CN202968242U - A sequencing batch activated sludge reactor for sewage treatment - Google Patents
A sequencing batch activated sludge reactor for sewage treatment Download PDFInfo
- Publication number
- CN202968242U CN202968242U CN2012206275004U CN201220627500U CN202968242U CN 202968242 U CN202968242 U CN 202968242U CN 2012206275004 U CN2012206275004 U CN 2012206275004U CN 201220627500 U CN201220627500 U CN 201220627500U CN 202968242 U CN202968242 U CN 202968242U
- Authority
- CN
- China
- Prior art keywords
- reactor
- reactor body
- activated sludge
- sequencing batch
- batch activated
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Lifetime
Links
Images
Classifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02W—CLIMATE CHANGE MITIGATION TECHNOLOGIES RELATED TO WASTEWATER TREATMENT OR WASTE MANAGEMENT
- Y02W10/00—Technologies for wastewater treatment
- Y02W10/10—Biological treatment of water, waste water, or sewage
Landscapes
- Purification Treatments By Anaerobic Or Anaerobic And Aerobic Bacteria Or Animals (AREA)
Abstract
The utility model discloses a sequencing batch activated sludge reactor for sewage treatment, which comprises a reactor main body, wherein an aeration device connected with an air pump is arranged in the reactor main body; the reactor main body is provided with a sample inlet and a water outlet, and the bottom of the reactor main body is provided with a sludge outlet; the aeration device comprises an aeration head arranged at the bottom of the reactor main body; the inner wall of the reactor body is rough. When the device is used for biological sewage treatment, the number of adding bacterial strains is small, the durability is good, and activated sludge and pollutant degrading bacteria can be filmed on the inner wall of the reactor with the help of a signal molecule preparation, so that various pollutants in sewage can be degraded quickly and effectively; the device has reliable principle, simple manufacturing structure, convenient monitoring and high treatment efficiency, and can be applied to actual industrial wastewater treatment after being amplified according to a certain proportion.
Description
Technical field
The utility model relates to sewage treatment area, relates in particular to a kind of sequencing batch activated sludge reactor for sewage disposal.
Background technology
It is more unmanageable industrial sewage at present that tobacco is processed waste water and fluorine containing organic waste water etc.Due to validity, the low price property of biological method, it has obtained generally using in wastewater treatment, and biological method goes for the continually varying Pollutant levels.The conventional activated sludge method is to utilize microorganism at first organism to be converted into carbonic acid gas, water and microbial cells, after reaction, microorganism is preserved, remove newly-increased microorganism at reasonable time by getting rid of excess sludge from system, reach the purpose of pollution degradation.
Sequencing batch active sludge (SBR) is a kind of active sludge sewage disposal technology that moves by the intermittent aeration mode, in recent years, due to SBR technique have simple in structure, do not establish second pond, characteristics of compact layout, occupation of land less, treatment effect is stable, flexible operation is variable, be convenient to realize the advantage such as automatization and more and more be subject to people and pay attention to.Along with the development of sewage treatment process, some novel procesies also appear in SBR, and the systems such as anaerobism SBR, multistage SBR have also obtained more deep research.The patent of invention of notification number CN100369830C discloses a kind of waste water treating process of circulation sequence batched active sludge and activated sludge reactor thereof.This reactor by two main reaction ponds and two auxiliary reaction tanks by communication channel or control the lock ring seal and be in series, wherein: be provided with aerating apparatus in two main reaction ponds, the head bay wall cloth in two main reaction ponds is put main reaction pond water-in; Be provided with whipping appts and residual sludge pump in two auxiliary reaction tanks, the head bay wall cloth of two auxiliary reaction tanks is put auxiliary reaction tank water-in, and the downstream bath wall cloth of two auxiliary reaction tanks is put water-freeing arrangement.The utility model patent of publication number CN202369443U discloses a kind ofly to be detested, lacks and aerobic sbr reactor device, whole one-tenth cylinder tubbiness includes the stirring wheel oar, and the stirring engine driven is arranged at its top, at reactor lower part, aeration opening is arranged, the outer gas blower that connects has aeration tube, shore pipe from top to bottom successively on the reactor post jamb, rising pipe, stopple coupon, upflow tube is useful on the water-bath part of regulating temperature outside reactive moieties.Also have in addition the parts such as venting port, dissolved oxygen sensor, water inlet pipe, nitrate water inlet pipe, intake pump, automatic timing device, water distribution storage barrel, circuit.The aerobic biological einforcement method of these existing use is processed the reactor of waste water, mostly there is no carrier and inner wall smooth, easy to be filmed not on inwall, and active sludge can not well-proportionedly be distributed in reactor, makes the practical application of biological reinforcing technology have a lot of drawbacks.
