CZ29275U1 - Antidiarrhetic veterinary composition containing lactoferin - Google Patents

Description

Technical field

The invention relates to a veterinary composition containing recombinant lactoferrin for the prevention and treatment of diarrheal diseases.

BACKGROUND OF THE INVENTION

Leaving aside the direct losses in the first weeks of life, when piglets are dependent on maternal nutrition and through them we can partially influence them, during the weaning period and several weeks thereafter, their health is entirely in the hands of breeders. This period is a very important stage for piglets. During it are exposed to a number of adverse influences, whose management largely affects the success and economy of rearing. One of the most serious problems of weaning is digestive disorders accompanied by diarrhea. Their formation is due not only to a radical change in nutrition and the end of the period of protection by lactogenic immunity, which prevented piglets from causing diarrhea infections, but also to a fundamental change in the composition of the intestinal microflora. Post-weaning leases are usually not the cause of direct mortality losses, but of indirect losses due to growth arrest or possible weight loss, which disproportionately prolong the fattening period. The main causative agents of diarrhea in this period are mainly enteropathogenic strains of Escherichia coli, salmonella, clostridia and lawsonia from bacteria, especially rotaviruses and coronaviruses.

In the past, the problem of diarrhea of weaned piglets was solved by the widespread use of antibiotics, which were supposed to eliminate the main cause of intestinal infections and at the same time to potentiate their growth ability. The gradual increase in bacterial strains showing multiple resistance has led the European Union authorities to significantly reduce the use of feed antibiotics.

Concern about the massive incidence of intestinal infections, particularly in weaned piglets, has led to the introduction of large amounts of zinc oxide into weaners. At present, the amount of zinc in feed is between 2 and 3 grams per kg of dry matter received. Most of the zinc ingested is again eliminated by the intestine and appears in the feces and subsequently in the manure. The manure used for fertilization shall not contain more than 300 mg of zinc per kg of manure. According to the monitoring of the Central Institute for Supervising and Testing in Agriculture today, the excess of zinc in animal waste is becoming one of the important factors that negatively affect the environment. The EU therefore seeks to significantly reduce such enriched feed. However, introducing them without adequate compensation would pose a high risk for livestock farmers due to increased morbidity and reduced yields. The search for a suitable substitute is all the more topical because breeding practice shows that neither antibiotics nor zinc oxide satisfactorily addresses the problem of post-weaning diarrhea.

One option that provides practical solutions to this problem is the enrichment of piglet feed with antimicrobial proteins, which have potent antimicrobial effects but because of their biological nature they do not pose a burden to the animal itself or to the environment. One of the most promising candidates is breast milk protein lactoferrin. Lactoferrin is a substance of biogenic nature found in body fluids and secretions. In addition to the direct antibacterial effect, it also has a marked anti-inflammatory effect. It is found on all mucous membranes where it forms one of the most effective systems of non-specific defense against infection (review by Ochoa and Cleary 2009). Attempts to use bovine lactoferrin isolated from milk (or other sources) as a preventive or possibly therapeutic agent against intestinal infections not only of pups but also of newborn children were mostly successful (Shan et al. 2007). The widespread use of lactoferrin in the prevention and treatment of enteral infections is mainly prevented by its cost.

Lactoferrin is an essential component of breast milk with proven antibacterial, anti-inflammatory and anti-tumor effects (Adlerova et al., 2008). The addition of the antimicrobial protein lactoferrin to piglet food after weaning from breast milk seems to be the most natural solution to post-weaning diarrhea. The question is how to get enough lactoferrin to enrich piglet food. Various genetically modified organisms in whose genome the gene for lactoferrin production is inserted can become a substitute source of lactoferrin. The interest in Lactto-1 CZ 29275 Ul ferin is evident from a number of different organisms in which research groups around the world seek to produce it (review Conesa et al., 2010). Among the organisms in which lactoferrin has been successfully produced are, for example, Saccharomyces cerevisce, Aspergillus oryzae and Aspergillus nidulan, Aspergillus awamori and Pichia pastoris.

Lactoferrin is an essential component of breast milk, which affects the development of organs and the physiology of the newborn. As a member of the transferrin family, it belongs to proteins that are capable of binding iron ions. For the first time lactoferrin was isolated from cow's milk in 1939 (Sorensen and Sorensen, 1939). In 1960, it was described by three independent laboratories as the major human milk protein capable of binding iron (Groves, 1960; Johanson, 1960; Montreuil et al., 1960). Lactoferrin is a glycoprotein with a molecular weight of about 80 kDa. The molecular structure and amino acid sequence of human lactoferrin was described in 1984 (Metz-Boutique et al., 1984). There are several major sources of lactoferrin in the body - myeloid cells, especially neutrophil granulocytes (Iyer and Lonnerdal, 1993; Baggiolini et al., 1970; Saito et al., 1993), secretory epithelial cells (Baynes and Bezwoda, 1994) and kidneys (Abrink et al., 2000). Lactoferrin can be found not only in the cells that produce it, but also in most mucosal secretions - milk, colostrum, uterine and vaginal secretions, seminal plasma, saliva, bile, pancreatic juice, secretions of the small intestine, nose and saliva (Masson and Heremans, 1971) Brock, 1980; Masson et al., 1966; Baker, 1994; Levay and Viljoen, 1995; Lonnerdal and Iyer, 1995; Kikuchi et al., 2003; Baker and Baker, 2005). Lactoferrin is also found at relatively low concentrations in blood plasma (Rumke et al., 1971; Boxer et al., 1982; Brown et al., 1983; Broxmeyer et al., 1983; Otnaess et al., 1983; Chung et al. , 1985; Scott, 1989). The concentration of lactoferrin increases significantly during the inflammatory reaction. It is therefore classified by some authors as so-called acute phase proteins (Kanyshkova et al., 2001). However, the highest lactoferrin concentration is found directly at the site of inflammation (Birgens, 1985). In addition to its ability to bind iron and to participate in its metabolism, lactoferrin has a number of other biological functions, including a role in cell proliferation and differentiation, in defending the body against bacteria, viruses and parasites. The antimicrobial effects of lactoferrin are associated, in addition to balancing the iron necessary for bacterial growth, with its ability to bind to lipopolysaccharide. Through electrostatic interactions between the negatively charged lipid component of lipopolysaccharides and the positively charged lactoferrin surface, changes in the permeability of the bacterial cell membrane occur (Valenti and Antonini, 2005).

