPT1 und HTRA3 besteht.The The above problem is also solved by the use of a Markers to diagnose a neurodegenerative disease, wherein the marker is selected from a group consisting of SNCA, IGSF4, WNT5A, ODZ2, CPXM2, ANGPT1 and HTRA3.

Bei der erfindungsgemäßen Verwendung wird zunächst eine Probe biologischen Materials von einem Individuum bereitgestellt und die Stärke der Genexpression mindestens eines der genannten Marker in diesem biologischen Material bestimmt. Dabei kann es vorteilhaft sein, den bei der Bestimmung der Genexpressionsstärke erhalten Messwert mit einem geeigneten Standard zu verglichen.at the use according to the invention is first a sample of biological material provided by an individual and the level of gene expression of at least one of said Marker determined in this biological material. It may be advantageous obtained in determining the gene expression level Measured value compared with a suitable standard.

Wie oben beschrieben kann die Bestimmung der Genexpressionsstärke sowohl auf der Menge der vorhandenen mRNA-Moleküle als auch auf der Menge der vorhandenen Proteinmoleküle des Markers erfolgen.As described above may be the determination of gene expression strength both on the amount of mRNA molecules present also on the amount of protein molecules present Markers done.

Die zugrundeliegende Aufgabe wird gleichfalls durch die Verwendung mindestens eines der Marker SNCA, IGSF4, WNT5A, ODZ2, CPXM2, ANGPT1 und/oder HTRA3 zur Vorhersage des Verlaufs einer neurodegenerativen Erkrankung bzw. der Bestimmung des Stadiums einer progressiv verlaufenden Erkrankung gelöst.The underlying task is also by using at least one of the markers SNCA, IGSF4, WNT5A, ODZ2, CPXM2, ANGPT1 and / or HTRA3 to predict the course of a neurodegenerative disease or determining the stage of a progressive disease solved.

Im Rahmen dieser Verwendung wird in einer bereitgestellten Probe biologischen Materials die Genexpressionsstärke mindestens eines der genannten Marker in dem biologischen Material bestimmt. Um quantitative Messwerte zu erhalten, wird im Rahmen der erfindungsgemäßen Verwendung bevorzugt ein geeigneter Standard, insbesondere ein interner Standard verwendet. Um Aussagen über den Verlauf einer bestimmten neurodegenerativen Erkrankung treffen zu können, wird ein große Anzahl von Daten aus Patienten mit einer bestimmten degenerativen Erkrankung mit unterschiedlichem Schweregrad der Erkrankung bzw. aus unterschiedlichen Stadien dieser Erkrankung benötigt. Verfahren zur Gewinnung derartiger Referenzwerte sind dem Fachmann bekannt.In the context of this use, in a provided sample of biological material, Genex press strength determined at least one of said markers in the biological material. In order to obtain quantitative measured values, a suitable standard, in particular an internal standard, is preferably used in the context of the use according to the invention. In order to be able to make statements about the course of a specific neurodegenerative disease, a large number of data from patients with a specific degenerative disease with different severity of the disease or from different stages of this disease is needed. Methods for obtaining such reference values are known to the person skilled in the art.

Dabei kann die Expressionsstärke eines Markers sowohl anhand der Menge der mRNA als auch der Menge des Proteins des jeweiligen Markers erfolgen.there The expression strength of a marker can be determined both by the amount of mRNA as well as the amount of protein of each Markers done.

Die vorliegende Aufgabe wird gleichfalls durch einen Kit zur Diagnose einer neurodegenerativen Erkrankung gelöst. Ein derartiger Kit weist mindestens ein Molekül auf, mit dem die Stärke der Genexpression mindestens eines Markers in biologischem Material nachgewiesen werden kann. Erfindungsgemäß ist dieser Marker ausgewählt aus der Gruppe bestehend aus SNCA, IGSF4, WNT5A, ODZ2, CPXM2, ANGPT1 und HTRA3. Weiterhin können die Marker CLU und SEPT6 ergänzend hinzugezogen werden.The This object is also achieved by a kit for diagnosis a neurodegenerative disease solved. Such a Kit has at least one molecule with which the starch Gene expression of at least one marker in biological material can be detected. According to the invention this marker is selected from the group consisting of SNCA, IGSF4, WNT5A, ODZ2, CPXM2, ANGPT1 and HTRA3. Furthermore you can the markers CLU and SEPT6 are additionally used.

Das mindestens eine Molekül des Kits ist in einer bevorzugten Ausführungsform ein Oligonukleotid, das chemisch modifiziert sein kann bzw. weitere chemische Gruppen aufweisen kann. In einer bevorzugten Ausführungsform des erfindungsgemäßen Kits ist dieses Oligonukleotid als ein für den spezifischen Nachweis eines der genannten Marker ausgebildeter PCR-Primer oder eine Detektionssonde, etwa eine auf einem Chip angeordneter Probe oder eine Detektionssonde, wie beispielsweise ein Molecular Beacon oder eine Taqman-Probe.The At least one molecule of the kit is in a preferred one Embodiment an oligonucleotide that chemically modifies may be or may have other chemical groups. In a preferred embodiment of the invention Kits is this oligonucleotide as one for the specific Detection of one of the mentioned markers of formed PCR primer or a detection probe, such as a sample placed on a chip or a detection probe, such as a molecular beacon or a Taqman sample.

In einer anderen Ausgestaltung des erfindungsgemäßen Kits ist das Molekül ein Antikörper zum spezifischen Nachweis einer der genannten Marker ist. Dieser Antikörper kann z. B. in der Immunhistochemie oder in Rahmen eines ELISAs dazu verwendet werden, einen der genannten Marker spezifisch nachzuweisen.In another embodiment of the invention Kits, the molecule is an antibody to the specific Detection of one of the mentioned markers. This antibody can z. In immunohistochemistry or as part of an ELISA be used to specifically detect one of said markers.

Die Erfindung umfasst weiterhin Antikörper zum spezifischen Nachweis eines Markers, wobei der Marker ausgewählt ist aus der Gruppe bestehend aus SNCA, IGSF4, WNT5A, ODZ2, CPXM2, ANGPT1 und HTRA3. Ein derartiger Antikörper kann zum spezifischen Nachweis eines der genannten Marker verwendet werden, insbesondere im Rahmen eines ELISAs oder eines immunohistochemischen Nachweises.

SNCA (α-Synuclein, synuclein) mRNA (SEQ ID NO 3)
SNCA (α-Synuclein, synuclein) Protein (SEQ ID NO 4)
IGSF4 (syncam) mRNA (SEQ ID NO 5)
IGSF4 (syncam) Protein (SEQ ID NO 6)
WNT5A mRNA (SEQ ID NO 7)
WNT5A Protein (SEQ ID NO 8)
ODZ2 (Teneurin-2) mRNA (SEQ ID NO 9)
ODZ2 (Teneurin-2) Protein (SEQ ID NO 10)
CPXM2 (carboxipeptidase-2) mRNA (SEQ ID NO 11)
CPXM2 (carboxipeptidase-2) (SEQ ID NO 12)
ANGPT1 mRNA (SEQ ID NO 13)
ANGPT1 Protein (SEQ ID NO 14)
HTRA3 mRNA (SEQ ID NO 15)
HTRA3 Protein (SEQ ID NO 16)

Table 1A PARK6 Patienten Fibroblasten:

Gene Symbol Affy Probe Set ID Affy Patient Taqman assay Taqman Patient PINK1/PARK6 Transkripte mit ähnlichen Änderunge in adulten Patienten und embryonalen Maus PARK6 Fibroblasten: ANGPT1 205609_at –3.92 p = 0.028 Hs00181613_m1 –2.33 p = 0.008 ANGPT1 205608_s_at –3.90 p = 0.016 CPXM2 226824_at –24.12 p = 0.007 Hs00406866_m1 –4.00 p = 0.014 CPXM2 236144_at –19.67 p = 0.003 SERPINB10 Hs00192370_m1 –12.82 p = 0.001 SERPINB7 206421_s_at –31.18 p = 0.024 Hs00186863_m1 –13.15 p = 0.01 Transkripte mit entgegengesetzten Änderungen in adulten Patienten und embryonalen Maus PARK6 Fibroblasten: CLCA2 206166_s_at 6.48 p = 0.003 Hs00197957_m1 5.18 p = 0.024 CLCA2 206165_s_at 5.78 p = 0.008 CLCA2 206164_at 4.42 p = 0.015 CLCA2 217528_at 4.15 p = 0.012 CLU 208791_at 9.75 p = 0.031 Hs00156548_m1 5.70 p = 0.011 CLU 222043_at 8.94 p = 0.022 Hs0017655 10.98 p = 0.005 CLU 208792_s_at 8.36 p = 0.027 GPR153 221902_at 3.84 p = 0.028 Hs00664129_s1 2.86 p = 0.009 GPR153 64942_at 2.38 p = 0.001 HTRA3 226944_at 2.85 p = 0.017 HS01099710_m1 –1.96 p = 0.005 WNT5A 231227_at –12.51 p < 0.0001 Hs00180103_m1 –7.69 p = 0.001 WNT5A 213425_at –10.22 p = 0.005 WNT5A 205990_s_at –9.19 p = 0.003 XPNPEP2 206484_s_at 3.97 p = 0.004 Hs00950918_m1 4.09 p = 0.01 XPNPEP2 216910_at 3.55 p = 0.010 Transkripte mit Änderungen nur in adulten Patienten PARK6 Fibroblasten: BEX1 218332_at –53.56 p = 0.021 Hs00218464_m1 –200.0 p < 0.0001 CPM 235019_at –5.10 p = 0.033 Hs01074151_m1 CPM 206100_at –4.34 p = 0.026 CPM 235706_at –3.64 p = 0.008 DDIT4L 228057_at 9.82 p = 0.0003 Hs00293956_m1 4.00 p = 0.009 DUSP6/MKP3 208893_s_at 3.43 p = 0.043 Hs00169257_m1 1.80 p = 0.03 DUSP6/MKP3 208891_at 2.71 p = 0.040 DUSP6/MKP3 208892_s_at 2.41 p = 0.035 GALNT12 222773_s_at 11.32 p = 0.008 Hs00226436_m1 8.72 p = 0.007 GALNT12 218885_s_at 10.69 p = 0.014 IGSF4/SYNCAM 209031_at –9.98 p = 0.002 Hs00204937_m1 –4.15 p = 0.015 IGSF4/SYNCAM 209030_s_at –5.92 p = 0.004 KLF5 209211_at –3.87 p = 0.006 Hs00156145_m1 –2.14 p = 0.019 KLF5 205608_s_at –3.90 p = 0.016 ODZ2 231867_at –16.22 p = 0.032 Hs00393060_m1 –3.00 p = 0.001 POMZP3 210910_s_at –3.72 p = 0.046 Hs00414110_m1 –2.55 p = 0.001 POMZP3 204148_s_at –3.17 p = 0.021 SCARA3 223842_s_at 3.74 p = 0.025 Hs00800387_s1 3.41 p = 0.01 SCARA3 219416_at 3.00 p = 0.003 Hs00212206_m1 3.26 p = 0.021 SEPT6 212415_at 3.82 p = 0.004 Hs00248408_m1 1.99 p = 0.02 SEPT6 214298_x_at 3.74 p = 0.007 SEPT6 212413_at 3.59 p = 0.003 SEPT6 1555526_a_at 3.56 p = 0.048 SEPT6 212414_s_at 3.15 p = 0.004 SLC16A3/MCT3 202855_s_at –4.21 p = 0.002 Hs00358829_m1 –3.56 p = 0.006 SLC16A3/MCT3 202856_s_at –3.57 p = 0.006 SNCA/PARK1 204466_s_at 8.48 p = 0.0498 Hs01103383_m1 7.74 p < 0.0001 SNCA/PARK1 Hs00240906_m1 5.66 p < 0.002 SNCA/PARK1 Hs01103386_m1 11.18 p < 0.0001

