CN1836038B - Methods for producing secreted polypeptides - Google Patents

Abstract

The present invention relates to methods for producing a polypeptide, comprising: (a) cultivating a fungal host cell in a medium conducive for the production of the polypeptide, wherein the fungal host cell comprises a nucleic acid construct comprising a first nucleotide sequence encoding a signal peptide operably linked to a second nucleotide sequence encoding the polypeptide, wherein the first nucleotide sequence is foreign to the second nucleotide sequence and the 3' end of the first nucleotide sequence is immediately upstream of the initiator codon of the second nucleotide sequence. The present invention also relates to the isolated signal peptide sequences and to constructs, vectors, and fungal host cells comprising the signal peptide sequences operably linked to nucleotide sequencesencoding polypeptides.

Description

The method for preparing secreted polypeptides

Rights statement about the invention under the research and development of federal funding, finished

The basic contract that the present invention provides according to Ministry of Energy (Primecontract) DE-AC36-98GO10337, subcontract (subcontract) No.ZCO-30017-02 makes under government supports.Government has certain right in the present invention.

Background of invention

Technical field that the present invention belongs to

The present invention relates to produce the method for secrete polypeptide.The invention still further relates to the isolating nucleotide sequence of coded signal peptide, and comprise nucleic acid construct, carrier and the host cell that to operate the signal peptide sequence that links to each other with the nucleotide sequence of coded polypeptide.

Related art is described

At fungal host cells, especially recombinant production heterologous protein in filamentous fungal cells such as Aspergillus (Aspergillus) or yeast cell such as the saccharomyces (Saccharomyces), can provide demand more urgent carrier, to be used for the protein production of commercial correlative.

The recombinant production of heterologous protein is generally finished by the construction expression box, and in expression cassette, the DNA of coded protein places under the expression control of the promotor that is suitable for host cell, promotor and modulated gene isolation.Expression cassette is undertaken by plasmid-mediated conversion usually to the importing of host cell.Produce heterologous protein by cultivating transformed host cells then, the cultivation of host cell is correctly brought into play under the necessary inductive condition of function and is carried out being contained in promotor on the expression cassette.

The new regulating and controlling sequence of enhancing general requirement of protein recombinant production is an available, and wherein regulating and controlling sequence is suitable for controlling the expression of protein in host cell.

U.S patent 6,015,703 discloses the genetics construct that comprises promotor, zytase (xylanase) secretion signal and ripe beta-glucosidase enzyme coding region.When disclosed construct is expressed in recombinant microorganism, to compare with unconverted microorganism, it increases the amount of the beta-glucosidase enzyme of being produced significantly.

WO 91/17243 discloses endoglucanase V and the gene thereof from Humicola insolens DSM 1800.

The purpose of this invention is to provide the method for in fungal host cells, producing polypeptide with signal peptide sequence through improved.

Summary of the invention

The present invention relates to produce the method for secrete polypeptide, comprise:

(a) in helping producing the substratum of described polypeptide, cultivate fungal host cells, wherein said fungal host cells comprises nucleic acid construct, this nucleic acid construct comprises first nucleotide sequence that can operate the coded signal peptide that links to each other with second nucleotide sequence of coding said polypeptide, wherein first nucleotide sequence is an external source to second nucleotide sequence, the upstream of the 3` end next-door neighbour second nucleotide sequence initiator codon of first nucleotide sequence, described first nucleotide sequence is selected from down group:

(i) nucleotide sequence of coded signal peptide, described signal peptide have the aminoacid sequence that at least 70% identity is arranged with SEQ ID NO:37;

The (ii) nucleotide sequence that has at least 70% homology with SEQ ID NO:36; With

(iii) under stringent condition with the Nucleotide of SEQ ID NO:36, or the nucleotide sequence of its complementary strand hybridization, wherein said stringent condition is defined as: under 5 ℃ to 10 ℃ conditions of the Tm value of calculating being lower than, at 0.9M NaCl, 0.09M Tris-HCl pH 7.6,6mM EDTA, 0.5%NP-40,1 * Denhardt ' s solution, the 1mM trisodium phosphate, 1mM monobasic sodium phosphate (sodium monobasicphosphate), 0.1mM ATP, and carry out prehybridization in the yeast rna of every milliliter of 0.2mg, hybridization and post-hybridization washing, under 5 ℃ to 10 ℃ conditions of the Tm value of calculating in being lower than, washing once in being added with 6 * SCC of 0.1%SDS, 15 minutes, with 6 * SCC washed twice, each 15 minutes; With

(b) from substratum, separate the excretory polypeptide.

The invention still further relates to isolating signal peptide sequence and comprise the construct that to operate the signal peptide sequence that links to each other with the nucleotide sequence of coded polypeptide, carrier, and fungal host cells.

The accompanying drawing summary

Fig. 1 shows the restriction map of pAILo1.

Fig. 2 shows the restriction map of pMJ04.

Fig. 3 shows the restriction map of pCahj527.

Fig. 4 shows the restriction map of pMT2188.

Fig. 5 shows the restriction map of pCaHj568.

Fig. 6 shows the restriction map of pMJ05.

Fig. 7 shows the restriction map of pSMai130.

Fig. 8 shows the dna sequence dna (SEQ ID NO:34) and the deduced amino acid (SEQ ID NO:35) of aspergillus oryzae (Aspergillus oryzae) beta-glucosidase enzyme secretory signal sequence.

Fig. 9 shows the dna sequence dna (SEQ ID NO:36) and the deduced amino acid (SEQ ID NO:37) of Humicola insolens endoglucanase V secretory signal sequence.

Figure 10 shows the restriction map of pSMai135.

Figure 11 shows the restriction map of pSATe101.

Figure 12 shows the restriction map of pSATe111.

Figure 13 shows the restriction map of pALFd1.

Figure 14 shows the restriction map of pAILo2.

Figure 15 shows the restriction map of pEJG97.