The antimicrobial effects of lactoferrin are also used to enrich feed supplements and mixtures for experimental purposes. Part of the experiments was performed on piglets as a model for human medicine. Feeding of germ-free piglets with lactoferrin compared to bovine serum albumin has been shown to reduce the mortality of piglets after intravenous administration of lipopolysaccharide from 74 to 17% (Lee et al., 1998). Piglets fed the milk of transgenic cows producing human lactoferrin showed both higher antibody levels and higher Th1 and Th2 cellular responses, as well as improved intestinal epithelial structure (Li et al., 2014) and increased intestinal cell proliferation (Reznikov et al., 2014) . Harada and coworkers have described that lactoferrin is resorbed from the intestine into the blood in which it appears as early as 2 hours; it is then secreted into the bile, reaching a maximum concentration in about 12 hours (Harada et al., 1999). Supplementation of feed with lactoferrin weaned piglets increased the height of their intestinal villi and, as a result, increased their daily gains; on average by more than 40% (Wang et al., 2006). Lactoferrin also increases the ability of both blood and spleen lymphocytes to respond to in vitro mitogenic stimuli. In addition, it increases serum IgG, IgA, C4 complement concentration and serum iron concentrations (Shan et al., 2007; Comstock et al., 2014). Part of the above-described effects may be due to increased mRNA expression for non-specific immunity genes (Wang et al., 2006; Yang et al., 2014).

The effect of lactoferrin on the composition of the intestinal microflora was also studied. The use of recombinant bovine lactoferrampin-lactoferricin resulted in an increase in the content of lactobacilli and bifidobacteria in the intestine of weaned piglets (Tang et al., 2012). One of the reasons explaining this is the so-called bifidogenic effect of lactoferrin and its pepsin hydrolyzate (Oda et al., 2014).

The use of yeast as a feed supplement has a longer tradition than the use of lactoferrin. The positive effect of yeast is based on the presence of β-1,3 / 1,6 glucan, which is recognized by cell surface receptors called dectins. Although some work benefit supplementation of feed rations piglets on

They did not show their growth or health (Hiss and Sauerwein, 2003; Sauerwein et al., 2007), but most other studies on this issue showed a positive effect. These works can be divided into two groups.

The first tested whether yeast could be an alternative to antimicrobial growth promoters. They showed positive effects on average daily gain, feed intake and selected immune system factors; eg, responses to vaccination (Jung et al., 2004; Li et al., 2005, 2006a, 2006b; van der Peet-Schwering et al., 2007; Hester et al., 2012).

The second group of experiments was aimed at addressing post-weaning diarrhea induced by enterotoxigenic strains of Escherichia coli (Stuyven et al., 2009; Collier et al., 2011; Badia et al., 2012, Kilo aria et al., 2012, Trckova et al., 2014 ).

Disadvantages of the current state of veterinary feed or veterinary preparations include, in particular, that they do not achieve sufficient biological efficacy in preventing and treating diarrhea in animals to limit the use of medicines, in particular antibiotics, or other additives, in particular zinc, according to current requirements.

The essence of the technical solution

The object of the present invention is to provide a new type of veterinary composition having suitable antimicrobial and immunostimulatory effects to protect livestock, especially piglets, from post-weaning diarrhea, thereby effectively preventing the death of livestock, especially piglets, after weaning.

This object is achieved and the drawbacks and drawbacks are eliminated by the anti-diarrheal veterinary composition according to the invention, which comprises inactivated recombinant yeast biomass comprising the recombinant lactoferrin of SEQ ID NO: 2 and / or fragments thereof, which are preferably accumulated inside the yeast cell.

Lactoferrin-expressing yeasts have the potential to become a valuable feed supplement that increases performance and improves the health of pigs and other livestock.

In one embodiment, the producer is lactoferrin, a recombinant yeast belonging to the genus Pichia comprising a gene of SEQ ID NO: 1 encoding lactoferrin. Preferably, the recombinant yeast belonging to the genus Pichia is a species of Pichia pastoris, more preferably Pichia pastoris GS115. Such yeasts produce recombinant porcine lactoferrin and, after their inactivation, are added to the feed of livestock to enhance the biological effect of the feed. Combining the positive effect of the antimicrobial protein lactoferrin with the traditionally recognized effect of yeast on the restoration of intestinal microflora and mucosal immunity results in a unique combination of active substances whose positive effects on the immune system and digestion complement each other. This yeast is a common expression system, i.e. it is widely used in the production of recombinant 35 proteins. The advantage over other expression systems is the high growth rate (biomass formation) and the ability to grow on a simple, cheap medium.