Sequenzen der Affymetrix-Oligonukleotide entsprechend der Affymetrix Internet-Seite: https://www.affymetrix.com/site/login/login.affx

Table 1B PARK6 Maus embryonale Fibroblasten:

Gene Symbol ABI MEF Taqman assay Taqman MEF PINK1/PARK6 –14.15 p = 0.0001 Transkripte mit ähnlichen Änderungen in adulten Patienten und embryonalen MauSPARK6 Fibroblasten: ANGPT1 Mm00456503_m1 –2.78 p < 0.0001 ANGPT1 CPXM2 –5.46 p = 0.0006 Mm00502123_m1 –6.67 p < 0.0001 CPXM2 SERPINB10 –5.54 p = 0.019 Mm01291800_m1 –3.15 p = 0.003 SERPINB7 Mm00452841_m1 –3.85 p = 0.005 Transkripte mit entgegengesetzten Änderungen in adulten Patienten und embryonalen Maus PARK6 Fibroblasten: CLCA2 –5.62 p = 0.008 Mm00661630-m1 –2.33 p < 0.0001 CLCA2 CLCA2 CLCA2 CLU Mm00442773_m1 –3.33 p < 0.0001 CLU CLU GPR153 Mm00805219_g1 –1.59 p = 0.008 GPR153 WNT5A Mm00437347_m1 1.38 p = 0.011 WNT5A WNT5A XPNPEP2 –3.96 p = 0.025 Mm00460007_m1 –2.94 p < 0.0001 XPNPEP2 Transkripte mit Änderungen nur in adulten Patienten PARK6 Fibroblasten: BEX1 Mm00784371_s1 n. s. CPM CPM CPM DDIT4L Mm00513313_m1 n. s. DUSP6/MKP3 Mm00650255_g1 n. s. DUSP6/MKP3 DUSP6/MKP3 GALNT12 Mm00554567_m1 n. s. GALNT12 IGSF4/SYNCAM Mm00457551_m1 n. s. IGSF4/SYNCAM KLF5 Mm00456521_m1 n. s. KLF5 ODZ2 Mm00496219_m1 n. s. POMZP3 Pom121 Mm00455744_m1 n. s. POMZP3 Zp3 Mm00442176_m1 n. s. SCARA3 Mm00553769_m1 n. s. SCARA3 SEPT6 Mm00490843_m1 n. s. SEPT6 SEPT6 SEPT6 SEPT6 SLC16A3/MCT3 Mm00446102_m1 n. s. SLC16A3/MCT3 SNCA/PARK1 Mm00447331_m1 n. s. SNCA/PARK1 Mm00447333_m1 n. s. SNCA/PARK1

Tabelle 2: Veränderte mRNA-Level der erfindungsgemäßen Marker in Hautproben von Patienten mit erblich bedingter PD (Hautbiopsien von 3 homozygoten und 3 heterozygoten von Trägern der G309D-PINK1-Mutation, 2 Kontrollen)

Gen Microarray (Affimetrix) qPCR (Taqman^®) SNCA 8,48 p = 0,0498 7,74 p < 0,0001 CPXM2 –24,12 p = 0,007 –4,00 p = 0,014 WNT5A –12,51 p < 0,0001 –7,69 p = 0,001 IGSF4 –9,98 p = 0,002 –4,15 p = 0,015 ODZ2 –16,22 p = 0,032 –3,00 p = 0,001 ANGPT1 –3,92 p = 0,028 –2,33 p = 0,008

The invention further comprises antibodies for the specific detection of a marker, wherein the marker is selected from the group consisting of SNCA, IGSF4, WNT5A, ODZ2, CPXM2, ANGPT1 and HTRA3. Such an antibody can be used for the specific detection of one of the mentioned markers, in particular in the context of an ELISA or an immunohistochemical detection.

Table 1A PARK6 patient fibroblasts:

Gene symbol Affy sample set ID Affine patient Taqman assay Taqman patient PINK1 / PARK6 Transcripts with similar alterations in adult patients and embryonic mouse PARK6 fibroblasts: ANGPT1 205609_at -3.92 p = 0.028 Hs00181613_m1 -2.33 p = 0.008 ANGPT1 205608_s_at -3.90 p = 0.016 CPXM2 226824_at -24.12 p = 0.007 Hs00406866_m1 -4.00 p = 0.014 CPXM2 236144_at -19.67 p = 0.003 SERPINB10 Hs00192370_m1 -12.82 p = 0.001 SERPINB7 206421_s_at -31.18 p = 0.024 Hs00186863_m1 -13.15 p = 0.01 Transcripts with opposite changes in adult patients and embryonic mouse PARK6 fibroblasts: CLCA2 206166_s_at 6.48 p = 0.003 Hs00197957_m1 5.18 p = 0.024 CLCA2 206165_s_at 5.78 p = 0.008 CLCA2 206164_at 4.42 p = 0.015 CLCA2 217528_at 4.15 p = 0.012 CLU 208791_at 9.75 p = 0.031 Hs00156548_m1 5.70 p = 0.011 CLU 222043_at 8.94 p = 0.022 Hs0017655 10.98 p = 0.005 CLU 208792_s_at 8.36 p = 0.027 GPR153 221902_at 3.84 p = 0.028 Hs00664129_s1 2.86 p = 0.009 GPR153 64942_at 2.38 p = 0.001 HTRA3 226944_at 2.85 p = 0.017 HS01099710_m1 -1.96 p = 0.005 Wnt5a 231227_at -12.51 p <0.0001 Hs00180103_m1 -7.69 p = 0.001 Wnt5a 213425_at -10.22 p = 0.005 Wnt5a 205990_s_at -9.19 p = 0.003 XPNPEP2 206484_s_at 3.97 p = 0.004 Hs00950918_m1 4.09 p = 0.01 XPNPEP2 216910_at 3.55 p = 0.010 Transcripts with changes only in adult patients PARK6 fibroblasts: BEX1 218332_at -53.56 p = 0.021 Hs00218464_m1 -200.0 p <0.0001 CPM 235019_at -5.10 p = 0.033 Hs01074151_m1 CPM 206100_at -4.34 p = 0.026 CPM 235706_at -3.64 p = 0.008 DDIT4L 228057_at 9.82 p = 0.0003 Hs00293956_m1 4.00 p = 0.009 DUSP6 / MKP3 208893_s_at 3.43 p = 0.043 Hs00169257_m1 1.80 p = 0.03 DUSP6 / MKP3 208891_at 2.71 p = 0.040 DUSP6 / MKP3 208892_s_at 2.41 p = 0.035 GALNT12 222773_s_at 11.32 p = 0.008 Hs00226436_m1 8.72 p = 0.007 GALNT12 218885_s_at 10.69 p = 0.014 IGSF4 / SYNCAM 209031_at -9.98 p = 0.002 Hs00204937_m1 -4.15 p = 0.015 IGSF4 / SYNCAM 209030_s_at -5.92 p = 0.004 KLF5 209211_at -3.87 p = 0.006 Hs00156145_m1 -2.14 p = 0.019 KLF5 205608_s_at -3.90 p = 0.016 ODZ2 231867_at -16.22 p = 0.032 Hs00393060_m1 -3.00 p = 0.001 POMZP3 210910_s_at -3.72 p = 0.046 Hs00414110_m1 -2.55 p = 0.001 POMZP3 204148_s_at -3.17 p = 0.021 SCARA3 223842_s_at 3.74 p = 0.025 Hs00800387_s1 3.41 p = 0.01 SCARA3 219416_at 3.00 p = 0.003 Hs00212206_m1 3.26 p = 0.021 SEPT6 212415_at 3.82 p = 0.004 Hs00248408_m1 1.99 p = 0.02 SEPT6 214298_x_at 3.74 p = 0.007 SEPT6 212413_at 3.59 p = 0.003 SEPT6 1555526_a_at 3.56 p = 0.048 SEPT6 212414_s_at 3.15 p = 0.004 SLC16A3 / MCT3 202855_s_at -4.21 p = 0.002 Hs00358829_m1 -3.56 p = 0.006 SLC16A3 / MCT3 202856_s_at -3.57 p = 0.006 SNCA / PARK1 204466_s_at 8.48 p = 0.0498 Hs01103383_m1 7.74 p <0.0001 SNCA / PARK1 Hs00240906_m1 5.66 p <0.002 SNCA / PARK1 Hs01103386_m1 11.18 p <0.0001

Sequences of the Affymetrix oligonucleotides according to the Affymetrix Internet site: https://www.affymetrix.com/site/login/login.affx

Table 1B PARK6 mouse embryonic fibroblasts:

Gene symbol ABI MEF Taqman assay Taqman MEF PINK1 / PARK6 -14.15 p = 0.0001 Transcripts with similar changes in adult patients and embryonic MauSPARK6 fibroblasts: ANGPT1 Mm00456503_m1 -2.78 p <0.0001 ANGPT1 CPXM2 -5.46 p = 0.0006 Mm00502123_m1 -6.67 p <0.0001 CPXM2 SERPINB10 -5.54 p = 0.019 Mm01291800_m1 -3.15 p = 0.003 SERPINB7 Mm00452841_m1 -3.85 p = 0.005 Transcripts with opposite changes in adult patients and embryonic mouse PARK6 fibroblasts: CLCA2 -5.62 p = 0.008 Mm00661630-m1 -2.33 p <0.0001 CLCA2 CLCA2 CLCA2 CLU Mm00442773_m1 -3.33 p <0.0001 CLU CLU GPR153 Mm00805219_g1 -1.59 p = 0.008 GPR153 Wnt5a Mm00437347_m1 1.38 p = 0.011 Wnt5a Wnt5a XPNPEP2 -3.96 p = 0.025 Mm00460007_m1 -2.94 p <0.0001 XPNPEP2 Transcripts with changes only in adult patients PARK6 fibroblasts: BEX1 Mm00784371_s1 ns CPM CPM CPM DDIT4L Mm00513313_m1 ns DUSP6 / MKP3 Mm00650255_g1 ns DUSP6 / MKP3 DUSP6 / MKP3 GALNT12 Mm00554567_m1 ns GALNT12 IGSF4 / SYNCAM Mm00457551_m1 ns IGSF4 / SYNCAM KLF5 Mm00456521_m1 ns KLF5 ODZ2 Mm00496219_m1 ns POMZP3 Pom121 Mm00455744_m1 ns POMZP3 zp3 Mm00442176_m1 ns SCARA3 Mm00553769_m1 ns SCARA3 SEPT6 Mm00490843_m1 ns SEPT6 SEPT6 SEPT6 SEPT6 SLC16A3 / MCT3 Mm00446102_m1 ns SLC16A3 / MCT3 SNCA / PARK1 Mm00447331_m1 ns SNCA / PARK1 Mm00447333_m1 ns SNCA / PARK1

Table 2: Altered mRNA levels of the markers according to the invention in skin samples from patients with hereditary PD (skin biopsies of 3 homozygous and 3 heterozygotes of carriers of the G309D PINK1 mutation, 2 controls)

gene Microarray (Affimetrix) qPCR (Taqman ^®) SNCA 8.48p = 0.0498 7.74p <0.0001 CPXM2 -24.12 p = 0.007 -4.00p = 0.014 Wnt5a -12.51 p <0.0001 -7.69 p = 0.001 IGSF4 -9.98 p = 0.002 -4.15 p = 0.015 ODZ2 -16.22 p = 0.032 -3.00 p = 0.001 ANGPT1 -3.92 p = 0.028 -2.33 p = 0.008

Figurencharacters

Die Erfindung wird nun anhand der Figuren erläutert. Es zeigen:The Invention will now be explained with reference to FIGS. Show it:

1: Generierung und Charakterisierung der Pink1^-/- Maus.

(A) stellt in einer schematischen Zeichnung die Targeting-Strategie dar.
(B) Darstellung des Allels, das die homologe Rekombination am PINK1 Locus repräsentiert; Southern Blotting der äußeren Sonde in der embryonalen Stammzelllinie.
(C) Die An- bzw. Abwesenheit des PINK1 Transkriptes in drei Geweben, nämlich der Homozygoten (hom) Mutante versus der Heterozygoten (het) Mutante und Wildtyp (wt) Mäusen mittels Northern Blotting, unter Verwendung β-Aktin als Kontrolle für gleiche Ausgangsmengen.

1 : Generation and Characterization of the Pink1 ^{- / -} Mouse.

(A) illustrates in a schematic drawing the targeting strategy.
(B) representation of the allele representing homologous recombination at the PINK1 locus; Southern blotting of the outer probe in the embryonic stem cell line.
(C) The presence or absence of the PINK1 transcript in three tissues, namely the homozygous (hom) mutant versus the heterozygous (het) mutant and wild-type (wt) mice by Northern blotting, using β-actin as controls for equal levels ,

2: Im Striatum von 18 Monate alten Snca^-/- Mäusen war die Transkription von Igsf4 signifikant vermindert. 2 : In the striatum of 18-month old Snca ^{- / -} mice the transcription of Igsf4 was significantly reduced.

3: Validierung der signifikanten Expressionsänderung im humanen Fibroblasten, wobei eine Hochregulation des SNCA Transkriptes in Kontrollfibroblasten einen Tag nach oxidativem Stress gezeigt ist. 3 : Validation of significant expression change in human fibroblast showing upregulation of the SNCA transcript in control fibroblasts one day after oxidative stress.

4: Validierung der signifikanten Expressionsänderung in humanen Fibroblasten, wobei eine erhöhte Proteinkonzentration für BCL-2, β-Clusterin und Septin-6 in PARK6-Patienten (hom) im Vergleich zu Kontroll(con)-Fibroblasten gezeigt ist. 4 : Validation of significant expression change in human fibroblasts showing increased protein concentration for BCL-2, β-clusterin and septin-6 in PARK6 patients (hom) compared to control (con) fibroblasts.

5: Reduktion des (2A, 2B) basalen mitochondralen Membranpotentials in dissoziierten Zellen und isolierten Mitochondrien von Pink1^-/- Gehirn und von (2C) basalen ATP-Konzentrationen in Pink1^-/- Gehirn und von (2D-F) mitochondralem Import in Pink1^-/- Mäuselebermitochondrien und in (2G) menschlichen PARK6 Fibroblasten. 5 : Reduction of (2A, 2B) basal mitochondrial membrane potential in dissociated cells and isolated mitochondria of Pink1 ^{- / -} brain and (2C) basal ATP concentrations in Pink1 ^{- / -} brain and (2D-F) mitochondrial import in Pink1 ^{- /} Mouse liver mitochondria and in (2G) human PARK6 fibroblasts.

6: Der Phänotyp von Pink1^-/- Mäusen über die Zeit:
(A) das Körpergewicht war während der präsymptomatischen Phase konsistent reduziert. Im fortgeschrittenen Alter von 16 bis 18 Monaten (B) wurde eine Reduktion der spontanen Bewegung (C) eine Erhöhung von Snca, Igsf4 und von Odz2 Transkriptionsleveln mit gleichzeitiger Abnahme von Wnt5A und Clu Transkriptionsleveln im Striatum aller knock-out (KO) versus Wildtyp (wt) Mäusen beobachtet. Individuelle Tiere zeigten (B) einen Buckel, (E) Erhöhungen von α-Synuclein, Clusterin, Septin-6 und Tyrosinhydroxylase im Vergleich zu β-Aktinproteinkonzentrationen im Hirnstamm nach Western Blotting. (F) Individuelle Tiere zeigten weiterhin eine Induktion von α-Synuclein Immunoreaktivität in histochemischen Schnitten des dorsalen motorischen Vaguskerns des Hirnstamms. 6 : The phenotype of Pink1 ^{- / -} mice over time:
(A) Body weight was consistently reduced during the presymptomatic phase. At the advanced age of 16 to 18 months (B) a reduction of spontaneous movement (C) was an increase of Snca, Igsf4 and of Odz2 transcriptional levels with concomitant decrease of Wnt5A and Clu transcriptional levels in the striatal of all knock-out (KO) versus wild-type ( wt) mice. Individual animals showed (B) a hump, (E) increases in α-synuclein, clusterin, septin-6 and tyrosine hydroxylase compared to brainstem β-actin protein levels after Western blotting. (F) Individual animals also showed induction of α-synuclein immunoreactivity in histochemical sections of the dorsal motor vagus kernels of the brain stem.

7: In Patientenfibroblasten waren die Transkriptionskonzentrationen von WNT5A, IGSF4, ODZ2 und CPXM2 sowohl für Morbus Parkinson als auch für Morbus Alzheimer verringert, wobei im Fall des SNCA Transkripts eine Erhöhung beobachtet wurde, die spezifisch für Morbus Parkinson ist. 7 : In patient fibroblasts, transcriptional levels of WNT5A, IGSF4, ODZ2, and CPXM2 were reduced for both Parkinson's disease and Alzheimer's disease, with an increase specific for Parkinson's disease in the case of the SNCA transcript.

BeispieleExamples

Im Folgenden wird die Erfindung anhand von Beispielen mit Bezug auf die Figuren erläutert.in the Below, the invention will be described by way of example with reference to FIG the figures explained.