Figure 16 shows the genomic dna sequence and the deduced amino acid (being respectively SEQ ID NO:46 and 47) of Aspergillus fumigatus (Aspergillus fumigatus) beta-glucosidase enzyme.The signal peptide of expection represents that with underscore the intron of expection is represented with italic.

Figure 17 shows the restriction map of pCR4Blunt-TOPOAfcDNA5`.

Figure 18 shows the restriction map of pCR4Blunt-TOPOAfcDNA3`.

Figure 19 shows the restriction map of pCR4Blunt-TOPOAfcDNA.

Figure 20 shows the restriction map of pALFd7.

Figure 21 shows the restriction map of pALFd6.

Detailed Description Of The Invention

The present invention relates to produce the method for polypeptide, comprise: (a) in helping producing the substratum of described polypeptide, cultivate fungal host cells, wherein said fungal host cells comprises nucleic acid construct, this nucleic acid construct comprises first nucleotide sequence that can operate the coded signal peptide that links to each other with second nucleotide sequence of coding said polypeptide, wherein first nucleotide sequence is an external source to second nucleotide sequence, the upstream of the terminal next-door neighbour of the 3` of first nucleotide sequence (immediately) second nucleotide sequence initiator codon, described first nucleotide sequence is selected from down group:: (i) nucleotide sequence of coded signal peptide, described signal peptide have the aminoacid sequence that at least 70% identity is arranged with SEQ ID NO:37; The nucleotide sequence that at least 70% homology is (ii) arranged with SEQ ID NO:36; (iii) under stringent condition with the Nucleotide of SEQ ID NO:36, or the nucleotide sequence of its complementary strand hybridization, wherein said stringent condition is defined as: under 5 ℃ to 10 ℃ conditions of the Tm value of calculating being lower than, at 0.9M NaCl, 0.09M Tris-HCl pH 7.6,6mM EDTA, 0.5%NP-40,1 * Denhardt ' s solution, the 1mM trisodium phosphate, 1mM monobasic sodium phosphate, 0.1mM ATP, and carry out prehybridization in the yeast rna of every milliliter of 0.2mg, hybridization and post-hybridization washing, under 5 ℃ to 10 ℃ conditions of the Tm value of calculating in being lower than, washing once in being added with 6 * SCC of 0.1%SDS, 15 minutes, with 6 * SCC washed twice, each 15 minutes; (b) from substratum, separate described secrete polypeptide.

In production method of the present invention, fungal host cells is incubated at and is suitable for producing in the nutritional medium of polypeptide with means known in the art.For example; can be in laboratory or industrial fermentation jar; in suitable substratum and under permission expression of polypeptides and/or the isolating condition, come culturing cell by shake-flask culture, small-scale or large scale fermentation (comprising successive, batch-wise, feed supplement-batch-wise or solid state fermentation).In comprising the proper nutrition substratum of carbon source and nitrogenous source and inorganic salt, cultivate with methods known in the art.Suitable medium can obtain from suppliers, perhaps can be with the composition announced (for example, in the American type culture collection catalogue) preparation.

Can survey polypeptide with the method that is specifically designed to described polypeptide known in the art.These detection methods can comprise the disappearance of using specific antibody, the formation of enzyme product or enzyme substrates.

In the production method of the present invention, when under identical working condition, cultivating, compare with the fungal cell who comprises with the nucleotide sequence of coded polypeptide can be operated the natural signals peptide sequence that links to each other, the polypeptide that the fungal cell produces many at least about 25%, more preferably many at least about 50%, more preferably many at least about 75%, more preferably many at least about 100%, be more preferably many at least about 200%, most preferably many at least about 300% even most preferably many at least about 400%.

Can directly from substratum, reclaim the secrete polypeptide of gained with methods known in the art.For example, can include but not limited to that centrifugal, filtration, extraction, spraying drying, evaporation or precipitation reclaim polypeptide by traditional method from nutritional medium.

Can include but not limited to that chromatography (for example with several different methods known in the art, ion exchange chromatography, affinity chromatography, hydrophobic chromatography, chromatofocusing chromatography, size exclusion chromatography), electrophoresis method (for example, preparation property isoelectric focusing electrophoresis), difference solubleness (differential solubility) (for example, SDS-PAGE or extraction ammonium sulfate precipitation), (referring to, for example, Protein Purification, J.-C.Jansonand Lars Ryden, editors, VCH Publishers, New York, 1989) come purified polypeptide.

Signal peptide sequence

Term " signal peptide sequence " is defined as coding herein and is connected in the N-terminal aminoacid sequence of polypeptide and guides encoded polypeptide to enter the peptide-coding region of emiocytosis approach.

Term " can be operated continuous " to be defined as a kind of structure herein, and in this structure, control sequence such as signal peptide sequence are suitably placed the position relevant with encoding sequence, so that the control sequence guiding is by the production of encoding sequence encoded polypeptides.

Term " encoding sequence " is defined as the nucleotide sequence that is transcribed into mRNA herein, and mRNA is translated as polypeptide under the control of suitable control sequence.Generally determine the boundary of encoding sequence by initiator codon that is positioned at mRNA 5` end open reading frame starting position and the terminator codon that is positioned at mRNA open reading frame 3` end.Encoding sequence can include but not limited to the nucleotide sequence of DNA, cDNA, semisynthetic, synthetic and reorganization.

The 5` end of polypeptid coding sequence can be included in translation and read the natural signals peptide-coding region that links to each other with the coding region fragment of coded polypeptide natively in the frame, signal peptide coding region wherein of the present invention can be replaced the natural signals peptide-coding region simply, to strengthen the secretion of polypeptide.Alternatively, the 5` of polypeptid coding area end can lack the natural signals peptide-coding region.

In the method for the invention, signal peptide sequence is an external source for the nucleotide sequence of the interested polypeptide of coding, just has but signal peptide sequence or nucleotide sequence can be fungal host cells itself.