The application for a patent for invention of publication number CN1772654A discloses in a kind of suspending carrier SBR art breading, the apparatus and method of samll cities and towns and biotope sewage and trade effluent, suspending carrier sbr reactor device is divided into inhalant region, main district and the SBR district of exposing to the sun, the main district of exposing to the sun is filled with suspending carrier, and sewage disposal was undertaken by the cycle.The method can improve the biological sludge total amount, enhanced reactor sludge activity, but it exists carrier not reuse, and the easy shortcoming such as alluvial.
The utility model content
The utility model provides a kind of sequencing batch activated sludge reactor for sewage disposal, is used for the biological einforcement method various pollutents of degradation of sewage quickly and efficiently.
A kind of sequencing batch activated sludge reactor for sewage disposal comprises reactor body, is provided with the aerating apparatus that is connected with pneumatic pump in reactor body; Described reactor body is provided with injection port and water port, and reactor body bottom is provided with mud discharging mouth; Described aerating apparatus comprises the aeration head that is located at the reactor body bottom; The inner wall coarse of described reactor body.
The reactor body inner wall coarse, easy biofilm, microorganism and active sludge can be evenly distributed in reactor, thereby strengthen the biological degradation to sewage.
Described reactor body is cylinder shape, and the height of reactor body is 8 with the internal diameter ratio: 1-10: 1.Under this ratio condition, be conducive to aeration most.
Described injection port is located at the top of reactor body, is convenient to sample introduction.
Described water port is located on the sidewall of reactor body, facilitates draining or sampling.
The quantity of described water port is 2-7, and water port is arranged on the sidewall of reactor body from bottom reactor body from bottom to top, and uppermost water port is the 16-23% of reactor body height from the distance on reactor body top.Preferably, the quantity of described water port is 5.Sidewall at reactor body arranges a plurality of water port from bottom to top conveniently in the different heights sampling, such as, during aeration, can get the muddy water compound sample at different heights place; When stopping the supple of gas or steam, can get respectively mud sample, compound sample and water sample from bottom to top, be convenient to examination and controlling.In addition, during due to Air Exposure, the sewage surface has foam to produce, and when uppermost water port accounted for reactor body height 16-23% from reactor body top distance, foam can not overflow, and the equipment and materials utilization ratio is the highest.
Described mud discharging mouth is the circular hole of diameter 0.8-1.0cm, is convenient to active sludge and discharges.
The inwall of described reactor body is provided with some particulate state projections, perhaps is provided with coarse line shape, perhaps is linked with nylon wire; Wherein, coarse line shape can be realized by the inwall hacking.Can easily inwall be arranged to coarse shape like this, microbial biofilm is easier to be formed thereon, is conducive to improve degradation efficiency.
Described aeration head is connected by the outer pneumatic pump of aeration tube and reactor body, and the aeration rate of pneumatic pump is 15-25L/h.
The bottom of described reactor body is provided with stationary installation, plays fixed action.Described stationary installation can be fixed support.
Particularly, reactor can adopt following size: reactor body is cylinder shape, is highly 62-67cm, internal diameter 7cm, wall thickness 0.5-1.0cm; The bottom arranges a mud discharging mouth, and diameter is 0.8-1.0cm; On the reactor body sidewall, begin from the bottom at interval of 13cm, a draining (mud) mouth to be set, arrange altogether 5, uppermost water port is 10-15cm from the distance on reactor body top.
Adopt above-mentioned sequencing batch activated sludge reactor to dispose of sewage, technique can for: active sludge, sewage, contaminant degradation bacterium seed liquor and signaling molecule preparation are mixed, add in reactor body; Open aerating apparatus mixed solution is carried out Air Exposure, carry out precipitation process after stopping the supple of gas or steam, make mud-water separation; Sewage qualified discharge after processing.
Described sewage can be tobacco wastewater or waste water from organic fluorine industry.
When sewage is tobacco wastewater, contaminant degradation bacterium seed liquor is the seed liquor of Arthrobacter (Acinetobacter sp.) TW of preserving number CGMCC No.7.47, and the signaling molecule preparation is N-3 oxo-caproyl-homoserine lactone solution of 8-16mmol/L and the N-caproyl that concentration is 4-8mmol/L-homoserine lactone solution by volume 2 by concentration: 1-1: 2 mix; The Air Exposure time is 18-48h, and the precipitation process time is 5-15min.