1. Materialien und Methoden1. Materials and Methods

Fibroblastenfibroblasts

Nach Genehmigung durch die örtlichen Ethikkommissionen und schriftlicher Einwilligungserklärung wurden Hautbiopsien von drei homozygoten Patienten (hom) und drei heterozygoten Trägern (het) der G309D-PINK1 Mutation sowie von zwei Kontroll-Individuen ähnlichen Alters entnommen. Primäre Fibroblasten wurden gezüchtet wie früher beschrieben ( H. H. Hoepken, S. Gispert, B. Morales et al., Neurobiol Dis 25 (2), 401 (2007) ) und benutzt zwischen Passagen 6 bis 13. Zusätzliche Fibroblasten von fünf Patienten mit Altersparkinson (Erkrankungsalter über 50 Jahren) (Katalog # AG08245, AG08395, AG20439, AG20442, AG20446), 3 Patienten mit Alzheimer (sporadisch mit Beginn im Alter bei AG08527, familiär bei AG09908 mit einer N141I-Presenilin-2 Mutation, familiär bei AG06840 mit einer A246E-Presenilin-1 Mutation) und 2 Kontrollpersonen (AG02261, AG16102) wurden kommerziell von einem Zell-Linien Depot beschafft ( www.coriell.org ). Besondere Sorgfalt wurde aufgewandt für die standardisierte simultane Kultur der Zelllinien und für ein konstantes Zeitintervall zwischen der Trypsinierung als Manipulation der Zelladhäsion und der Zellextraktion für Biomarker-Analysen. Um Maus embryonale Fibroblasten (MEF) Linien zu etablieren, wurden individuelle Föten aus der Gebärmutter eines schwangeren Weibchens isoliert, der Kopf und die Eingeweide wurden verworfen, die Haut wurde in kleine Stücke geschnitten und in DMEM mit 5 × Penicillin/Streptomycin für 15 min gewaschen, in PBS gewaschen und mit HyQtase (Hyclone) für 30 min bei 37°C inkubiert, für 5 Minuten bei 800 rpm zentrifugiert um HyQtase zu entfernen, das Gewebe in DMEM mit 25 mmol/l Glucose und 15% bovinem Serum suspendiert, in 6-well-Platten verbracht und bei 37°C inkubiert. Das Medium wurde jeden Tag gewechselt. Nach 5 bis 6 Tagen mit nahezu konfluenten Platten wurden die MEF Kulturen nach Standardprotokollen geteilt.Skin biopsies were obtained from three homozygous patients (hom) and three heterozygous carriers (het) of the G309D-PINK1 mutation and from two control individuals of similar age, after approval by the local ethics committees and written informed consent. Primary fibroblasts were cultured as previously described ( HH Hoepken, S. Gispert, B. Morales et al., Neurobiol Dis 25 (2), 401 (2007) ) and uses between passages 6 to 13. Additional fibroblasts from five patients with age-parkinsonian disease (over 50 years of age) (catalog # AG08245, AG08395, AG20439, AG20442, AG20446), 3 patients with Alzheimer's disease (sporadic with onset at AG08527, familial in AG09908 with a N141I presenilin-2 mutation, familial in AG06840 with an A246E presenilin-1 mutation) and 2 control persons (AG02261, AG16102) were obtained commercially from a cell line depot ( www.coriell.org ). Special care has been taken for the standardized simultaneous culture of cell lines and for a constant time interval between trypsinization as manipulation of cell adhesion and cell extraction for biomarker analyzes. In order to establish mouse embryonic fibroblast (MEF) lines, individual fetuses were isolated from the uterus of a pregnant female, the head and viscera were discarded, the skin was cut into small pieces and washed in DMEM with 5x penicillin / streptomycin for 15 min , washed in PBS and incubated with HyQtase (Hyclone) for 30 min at 37 ° C, centrifuged for 5 minutes at 800 rpm to remove HyQtase, the tissue suspended in DMEM with 25 mmol / l glucose and 15% bovine serum, in 6 Well plates and incubated at 37 ° C. The medium was changed every day. After 5-6 days with nearly confluent plates, the MEF cultures were split according to standard protocols.

H₂O₂ InkubationH ₂ O ₂ incubation

Die Fibroblastenlinie AG16102 wurde mit 100 μmol/l Hydrogenperoxid bei 37°C für eine Stunde in Inkubationspuffer (20 mmol/l HEPES, 5 mmol/l Glucose, 145 mmol/l NaCl, 1,8 mmol/l CaCl₂, 5,4 mmol/l KCl, 1 mmol/l MgCl₂, 0,8 mmol/l Na₂HPO₄, pH 7,4) inkubiert. Kontrollzellen wurden nur in Inkubationspuffer für eine Stunde inkubiert. Nach Entfernung des Inkubationspuffers erholten sich die Zellen für 23 Stunden in DMEM mit 10% fötalem Kalbsserum, bevor die RNA isoliert wurde.The fibroblast line AG16102 was incubated with 100 μmol / l hydrogen peroxide at 37 ° C for one hour in incubation buffer (20 mmol / l HEPES, 5 mmol / l glucose, 145 mmol / l NaCl, 1.8 mmol / l CaCl ₂ , 5.4 mmol / l KCl, 1 mmol / l MgCl ₂ , 0.8 mmol / l Na ₂ HPO ₄ , pH 7.4). Control cells were incubated only in incubation buffer for one hour. After removal of the incubation buffer, the cells recovered for 23 hours in DMEM with 10% fetal calf serum before RNA was isolated.

Iranskript-KonzentrationenIran script concentrations

Gesamt RNA wurde mit dem RNeasy mini kit (Qiagen) isoliert, von 4 × 10⁶ Fibroblasten gemäß den Anleitungen des Herstellers. Die Transkriptom-Analyse mit Affymetrix U133 Plus 2.0 Microarray Chips wurde durchgeführt wie bereits beschrieben ( T. S. Benamer, J. Patterson, D. G. Grosset et al., Mσv Disord 15 (3), 503 (2000) ) in 3 homozygoten G309D-PINK1 Patienten versus Kontrollpersonen. Transkriptom-Analyse mit ABI microarray V1 Chips wurde von einem kommerziellen Dienstleister (IMGM, Martinsried) durchgeführt, gemäß Anleitungen des Herstellers ( G. E. Gibson and H. M. Huang, Front Biosci 7, d1007 (2002) ), in 3 mutanten versus 3 wildtyp MEFS. qPCR wurde in unabhängigen Fibroblasten-Kulturen von 3 PARK6 Patienten und 5 PD Patienten versus 4 Alters-korrelierte Kontrollpersonen durchgeführt, und in unabhängigen embryonalen Fibroblasten-Kulturen von 4 Pink1^-/- Mäusen versus 6 wildtyp-Geschwistern. 18 Monate alte Mausgehirne wurden seziert, eine Hemisphäre für RNA benutzt, die andere Hemisphäre für Proteinextraktion. Cerebellum, Hirnstamm, Mittelhirn und Cortex wurden separat mit Trizol (Invitrogen) entsprechend den Anleitungen des Herstellers extrahiert. Die RNA aus Striatum wurde mit dem RNeasy Lipid Tissue Mini Kit von Qiagen extrahiert. Gesamt RNA wurde mit DNAse Amplification Grade (Invitrogen) verdaut, zwei Mikrogramm wurden revers transkribiert in 33 μl, unter Benutzung von pd(N)₆ und NotId(T)₁₈ Oligonukleotiden und dem First Strand cDNA Synthesis Kit (Amersham Bioscience), und die qPCR wurde in 20 μl auf einem ABI Prism 5700 Sequence Detection System mit Taqman-Assays von Applied Biosystems und Tbp (Mm00446973_m1) als interner Kontrolle durchgeführt. Expressionsveränderungen wurden sowohl mit der 2^–ΔΔCt Methode und der REST2005 Software analysiert. Im Gehirn wurden die Veränderungen von Adhäsions-Tanskripten (für Snca, Mm00447331_m1 und Dat/Slc6a3, Mm00438388_m1) validiert nach unabhängiger cDNA Synthese mit SuperScript III Reverser Transcriptase in einer qPCR mit Ywhaz (Mm01158417_g1) und Gapdh (Mm99999915_g1) als interner Kontrolle.Total RNA was isolated with the RNeasy mini kit (Qiagen) from 4 x 10 ⁶ fibroblasts according to the manufacturer's instructions. Transcriptome analysis with Affymetrix U133 Plus 2.0 microarray chips was performed as previously described ( TS Benamer, J. Patterson, DG Grosset et al., Mσv Disord 15 (3), 503 (2000) ) in 3 homozygous G309D-PINK1 patients versus controls. Transcriptome analysis with ABI microarray V1 chips was performed by a commercial service provider (IMGM, Martinsried) according to the manufacturer's instructions ( Gibson and HM Huang, Front Biosci 7, d1007 (2002) ), in 3 mutant versus 3 wild MEFS. qPCR was performed in independent fibroblast cultures of 3 PARK6 patients and 5 PD patients versus 4 age-matched controls, and in independent embryonic fibroblast cultures of 4 Pink1 ^{- / -} mice versus 6 wild-type siblings. 18-month-old mouse brains were dissected, one hemisphere used for RNA, the other hemisphere for protein extraction. Cerebellum, brainstem, midbrain, and cortex were extracted separately with trizol (Invitrogen) according to the manufacturer's instructions. Striatum RNA was extracted with Qiagen's RNeasy Lipid Tissue Mini Kit. Total RNA was digested with DNAse Amplification Grade (Invitrogen), two micrograms were reverse transcribed in 33 μl, using pd (N) ₆ and NotId (T) ₁₈ oligonucleotides and the First Strand cDNA Synthesis Kit (Amersham Bioscience), and the qPCR was performed in 20 μl on an ABI Prism 5700 Sequence Detection System with Taqman Assays from Applied Biosystems and Tbp (Mm00446973_m1) as an internal control. Expression changes were made using both the 2 ^-ΔΔCt method and the REST2005 software analyzed. In the brain, the changes of adhesion tanscripts (for Snca, Mm00447331_m1 and Dat / Slc6a3, Mm00438388_m1) were validated after independent cDNA synthesis with SuperScript III reverse transcriptase in a qPCR with Ywhaz (Mm01158417_g1) and Gapdh (Mm99999915_g1) as internal control.

Protein ValidierungProtein validation

Protein-Extrahierung und Western blotting wurden durchgeführt wie bereits beschrieben ( H. H. Hoepken, S. Gispert, B. Morales et al., Neurobiol Dis 25 (2), 401 (2007) ), mit primären Antikörper Titern wie folgt: anti-α-Synuclein (1:500, BD Transduction Laboratories), anti-β-Actin (1:10000, Sigma), anti-β-clusterin (1:200, Santa Cruz Biotechnology, Inc.), anti-Septin-6 (1:200, Santa Cruz Biotechnology, Inc.), anti-BCL-2, (sc-23960: 1:100, sc-509: 1:100, beide Santa Cruz Biotechnology, Inc.). Für Densitometrie, wurde die Image Master Total Lab Software (Amersham Pharmacia) benutzt.Protein extraction and Western blotting were performed as previously described ( HH Hoepken, S. Gispert, B. Morales et al., Neurobiol Dis 25 (2), 401 (2007) ) with primary antibody titers as follows: anti-α-synuclein (1: 500, BD Transduction Laboratories), anti-β-actin (1: 10,000, Sigma), anti-β-clusterin (1: 200, Santa Cruz Biotechnology , Inc.), anti-Septin-6 (1: 200, Santa Cruz Biotechnology, Inc.), anti-BCL-2, (sc-23960: 1: 100, sc-509: 1: 100, both Santa Cruz Biotechnology , Inc.). For densitometry, Image Master Total Lab software (Amersham Pharmacia) was used.