In aspect first, the isolating nucleotide sequence of coded signal peptide and SEQ ID NO:37 have at least about 70%, preferably at least about 75%, more preferably at least about 80%, more preferably at least about 85%, be more preferably at least about 90%, most preferably at least about 95% even most preferably at least about 97% identity, it has the ability (after this claiming " homology signal peptide ") that the guiding polypeptide enters the emiocytosis approach.In preferred version, homology signal peptide and SEQ ID NO:37 have 5 amino acid, preferred 4 amino acid, more preferably 3 amino acid, preferred 2 amino acid, 1 amino acid whose difference most preferably again.To achieve the object of the present invention, with LASERGENE with identity table ^TMMEGALIGN ^TMSoftware (DNASTAR, Inc., Madison, WI), by Clustal method (Higgins, 1989, CABIOS 5:151-153) measure identity between two aminoacid sequences, multisequencing comparison parameter is as follows: gap penalty (gap penalty) is 10, room length point penalty is 10.(pairwise) comparison parameter is Ktuple=1, gap penalty=3, window=5, diagonal lines (diagonals)=5 in pairs.

Preferably, nucleotide sequence codedly comprise SEQ ID NO:37 aminoacid sequence, or the signal peptide of its allelic variant (allelic variants); Or it has the fragment that can guide polypeptide to enter the emiocytosis approach.In preferred scheme, the nucleotide sequence coded signal peptide that comprises the aminoacid sequence of SEQ ID NO:37 of the present invention.In another preferred version, nucleotide sequence coded aminoacid sequence, or the signal peptide of its fragment composition by SEQ IDNO:37, wherein the signal peptide fragment has the ability that the guiding polypeptide enters the emiocytosis approach.In another preferred version, the nucleotide sequence coded signal peptide of forming by the aminoacid sequence of SEQ ID NO:37 of the present invention.

The present invention also comprises the nucleotide sequence of signal peptide that coding has the aminoacid sequence of SEQ ID NO:37, and it is because the degeneracy of genetic code and different with SEQ ID NO:36.The invention still further relates to the subsequence (subsequence) of the segmental SEQ ID NO:36 of coding SEQ ID NO:37, the fragment of SEQ ID NO:37 has the ability that the guiding polypeptide enters the emiocytosis approach.

The subsequence of SEQ ID NO:36 is to be contained in SEQ ID NO:36 but the nucleotide sequence of having deleted one or more Nucleotide at 5` and/or 3` end.Preferably, subsequence comprises at least 45 Nucleotide, more preferably at least 51 Nucleotide, most preferably at least 57 Nucleotide.The fragment of SEQ ID NO:37 is to have deleted one or more amino acid whose polypeptide from the amino of this aminoacid sequence and/or carboxyl terminal.Preferably, fragment comprises at least 15 amino-acid residues, more preferably at least 17 amino-acid residues, most preferably at least 19 amino-acid residues.

Allelic variant refers to occupy any in two or more optional gene forms of identical chromosomal foci.Allelic variation produces by the sudden change nature, can cause colony's polymorphism.Transgenation can be the signal peptide of reticent (do not have in coded signal peptide change) or the aminoacid sequence with change of can encoding.The allelic variant of signal peptide is the peptide by the allelic variant coding of gene.

In preferred version, first nucleotide sequence is the signal coding sequence that is contained in the endoglucanase V gene of Humicola insolens DSM 1800.

In aspect second, the isolated nucleic acid sequences of coded signal peptide and SEQ ID NO:36 have at least about 70%, preferably at least about 75%, more preferably at least about 80%, more preferably at least about 85%, more preferably at least about 90%, most preferably at least about 95% even most preferably at least about 97% homology degree, its coded signal peptide; Or allelic variant or the subsequence of the SEQ ID NO:36 of coded signal peptide fragment, the signal peptide fragment has the ability that the guiding polypeptide enters the emiocytosis approach.For the purposes of the present invention, with LASERGENE with identity table ^TMMEGALIGN ^TMSoftware, by Wilbur-lipman method (Wilbur and lipman, 1983, Proceedings of the NationalAcademy of Science USA 80:726-730) measure homology degree between two nucleotide sequences, multisequencing comparison parameter is as follows: gap penalty is 10, room length point penalty is 10.The comparison parameter is Ktuple=3, gap penalty=3, window=20 in pairs.

In aspect the 3rd, isolating nucleotide sequence coded signal peptide, wherein nucleotides sequence is listed under the stringent condition Nucleotide with SEQ ID NO:36, or its complementary strand hybridization (J.Sambrook, E.F.Fritsch, and T.Maniatus, 1989, Molecular colning, A laboratory Manual, 2dedition, Cold Spring Harbor, New York).

The nucleotide sequence of SEQ ID NO:36 or its subsequence, and the aminoacid sequence of SEQ ID NO:37 or its fragment can be used for by method designing nucleic acid probe well known in the art are with from different genus or plant and identify and the DNA of clones coding signal peptide.Especially, can these probes be used for hybridizing with the genome or the cDNA of interested genus or kind according to standard Southern blotting, to identify and separation corresponding gene wherein.Such probe can be than complete sequence much shorter, but should be at least 15, preferably at least 25, more preferably at least 35 length of nucleotides.DNA and rna probe all can use.Typically, probe is labeled, and is used to survey corresponding gene and (for example, uses ³²P, ³H, ³⁵S, vitamin H or avidin).The present invention also comprises such probe.

So, can be from the genomic dna or the cDNA library screening DNA of such other biological preparation, described DNA and above-mentioned probe hybridization, and coded signal peptide.Can separate from the genomic dna of such other biological or other DNA with agarose or polyacrylamide gel electrophoresis or other isolation technique.DNA or separated DNA from described library can be shifted and be fixed on nitrocotton or other appropriate carriers materials.In order to identify NO:36 with SEQ ID, or its subsequence homologous clone or DNA, described solid support material in the Southern trace, used.For the purposes of the present invention, hybridization refer to nucleotide sequence with corresponding to the nucleotide sequence of SEQ ID NO:36, its complementary strand, or the nucleic acid probe hybridization of the mark of its subsequence.Survey the molecule that nucleic acid probe is under these conditions hybridized with x-ray film.