Wherein, Arthrobacter TW Classification And Nomenclature is Arthrobacter (Acinetobacter sp.), and strain number is TW, and preservation, depositary institution: China Committee for Culture Collection of Microorganisms's common micro-organisms center, preservation date: in November, 2011, preserving number: CGMCC No.7.47.this bacterial strain is preserved in Zhejiang Prov Industrial And Commercial University's solid waste treatment disposal and recycling laboratory simultaneously, (the WangMeizhen such as Wang, Yang Guiqin, Wang Xin, Yao Yanlai, Min Hang, Lv Zhenmei.Nicotine degradation by two novel bacterial isolates of Acinetobacter sp.TWand Sphingomonas sp.TY and their responses in the presence of neonicotinoidinsecticides.World Journal of Microbiology and Biotechnology, 2011, 27 (7): 1633-1640.) disclose the evaluation of this bacterial strain.Arthrobacter TW is Gram-negative bacteria, and on the ISM solid medium that contains Nicotine or 4-fluoroaniline, size is (0.5-0.7 * 1.6-2.0 μ m), and bacterium colony is white in color, moistening circle; In containing the ISM liquid nutrient medium of Nicotine, be yellow-green colour, in containing the ISM liquid nutrient medium of 4-fluoroaniline, be oyster white.The GenBank number of logging in of this bacterial strain 16S rDNA gene order is FJ753401.
Described N-3 oxo-caproyl-homoserine lactone solution is that (v: v=1: the solution that makes 1), N-caproyl-homoserine lactone solution are the water-soluble mixed solution (v: v=1: the solution that makes 1) with acetonitrile of N-caproyl-homoserine lactone to the water-soluble mixed solution with acetonitrile of N-3 oxo-caproyl-homoserine lactone.These two kinds of materials belong to N-acyl group-homoserine lactone class (AHLs) compound; it is a most important class signaling molecule in the gram negative bacteria quorum sensing system; the expression of the many physiological properties of its regulation and control; these two kinds of solution by volume 2: 1-1: the 2 signaling molecule preparations that are mixed to get; can improve the character of active sludge to a certain extent; the extracellular polymeric secretion of Arthrobacter TW is increased; impel biofilm formation; be conducive to the bacterial strain field planting, thereby guarantee the fast degradation of purpose pollutent.
In order to obtain better synergy, preferably, the volume ratio of N-3 oxo-caproyl-homoserine lactone solution and N-caproyl-homoserine lactone solution is 1: 1.
In every liter of tobacco wastewater, the addition of each material is: active sludge 150-250mL, Arthrobacter TW seed liquor 10-30mL, signaling molecule preparation 5-10mL.Under this consumption condition, Arthrobacter TW seed liquor and signaling molecule preparation proportioning are suitable, make bacterial strain easier in the active sludge system growth and breeding, be conducive to the degraded of pollutent.
Described Arthrobacter TW seed liquor prepares by the following method: in Arthrobacter TW access liquid nutrient medium, cultivate 18-28h in 28-32 ℃ of shaking table; By this training method, bacterial strain is cultivated, until bacterium liquid OD600 〉=0.65 is the seed liquor that is cultured to logarithmic phase.In volume 1L, described liquid nutrient medium is composed of the following components: K
2HPO
40.15-0.25g, KH
2PO
40.7-0.9g, Na
2MoO
4H
2O 0.003-0.0036g, MgSO
40.15-0.25g, CaSO
42H
2O 0.05-0.15g, FeSO
47H
2O 0.003-0.007g, Nicotine 0.8-1.2g, surplus is water; The pH of liquid nutrient medium is 6-7.Add appropriate Nicotine, with as the necessary carbon nitrogen source of Arthrobacter TW seed liquor growth and breeding.
When sewage is waste water from organic fluorine industry, contaminant degradation bacterium seed liquor is the seed liquor of Arthrobacter (Acinetobacter sp.) TW of preserving number CGMCC No.7.47, and the signaling molecule preparation is N-3 oxo-caproyl-homoserine lactone solution of 8-16mmol/L and the N-caproyl that concentration is 4-8mmol/L-homoserine lactone solution by volume 2 by concentration: 1-1: 2 mix; The Air Exposure time is 24-72h, and the precipitation process time is 5-15min.
Wherein, the volume ratio of N-3 oxo-caproyl-homoserine lactone solution and N-caproyl-homoserine lactone solution is 1: 1.
Described waste water from organic fluorine industry is the waste water that contains the 4-fluoroaniline.The waste water that contains the 4-fluoroaniline is after organic fluorine source mill draining anaerobic technique premenstruum is processed, produce enter aerobic stage contain 4-fluoroaniline waste water.For this waste water, ordinary method is more difficult, the 4-fluoroaniline but Arthrobacter TW and the combination of signaling molecule preparation can optionally be degraded, and degradation efficiency is higher.