The veterinary composition according to the invention is an effective means which utilizes the natural defense pathways against infection based on the immunomodulatory effect of betaglucans from yeast cell walls and lactoferrin, respectively. its cleaved fragments, which also exhibit antimicrobial effects. On the one hand, the composition supports its own mechanisms of defense against infection and on the other hand, we fortify the effect of feed by supplying substances of a biogenic nature (recombinant lactoferrin and its cleavage products that naturally arise from yeast biomass cultivation and subsequent processing). In addition to the effects of lactoferrin alone, the composition according to the invention also exhibits a synergistic immunomodulatory effect of yeast wall betaglucans and the surface of oligomannan structures present, the importance of which is in neutralizing the adhesion factors of some pathogenic bacteria. A composition according to the invention having such properties substantially helps to reduce livestock losses and to significantly reduce the use of antibiotics and zinc-containing feed.

Pichia pastoris GS115 yeast containing a serpentine collagen coding for porcine lactoferrin (SEQ ID NO: 1) was prepared by recombinant gene technology. Yeasts containing this sequence produce

The pig lactoferrin, which remains inside the yeast cell (intracellular production), is a key advantage in the subsequent processing of yeast biomass.

The inactivation of the yeast biomass is carried out at an elevated temperature, preferably at 50 ° C.

The active ingredient of the preparation according to the invention is in the form of a dried powder obtained by lyophilization, fluid drying or spray drying or a liquid. The amount of inactivated recombinant yeast in the composition according to the invention is in the range of 0.001 to 90% by weight, preferably 1 to 10% by weight. to the total weight of the composition.

According to another embodiment of the invention, the composition may further comprise additional biologically active substances in an amount of from 0.001 to 99% by weight, based on the total weight of the composition, preferably 0.1 to 2% by weight. -glucan, lactose. LgY antibodies, panthenol, hyaluronic acid, its derivatives and salts, allantoin, beeswax and its derivatives, polylysine and its derivatives, nicotinamide, vitamins, minerals, probiotic oligosaccharides, intestinal regeneration and protection additives, short-chain fatty acids, plant extracts or other biologically active substances.

According to yet another embodiment of the invention, the composition may further comprise physiologically acceptable excipients in an amount of from 0.01 to 99% by weight, preferably 90 to 99% by weight. to the total weight of the composition. These are selected from the group consisting of microcrystalline cellulose, corn starch, potato starch, inulin, bamboo fiber, resistant starch, agar, hydroxypropylmethylcellulose, sodium carboxymethylcellulose, maltodextrin, or mixtures thereof, glycerin, macadam oil, sodium polyacrylate, laureate salt, cetate. coconut butter, xylitol, mannitol, erythritol, gelatin, alginate, agar, chlorhexidine digluconate, chlorhexidine, magnesium stearate, water.

The composition according to the invention can be produced in various application forms, in particular in solid, semi-solid or liquid form, preferably in the form of powder, pulse, granulate, micropellets, tablets, paste or liquid. It is applied orally as an animal feed component.

The composition of the invention is used to prevent or treat diarrheal diseases of animals, preferably post-weaning diarrhea of piglets.

In adjunctive therapy, the composition of the invention may also be used in combination with other pharmaceutical preparations, e.g., those selected from the group consisting of an antifungal, antibiotic, chemotherapeutic, vaccine, and zinc compound.

The composition according to the invention has a wide application in veterinary medicine. It may be part of a range of anti-diarrheal pharmaceutical, veterinary or feed products.

The term "yeast biomass" means the sum of substances forming the cells of yeast producing lactoferrin selected from the group consisting of yeasts of the genera Saccharomyces, Aspergillus or Pichia,

Preferably, JS species are Saccharomyces cerevisce, Aspergillus oryzae, Aspergillus nidulan, Aspergillus awamori, or Pichia pastoris

The term "fragment" refers to a portion of the recombinant lactoferrin polypeptides of SEQ No: 2 that fully or at least partially retains its biological activity against diarrhea in livestock, and whose sequence is at least 85% identical to that of SEQ No.2. At least is preferred

96%, 97%, 98%, or 99% sequence identity.

BRIEF DESCRIPTION OF THE DRAWINGS FIG. 1 - DNA electrophoresis of the PCR reaction product. ST - DNA marker, upper band 1500 base, LF - amplicon 2050 bases, Fig. 2 - Yeast immunoblot after induction of rLF expression at time intervals (1-0 h, 2-6 h,

3 - 24 h, 4 - 36 h, 5 - 48 h, 6 - 72 h after induction), Ctrl - P. pastoris strain without transformed plasmid - negative control

-4GB 29275 Ul

Examples of technical solutions

He did

The recombinant production strain can be prepared as follows: Pichia pastoris GS115 (part of the EasySelect Pichia Expression Kit, Invitrogen), the mut ⁺ phenotypes (ability to metabolize methanol as the sole carbon source, the presence of alcohol oxidases A0X1 i) were used to express recombinant porcine lactoferrin. AOX2) and His' (mutations in the histidinol dehydrogenase gene).