In preferred version, nucleic acid probe is the nucleotide sequence of the signal peptide of coding SEQ ID NO:37, or its subsequence.In another preferred version, nucleic acid probe is SEQ ID NO:36.In another preferred version, nucleic acid probe is the signal coding sequence that is contained in the endoglucanase V gene of Humicola insolens DSM 1800.

For about 15 short probes to about 60 length of nucleotides, stringent condition is defined as, in the method for calculation (1962 that are lower than according to Bolton and McCarthy, Proceedings of the NationalAcademy of Sciences USA 48:1390) under 5 ℃ to 10 ℃ condition of Tm value of being calculated, at 0.9M NaCl, 0.09 MTris-HCl pH 7.6,6mM EDTA, 0.5%NP-40,1 * Denhardt ' s solution, the 1mM trisodium phosphate, 1mM monobasic sodium phosphate, 0.1mM ATP, and in every ml 0.2mg yeast rna, Southern blotting according to standard carries out prehybridization, hybridization and post-hybridization washing.

For about 15 short probes to about 60 length of nucleotides, be lower than under 5 ℃ to 10 ℃ conditions of Tm value of being calculated, add among the 0.1%SDS wash vehicle material once at 6 * SSC, 15 minutes, with 6 * SSC washed twice, each 15 minutes.

In aspect the 4th, the isolated nucleic acid sequences of coded signal peptide varient has the aminoacid sequence of the SEQ ID NO:37 that comprises one or more aminoacid replacement, deletion and/or insert.

The aminoacid sequence of variability signals peptide can replace one or more amino-acid residues owing to the insertion of one or more amino-acid residues or deletion and/or with different amino-acid residues, and different with the aminoacid sequence of SEQ IDNO:37.Preferably, it is to have less attribute change that amino acid changes, and just replaces such as the active conservative amino acid that does not obviously have influence on signal peptide; Or little deletion, typically be one to about 5 amino acid.

The example that conservative property replaces occurs in basic aminoacids (arginine, Methionin and Histidine), acidic amino acid (L-glutamic acid and aspartic acid), polare Aminosaeren (glutamine and l-asparagine), hydrophobic amino acid (leucine, Isoleucine and Xie Ansuan), in die aromatischen Aminosaeuren (phenylalanine, tryptophane and tyrosine) and little propylhomoserin (glycine, L-Ala, Serine, Threonine and the methionine(Met)) group.Usually the aminoacid replacement that does not change specific activity is known in this area, H.Neurath and R.L.Hill for example, and 1979, at The Proteins, described in the Academic Press, New York.The most normal generation changes into Ala/Ser, Val/Ile, Asp/Glu, Thr/Ser, Ala/Gly, Ala/Thr, Ser/Asn, Ala/Val, Ser/Gly, Tyr/Phe, Ala/Pro, Lys/Arg, Asp/Asn, Leu/Ile, Leu/Val, Ala/Glu and Asp/Gly and opposite change.

The present invention also relates to above disclosed isolating signal peptide sequence.

The nucleotide sequence of coded polypeptide

By the second nucleotide sequence encoded polypeptide, can be natural or allogenic concerning interested fungal host cells.

Term " polypeptide " is not meant the coded product of length-specific herein, and therefore, it comprises peptide, oligopeptides and protein.Term " heterologous polypeptide " is defined as non-natural polypeptide concerning the fungal cell herein, in natural polypeptides, modify and changed the natural polypeptides of its sequence, perhaps the gene of coded polypeptide is operated and quantitatively changed the natural polypeptides of its expression by recombinant DNA technology.The fungal cell can comprise the nucleotide sequence of the coded polypeptide of one or more copies.

Preferably, polypeptide is hormone or its varient, enzyme, acceptor or its part, antibody or its part or reporter protein.In preferred version, polypeptide is oxydo-reductase, transferring enzyme, lytic enzyme, lyase, isomerase or ligase enzyme.In more preferably scheme, polypeptide is an aminopeptidase, amylase, saccharifying enzyme, carboxypeptidase, catalase, cellulase, cellobiohydrolase, chitinase, at, the cyclodextrin glycosyltransferase, deoxyribonuclease, endoglucanase (endoglucanase), esterase, alpha-galactosidase, beta-galactosidase enzymes, glucoamylase, alpha-glucosidase, beta-glucosidase enzyme, saccharase, laccase, lipase, mannosidase, mutanase, oxydase, pectin lyase, peroxidase, Phospholipid hydrolase, phytase, polyphenoloxidase, proteolytic ferment, rnase, transglutaminase, zytase (xylanase), xylobiase (xylosidase).In scheme most preferably, polypeptide is that to be used for cellulose conversion be endoglucanase, cellobiohydrolase and/or the beta-glucosidase enzyme of glucose, and it includes but not limited to endoglucanase I, endoglucanase II, endoglucanase III, endoglucanase IV, endoglucanase V, cellobiohydrolase I, cellobiohydrolase II and beta-glucosidase enzyme.Endoglucanase and cellobiohydrolase are referred to as " cellulase ".

The nucleotide sequence of interested polypeptide of encoding can be obtained by any protokaryon, eucaryon or other source.For the purposes of the present invention, here with the term of given source logotype " by ... obtain " mean that described polypeptide is produced by this source or by the cell generation of wherein having inserted from the gene in this source.

Be used to separate or the technology of the nucleotide sequence of the interested polypeptide of clones coding is known in the art, comprise from genomic dna separate, from cDNA preparation or both combinations.For example by utilizing well-known polymerase chain reaction (PCR) can realize from the described nucleotide sequence of such genomic dna cloning.Referring to, for example, Innis etc., 1990, PCR Protocols:A Guideto Methods and Application, Academic Press, New York.Cloning process can relate to required nucleotide fragments to the nucleotide sequence that comprises coded polypeptide and excise and separate, fragment is inserted carrier molecule, and with recombinant vectors mix the sudden change fungal cell, a plurality of copies of nucleotide sequence or clone will in described fungal cell, duplicate.Nucleotide sequence can be genomic, cDNA, RNA, semi-synthetic, synthetic source, perhaps their any combination.