Generierung der Pink1^-/- MäuseGeneration of Pink1 ^{- / -} mice

Eine Bibliothek von Bakteriellen Artifiziellen Chromosomen, konstruiert vom Mausgenom der Linie 129 SvEv wurde mit einer cDNA Pink1 Sonde durchsucht. Ein Zielvektor wurde mit einem 4,2 kb NheI/NheI Fragment konstruiert, das die Exone II, III, IV and V beinhal tete. Im Exon IV wurde die Mutation g/a in Position 8343 der Position NT_039267 (was die pathogene G309D Mutation ergibt) bereits vorher mit dem QuickChange Site Directed Mutagenesis Kit (Stratagene) und den Oligonukleotiden ctacccagaaggcctggaccacggtcgtacactg (SEQ ID NO 1) und cagtgtacgaccgtggtccaggccttctgggtag (SEQ ID NO 2) innerhalb eines 3,2 kb NheI/BstZ17I Fragments (1A) eingeführt. Embryonale Stammzell(ES)-Kolonien mit Resistenz für Neomycin und Aminoglykosid G418 wurden mit Southern blotting (AccI Verdau und äußere Sonde) durchsucht, um korrekt inserierte Zellklone zu identifizieren (1B) und diese für Blastozysten Injektionen zu benutzen. Die mutante Mauslinie wurde in einem ingezüchteten 129 SvEv Hintergrund aufrechterhalten. Genomische DNA wurde von Schwanzbiopsien isoliert und RNA vom Gehirn, Leber und Skelettmuskel isoliert, um die erfolgreiche Mutation zu demonstrieren und die Expression zu testen.A library of bacterial artificial chromosomes constructed from the mouse genome of line 129 SvEv was screened with a cDNA Pink1 probe. A target vector was constructed with a 4.2 kb NheI / NheI fragment containing exons II, III, IV and V. In exon IV, mutation g / a at position 8343 of position NT_039267 (yielding the pathogenic G309D mutation) was previously preceded by the QuickChange Site Directed Mutagenesis Kit (Stratagene) and the oligonucleotides ctacccagaaggcctggaccacggtcgtacactg (SEQ ID NO 1) and cagtgtacgaccgtggtccaggccttctgggtag (SEQ ID NO 2) within a 3.2 kb NheI / BstZ17I fragment ( 1A ) introduced. Embryonic stem cell (ES) colonies with resistance to neomycin and aminoglycoside G418 were screened by Southern blotting (AccI digestion and outer probe) to identify correctly inserted cell clones ( 1B ) and to use these for blastocyst injections. The mutant mouse line was maintained in an inbred 129 SvEv background. Genomic DNA was isolated from tail biopsies and RNA isolated from the brain, liver, and skeletal muscle to demonstrate the successful mutation and to test expression.

Mitochondriales Membranpotential (Δψm) und ATP KonzentrationMitochondrial membrane potential (Δψm) and ATP concentration

Dissoziierte Hirnzellen wurden präpariert wie bereits beschrieben ( M. Kuhn, K. Haebig, M. Bonin et al., Neurogenetics 8 (2), 71 (2007) ). Um ihr Δψm zu detektieren, wurden die Zellen in „24-wells" ausplatiert und für 15 Minuten mit 0,4 mmol/l des Fluoreszenzfarbstoffes Rhodamin 123 (R123) inkubiert. Die ATP Spiegel in dissoziierten Hirnzellen wurden mit der biolumineszenten Messung von ATP bestimmt, wie publiziert ( S. J. Walker and K. A. Grant, Alcohol 38 (1), 1 (2006) ). Die Präparierung von isolierten Mitochondrien wurde durchgeführt wie veröffentlicht ( U. Keil, I. Scherping, S. Hauptmann et al., British journal of pharmacology 147 (2), 199 (2006) ), durch Messung des Δψm mit R123 bei einer finalen Konzentration von 0,4 μmol/l mit dem Victor Multiplate Reader (Perkin Elmer Life Sciences) bei 490 nm (Anregung)/535 nm (Emission). Die Ergebnisse (n = 8) wurden als Fluoreszenz-Einheiten pro mg/ml Protein dargestellt.Dissociated brain cells were prepared as already described ( Kuhn, K., Haebig, M. Bonin et al., Neurogenetics 8 (2), 71 (2007) ). To detect their Δψm, the cells were plated in "24-wells" and incubated for 15 minutes with 0.4 mmol / l of the fluorescent dye rhodamine 123 (R123) .The ATP levels in dissociated brain cells were determined by the bioluminescent measurement of ATP as published ( SJ Walker and KA Grant, Alcohol 38 (1), 1 (2006) ). The preparation of isolated mitochondria was performed as published ( U. Keil, I. Scherping, S. Hauptmann et al., British Journal of Pharmacology 147 (2), 199 (2006) ) by measuring the Δψm with R123 at a final concentration of 0.4 μmol / L with the Victor Multiplate Reader (Perkin Elmer Life Sciences) at 490 nm (excitation) / 535 nm (emission). The results (n = 8) were presented as fluorescence units per mg / ml protein.

Mitochondrialer ImportMitochondrial import

Isolierung von Mitochondrien aus Mausleber: Das Tier wurde geopfert durch Enthauptung und von der Bauchseite geöffnet. Die Leber wurde auf eine eisgekühlte Porzellanschale gelegt und in Lösung A gewaschen (0,22 mol/l Mannitol, 0,07 mol/l Sucrose, 0,02 mol/l HEPES, pH 7,6, 1 mmol/l EDTA, 0,1% BSA, 1 mmol/l PMSF). Darauf wurde es zerkleinert und homogenisiert mit 20 hoch-und-runter Bewegungen in einem Glas Homogenisator mittels eines Teflon Stößels. Das Homogenat wurde bei 1,500 g für 5 Minuten zentrifugiert. Der Überstand wurde bei 10,000 g für 10 Minuten zentrifugiert. Der resultierende Bodensatz wurde resuspendiert in Lösung B (0,22 mol/l Mannitol, 0,07 mol/l Sucrose, 0,02 mol/l HEPES, pH 7,6, 1 mmol/l EDTA, 1 mmol/l PMSF) und zentrifugiert bei 1,500 g für 5 Minuten. Der Überstand wurde wieder abzentrifugiert bei 10,000 g für 10 Minuten. Die zwei letzten Schritte wurden zweimal wiederholt und der letzte Bodensatz wurde resuspendiert in Lösung B ohne PMSF.insulation of mitochondria from mouse liver: The animal was sacrificed by decapitation and opened from the ventral side. The liver was on one ice-cold porcelain dish laid and in solution A washed (0.22 mol / l mannitol, 0.07 mol / l sucrose, 0.02 mol / l HEPES, pH 7.6, 1 mmol / L EDTA, 0.1% BSA, 1 mmol / L PMSF). On it was It crushes and homogenizes with 20 up-and-down movements in a glass homogenizer by means of a Teflon pestle. The homogenate was centrifuged at 1.500 g for 5 minutes. The supernatant was at 10,000 g for 10 minutes centrifuged. The resulting pellet was resuspended in Solution B (0.22 mol / l mannitol, 0.07 mol / l sucrose, 0.02 mol / l HEPES, pH 7.6, 1 mmol / l EDTA, 1 mmol / l PMSF) and centrifuged at 1.500 g for 5 minutes. The supernatant was again centrifuged at 10,000 g for 10 minutes. The two last steps were repeated twice and the last dregs was resuspended in solution B without PMSF.

Isolierung von Mitochondrien aus kultivierten Fibroblasten: Die Zellen wurden durch Trypsinierung geerntet, in Phosphat-gepufferter Salzlösung gewaschen und in Lösung A resuspendiert (0,22 mol/l Mannitol, 0,07 mol/l Sucrose, 0,02 mol/l HEPES, pH 7,6, 1 mmol/l EDTA, 0,1% BSA, 1 mmol/l PMSF). Die Suspension wurde homogenisiert mit 20 Bewegungen mittels eines Glas-Homogenisators und eines Teflon-Stößels. Das Homogenat wurde bei 1,000 g für 5 Minuten zentrifugiert. Der Überstand wurde bei 14,500 g für 10 Minuten zentrifugiert. Der resultierende Bodensatz wurde resuspendiert in Lösung B (0,22 mol/l Mannitol, 0,07 mol/l Sucrose, 0,02 mol/l HEPES, pH 7,6, 1 mol/l EDTA, 1 mmol/l PMSF) und zentrifugiert bei 1,500 g für 5 Minuten. Der Überstand wurde wieder abzentrifugiert bei 14,500 g für 10 Minuten. Die zwei letzten Schritte wurden zweimal wiederholt und der letzte Bodensatz wurde resuspendiert in Lösung B ohne zugefügtes PMSF.Isolation of Mitochondria from Cultured Fibroblasts: The cells were harvested by trypsinization, washed in phosphate buffered saline and resuspended in Solution A (0.22 mol / l mannitol, 0.07 mol / l sucrose, 0.02 mol / l HEPES, pH 7.6, 1 mmol / l EDTA, 0.1% BSA, 1 mmol / l PMSF). The suspension was homogenized with 20 movements by means of a glass homogenizer and a Teflon pestle. The homogenate was centrifuged at 1,000 g for 5 minutes. The supernatant was centrifuged at 14,500 g for 10 minutes. The resulting pellet was resuspended in solution B (0.22 mol / l mannitol, 0.07 mol / l sucrose, 0.02 mol / l HEPES, pH 7.6, 1 mol / l EDTA, 1 mmol / l PMSF). and centrifuged at 1.500 g for 5 minutes. The supernatant was again collected by centrifugation at 14,500 g for 10 minutes. The last two steps were repeated twice and the last pellet was resuspended in solution B without added PMSF.