Escherichia coli TOP 10 strain (Invitrogen) was used for plasmid construction and transformation. It is also possible to use strains of Escherichia coli of similar genotype if the transformation method is modified.

Design and preparation of the insert

The mammary gland cells were separated from the sow colostrum from which RNA was isolated using the RNeasy Mini Kit (QIAGEN) according to the manufacturer ' s instructions. using lysis buffer (RLT), cells were broken and after centrifugation (3 min, 15000 x g), the supernatant was withdrawn to which an equal volume of 70% ethanol was added. 700 μΐ of this sample was transferred to a membrane centrifuge column. After centrifugation (15 sec, 8000 x g), the column was washed with RW1 buffer, then twice with RPE buffer (under the same centrifugation conditions). The RNA was then eluted from the column with 30 μΐ of RNase water. By reverse transcriptase reaction (M-MLV transcriptase, Invitrogen), RNA was transcribed into complementary DNA using Oligo (dT) primers according to the protocol, i.e. 1 µg of RNA, 1 µΐ of oligo (d LT) primers (500 µg / ml) and 1 µm of 10 mM dNTP mix were mixed in a tube, baking at 65 ° C for 5 minutes, then chilled on ice. Subsequently, 4 μΐ 5x concentrated buffer, 2 μΐ 0.1Μ DTT, 1 μΐ ribonuclease inhibitor were added to the mixture and made up to a volume of 19 μΐ with sterile water. After heating at 37 ° C for 2 minutes, 1 µΐ (200 units) of M-MLV reverse transcriptase was added and incubated for 50 minutes at 37 ° C. The reaction was then inactivated by heating to 70 ° C for 15 minutes.

Primers for amplifying the cDNA template were designed from a sequence for porcine lactotransferrin (Sus strofa, UniProt P14632) without signal peptides (first 19 amino acids) and extended by 15 nucleotides complementary to the end regions of the pPICZ A vector (EasySelect Pichia Expression Kit, Invitrogen). Forward prirner contains yeast consensus sequence part (A / YAA / TAATGTCT).

Table 1 - primer sequences for rLF, including 15 nucleotide overhangs (Seamless cloning) and yeast consensus sequence 5 '- 3'

Έ TCTCGGATCGGTACCTCGAGYATAATGTCTGCCCCTAAGAAAGGGGTT

CG

R: TCTACGTAAGCTGGCGGCCGCAACCTCATCATGAAGGCACAGG

Using the polymerase chain reaction method, sequence amplification for porcine lactoferrin without signal peptides was performed with the primers listed in Table 1. After mixing 12.5 μΐ of Plain PP MasterMix (Top-Bio), 0.25 μΐ of both primers (0.1 mM), 5 μΐ DNA template and 7 μΐ H ₂ O were performed 30 cycles of PCR reaction.

-5GB 29275 Ul tab. 2 - individual steps PCR reaction step time temperature

The presence of the amplification was confirmed by DNA electrophoresis on a 1% agarose gel with 2 μΐ / ΐ00 ml Midori green (Nippon Genetice) for UV detection (Fig. 1).

Cloning and transformation into E. coli

Ligation of the insert (rLF sequence) into the vector (plasmid pPICZ A with Zeocin resistance gene and HisTag tag for detection and isolation of rLF) was performed by Seamless Cloning (GENEART Seamless Cloning and Assembly Kit, Invitrogen). The vector was linearized with two restriction enzymes Xho I and Not I (NewEngland Biolabs).

Transformation into chemically competent TOP10 E. coli cells followed. (Invitrogen) plasmid thus prepared. The cells were then plated on Petri dish with solid LB medium (Low Salt, Sigma) with 25 µg / ml Zeocin. The E. coli transformed dish was incubated overnight at 37 ° C. Positive colonies were identified by PCR reaction with the above primers (Table 1). Sequence and reading frame accuracy was verified by sequencing analysis.

Plasmid isolation

The plasmid introduced E. coli was cultured in 10 ml of liquid LowSalt LB medium with 25 µg / ml Zeocin overnight at 37 ° C. The cells were then centrifuged and the pellet was used for plasmid isolation using the PureLink Quick Plasmid Miniprep Kit (Invitrogen). 5-10 µg of purified plasmid DNA was linearized with Sac I restriction enzyme (NewEngland Biolabs). The linearized plasmid was centrifuged and then washed in 80% ethanol, dried and resuspended in 10 μΐ sterile deionized water.

Transformation of P. pastoris yeast ΐ electrocompetent P. pastoris yeast was transformed with 5-10 µg of linearized plasmid pPICZ A with rLF by pulse electroporation (Gene Pulser Xcell Electroporation System, Bio Rad). Transformed yeast cells were spread on YPLDS plates (YPD + 1M sorbitol, Sigma) with increasing Zeocin concentration (100, 500, 1000 and 2000 pg / ml). Selected individual colonies were passaged onto YPDS medium plates containing 100 µg / ml Zeocin.