In the method for the invention, polypeptide can also comprise polypeptide fusion or heterozygosis, and wherein another kind of polypeptide is blended in described polypeptide or its segmental N-end or C-end.The nucleotide sequence (or its part) that nucleotide sequence (or its part) by the peptide species of will encoding is blended in the another kind of polypeptide of coding comes the production fusion polypeptide.The technology of production fusion polypeptide is known in the art, and it comprises that the encoding sequence with coded polypeptide connects so that they are in reads in the frame, and the expression of fusion polypeptide is under the control of identical promoters and terminator.Hybrid polypeptide can comprise at least from two kinds of not combinations of the part or all of peptide sequence of homopolypeptide, and one or more in the wherein said polypeptide can be allogenic for described sudden change fungal cell.

Nucleic acid construct

The invention still further relates to the nucleic acid construct of the nucleotide sequence that comprises coded polypeptide, described nucleotide sequence can be operated with one or more control sequences with signal peptide sequence of the present invention and link to each other, and described control sequence is suitably being expressed in the host cell at guiding encoding sequence under the condition compatible with control sequence.Expression is interpreted as and comprises and relate to any step that polypeptide is produced, and includes but not limited to transcribe, post transcriptional modificaiton, translation, posttranslational modification and secretion.

" nucleic acid construct " is defined as strand or double-stranded nucleic acid molecule herein, and it is from the gene isolation of natural generation, or comprised through modifying in the non-existent mode of nature and make up and in abutting connection with the nucleic acid fragment of (juxtaposed).When nucleic acid construct had comprised encoding sequence and encoding sequence and expresses all required control sequences, term nucleic acid construct and term expression cassette were synonyms.

Can further operate the isolating nucleotide sequence of coded polypeptide, for the usefulness of expression of polypeptides with several different methods.According to the situation of expression vector, operating on it before nucleotide sequence inserts carrier is to need or necessity.The technology of utilizing recombinant DNA method to transform nucleotide sequence is well known in the art.

In the method for the invention, nucleotide sequence can comprise one or more natural control sequences, perhaps one or more natural control sequences can be replaced by the one or more control sequences by external source concerning nucleotide sequence, to improve the expression of encoding sequence in host cell.

Ding Yi term " control sequence " comprises and expresses the necessary or favourable all component of interested polypeptide institute herein.Each control sequence can be natural or external source for the nucleotide sequence of coded polypeptide.Such control sequence includes but not limited to leader sequence (leader), polyadenylation (polyadenylation) sequence, leading peptide (propeptide) sequence, signal peptide sequence of the present invention and transcription terminator.Control sequence is minimum to be comprised signal peptide sequence of the present invention and transcribes and the translation termination signal.Can be for control sequence provide joint (linker), purpose is in order to introduce the specific limited site so that control sequence is connected with the coding region of the nucleotide sequence of coded polypeptide.

Control sequence can be suitable promoter sequence, and it is discerned by host cell and nucleotide sequence is expressed.Promoter sequence comprises the transcriptional control sequence that mediates expression of polypeptides.Promotor can be any sequence that shows transcriptional activity in selected host cell, comprises sudden change, brachymemma and promotor hybridization, its can be by the coding born of the same parents in the outer or born of the same parents polypeptide, obtain with host cell homology or allogenic gene.

Guide the example of the suitable promotor that nucleic acid construct of the present invention transcribes in filamentous fungal host cell to be: by aspergillus oryzae (Aspergillus oryzae) TAKA amylase, Rhizomucor miehei (Rhizomucor miehei) aspartate protease, the neutral α-Dian Fenmei of aspergillus niger (Aspergillus niger), aspergillus niger acid acceptance α-Dian Fenmei, aspergillus niger or Aspergillus awamori (Aspergillus awamori) glucoamylase (glaA), Palatase, the aspergillus oryzae Sumizyme MP, the aspergillus oryzae triose-phosphate isomerase, Aspergillus nidulans (Aspergillus nidulans) acetamidase, toxicity fusarium (Fusarium venenatum) amyloglucosidase, with fusarium oxysporum mould (Fusarium oxysporum) trypsinase proteolytic enzyme (WO 96/00787), Trichodermareesei (Trichoderma reesei) endoglucanase I, Trichodermareesei endoglucanase II, Trichodermareesei endoglucanase III, Trichodermareesei endoglucanase IV, Trichodermareesei endoglucanase V, the Trichodermareesei xylanase I, Trichodermareesei xylanase I I, the Trichodermareesei xylanase I, the promotor that Trichodermareesei xylobiase gene obtains, and NA2-tpi promotor (heterozygote of neutral α-Dian Fenmei of aspergillus niger and aspergillus oryzae triose-phosphate isomerase gene promoter), and sudden change, the promotor of brachymemma and hybridization.

In yeast host, useful promotor by cereuisiae fermentum (Saccharomyces cerevisiae) enolase (ENO-1), cereuisiae fermentum galactokinase (GAL1), cereuisiae fermentum alcoholdehydrogenase/glyceraldehyde-3-phosphate dehydrogenase (ADH1, ADH2/GAP), cereuisiae fermentum triose-phosphate isomerase (TPI), cereuisiae fermentum metallothionein(MT) (CUP1) and the kinase whose gene of cereuisiae fermentum 3-phoshoglyceric acid obtain.Other useful pure female host cell promotors are described in Romanos etc., and 1992, Yeast 8:423-488.

Control sequence can be suitable Transcription Termination subsequence, and it is discerned and stopped transcribing by host cell.The terminator sequence can be operated with the nucleotide sequence 3` end of coded polypeptide and be linked to each other.Any terminator of bringing into play function in selected host cell all can be used for the present invention.