In waste water, the concentration of 4-fluoroaniline is 0.2-1.5g/L; In every liter of waste water, the addition of each material is: active sludge 150-250mL, Arthrobacter TW seed liquor 20-40mL, signaling molecule preparation 5-10mL.Under this consumption condition, Arthrobacter TW seed liquor and signaling molecule preparation proportioning are suitable, make bacterial strain easier in the active sludge system growth and breeding, be conducive to the degraded of pollutent.
Described Arthrobacter TW seed liquor prepares by the following method: in Arthrobacter TW access liquid nutrient medium, cultivate 24-48h in 28-32 ℃ of shaking table; By this training method, bacterial strain is cultivated, until bacterium liquid OD600 〉=0.65 is the seed liquor that is cultured to logarithmic phase.In volume 1L, described liquid nutrient medium is composed of the following components: K
2HPO
40.15-0.25g, KH
2PO
40.7-0.9g, Na
2MoO
4H
2O 0.003-0.0036g, MgSO
40.15-0.25g, CaSO
42H
2O 0.05-0.15g, FeSO
47H
2O 0.003-0.007g, 4-fluoroaniline 0.8-1.2g, surplus is water; The pH of liquid nutrient medium is 7.5-8.5.Add appropriate 4-fluoroaniline, with as the necessary carbon nitrogen source of Arthrobacter TW seed liquor growth and breeding.
Aerating apparatus can arrange following program: the 5min sample introduction, 5min draining and spoil disposal are set the 5-15min precipitation process time according to activated sludge settling property, according to water outlet performance setting 18-72h hydraulic detention time (Air Exposure time).
Adopt the utility model, have following beneficial effect:
(1) sequencing batch activated sludge reactor that provides of the utility model, have that principle is reliable, manufacturing structure is simple, monitoring is convenient, the processing efficiency advantages of higher, especially the signaling molecule preparation of arranging in pairs or groups uses, have very good effect, can be applicable to larger industrialization wastewater treatment occasion after amplifying by a certain percentage.
(2) this reactor wall is coarse; under the help of signaling molecule; active sludge and contaminant degradation bacterium can be in the reactor wall biofilms; in the same volume situation; reaction efficiency is improved; be the novel reactor for industrial sewages such as tobacco waste or waste water from organic fluorine industries of a kind of comparatively desirable efficient, economy, environmental protection, can reduce waste to the harm of environment and human body, environment protection is significant.
(3) adopt this reactor to carry out sewage disposal, have easy to operately, add number of times few, but and the advantage of dauer effect, can greatly shorten the reactor start-up time, accelerating reactor is stable.
(4) adopt this reactor to carry out sewage disposal, contaminant degradation bacterium and be conducive to its signaling molecule preparation of field planting in environment and (microorganism almost do not had toxicity, can improve the character of active sludge), can degrade preferentially, fast and efficiently under the condition of abundant nutrition source Nicotine or 4-fluoroaniline; Simultaneously, when processing tobacco waste, can also reduce the total COD value of tobacco waste.
Description of drawings
Fig. 1 is the structural representation of the utility model sequencing batch activated sludge reactor (SBR) of being used for sewage disposal.
Embodiment
A kind of sequencing batch activated sludge reactor for sewage disposal, comprise reactor body 1 and aerating apparatus 2 as shown in Figure 1.
The bottom of reactor body 1 is provided with stationary installation, plays fixed action; Stationary installation is fixed support.
The top of reactor body 1 offers injection port 11, is used for adding of sewage, active sludge etc.; The bottom of reactor body 1 offers mud discharging mouth 13, and mud discharging mouth 13 is the circular hole of diameter 0.8cm, is used for the discharge of active sludge.
The sidewall of reactor body 1 vertically offers 5 water port 12 from bottom to top altogether, nethermost water port 12 is located at bottom reactor body 1 sidewall, begin from the bottom to be provided with a water port 12 at interval of 13cm, uppermost water port 12 is 15cm from the distance on reactor body 1 top.
The inwall of reactor body 1 is adherent hangs a nylon wire, makes inwall rough-shape, easy biofilm, and microorganism and active sludge can be evenly distributed in reactor, can effectively improve degradation efficiency.
Aerating apparatus 2 comprises aeration head 22 and aeration tube 21, and aeration head 22 is located at the bottom of reactor body 1 inner chamber, and aeration head 22 is connected with the pneumatic pump 3 of reactor body 1 outside by aeration tube 21.