Induction of recombinant LF expression in P. pastoris yeast

An individual colony after antibiotic selection (from the highest Zeocin concentration) was inoculated with 10 ml MGYH medium (1.34% YNB, 1% glycerol, 4 x 10-5% biotin, 0.004% histidine) in a 50 ml sterile tube and cultured in an incubator at 28-30 ° C with shaking (250300 rpm) overnight (16-18 h) to an optical density of the culture of OD 600 = 2-6 (cells in logarithmic growth phase). The grown yeast cells were concentrated into the pellet by centrifugation at 1500-3000 xg, 5 min at room temperature. The supernatant was removed by decantation. The cell pellet containing yeast was resuspended in 5 πύ MMH medium (1.34% YNB, 0.5% methanol, 4 x 10-5% biotin, 0.004% histidine). Expression induction was initiated by diluting the yeast culture in 15 ml MMH medium to an OD ₅₀ of 1.0. The culture was placed in a 50 ml tube,

Covered with two layers of sterile gauze and placed in an incubator (28-30 ° C, 250-300 rpm). To maintain induction, methanol was added to a final concentration of 0.5% every 24h. 1 ml aliquots were then taken at time intervals (0, 6, 24, 36, 48, and 72 h) to find the optimal time for recombinant lactoferrin production. Aliquots were placed in 1.5 ml tubes, then centrifuged at 14,000 x g for 10 min at room temperature. Yeast pellets were resuspended in Laemmli sample buffer, boiled (5 min, 95 ° C), sonicated, and analyzed by SDS-PAGE and Westemblot for the presence of recombinant lactoferrin (Fig. 2). Lactoferrin antibody (Sigma) conjugated with horseradish peroxidase was used for detection. Protein visualization on the membrane was performed using 3,3´-diaminobenzidine as chromogen. The highest production of recombinant lactoferrin was found 24 h after induction.

Verify the presence of rLF by LC-MS / MS

A region specifically reacting with anti-LF antibody (ca. 80 kDa, at 24 h after induction) was excised from the membrane after Westemblot by scalpel and mass spectrometric analysis was performed to confirm the presence of porcine LF. The LC-MS / MS system was equipped with a liquid chromatograph (RSLCnano, Thermofisher Scientific) coupled online with a nanoelectrospray and a high resolution mass spectrometer (Orbitrap Velos Pro). The measured spectra were scanned in the Proteome Discoverer software using the MASCOT program using a protein database (P. pastoris with added lactoferrin sequences, UniProt).

The presence of high-score porcine lactoferrin (FDR 0.01, protein coverage about 25%) must be confirmed in the sample to be examined.

Example 2

The biomass production of the recombinant production strain can be carried out in the following manner using the recombinant Pichia pastoris GS115 production strain prepared according to the procedure of Example 1.

The preliminary stages were carried out in a total of 17 Erlenmeyer flasks (250 ml):

To each flask of 80 ml distilled water, 10 ml of 10% glycerol was added, autoclaved, and then 10 ml of YNB medium (medium prepared for all flasks together: 26.8 g YNB in 200 ml sterile water (500 ml Erlenmeyer flask, 0.2 ml of sterile 500X biotin solution and 1 ml of sterile 100X histidine solution were then sterile pipetted into each flask, and each flask was inoculated with 100 ml of Pichia pastoris n MGYH medium (prepared by transfer 1-2). colonies from plates prepared in pre-cultures (YPD agar) into flasks with MGYH medium, cultivated for about 24 h, to OD ₆ o-4.48) and flasks cultivated on shaker at T 29 ° C for 18-20 h, ie over Cultivation in an inoculation (30-L) fermenter (aerobic batch culture, inoculation 1:10)

A solution of 13.4 L of water + 170 mL of glycerol was sterilized in situ (121 ° C, 1 bar, 30 min) and cooled to T 29 ° C and the pH adjusted to 5.0 with 28% NH 4 OH. The volume after sterilization was 15, 32 L. A sterile 2L filter changer was transferred to the fermenter with 1.7 LYNB (227.8 g YNB per 1.7L supplemented with sterile water). 80 ml of sterile 500X biotin solution and 80 ml of sterile histidine solution (0.612 g of histidine in 80 ml of sterile water) were transferred to the fermenter via a microbial filter. Inoculated with 1.7 L from flasks (see above) and cultured at T 29 ° C, pH adjusted to 5.0.

Cultivation in production (202-L) fermenter:

- Glycerol batch phase (inoculation 1:10)

In a 200 L fermenter, 153 L of basic medium (FBSM - Fermentation Basal Salt Medium) was prepared dissolved in 144.3 L of water + 4.09 LH 3 PO 4 + 4.6 L of glycerol). Sterilized in situ (121 ° C, 1 bar, 30 min) and cooled to 29 ° C, pH 5.0 adjusted with 28% NH 4 OH. Using a 1L filter converter, 801 mL of PTM1 was transferred to the fermenter. Another sterile 1L filter-converter was transferred to the fermentor with histidine solution I (25.5 g histidine to 1000 ml ste-7EN 29275 Ul. Distilled water). Inoculated with 17 L of Pichia pastoris from an inoculation fermenter, the pH dropped to 4.6 during cultivation and was further regulated at this value with 28% NH 4 OH.

- Methanol fed-batch phase:

After 23 hours start of methanol feed with PTM: 1: Methyl sPTM1 (20 L methanol + 240 ml PTM1) was fed to a 200 L fermenter at a rate of 4.74 mL / min through a sterile 20L converter. A sterile 1L filter filter was added to the fermentor with histidine solution Π (28.3 g histidine to 1000 ml sterile distilled water).