Be used for of the gene acquisition of the preferred terminator of filamentous fungal host cell by aspergillus oryzae TAKA amylase, aspergillus niger glucoamylase, Aspergillus nidulans anthranilate synthase, aspergillus niger alpha-glucosidase, the mould trypsinase proteolytic enzyme of fusarium oxysporum.

Be used for of the gene acquisition of the preferred terminator of yeast host cell by cereuisiae fermentum enolase, cerevisiae pigment C (CYC1) and cereuisiae fermentum glyceraldehyde-3-phosphate dehydrogenase.Romanos etc., 1992, as above, described other and be used for the useful terminator of yeast host cell.

Control sequence also can be a leader sequence, and it is the non-translational region of mRNA, but is important to the translation of host cell.Leader sequence can be operated with the nucleotide sequence 5` end of coded polypeptide and link to each other.Any leader sequence of bringing into play function in selected host cell all can be used for the present invention.

Be used for of the gene acquisition of the preferred leader sequence of filamentous fungal host cell by aspergillus oryzae TAKA amylase, Aspergillus nidulans triose-phosphate isomerase.

Be used for of the gene acquisition of the suitable leader sequence of yeast host cell by cereuisiae fermentum enolase (ENO-1), cereuisiae fermentum glycerol 3-phosphate acid kinase, cereuisiae fermentum α-factor and cereuisiae fermentum alcoholdehydrogenase/glyceraldehyde-3-phosphate dehydrogenase (ADH2/GAP).

Control sequence also can be the polyadenylation sequence, and it can be operated with the 3` end of nucleotide sequence and link to each other, and when transcribing, it is discerned by host cell as the signal that adds poly adenosine residue, with transcript mRNA.Any polyadenylation sequence of bringing into play function in selected host cell all can be used for the present invention.

Be used for of the gene acquisition of the preferred polyadenylation sequence of filamentous fungal host cell by the mould trypsinase proteolytic enzyme of aspergillus oryzae TAKA amylase, aspergillus niger glucoamylase, Aspergillus nidulans anthranilate synthase and fusarium oxysporum, aspergillus niger alpha-glucosidase.

Guo and Sherman, 1995, Molecular Cellular Biology 15:5983-5990 has described the polyadenylation sequence useful to yeast host cell.

Control sequence also can be the leading peptide coding region that coding is positioned at the N-terminal aminoacid sequence of polypeptide.The polypeptide of known gained is called pre-enzyme (proenzyme) or precursor polypeptide (propolypeptide) (also being proenzyme (zymogen) sometimes).The precursor polypeptide does not normally have active, can change sophisticated active polypeptide into by leading peptide catalysis or autocatalysis cracking by the precursor polypeptide.Can obtain the leading peptide coding region from laccase (WO 95/33836) gene of cereuisiae fermentum α-factor, Rhizomucor miehei aspartate protease, thermophilic Huang mould (Myceliophthorathermophila).

When the aminoterminal of polypeptide existed signal peptide and propetide district simultaneously, the propetide district was positioned at the aminoterminal of next-door neighbour's polypeptide, and signal peptide district next-door neighbour is positioned at the aminoterminal in leading peptide district.

Also may need to add the regulating and controlling sequence that allows the relevant expression of polypeptides of modulate host cell growth.The example of regulator control system is to comprise the existence of regulating compound in response to chemistry or physical stimulation, and make the regulator control system that genetic expression is open or close.In yeast, can use ADH2 system or GAL1 system.In filamentous fungus, TAKA α-Dian Fenmei promotor, aspergillus niger glucoamylase promotor and aspergillus oryzae glucoamylase promotor can be used as regulating and controlling sequence.Other examples of regulating and controlling sequence are for allowing the regulating and controlling sequence of gene amplification.In eukaryotic system, it comprises the dihydrofolate reductase gene that increases when having methotrexate, and the metallothionein gene that increases when having heavy metal.In these cases, the nucleotide sequence of coded polypeptide will can be operated with regulating and controlling sequence and link to each other.

Expression vector

The invention still further relates to the nucleotide sequence that comprises signal peptide sequence of the present invention, the interested polypeptide of coding and transcribe recombinant expression vector with the translation termination signal.Above-mentioned various nucleic acid and control sequence can link together and obtain recombinant expression vector, and it can comprise one or more restriction sites easily, to allow to insert or replace in these sites the nucleotide sequence of promotor and/or coded polypeptide.Alternatively, can express nucleotide sequence by with nucleotide sequence or comprise signal peptide sequence and/or the nucleic acid construct of the nucleotide sequence of coded polypeptide inserts the suitable expression be used to express.When construction of expression vector, encoding sequence is placed carrier, so that can being operated with one or more suitable expression control sequencs that are used to express with signal peptide sequence of the present invention, encoding sequence links to each other.

Recombinant expression vector can be to be advantageously used in recombinant DNA method, but and any carrier (for example, plasmid or virus) of initiated core nucleotide sequence expression.Typically, the selection of carrier depends on the compatibility of carrier and its host cell that will be imported into.This carrier can be the plasmid of linearity or the cyclic plasmid of sealing.

Carrier of the present invention preferably comprises one or more selectable marks, and it allows to select at an easy rate cell transformed.Can select to be labeled as gene, its product provides Biocidal or virus resistance, heavy metal resistance, to auxotrophic prototroph etc.The appropriate flags that is used for yeast host cell includes but not limited to ADE2, HIS3, LEU2, LYS2, MET3, TRP1, and URA3.The marks packets selected that is used for filamentous fungal host cell is drawn together but is not limited to amdS (acetamidase), argB (ornithine carbamyl transferase), bar (careless fourth phosphinothricin acetyl transferring enzyme), hygB (hygromix phosphotransferase), niaD (nitrate reductase), pyrG (orotidylic acid-5 '-phosphate decarboxylase), sC (sulfuric acid adenylyl transferase), trpC (anthranilate synthase), and equivalent.What be preferred for the Aspergillus mycetocyte is Aspergillus nidulans or the amdS of aspergillus oryzae and the bar gene of pyrG gene and streptomyces hygroscopicus (Streptomyceshygroscopicus).