1, the sbr reactor device of the inner wall coarse of employing embodiment 1 is for the treatment of tobacco waste
(1) screening of Arthrobacter TW and cultivation:
Get Hangzhou profit group cigar mill's tobacco waste, continue to cultivate 14d, with enrichment nicotine degradation bacterium; The dilution of enrichment culture thing, coating are inoculated on the Nicotine minimal medium and cultivate; Picking colony continues dilution spread and cultivates, until picking obtains single bacterium colony.
Through identifying, this list bacterium colony is Arthrobacter (Acinetobacter sp.), called after Arthrobacter TW.Arthrobacter TW preservation, depositary institution: China Committee for Culture Collection of Microorganisms's common micro-organisms center, preservation date: in October, 2011, preserving number: CGMCC No.7.47.This bacterial strain is Gram-negative bacteria, and size is (0.5-0.7 * 1.6-2.0 μ m), and Arthrobacter TW bacterium colony is white in color, moistening circle; The GenBank number of logging in of this bacterium 16S rDNA sequence is FJ753401 (concrete sequence is as follows).(the Wang Meizhen such as Wang, Yang Guiqin, Wang Xin, Yao Yanlai, MinHang, LvZhenmei.Nicotine degradation by two novel bacterial isolates ofAcinetobacter sp.TW and Sphingomonas sp.TY and their responses in thepresence of neonicotinoid insecticides.World Journal of Microbiology andBiotechnology, 2011,27 (7): 1633-1640.) disclose the evaluation of Arthrobacter TW.
The 16S rDNA sequence of Arthrobacter TW is:
caaaaaggat?tgcgggggct?taccatgcaa?gtcgagcggg?ggaaggtagc?ttgctactgg?acctagcggc?ggacgggtgagtaatgctta?ggaatctgcc?tattagtggg?ggacaacatc?tcgaaaggga?tgctaatacc?gcatacgtcc?tacgggagaaagcaggggat?cttcggacct?tgcgctaata?gatgagccta?agtcggatta?gctagttggt?ggggtaaagg?cctaccaaggcgacgatctg?tagcgggtct?gagaggatga?tccgccacac?tgggactgag?acacggccca?gactcctacg?ggaggcagcagtggggaata?ttggacaatg?gggggaaccc?tgatccagcc?atgccgcgtg?tgtgaagaag?gccttatggt?tgtaaagcactttaagcgag?gaggaggcta?ctctagttaa?tacctaggga?tagtggacgt?tactcgcaga?ataagcaccg?gctaactctgtgccagcagc?cgcggtaata?cagagggtgc?gagcgttaat?cggatttact?gggcgtaaag?cgtgcgtagg?cggcttattaagtcggatgt?gaaatccccg?agcttaactt?gggaattgca?ttcgatactg?gtgagctaga?gtatgggaga?ggatggtagaattccaggtg?tagcggtgaa?atgcgtagag?atctggagga?ataccgatgg?cgaaggcagc?catctggcct?aatactgacgctgaggtacg?aaagcatggg?gagcaaacag?gattagatac?cctggtagtc?catgccgtaa?acgatgtcta?ctagccgttggggcctttga?ggctttagtg?gcgcagctaa?cgcgataagt?agaccgcctg?gggagtacgg?tcgcaagact?aaaactcaaatgaattgacg?ggggcccgca?caagcggtgg?agcatgtggt?ttaattcgat?gcaacgcgaa?gaaccttacc?tggccttgacatactagaaa?ctttccagag?atggattggt?gccttcggga?atctagatac?aggtgctgca?tggctgtcgt?cagctcgtgtcgtgagatgt?tgggttaagt?cccgcaacga?gcgcaaccct?tttccttact?tgccagcatt?tcggatggga?actttaaggatactgccagt?gacaaactgg?aggaaggcgg?ggacgacgtc?aagtcatcat?ggcccttacg?gccagggcta?cacacgtgctacaatggtcg?gtacaaaggg?ttgctacaca?gcgatgtgat?gctaatctca?aaaagccgat?cgtagtccgg?attggagtctgcaactcgac?tccatgaagt?cggaatcgct?agtaatcgcg?gatcagaatg?ccgcggtgaa?tacgttcccg?ggccttgtacacaccgcccg?tcacaccatg?ggagtttgtt?gcaccagaag?tagctagcct?aactgcaaag?agggcggtac?cacggtgcccgtggctttct?tt
The seed liquor culture medium prescription of Arthrobacter TW is: K
2HPO
40.2g/L, KH
2PO
40.8g/L, MgSO
40.2g/L, CaSO
42H
2O 0.1g/L, NaMoO
4H
2O 0.0033g/L, FeSO
47H
2O 0.005g/L, agar 10g/L (in solid medium), Nicotine 1g/L, pH6.5.