Preparation of inactivated dry matter

The fermentation volume (190 L) was cooled to 15 ° C after centrifugation and centrifuged on Sharples to isolate 16.43 kg of sediment with 31.4% dry matter. Then, all of this sediment was resuspended to a target volume of 50 L and inactivated at 50 ° C for 4 hours. The inactivated suspension was spray dried. The presence of lactoferrin in dried yeast biomass was verified by western blotting.

The preparation of the recombinant lactoferrin-containing composition was carried out in the following ways (Example 3-10). A recombinant inactivated culture of the yeast Pichia pastoris GS115 strain prepared according to Example 2 was used.

Example 3

Preparation of 70 kg feed homogenate in a barrel homogenizer with paddles. The mixture is prepared by mixing the ingredients below and homogenizing for 20 min at rpm.

Recombinant inactivated culture 1.190 kg

Resistant potato starch 11,90 kg

Maltodextrin 20 kg

Microcrystalline Cellulose 102 (MCC 102) 36.91 kg

Total 70 kg

Example 4

Preparation of 70 kg feed homogenate in a barrel homogenizer with paddles. The mixture is prepared by mixing the ingredients below and homogenizing for 20 min at rpm.

Recombinant inactivated culture 1.190 kg

Maltodextrin 20 kg

MCC 102 38 kg

Inulin 2 kg

Potato starch 8,810 kg

Total 70 kg

Example 5

Preparation of 100 kg of feed homogenate in a Y-shaped drum homogenizer. The mixture is prepared by mixing the ingredients below and homogenizing for 20 min at 13 rpm.

The inactivated recombinant biomass is mixed in a liquid state with liquid fuco-oligosaccharides-oligofructose made from chicory in a ratio of 3: 1. The resulting liquid mixture is spray dried at an air inlet temperature of 92 ° C. The resulting encapsulate is then used to homogenize the feed.

Recombinant encapsulated inactivated culture 2 kg

Potato starch. 8,810 kg

-8GB 29275 U1

Maltodextrin MCC 102 Meat aroma Total

Example 6 kg 20 kg 0.050 kg 100 kg

Preparation of 100 kg of feed homogenate in a homogenizer. The raw materials listed below were homogenized in a mixer for 10 min. The resulting mixture was transferred to a granulator and granulated at 60 ° C. The resulting granulate was sieved through a 3 mm sieve.

Potato starch 50 kg and soya extract 30 kg

Glucose-fructose syrup 10 kg

Microcrystalline cellulose 7 kg

Inactivated recombinant yeast biomass 3 kg

Water purified 10 kg

Total 100 kg

Example 7: Preparation of feed paste

The dried or liquid inactivated recombinant yeast biomass was mixed with dried egg yolks and the resulting fraction mixed with a suitable vehicle, preferably palm oil, so that the proportion of inactivated recombinant biomass and yolks in the finished product corresponded to the selected weight percent based on the total weight of the preparation.

Potato starch 35.05 kg

Palm oil 35 kg

Soya extract 20 kg

Rape oil 7 kg

Inactivated recombinant yeast biomass 2.9 kg

L-Polylysine 0.1 kg

Sodium benzoate 0.05 kg

Example 8

Veterinary medicine in the form of tablets. Preparation of 70 kg feed homogenate in a barrel homogenizer with paddles. The mixture is prepared by mixing the ingredients below and homogenizing for 20 min at 15 rpm. Tableting follows.

Recombinant inactivated culture 1.190 kg

Maltodextrin 20 kg

MCC 102 37.65 kg

Inulin 2 kg

Potato starch 8,810 kg

Magnesium stearate 0,35 kg

Total 70 kg

Example 9

Preparation of 70 kg feed homogenate in a barrel homogenizer with paddles. The mixture is prepared by mixing the ingredients below and homogenizing for 20 min at 15 rpm.

Recombinant inactivated culture 1.190 kg

Maltodextrin 20 kg

-9EN 29275 UI

MCC 102 39 kg

1,3-1,6 Betaglucan yeast 1 kg

Potato starch 8,810 kg

Total 70 kg

Example 10

Preparation of 70 kg feed homogenate in a barrel homogenizer with paddles. The mixture is prepared by mixing the ingredients below and homogenizing for 20 min at rpm.

Recombinant inactivated culture 1.190 kg

Maltodextrin 19.9 kg

MCC 102 38 kg

Inulin 2 kg

Polylysine 0.1 kg

Potato starch 8,810 kg

Total 70 kg

-10GB 29275 Ul

LIST OF SEQUENCES <110> Veterinary Research Institute, v.v.1., Brno Pharmaceutical Blotechnollgy s.r.o.

<120> anti-diarrhea veterinary composition containing lactoferrin <130> D3841 / Ma <160> 2 <170> BiSSAP 1.3 <210> 1 <211> 2052 <212> DNA <213> Art1f1c1al sequence <220>