Described carrier can be an autonomously replicationg vector, and for example, with the carrier that the outer entity of karyomit(e) exists, it duplicates and does not rely on THE REPLICATION OF CHROMOSOME, for example, and plasmid, extrachromosomal element, minute chromosome or artificial chromosome.Carrier can comprise any mode of guaranteeing self-replacation.Alternatively, carrier can be a such carrier, and when it was imported in the host cell, it was incorporated in the genome, and duplicated with its karyomit(e) of integrating.In addition, also can use the single carrier or the plasmid that comprise all DNA that will import the host cell gene group together, perhaps two or more carriers or plasmid perhaps can use transposon.

Carrier of the present invention preferably comprises the permission carrier and stably is integrated in the host cell gene group or allows carrier not rely on genome and the composition of self-replicating in cell.

In order to be integrated in the host cell gene group, carrier may depend on the nucleotide sequence of coded polypeptide, perhaps depends on other and anyly is used for by homology and non-homologous recombination and carrier stably is integrated in the carrier components of genome.Alternatively, carrier can comprise the extra nucleotide sequence of integrating to the host cell gene group by the homologous recombination guiding.Extra nucleotide sequence makes carrier can be integrated in accurate chromosome position in the host cell gene group.In order to be increased in the possibility that accurate site is integrated, integrate the Nucleotide that composition should preferably comprise sufficient amount, for example 100 to 1,500 base pairs, preferred 400 to 1,500 base pairs, most preferably 800 to 1,500 base pairs, these base pairs and corresponding target sequence height homology are to increase the probability of homologous recombination.Integrate composition and can be with the host cell gene group in any sequence of target sequence homologous.In addition, integrating composition can be non-coding or coding nucleotide sequence.On the other hand, carrier can be by non-homogeneous recombination and integration in the host cell gene group.

For self-replicating, carrier can further comprise can make carrier in described host cell self-replicating duplicate origin.Duplicate any plasmid replicon that origin can mediate self-replicating, it brings into play function in cell.Term " duplicates origin " or " plasmid replicon " is defined as the nucleotide sequence that plasmid or carrier are duplicated in vivo herein.

The example that duplicates origin that is used for yeast host cell is that 2 micron duplicate the combination of origin, ARS1, ARS4, ARS1 and CEN3 and the combination of ARS4 and CEN6.Duplicating origin can be the origin of duplicating with sudden change, this sudden change make its in host cell, bring into play the temperature sensitive sexual function (referring to, for example, Ehrlich, 1978, Proceedings of the National Academy of Sciences USA75:1433).

The example that duplicates origin that is used for filamentous fungal cells is AMA1 and ANS1 (Gems etc., 1991, Gene 98:61-67; Cullen etc., 1987, Nucleic Acids Research 15:9163-9175; WO 00/24883).The separation of AMA1 gene and comprise the plasmid of this gene or the structure of carrier can carry out according to described in the WO 00/24883.

The nucleotide sequence that surpasses the coded polypeptide of a copy can be inserted host cell to increase the production of gene product.Can be integrated in the copy number that increases nucleotide sequence in the host cell gene group by the sequence copy that at least one is extra, but perhaps by in the cell of the selectable marker gene copy that comprises amplification, but make nucleotide sequence comprise the selectable marker gene that can increase, but and therefore can be under the situation that has suitable selective reagents, select the nucleotide sequence of additional copy by culturing cell, to be used to increase the copy number of nucleotide sequence.

Be used to connect said components, with the method that makes up recombinant expression vector of the present invention be well-known to those skilled in the art (referring to, for example, Sambrook etc., 1989, the same).

Host cell

The invention still further relates to the recombinant host cell that comprises signal peptide sequence of the present invention, it can be advantageously used in the recombinant production of polypeptide, and described signal peptide sequence can be operated with the nucleotide sequence of coded polypeptide and link to each other.Carrier is imported host cell, so that carrier exists as the karyomit(e) composition or as the outer carrier of the karyomit(e) of aforesaid self-replacation, described carrier comprises with the nucleotide sequence of coded polypeptide can operate the signal peptide sequence of the present invention that links to each other.Term " host cell " comprises any descendant of the parental cell different with the parental cell of undergoing mutation in the reproduction process.The selection of host cell will depend on the gene and the source thereof of coded polypeptide to a great extent.

Host cell can be any fungal cell who can be used for method of the present invention." fungi " used herein comprises Ascomycota (Ascomycota), Basidiomycota (Basidiomycota), chytrid door (Chytridiomycota), and Zygomycota (Zygomycota) is (as Hawksworth etc., at Ainsworth and Bisby ' s Dictionary of The Fungi, 8th edition, 1995, CABInternational, University Press, Cambridge, defined among the UK), and oomycetes door (Oomycota) is (as Hawksworth etc., 1995, as above, page 171 is quoted) fungi and all mitospore fungi (mitosporic fungi) (Hawksworth etc., 1995, the same).

In preferred version, fungal host cells is a yeast cell." yeast " used herein comprises ascosporogenous yeast (ascosporogenous) (Endomycetale (Endomycetales)), produce basidiosporangium yeast (basidiosporogenous) and belong to the yeast of imperfect fungi (gemma guiding principle (Blastomycetes)).Because the zymic classification may change in the future to some extent, for the purposes of the present invention, should be according to Biology andActivities of Yeast (Skinner, F.A., Passmore, S.M., and Davenport, R.R., eds, Soc.App.Bacteriol.Symposium Series No.9,1980) define yeast described in.

In more preferably scheme, yeast host cell is candiyeast (Candida), debaryomyces hansenii (Hansenula), kluyveromyces (Kluyveromyces), pichia spp (Pichia), saccharomyces (Saccharomyces), fission yeast (Schizosaccharomyces) or Yarrowia cell.