(2) be conducive to the signaling molecule preparation preparation of nicotine degradation and bacterial strain biofilm: this signaling molecule preparation is by 3-oxo-C
6-HSL and C6-HSL form, and the concentration of its mother liquor is respectively 8mmol/L and 4mmol/L, and both blending ratios are 1: 1, and cumulative volume is 10mL.The effect of described signaling molecule preparation is that the extracellular polymeric secretion of bacterial strain is increased, and impels biofilm formation, is beneficial to the bacterial strain field planting, thereby guarantees the degraded of purpose pollutent.
(3) process tobacco waste:
(in tobacco wastewater, tobacco waste derives from Hangzhou profit group cigar mill with active sludge (take from Hangzhou seven lattice sewage work), tobacco wastewater, concentration improves gradually with reactor operation), Arthrobacter TW seed liquor (being cultured to logarithmic phase) and the mixing of signaling molecule preparation, add the reactor body 1 of sbr reactor device from injection port 11; Open 2 pairs of mixed solutions of aerating apparatus and carry out Air Exposure, carry out precipitation process after stopping the supple of gas or steam, make mud-water separation; Sewage qualified discharge after processing.
Wherein, in every liter of tobacco wastewater, the inoculum size of active sludge is 200mL; The inoculum size of Arthrobacter TW seed culture fluid is 20mL, and the signaling molecule preparation add-on that is conducive to nicotine degradation is 10mL; Reaction conditions is room temperature, and pH 5.0-8.0, DO are 3-5mg/L, and aeration rate is 20L/h; Working procedure is: the 5min sample introduction, 5min draining and spoil disposal are according to the sludge settling time of activated sludge settling property setting 5-15min, according to the hydraulic detention time of water outlet performance setting 18-48h.The reaction solution volume of adding after each draining be overall reactor long-pending 1/2.
During aeration, can take a sample respectively by 5 water port 12, the muddy water compound sample that obtains different heights detects; When stopping the supple of gas or steam, can get respectively mud sample, compound sample and water sample from water port 12 from bottom to top, for detection of and the monitoring.
Result shows, inoculation once, can continue to monitor Arthrobacter TW in reactor mud, and active sludge and bacterial strain TW wall built-up on nylon wire are obvious, demonstrated the outstanding effect of signaling molecule preparation aspect biofilm formation, active sludge no longer only sinks to reactor bottom like this, but all distributes in whole reactor, make the clearance of Nicotine and COD maintain higher level, continue to monitor 100d; After reactor was stable, in tobacco wastewater, Nicotine degradation rate in 24h HRT was 100%, and wherein the Nicotine influent concentration is between 1.0-1.5g/L; The clearance of COD surpasses 80%, and after wherein reactor changes water at every turn, COD concentration is in the 25000mg/L left and right.
Comparative Examples changes the sbr reactor device of inner wall coarse in above-mentioned example into the sbr reactor device of inner wall smooth, does not namely hang nylon wire, and other operations are identical.
Result shows, inoculates once, can continue to monitor Arthrobacter TW in reactor mud, and the time that continues to monitor is 100d; After reactor was stable, in tobacco wastewater, Nicotine degradation rate in 24hHRT was 100%, and wherein the Nicotine influent concentration is between 1.0-1.5g/L; The clearance of COD is up to 75%, and after wherein reactor changes water at every turn, COD concentration is in the 25000mg/L left and right.
2, the sbr reactor device of the inner wall coarse of employing embodiment 1 is for the treatment of waste water from organic fluorine industry
(1) cultivation of Arthrobacter TW:
It is in the minimal medium of 1.0g/L that the Arthrobacter TW of screening acquisition in embodiment 1 is inoculated into 4-fluoroaniline concentration, and culture medium prescription is: K
2HPO
40.2g/L, KH
2PO
40.8g/L, MgSO
40.2g/L, CaSO
42H
2O 0.1g/L, NaMoO
4H
2O 0.0033g/L, FeSO
47H
2O 0.005g/L, 4-fluoroaniline 1g/L, pH8.0; Cultivate 32h in 130rpm, 30 ℃ of shaking tables.
(2) being conducive to the degraded of 4-fluoroaniline prepares with the signaling molecule preparation of bacterial strain biofilm: this signaling molecule preparation is by 3-oxo-C
6-HSL and C
6-HSL forms, and the concentration of its mother liquor is respectively 8mmol/L and 4mmol/L, and both blending ratios are 1: 1, and cumulative volume is 10mL.The effect of described signaling molecule preparation is that the extracellular polymeric secretion of bacterial strain is increased, and impels biofilm formation, is beneficial to the bacterial strain field planting, thereby guarantees the degraded of purpose pollutent.