In vitro Import von Präproteinen in isolierte MitochondrienIn vitro import of preproteins in isolated mitochondria

Die Synthese von radioaktiv markierter Prä-Ornithin-Transcarbamylase (pOTC) wurde durchgeführt mittels in vitro Transkription und Translation in Kaninchen Retikulozyten Lysate in Gegenwart von [³⁵S]-Methionin (TNT-gekoppeltes Reticulozyten Lysat System, Promega). Für die Import Reaktionen wurden isolierte Mitochondrien in Import-Puffer verdünnt (20 mmol/l HEPES-KOH, pH 7,6, 250 mmol/l Sucrose, 5 mmol/l MgAc, 160 mmol/l KAc, 5 mmol/l Succinat, 5 mmol/l Malat, 1 mmol/l DTT) bis zu einer finalen Konzentration von 125 bis 250 μg/ml. ATP wurde hinzugefügt bis zu einer finalen Konzentration von 3 mmol/l. In einer Kontrollprobe wurde das Membranpotential (Δψm) zerstreut durch Zugabe von einer Mischung von Potential Inhibitoren bestehend aus Antimycin A (finale Konzentration (f. K.): 8 μmol/l), Valinomycin (f. K.: 0,5 μmol/l), und Oligomycin (f. K.: 2 μmol/l). Nach Inkubation für 3 Minuten bei 30°C wurden die Importreaktionen gestartet durch Zugabe von Reticulozyten Lysat mit pOTC und Inkubation bei 30°C. Die Import Reaktionen wurden gestoppt durch Zugabe von 1 μM des K⁺-Ionophors Valinomycin. Um non-importierte Präproteine zu entfernen, wurde Trypsin hinzugefügt bis zu einer finalen Konzentration von 50 μg/ml. Nach Protease Behandlung über 35 Minuten auf Eis wurden 400 μg/ml Trypsin-Inhibitor und 1 mmol/l Phenylmethylsulfonyl Fluoride (PMSF) zugefügt. Nach Inkubation auf Eis für weitere 25 Minuten wurden die Mitochondrien reisoliert und in Importpuffer gewaschen. Die Proben wurden einer Sodium Dodecyl Sulfate Polyacrylamide Gel Electrophoresis (SDS-PAGE) unterzogen. Die Messung von importiertem und prozessiertem OTC wurde mit Autoradiographie durchgeführt. Importiertes Proteinmaterial wurde quantifiziert mit Hilfe der ImageQuant Software (GE Healthcare).The synthesis of radioactively labeled pre-ornithine transcarbamylase (pOTC) was performed by in vitro transcription and translation in rabbit reticulocyte lysates in the presence of [ ³⁵ S] -methionine (TNT-coupled reticulocyte lysate system, Promega). For the import reactions, isolated mitochondria were diluted in import buffer (20 mmol / l HEPES-KOH, pH 7.6, 250 mmol / l sucrose, 5 mmol / l MgAc, 160 mmol / l KAc, 5 mmol / l succinate, 5 mmol / l malate, 1 mmol / l DTT) to a final concentration of 125 to 250 μg / ml. ATP was added to a final concentration of 3 mmol / L. In a control sample, the membrane potential (Δψm) was scattered by addition of a mixture of potential inhibitors consisting of antimycin A (final concentration (f.c.): 8 μmol / l), valinomycin (f.c .: 0.5 μmol / l), and oligomycin (f.K .: 2 μmol / l). After incubation for 3 minutes at 30 ° C, the import reactions were started by addition of reticulocyte lysate with pOTC and incubation at 30 ° C. The import reactions were stopped by the addition of 1 μM of the valenomycin K ⁺ ionophore. To remove non-imported pre-proteins, trypsin was added to a final concentration of 50 μg / ml. After protease treatment on ice for 35 minutes, 400 μg / ml trypsin inhibitor and 1 mmol / l phenylmethylsulfonyl fluoride (PMSF) were added. After incubation on ice for an additional 25 minutes, the mitochondria were reisolated and washed in import buffer. The samples were subjected to sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE). The measurement of imported and processed OTC was performed by autoradiography. Imported protein material was quantified using ImageQuant software (GE Healthcare).

Verhalten und motorische FunktionBehavior and motor function

Alle Tests wurden in einer Kohorte von 16 (7 Weibchen und 9 Männchen) homozygoten Pink1^-/- und 16 wildtyp-(6 Weibchen und 10 Männchen)Mäusen im Alter von 3, 10 und 18 Monaten durchgeführt. Allgemeine Gesundheit und neurologische Leistungsfähigkeit wurden mit dem SHIRPA-Test evaluiert. Das Gewicht als eine Messgröße des Metabolismus, Nestbauaktivität als Messgröße der normalen Entwicklung, und die Produktion von Urin und Fäzes während Untersuchungen als Messgröße von Ängstlichkeit wurden beobachtet und aufgezeichnet. Stärke und Koordination, Griff-Stärke, "Inverted-Screen", "Pole-Test", "Rota-Rod" und Fußabdrücke wurden analysiert wie bereits veröffentlicht ( Gispert et al., Mol Cell Neurosci 24 (2), 419–429 (2003) ). Die Spontanbewegungen der Mäuse in einer Arena von 20 × 20 cm wurden von Infrarotstrahlen in einem Digiscan Monitor (AccuScan, Columbus, OH) festgehalten ( Gispert et al., Mol Cell Neurosci 24 (2), 419–429 (2003) ).All tests were performed in a cohort of 16 (7 females and 9 males) homozygous Pink1 ^{- / -} and 16 wildtype (6 females and 10 males) mice at 3, 10 and 18 months of age. Overall health and neurological performance were evaluated with the SHIRPA test. The weight as a measure of metabolism, nest building activity as a measure of normal development, and the production of urine and feces during investigations as a measure of anxiety were observed and recorded. Strength and Coordination, Grip Strength, "Inverted Screen", "Pole Test", "Rota Rod" and Footprints were analyzed as already published ( Gispert et al., Mol Cell Neurosci 24 (2), 419-429 (2003) ). The spontaneous motions of the mice in a 20 × 20 cm arena were recorded by infrared rays in a Digiscan Monitor (AccuScan, Columbus, OH) ( Gispert et al., Mol Cell Neurosci 24 (2), 419-429 (2003) ).

Immunhistochemieimmunohistochemistry

16 Monate alte Maushirne wurden mit 4% Paraformaldehyd fixiert, in Paraplast-plus eingebettet und in 5 μm dicken coronalen konsekutiven Scheiben vom Hirnstamm bis zum Striatum geschnitten. Alle Scheiben wurden in 3% H₂O₂, 0,05 mol/l Tris, 0,9% NaCl, pH 7,5 für 30 Minuten eingetaucht, gewaschen und dann für 60 Minuten in 0,25% Triton X100, 5% BSA und 0,1 mol/l DL-lysine eingetaucht. Die Scheiben wurden über Nacht im ersten Antikörper inkubiert (anti-Snca von Transduction Labs bei Titer 1:200, anti-Th von Pel Freeze bei 1:1000, Gfap von Sigma bei 1:500), bei Raumtemperatur. Am nächsten Tag wurden die Scheiben nach Abspülen für eine Stunde bei Raumtemperatur mit dem entsprechenden zweiten biotinylierten Antikörper inkubiert. Nach den Waschungen wurden die Scheiben für 1 Stunde mit dem Avidin-Biotin-Peroxidase Komplex (1:100, ABC-Elite, Vector Laboratories) inkubiert. Nach mehreren Wasch-Schritten wurden die Scheiben in einer 3,3-Diaminobenzidin Lösung (0,07% DAB und 0,002% H₂O₂) zur Reaktion gebracht. Die Scheiben wurden dehydriert und auf Objektträger aufgebracht.16-month-old mouse brains were fixed with 4% paraformaldehyde, embedded in Paraplast-plus and cut into 5 μm thick coronal consecutive slices from the brainstem to the striatum. All disks were immersed in 3% H ₂ O ₂ , 0.05 mol / l Tris, 0.9% NaCl, pH 7.5 for 30 minutes, and then washed for 60 minutes in 0.25% Triton X100, 5%. Immersed in BSA and 0.1 mol / l DL-lysine. Slices were incubated overnight in the first antibody (anti-Snca from Transduction Labs at titer 1: 200, anti-Th from Pel Freeze at 1: 1000, Gfap from Sigma at 1: 500), at room temperature. The next day, after rinsing, the discs were incubated for one hour at room temperature with the appropriate second biotinylated antibody. After the washes, the disks were incubated for 1 hour with the avidin-biotin-peroxidase complex (1: 100, ABC-Elite, Vector Laboratories). After several washes, the disks were reacted in a 3,3-diaminobenzidine solution (0.07% DAB and 0.002% H ₂ O ₂ ). The discs were dehydrated and placed on slides.

Statistikstatistics

Die Analyse der Microarray Daten wurden mit den entsprechenden Softwares von Affymetrix und ABI durchgeführt. Bewertungen mittels ungepaartem t-test mit Dunnett's posttest und graphische Dokumentation wurden mit der GraphPad Software ausgeführt. Die Signifikanz wurde in den Abbildungen mit Sternchen angezeigt (* für p < 0,05; ** für p < 0,01; *** für p < 0,001).The Analysis of the microarray data was done with the appropriate softwares performed by Affymetrix and ABI. Reviews by unpaired t-test with Dunnett's posttest and graphic documentation running with the GraphPad software. The significance was indicated in the figures with asterisks (* for p <0.05, ** for p <0.01; *** For p <0.001).

2. Ergebnisse2 results

Kürzlich konnte eine „Loss-of-Function" Mutation in der mitochondralen Serin/Threonin Kinase PINK1 als Ursache der autosomal rezessiven früh einsetzenden („early-onset") PARK6 Variante von Morbus Parkinson identifiziert werden. Auf Grund der ubiquitären Expression von PINK1 wurden verschiedene periphere Gewebe untersucht, wie Skelettmuskel, Lymphoblaten, Blut- und Hautfibroblasten für mitochondrale Dysfunktion. Dabei konnte signifikanter oxidativer Stress in primären Hautfibroblasten von PARK6 Patienten nachgewiesen werden.Recently, a loss-of-function mutation in the mitochondrial serine / threonine kinase PINK1 As a result of the ubiquitous expression of PINK1, various peripheral tissues, such as skeletal muscle, lymphoblasts, blood and skin fibroblasts for mitochondrial dysfunction, could be identified as causes of the early-onset PARK6 variant of Parkinson's disease significant oxidative stress in primary dermal fibroblasts of PARK6 patients.

Auf Grund dessen wurde das Expressionsprofil von PARK6-Patienten Fibroblasten untersucht. Zusätzlich bedienten sich die Erfinder unter anderem einer Mausmutante mit einer Pink1 „Loss-of-Function" Mutation, um Schlüsse über die mitochondrale Dysfunktion und seine Konsequenzen für Wachstum motorische Kompetenz und um Hirnbiomarker für neurodegenerative Erkrankungen zu finden.On The reason for this was the expression profile of PARK6 patients fibroblasts examined. In addition, the inventors made use of another mouse mutant with a Pink1 "Loss-of-Function" Mutation to draw conclusions about mitochondrial dysfunction and its consequences for growth motor skills and brain biomarkers for neurodegenerative diseases to find.