<22 3> sequence encoding porcine laktoferln <400> 1 gcccctaaga aaggggttcg atggtgtgtc atatccacag cagagtattc aaaatgccgc 60 cagtggcaat caaagataag aagaactaat cccatgttct gcataaggag ggcttctccc 120 actgactgta tccgggccat cgcggcaaaa agggcagatg ctgtgaccct tgatggtggt 180 ttggtgtttg aagcagacca gtacaaactg cggccggtag cagcggagat ctacgggaca 240 gaagagaatc cccaaaccta ctattatgct gtggctgtag tgaagaaagg tttcaacttt 300 cagaaccagc tacaaggtcg aaagtcctgc cacacaggcc ttggcaggtc tgccgggtgg 360 aatatcccta tagggttact tcgccggttc ttggactggg cagggccacc tgagcccctc 420 cagaaagctg tggccaaatt cttctctcag agctgtgtgc cctgcgcaga tggaaatgcg 480 tatcccaacc tgtgtcagct gtgcataggg aaagggaaag ataaatgtgc ttgttcctcc 540 caggaaccgt attttggcta ttccggtgcc ttcaactgtc tgcacaaagg gattggagat 600 gtggcttttg tcaaggagag tacagtgttt gagaacctgc cacagaaggc tgaccgggac 660 aaatacgagc tactctgccc agacaatact cgaaagccag tggaagcatt cagggagtgc 720 caccttgccc gggtcccttc tcatgctgtt gtggcccgaa gtgtgaatgg caaggagaac 780 tccatctggg agcttctcta ccagtcacag aa aaagtttg gaaaaagcaa tccacaggag 840 ttccagctct ttggctctcc tggtcagcag aaggacctcc tgtttagaga tgctaccatc 900 gggtttttga agatcccctc aaagatagat tctaagctgt acctgggcct cccgtacctt 960 actgccatcc agggcctgag ggaaacggca gcggaggtgg aggcgcggca ggcgaaggtc 1020 gtgtggtgcg ccgtgggtcc agaggagctg cgcaagtgcc ggcagtggag cagccagagc 1080 agccagaacc tgaactgcag cctggcctcc accaccgagg actgcatcgt ccaggtgctg 1140 aaaggagaag ctgatgctat gagcttggat ggaggattta tctacactgc gggcaagtgt 1200 ggtttggtgc ctgtcctggc agagaaccaa aaatctcgcc aaagcagtag ctcagactgt 1260 gtgcatagac caacacaagg gtattttgcc gtggcggttg tcaggaaagc aaatggtggt 1320

-11 CZ 29275 Ul ggctggaaca tccccatggg cctgcttgtc aaccagacag gctcctgcaa atttgacgaa ttctttagtc aaagctgtgc tcctgggtct cagccgggat ccaatctctg tgcactgtgt gttggcaatg accagggcgt ggacaagtgt gtgcccaaca gtaatgagag atactatggt tacaccgggg ctttcaggtg cctggctgag aatgctgggg atgtggcgtt tgtgaaagat gtcactgtct tggacaacac gaatggacag aacacagaag agtgggccag ggaattgagg tcagatgact ttgagctgct gtgccttgat ggcaccagga agcctgtgac tgaggctcag aactgtcacc tggctgtggc ccccagtcat gctgtggtct ctcggaagga aaaggcagca caggtggaac aggtgctact cactgagcag gctcagttg gcgcgtgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcg

1440

1500

1560

1620

1680

1740

1800

1860

1920

1980

2040

2052

Glv Leu Leu Arg

<210> 2 <211> 683 <212> PRT <213> Art1f1c1al Sequence <220>

<223> amino acid sequence of recombinant lactoferrin <400> 2

Ala Lys Lys Gly Val Arg Trp cys Val ile ser Thr Ala Glu Tyr

5 10 15 Ser Lys cys Arg Gin Trp Gin Ser Lys xle Arg Arg Thr Asn Pro Met

25 30

Phe cys bad Arg Arg Ala ser Pro Thr Asp cys ile Arg Ala bad Ala 35 4Ó 45

Ala Lys Arg Ala Asp Ala Val Thr Leu Gly Gly Glu Leu Phe Glu 50 55 60

Ala Asp Gin Tyr Gly Thr

70

Glu Glu Asn Pro Gin Thr Tyr Tyr Tyr Vall Val Vall Val Lys Lys

90 95

Gly Phe Gn Asn Gin Gn Leu Gin Gly Arg Lys ser cys His Thr 100 105 110

Trp Asn ile for ile

120

Arg Phe Leu Asp Trp Ala Gly Pro for Glu Pro Leu Gin Lys Ala Val 130 135 140

Ala Lys Phe Phe Ser Gin Ser Cys Val Pro Cys Ala Asp Gly Asn Ala 145 150 155 160

Tyr Pro Asn Leu Cgs Gin Leu Cys Ile Gig Lys Gly Lys Asp L ^ | cys

Ala cys ser ser Gin Glu For Tyr Phe Gly Tyr ser Gly Ala Phe Asn

180 185 190 cys Leu His Lys Gly Wrong Gly Asg Val Ala Phe Val Lg | Glu Ser Thr

Val Phe Glu Asn Leu

210 215 220

Leu Cys Pro Asp Asn Thr Arg Lys Pro Val Glu Ala Phe Arg Glu cys 225 230 235 240

His Leu Ala Arg Val For Ser His Ala Val Val Ala Ser Ser Asn, "245 250 255

Gly Lys Glu Asn Ser Ile Trp Glu Leu Leu Tyr Gin Ser Gin Lys Lys

260 265 270

- 12GB 29275 Ul

Phe Gly Lys 275 Ser Asn For Gin Glu Phe 280 Gin Leu Phe Gly Ser For Gly Gin Gin Lys Asp Leu Leu Phe Arg Asp Ala Thr ile Gly Phe Leu Lys 290 ile 295 300 Ile 305 For Ser Lys Asp 310 Ser Lys Leu Tyr Leu 315 Gly Leu For Tyr Leu 320 Thr Ala Ile Gin Gly Leu Arg Glu Thr Ala Ala Glu Val Glu Ala Arg