(3) process waste water from organic fluorine industry:
With active sludge (take from Hangzhou seven lattice sewage work), the waste water from organic fluorine industry (waste water from organic fluorine industry that contains the 4-fluoroaniline, produce after processing for organic fluorine source mill draining anaerobic technique premenstruum enter aerobic stage contain 4-fluoroaniline waste water), Arthrobacter TW seed liquor (being cultured to logarithmic phase) and the mixing of signaling molecule preparation, add the reactor body 1 of sbr reactor device from injection port 11; Open 2 pairs of mixed solutions of aerating apparatus and carry out Air Exposure, carry out precipitation process after stopping the supple of gas or steam, make mud-water separation; Sewage qualified discharge after processing.
Wherein, in every liter of waste water from organic fluorine industry, the inoculum size of active sludge is 200mL; The inoculum size of Arthrobacter TW seed culture fluid is 30mL, and the signaling molecule preparation add-on that is conducive to nicotine degradation is 10mL; Reaction conditions is room temperature, and pH 6.5-9.5, DO are 3-5mg/L, and aeration rate is 20L/h; Working procedure is: the 5min sample introduction, 5min draining and spoil disposal are according to the sludge settling of activated sludge settling property setting 5-15min, according to the hydraulic detention time of water outlet performance setting 24-72h.The reaction solution volume of adding after each draining be overall reactor long-pending 1/2.
During aeration, can take a sample respectively by 5 water port 12, the muddy water compound sample that obtains different heights detects; When stopping the supple of gas or steam, can get respectively mud sample, compound sample and water sample from water port 12 from bottom to top, for detection of and the monitoring.
Result shows, inoculation once, can continue to monitor Arthrobacter TW in reactor mud, and active sludge and bacterial strain TW wall built-up on nylon wire are obvious, demonstrated the outstanding effect of signaling molecule preparation aspect biofilm formation, active sludge no longer only sinks to reactor bottom like this, but all distributes in whole reactor, make the clearance of 4-fluoroaniline and COD maintain higher level, continue to monitor 100d; After reactor was stable, 4-fluoroaniline degradation rate in 32h HRT was 100%, and wherein 4-fluoroaniline influent concentration is between 1.0-1.5g/L; The clearance of COD surpasses 80%, and after wherein reactor changes water at every turn, COD concentration is in the 15000mg/L left and right.
Comparative Examples changes the sbr reactor device of inner wall coarse in above-mentioned example into the sbr reactor device of inner wall smooth, does not namely hang nylon wire, and other operations are identical.
Result shows, the inoculum size with 3%, and only inoculation once, can continue to monitor Arthrobacter TW in reactor mud, and the time that continues to monitor is 100d; After reactor was stable, in the organic fluorine processing waste water, 4-fluoroaniline degradation rate in 32h HRT was 100%, and wherein 4-fluoroaniline influent concentration is between 1.0-1.5g/L; The clearance of COD reaches 75%, and after wherein reactor changes water at every turn, COD concentration is in the 15000mg/L left and right.
Claims (8)
1. sequencing batch activated sludge reactor that is used for sewage disposal, comprise reactor body (1), be provided with the aerating apparatus (2) that is connected with pneumatic pump (3) in reactor body (1), it is characterized in that, described reactor body (1) is provided with injection port (11) and water port (12), and reactor body (1) bottom is provided with mud discharging mouth (13); Described aerating apparatus (2) comprises the aeration head (22) that is located at reactor body (1) bottom; The inner wall coarse of described reactor body (1).
2. sequencing batch activated sludge reactor according to claim 1, is characterized in that, described reactor body (1) is cylinder shape, and the height of reactor body (1) is 8 with the internal diameter ratio: 1-10: 1.
3. sequencing batch activated sludge reactor according to claim 1, is characterized in that, described injection port (11) is located at the top of reactor body (1).
4. sequencing batch activated sludge reactor according to claim 1, is characterized in that, described water port (12) is located on the sidewall of reactor body (1).
5. sequencing batch activated sludge reactor according to claim 1, it is characterized in that, the quantity of described water port (12) is 2-7, water port (12) is arranged on the sidewall of reactor body (1) from bottom reactor body (1) from bottom to top, and uppermost water port (12) is the 16-23% of reactor body (1) height from the distance on reactor body (1) top.
6. sequencing batch activated sludge reactor according to claim 1, is characterized in that, described mud discharging mouth (13) is the circular hole of diameter 0.8-1.0cm.
7. sequencing batch activated sludge reactor according to claim 1, is characterized in that, the inwall of described reactor body (1) is provided with some particulate state projections, perhaps is provided with coarse line shape, perhaps is linked with nylon wire.