Dabei wurde eine starke und konsistente Änderung im Expressionsprofil von drei PARK6 Patientenfibroblastenlinien beobachtet: Zehn Transkripte zeigten eine mehr als achtfache Veränderung in einem Microarraypunkt und elf Transkripte zeigten eine mehr als dreifache Änderung in wenigstens zwei Microarraypunkten (Tabelle 1a). Ebenfalls wurde gefunden, dass das SNCA Transkript, das für α-Synuclein kodiert, achtfach erhöht war (Tabelle 1). Überraschenderweise ging die Hochregulation des präsynaptischen Markers SNCA in PARK6 Fibroblasten mit der Dysregulation verschiedener anderer synaptischer Proteine einher: Eine Unterregulation verschiedener Transkripte, die eine bekannte Rolle in der Bildung, Differenzierung und Aufrechterhaltung von Synapsen spielen, wie IGSF4 (syncam), WNT5A (einem Mitglied des „Wingless" Signaltransduktionsweges), ODZ2 (Teneurin-2), CPXM2 (Carboxypeptidase-2) und ANGPT1 (Angiopoietin-1), wie auch eine Hochregulierung von CLU (Clusterin), das eine Rolle in synaptischen Umstrukturierung und der Zelladhäsion spielt.there became a strong and consistent change in the expression profile observed from three PARK6 patient fibroblast lines: ten transcripts showed a more than eight-fold change in a microarray point and eleven transcripts showed a more than threefold change in at least two microarray points (Table 1a). Also became found that the SNCA transcript, responsible for α-synuclein was encoded eight times (Table 1). Surprisingly was the upregulation of the presynaptic marker SNCA in PARK6 fibroblasts with dysregulation of various others synaptic proteins: a subregulation of various Transcripts that have a well-known role in education, differentiation and maintain synapses, such as IGSF4 (syncam), WNT5A (a member of the wingless signal transduction pathway), ODZ2 (teneurin-2), CPXM2 (carboxypeptidase-2) and ANGPT1 (angiopoietin-1), as well as an up-regulation of CLU (clusterin) that matter in synaptic restructuring and cell adhesion plays.

Die mit dem Microarray erhaltenen Daten wurden mittels quantitativer RT-PCR (qPCR) für drei verschiedene Regionen des SNCA Transkriptes validiert. Dabei wurde diese als mehr als fünffache Hochregulierung bestätigt. Weiterhin wurden alle anderen Expressionsveränderungen mit gPCR in separaten Fibroblastenkulturen bestätigt (Tabelle 1a). Zur Bestätigung der Hypothese, dass oxidativer Stress der Mitochondrien für die SNCA Induktion verantwortlich ist, wurden Kontrollfibroblasten mit 100 μmol/l H₂O₂ inkubiert. Dabei wurde eine 3,2fache Induktion des SNCA Transkriptes nach einem Tag beobachtet (3).The data obtained with the microarray were validated by quantitative RT-PCR (qPCR) for three different regions of the SNCA transcript. This was confirmed as more than fivefold upregulation. Furthermore, all other expression changes with gPCR were confirmed in separate fibroblast cultures (Table 1a). To confirm the hypothesis that mitochondrial oxidative stress is responsible for SNCA induction, control fibroblasts were incubated with 100 μmol / l H ₂ O ₂ . A 3.2-fold induction of the SNCA transcript was observed after one day ( 3 ).

Diese Daten bestätigen, dass eine mitochondrale Dysfunktion die Transkriptionsstärke von SNCA erhöht und dass dieser Krankheitsprozess, wenigstens teilweise, wegen einer erhöhten α-Synucleinexpression in PARK6 auftritt. Die Expression von α-Synuclein in Fibroblasten ist so gering, dass eine Validierung durch Western Blotting weniger geeignet ist. Eine robuste Induktion der Proteinkonzentrationen für Clusterin und Septin-6 (SEPT6) konnte die Transkriptomdaten bestätigen (4).These data confirm that mitochondrial dysfunction increases the transcriptional strength of SNCA and that this disease process occurs, at least in part, because of increased α-synuclease expression in PARK6. The expression of α-synuclein in fibroblasts is so low that validation by Western blotting is less suitable. Robust induction of protein concentrations for clusterin and septin-6 (SEPT6) confirmed the transcriptome data ( 4 ).

Zur weiteren Validierung der Microarraydaten von menschlichen Fibroblasten wurde eine Pink1 „Loss-of-Function" (Pink1^-/-) Maus generiert (1). Dazu wurde die pathogene G309D-PINK1 Mutation von PARK6 Patienten in den homologen Mauslocus insertiert. Da die „Loss-of-Function" Mutation von PINK1 die Ursache von PARK6 ist, sind diese Mäuse mit einer 93 bis 94%igen Reduzierung der Pink1 Expression ein brauchbares Krankheitsmodell.To further validate the microarray data of human fibroblasts, a Pink1 "Loss-of-Function" (Pink1 ^{- / -} ) mouse was generated ( 1 ). For this purpose, the pathogenic G309D-PINK1 mutation of PARK6 patients was inserted into the homologous mouse locus. Since the "loss-of-function" mutation of PINK1 is the cause of PARK6, these mice are a useful disease model with a 93 to 94% reduction in Pink1 expression.

In Tabelle 1b sind die Transkriptionsstärken der gemessenen murinen embryonalen Fibroblasten (MEF) aufgelistet. Expressionsveränderungen, die ähnlich zu den von PARK6 Patientenfibroblasten sind, wurden für Angpt1 Cpxm2 und Serpinb7 gefunden, was dafür spricht, dass diese Gene, die alle eine Rolle in der Synaptogenese und der Aufrechterhaltung der Synapsen spielen, frühe und stabile Folge der PINK1 „Loss-of-Function" Mutation sind. Im Gegensatz dazu zeigten fünf Transkripte signifikante Änderungen in MEFs, aber in einer entgegengesetzten Richtung zu der in menschlichen Fibroblasten gefundenen Ergebnissen, während weitere 13 Transkripte, die in Fibroblasten von Patienten mit PARK6 geändert waren, keine signifikante Änderung in MEFs zeigten. Dies spricht dafür, dass diese Transkripte in symptomatischen Krankheitsstadien dysreguliert werden. Diese zuletzt genannten Transkripte sind daher besonders vorteilhaft zur Bestimmung der Progression der mitochondralen Dysfunktion. Dazu gehört beispielsweise die Serinprotease HTRA3.In Table 1b are the transcription strengths of the measured murine embryonic fibroblasts (MEF). Expression changes which are similar to PARK6 patient fibroblasts, were found for Angpt1 Cpxm2 and serpinb7, which is why speaks that these genes all play a role in synaptogenesis and the maintenance of the synapses play, early and stable consequence of the PINK1 "loss-of-function" mutation. In contrast, five transcripts showed significant changes in MEFs, but in an opposite direction to that in human Fibroblasts found results, while further 13 Transcripts that changed into fibroblasts from patients with PARK6 showed no significant change in MEFs. This suggests that these transcripts in symptomatic Disease stages are dysregulated. These last-mentioned transcripts are therefore particularly advantageous for determining the progression mitochondrial dysfunction. This includes, for example the serine protease HTRA3.

PINK1^-/- Mäuse wurden in verschiedenem Alter untersucht, um die zeitliche Abfolge der Veränderungen der Transkription zu untersuchen. Das mitochondriale Membranpotential (Δψm), ATP Konzentrationen und der mitochondriale Import wurden als funktionale Assays der frühen präsymptomatischen Stadien untersucht. Die Messwerte des mitochondriale Membranpotentials über das Lebensalter der Mäuse kann aus den 5A und 5B entnommen werden. Weiterhin wurden Mitochondrien aus den Lebern von PINK1^-/- Mäusen und Wiltyp-Mäusen verschiedenen Alters isoliert und mit einem radiomarkiertem Vorläufer der Ornitintranscarbamylase (OTC) aus Ratten inkubiert. Die Ergebnisse dieser Experimente sind in den 5D bis 5F dargestellt.PINK1 ^{- / -} mice were studied at various ages to study the timing of transcriptional changes. Mitochondrial membrane potential (Δψm), ATP concentrations and mitochondrial import were studied as functional assays of the early presymptomatic stages. The measurements of the mitochondrial membrane potential over the age of the mice can from the 5A and 5B be removed. Furthermore, mitochondria were isolated from the livers of PINK1 ^{- / -} mice and wild-type mice of various ages and incubated with a radiolabelled precursor of rat ornitin transcarbamylase (OTC). The results of these experiments are in the 5D to 5F Darge provides.

Zur Untersuchung der Konsequenzen einer mitochondralen Dysfunktion auf den gesamten Organismus wurden das Körperwachstum, die motorischen Symptome bei Parkinson und die synaptischen Marker in den dopaminergen Projektionen über ein Zeitintervall von achtzehn Monaten in PINK1^-/- Mäusen untersucht (6). Wie in 6C erkennbar, wurden zwei- bis siebenfache Veränderungen in der Expression von Snca, Wnt5a, Igsf4, Odz2 und Clu im Striatum gefunden.To investigate the consequences of mitochondrial dysfunction on the entire organism, body growth, motor symptoms in Parkinson's and synaptic markers in the dopaminergic projections were studied over a 18-month interval in PINK1 ^{- / -} mice ( 6 ). As in 6C recognizable, two to seven-fold changes in the expression of Snca, Wnt5a, IgSf4, Odz2 and Clu were found in the striatum.