(+420) 325 330 335

Gin Ala Lys val Val Trp cys Ala Val Gly Pro Glu Glu Leu Arg Lys 340 345 350 cys Arg Gin Trp ser ser Gin ser ser Gin Asn Leu Asn cys ser Leu 355 360 365

Ala Ser Thr Thr Glu Asp Cys Ile Val Gin Val Leu Lys Gly Ala 370 375 380

Asp Ala Met Ser Leu Asp Gly Gly Phe Ile Tyr Thr

385 390 395 400

Gly Leu val Pro val Leu Ala Glu Asn Gin Lys ser Arg Gin ser ser

405 410 415 ser Asp Asp cys val His Arg for Thr Gin Gly Tyr phe Ala val Ala 420 425 430

Val Arg Lys Ala Asn Gly Gly ile Thr Trp Asn Ser Val Arg Gly 435 440 445

Thr Lys 450 ser cys His Thr Ala 455 Wall Asp Arg Thr Ala 460 Gly Trp Asn li e For Met Gly Leu Leu Wall Asn Gin Thr Gly ser cys Lys Phe Asp Gl u 465 Phe 470 475 480 Phe ser Gin Ser Cys Ala For Gly ser Gin For Gly Ser Asn Leu 485 490 495

Cys Ala Leu Cys Val Gly Asn Asp Gins Gly Val Asp Lys Cys Val Pro 500 505 510

Asn ser Asn Glu Tyr Tyr Tyr Gly Tyr Thr Gly Ala Phe Arg cys Leu 515 520 525

Ala Glu Asn Ala Gly Asp Val Ala Phe Val Lys Asp Val Thr Val Leu 530 535 540

Asp 545 Asn Thr Asn Gly Gin 550 Asn Thr Glu Glu Trp Ala 554 Arg Glu Leu Arg 560 Ser Asp Asp Phe Glu Leu Leu cys Leu Asp Gly Thr Arg Lys For Wall Thr 565 570 575 Glu Ala Gin Asn cys His Leu Ala Wall Ala Pro ser His Ala Val 580 585 590 Wall ser Arg Lys Glu Lys Ala Ala Gin Wall Glu Gin Wall Leu Leu Thr Glu 595 phe 600 605 Gin Ala fim Gin Gly Arg Tyr Gly Lys ^Asp βίο For Asp Lys Phe cys 625 Leu Phe Arg ser Glu 630 Thr Lys Asn Leu Leu Phe Asn Asp Asn Thr 640 Glu wall Leu Ala Gin 645 Leu Gin Gly Lys Thr 650 Thr Tyr Glu Lys Tyr 655 Leu Gly Ser Glu Tyr Wall Thr Ala Ile Ala Asn Leu Lys Gin cys Ser wall 660 665 670 Ser For Leu Leu Glu Ala cys Ala Phe Met Met Arg 675 680

PROTECTION REQUIREMENTS

Claims (10)

An anti-diarrhea veterinary composition comprising lactoferrin, comprising inactivated recombinant yeast biomass containing recombinant yeast 5 lactoferrin having the sequence of SEQ ID NO: 2 and / or fragments thereof. -13GB 29275 UI A veterinary composition according to claim 1, characterized in that the recombinant yeast belongs to the genus Pichia and comprises a gene of the sequence SEQ ID NO: 1. Veterinary composition according to claim 2, characterized in that the recombinant yeast belonging to the genus Pichia is a species of Pichia pastoris, preferably a strain of Pichia pastoris GS115. Veterinary composition according to any one of claims 1 to 3, characterized in that the amount of inactivated biomass is in the range of 0.001 to 90% by weight, preferably 1 to 10% by weight. to the total weight of the composition. A veterinary composition according to any one of claims 1 to 4, characterized in that it contains physiologically acceptable excipients. io The veterinary composition according to claim 5, wherein the physiologically acceptable excipient is selected from the group consisting of microcrystalline cellulose, corn starch, potato starch, inulin, bamboo fiber, resistant starch, agar, hydroxypropylmethylcellulose, sodium carboxymethylcellulose, maltodextrin, or mixtures thereof, glycerin, macadam oil, sodium polyacrylate, laureate salts, cetearyl alcohol, coconut butter, xylitol, manili tol, erythritol, gelatin, alginate, agar, chlorhexidine digluconate, chlorhexidine, magnesium stearate, water. Veterinary composition according to any one of claims 1 to 6, characterized in that it contains additional biologically active substances. Veterinary composition according to claim 7, characterized in that it is complementary The biologically active substances are selected from the group consisting of beta-glucan, lactose. LgY antibodies, panthenol, hyaluronic acid, its derivatives and salts, allantoin, beeswax and its derivatives, polylysine and its derivatives, nicotinamide, vitamins, minerals, probiotic oligosaccharides, intestinal regeneration and protection additives, short-chain fatty acids, plant extracts or other biologically active substances. 25 Veterinary composition according to any one of claims 1 to 8, characterized in that it is in solid, semi-solid or liquid dosage form. Veterinary composition according to claim 9, characterized in that it is in the form of a powder, pulse, granulate, pellets, micropellets, paste, gel or solution. An anti-diarrheal veterinary or feed product comprising a veterinary composition according to any one of claims 1 to 10.