8. sequencing batch activated sludge reactor according to claim 1, is characterized in that, the bottom of described reactor body (1) is provided with stationary installation.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2012206275004U CN202968242U (en) | 2012-11-22 | 2012-11-22 | A sequencing batch activated sludge reactor for sewage treatment |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2012206275004U CN202968242U (en) | 2012-11-22 | 2012-11-22 | A sequencing batch activated sludge reactor for sewage treatment |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN202968242U true CN202968242U (en) | 2013-06-05 |
Family
ID=48509344
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2012206275004U Expired - Lifetime CN202968242U (en) | 2012-11-22 | 2012-11-22 | A sequencing batch activated sludge reactor for sewage treatment |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN202968242U (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103382049A (en) * | 2012-11-22 | 2013-11-06 | 浙江工商大学 | Sequencing batch activated sludge reactor for sewage treatment and treatment process |
| CN103626290A (en) * | 2013-11-05 | 2014-03-12 | 浙江工商大学 | Rapid domestication reactor and rapid domestication method for anaerobic granular sludge |
-
2012
- 2012-11-22 CN CN2012206275004U patent/CN202968242U/en not_active Expired - Lifetime
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103382049A (en) * | 2012-11-22 | 2013-11-06 | 浙江工商大学 | Sequencing batch activated sludge reactor for sewage treatment and treatment process |
| CN103382049B (en) * | 2012-11-22 | 2014-12-17 | 浙江工商大学 | Sequencing batch activated sludge reactor for sewage treatment and treatment process |
| CN103626290A (en) * | 2013-11-05 | 2014-03-12 | 浙江工商大学 | Rapid domestication reactor and rapid domestication method for anaerobic granular sludge |
| CN103626290B (en) * | 2013-11-05 | 2015-01-07 | 浙江工商大学 | Rapid domestication reactor and rapid domestication method for anaerobic granular sludge |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101691547B (en) | Method for restoring micro-scale polluted reservoir water by using situ bio-contact oxidation | |
| Pan et al. | Effects of the combination of aeration and biofilm technology on transformation of nitrogen in black-odor river | |
| CN105776570B (en) | A kind of high-density biology enrichment reactor and its processing method for high ammonia nitrogen organic chemical waste water with high salt | |
| CN103382049B (en) | Sequencing batch activated sludge reactor for sewage treatment and treatment process | |
| CN105541003A (en) | Method for treating aquaculture wastewater | |
| CN109678257A (en) | A method of being suitable for the functional flora construction method and application flora improvement black and odorous water of black and odorous water improvement | |
| CN102776140B (en) | Cold-tolerant pseudomonas strain Den-05, and screening method and application thereof | |
| CN103183455A (en) | Device and method for biologically denitrifying wastewater with high salinity | |
| CN104310714A (en) | System for processing breeding and slaughtering sewage and technology for system | |
| CN102718326B (en) | Water eco-purification system and purification method thereof | |
| CN103626302B (en) | The sewage water treatment method that a kind of denitrogenation dephosphorizing bacterial classification On-line testing is cultivated and tamed | |
| CN104560823A (en) | Shewanella putrefaciens capable of efficiently degrading acetonitrile and application thereof | |
| CN107963719A (en) | A kind of processing unit and method of high concentration rhodanate waste water | |
| Li et al. | Towards enhanced treatment of piggery biogas slurry in tidal flow constructed wetlands by regulation of hydraulic retention time | |
| CN107487938A (en) | A kind of rural sewage treatment process | |
| CN109574259A (en) | A kind of device and Groundwater Treatment Methodss removing low temperature underground water middle and high concentration nitrate | |
| CN111689640A (en) | Sewage treatment method | |
| CN110156177A (en) | Intermittent Vertical Flow Constructed Wetland Nitrogen Removal Simulation Experimental Device and Experimental Method | |
| CN202968242U (en) | A sequencing batch activated sludge reactor for sewage treatment | |
| CN203737104U (en) | Ethylene oxide waste gas treatment system based on biodegradation | |
| CN107337283B (en) | Method for rapidly culturing pig breeding sewage activated sludge | |
| CN101983938B (en) | Preparation method of bagasse-based biofilm | |
| CN103880184B (en) | A kind of without the ultra-clean sewage water treatment method of sludge organism ball and system | |
| CN106904743A (en) | A kind of water-treatment biological membrane reactor | |
| CN207375911U (en) | A kind of bacteria bed |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| AV01 | Patent right actively abandoned |
Granted publication date: 20130605 Effective date of abandoning: 20141217 |
|
| AV01 | Patent right actively abandoned |
Granted publication date: 20130605 Effective date of abandoning: 20141217 |
|
| RGAV | Abandon patent right to avoid regrant |