Weiterhin wurde untersucht, ob die beschriebenen Veränderungen in der Expression für early-onset autosomal rezessives PARK6 spezifisch sind. Dazu wurden alle von der CORIELL Zelllinienbank erhältlichen late-onset Parkinsonzelllinien und alle Alzheimerfibroblasten untersucht. Wie sich aus den in 7 gezeigten Ergebnissen ergibt sind die genannten Marker für diesen Defekt für spezifisch. Die Herunterregulation von WNT5A, IGSF4, ODZ2 und CPXM2 in late-onset Parkinson und Alzheimer-Fibroblasten war geringer als in early-onset PARK6 Fibroblasten, was mit dem höherem Alter beim Beginn sporadischer Parkinson und Alzheimer Krankheit versus PARK6 korreliert. Die beobachtete Hochregulation der α-Synucleinexpression (bis zu zweiundzwanzigfach) ist für Morbus Parkinson spezifisch. Dies könnte zur Bildung von unlöslichen α-Synucleinaggregaten („Lewy Körperchen") im Hirn aller untersuchten Parkinsonvarianten fuhren, was ein zentrales pathologisches Ereignis für verschiedene Varianten der parkinsonschen Krankheit darstellt. Die Expressionsveränderungen von synaptischen Transkripten spiegeln Ereignisse in gemeinsamen Pathways wieder. Daher können die hier beschriebenen Biomarker für verschiedene Varianten neurodegenerativer Erkrankungen wirkungsvoll eingesetzt werden.Furthermore, it was investigated whether the described changes in expression are specific for early-onset autosomal recessive PARK6. All of the late-onset Parkinson cell lines and all Alzheimer's fibroblasts available from the CORIELL cell line bank were examined. As can be seen from the in 7 results shown are the mentioned markers for this defect for specific. Downregulation of WNT5A, IGSF4, ODZ2, and CPXM2 in late-onset Parkinson's and Alzheimer's fibroblasts was lower than in early-onset PARK6 fibroblasts, which correlates with the onset of sporadic Parkinson's and Alzheimer's disease versus PARK6. The observed upregulation of α-synuclein expression (up to twenty-twofold) is specific for Parkinson's disease. This could lead to the formation of insoluble α-synuclein aggregates ("Lewy bodies") in the brain of all Parkinsonian variants studied, which is a central pathological event for different variants of Parkinson's disease Biomarkers described here can be used effectively for different variants of neurodegenerative diseases.

Auf Grund der gezeigten Daten kann man vom folgenden Modell für die PARK6 Pathogenese ausgehen:

1. Mutationen in PINK1 führen zur mitochondralen Dysfunktion durch posttranslationale Modifikation von intramitochondrialen Proteinen.
2. Diese mitochondriale Dysfunktion resultiert in Defiziten des mitochondrialen Membranpotentials, der ATP Konzentration und des mitochondrialen Imports während der präsymptomatischen Periode.
3. Der damit einhergehende oxidative Stress hat die Hochregulation von α-Synuclein zur Folge, was die präsynaptische Funktion beeinflusst.
4. Die Induktion von α-Synuclein verursacht eine Veränderung der IGSF4 Expression und wird begleitet von einer Dysregulation von WNT5A, ODZ2 und CPXM2, wobei sich die WNT Signalkaskade verändert, die präsynaptische/postsynaptische Adhäsion verringert und die postsynaptische Rezeptorformierung gestört ist.
5. Der synaptische Umbau mit dem Verlust der Expression des Dopamintransporters ist eine direkte Folge des oxidativen Stresses und der α-Synucleininduktion und ein frühes Ereignis der Hirnpathologie und keine Folge einer Aggregat-induzierten Verschlechterung des axonalen Transportes in sterbenden Neuronen.
6. Die Verschlechterung der motorischen Funktion in der PINK1^-/- Maus ist eine Folge dieser Veränderungen der synaptischen Integrität.

Based on the data shown, one can assume the following model for PARK6 pathogenesis:

1. Mutations in PINK1 lead to mitochondrial dysfunction by posttranslational modification of intramitochondrial proteins.
2. This mitochondrial dysfunction results in deficits of mitochondrial membrane potential, ATP concentration and mitochondrial import during the presymptomatic period.
3. The associated oxidative stress results in the upregulation of α-synuclein, which influences the presynaptic function.
4. Induction of α-synuclein causes a change in IGSF4 expression and is accompanied by dysregulation of WNT5A, ODZ2 and CPXM2, altering the WNT signaling cascade, decreasing presynaptic / postsynaptic adhesion and disrupting postsynaptic receptor formation.
5. Synaptic remodeling with the loss of dopamine transporter expression is a direct consequence of oxidative stress and α-synuclein induction and an early event of brain pathology and not a result of aggregate-induced deterioration of axonal transport in dying neurons.
6. The deterioration of motor function in the PINK1 ^{- / -} mouse is a consequence of these changes in synaptic integrity.

Unsere Ergebnisse sprechen dafür, dass die verschiedenen Ursachen des Morbus Parkinson in einem gemeinsamen Signalweg münden. Erhöhte SNCA Konzentrationen iniziieren die Parkinsonsche Pathogenese, sowohl im autosomal dominanten early-onset PARK1/PARK4 als auch im sporadischen Morbus Parkinson, der im Alter auftritt und der Demenz mit Lewy Körpern.Our Results suggest that the different causes of Parkinson's disease in a common signaling path. Increased SNCA concentrations inactivate Parkinson's Pathogenesis, both in the autosomal dominant early-onset PARK1 / PARK4 as well as in sporadic Parkinson's disease, which occurs in old age and dementia with Lewy bodies.

Es folgt ein Sequenzprotokoll nach WIPO St. 25.It follows Sequence listing according to WIPO St. 25. Dieses kann von der amtlichen Veröffentlichungsplattform des DPMA heruntergeladen werden.This can of the official publication platform of the DPMA become.

ZITATE ENTHALTEN IN DER BESCHREIBUNGQUOTES INCLUDE IN THE DESCRIPTION

Diese Liste der vom Anmelder aufgeführten Dokumente wurde automatisiert erzeugt und ist ausschließlich zur besseren Information des Lesers aufgenommen. Die Liste ist nicht Bestandteil der deutschen Patent- bzw. Gebrauchsmusteranmeldung. Das DPMA übernimmt keinerlei Haftung für etwaige Fehler oder Auslassungen.This list The documents listed by the applicant have been automated generated and is solely for better information recorded by the reader. The list is not part of the German Patent or utility model application. The DPMA takes over no liability for any errors or omissions.

Zitierte Nicht-PatentliteraturCited non-patent literature

- https://www.affymetrix.com/site/login/login.affx [0028]
- HH Hoepken, S. Gispert, B. Morales et al., Neurobiol Dis 25 (2), 401 (2007) [0038]
- www.coriell.org [0038]
TS Benamer, J.Patterson, DG Grosset et al., Mσv Disord 15 (3), 503 (2000) [0040]
Gibson and HM Huang, Front Biosci 7, d1007 (2002) [0040]
- HH Hoepken, S. Gispert, B. Morales et al., Neurobiol Dis 25 (2), 401 (2007) [0041]
Kuhn, K., Haebig, M. Bonin et al., Neurogenetics 8 (2), 71 (2007) [0043]
- SJ Walker and KA Grant, Alcohol 38 (1), 1 (2006) [0043]
U.Keil, I. Scherping, S. Hauptmann et al., British Journal of Pharmacology 147 (2), 199 (2006) [0043]
Gispert et al., Mol Cell Neurosci 24 (2), 419-429 (2003) [0047]
Gispert et al., Mol Cell Neurosci 24 (2), 419-429 (2003) [0047]

Claims

Method for the diagnosis of a neurodegenerative Illness, including the following steps a) Provide a sample of biological material, and b) Determination of strength gene expression of at least one marker in the biological material, wherein the marker is selected from the group consisting from SNCA, IGSF4, WNT5A, ODZ2, CPXM2, ANGPT1 and HTRA3.

The method of claim 1, further comprising step c) Comparison of the determination of the strength the gene expression obtained with a suitable standard.

The method of claim 1 or 2, wherein the sample from a biopsy.

The method of claim 3, wherein the biopsy is a Skin biopsy, a nerve biopsy or a skeletal muscle biopsy is.

Method according to one of the preceding claims, wherein the nerve biopsy is a biopsy of the sural nerve.

Method according to one of the preceding claims, the sample having fibroblasts.

Method according to one of the preceding claims, the sample being from an epithelial cell retrieval.

Method according to one of the preceding claims, the determination of the strength of gene expression by Determination of marker or existing mRNA available Protein of the marker is done.

Method according to one of the preceding claims, wherein the determination of the existing mRNA of the marker by quantitative Amplification, chip analysis, in situ hybridization or by Northern Blot done.

Method according to one of the preceding claims, wherein the determination of the protein present by the marker by Western blot, immunohistochemistry or ELISA done.

Method according to one of the preceding claims, the neurodegenerative disease Parkinson's disease, Morbus Alzheimer's, an ataxia or a spasticity is.

Use of a marker for the diagnosis of a neurodegenerative Disease, wherein the marker is selected from the group consisting of SNCA, IGSF4, WNT5A, ODZ2, CPXM2, ANGPT1 and HTRA3.

Use according to claim 12, wherein a sample is biological Material is provided and the strength of gene expression at least one marker in the biological material is determined.

Use according to claim 13, wherein the determining the level of gene expression obtained with a appropriate standard is compared.

Use according to one of claims 11 to 13, where the determination of the strength of gene expression by determining the amount of mRNA present in the marker or the amount of protein of the marker is present.

Use of a marker to predict the course a neurodegenerative disease, wherein the marker is selected is from the group consisting of SNCA, IGSF4, WNT5A, ODZ2, CPXM2, ANGPT1 and HTRA3.

Use according to claim 16, wherein a sample is biological Material is provided and the strength of gene expression at least one marker in the biological material is determined.

The use of claim 17, wherein the method is used in determining the level of gene expression value is compared with a suitable standard.

Use according to one of claims 16 to 18, where the determination of the strength of gene expression by determining the amount of mRNA present in the marker or the amount of protein of the marker is present.

Kit for the diagnosis of neurodegenerative diseases, having at least one molecule with which the starch Gene expression of at least one marker in a biological Material can be detected, with the marker selected is from the group consisting of SNCA, IGSF4, WNT5A, ODZ2, CPXM2, ANGPT1 and HTRA3.

The kit of claim 20, wherein the molecule is an oligonucleotide.

The kit of claim 21, wherein the oligonucleotide comprises PCR primer or a detection probe.

The kit of claim 20, wherein the molecule an antibody for specific detection of any of the above Marker is.

Antibody for specific detection of a Markers, which is selected from the group consisting of SNCA, IGSF4, WNT5A, ODZ2, CPXM2, ANGPT1 and HTRA3.

Use of an antibody according to claim 24 for specific detection of a marker selected is from the group consisting of SNCA, IGSF4, WNT5A, ODZ2, CPXM2, ANGPT1 and HTRA3.