In scheme most preferably, yeast host cell is saccharomyces carlsbergensis (Saccharomyces carlsbergensis), cereuisiae fermentum (Saccharomyces cerevisiae), saccharomyces diastaticus (Saccharomyces diastaticus), Saccharomyces douglasii, kluyveromyces (Saccharomyces kluyveri), promise ground yeast (Saccharomyces norbensis) or ellipsoideus yeast (Saccharomyces oviformis) cell.In another preferred scheme, yeast host cell is Kluyveromyces lactis (Kluyveromyces lactis) cell.In another preferred scheme, yeast host cell is a Yarrowia lipolytica cell.

In another preferred version, fungal host cells is a filamentous fungal cells." filamentous fungus " comprises the subclass of all thread forms of Mycophyta (Eumycota) and oomycetes door (Oomycota) (as Hawksworth etc., 1995, defined above).Filamentous fungus is a feature with the mycelia body wall of being made up of chitin, Mierocrystalline cellulose, dextran, chitosan, mannosans and other complex polysaccharides.Nourishing and growing relies on the prolongation of mycelia, and it is aerobic that carbon decomposes.On the contrary, yeast for example nourishing and growing of cereuisiae fermentum is undertaken by unicellular thallophytic sprouting, and it can be fermentation that carbon decomposes.

In preferred scheme, filamentous fungal cells is but is not limited to the cell of Acremonium (Acremonium), Aspergillus (Aspergillus), Fusarium (Fusarium), Humicola (Humicola), Mucor (Mucor), myceliophthora (Myceliophthora), Neurospora (Neurospora), Penicillium (Penicillium), Thielavia (Thielavia), Tolypociadium or Trichoderma (Trichodema) species.

In the scheme that is more preferably, filamentous fungal cells is Aspergillus awamori (Aspergillus awamori), smelly aspergillus (Aspergillus foetidus), aspergillus japonicus (Aspergillusjaponicus), Aspergillus nidulans, aspergillus niger or aspergillus oryzae cell.In the scheme that another is more preferably, filamentous fungal cells is a bar spore shape sickle spore (Fusarium bactridioides), Fusarium cerealis, Fusarium crookwellense, machete sickle spore (Fusarium culmorum), F.graminearum schw (Fusarium graminearum), the red sickle spore of standing grain (Fusarium graminum), different spore sickle spore (Fusarium heterosporum), albizzia sickle spore (Fusarium negundi), point sickle spore (Fusarium oxysporum), racemosus sickle spore (Fusarium reticulatum), pink sickle spore (Fusarium roseum), Williams Elder Twig sickle spore (Fusarium sambucinum), colour of skin sickle spore (Fusarium sarcochroum), intend branch spore sickle spore (Fusarium sporotrichioides), sulphur look sickle spore (Fusarium sulphureum), Fusarium torulosum, Fusarium trichothecioides, perhaps toxicity fusarium (Fusarium venenatum) cell.In the scheme that another is more preferably, filamentous fungal cells is Humicola insolens, fetal hair humicola lanuginosa (Humicola lanuginosa), the conspicuous Mucor (Mucor miehei) of rice, thermophilic Huang mould (Myceliophthora thermophila), Neuraspora crassa (Neurospora crassa), penicillium purpurogenum (Penicillium purpurogenum), Thielaviaterrestris, Trichoderma harzianum, healthy and free from worry wood mould (Trichoderma koningii), Trichoderma longibrachiatum, Trichodermareesei or viride (Trichoderma viride) cell.

In scheme most preferably, toxicity fusarium cell is toxicity fusarium A3/5, it is F.graminearum schw (Fusarium graminearum) ATCC 20334 by preservation at first, nearest Yoder and Christianson, 1998, Fungal Genetics and Biology, 23:62-80 and O ' Donnell etc., 1998, Fungal Genetics and Biology, 23:57-67 is re-classified as the toxicity fusarium with it; And the taxonomy equivalent of toxicity fusarium, no matter what current known kind name is.In another preferred version, toxicity fusarium cell is the morphological mutant as WO97/26330 disclosed toxicity fusarium A3/5 or toxicity fusarium ATCC 20334.

In another most preferred scheme, the Trichoderma cell is Trichodermareesei ATCC 56765, Trichodermareesei ATCC 13631, Trichodermareesei CBS 526.94, Trichodermareesei CBS 529.94, Trichoderma longibrachiatum CBS528.94, Trichoderma longibrachiatumATCC 2106, Trichoderma longibrachiatum CBS 592.94, viride NRRL3652, viride CBS 517.94 and viride NIBH FERM/BP447.

Can come the transformed eukaryotic mycetocyte in a manner known way by relating to protoplastis formation, protoplast transformation and cell walls regenerated method.Among the EP 238 023 and Yelton etc., 1984, Proceedings of the National Academy of Sciences USA 81:1470-1474 has described the proper method that is used to transform the Aspergillus host cell.Penttila etc., 1987, Gene, 61:155-164 and Gruber etc., 1990, Curr Genet., 18 (1): 71-6 has described the proper method that is used to transform the Trichodermareesei host cell.Malardier etc., 1989, Gene, 78:147-156 and WO 96/00787 have described the proper method that is used to transform the Fusarium species.Can use Becker and Guarente at Abelson, J.N. and Simon, M.I., the Guide to Yeast Geneticsand Molecular Biology that writes, Methods in Enzymology, Volume 194, pp 182-187, Academic Press, Inc., New York; Ito etc., 1983, Journal of Bacteriology 153:163; With Hinnen etc., 1978, the method transformed yeast of describing among the Proceedings of the National Academy of Sciences USA75:1920.

The degraded of biomass

The invention still further relates to the method for the biomass (biomass) of degraded or conversion cellulose and/or hemicellulose, comprise use and handle biomass by one or more polypeptide of the significant quantity of method acquisition of the present invention, wherein one or more polypeptide have the enzymic activity at the biomass of cellulose and/or hemicellulose.For example, method of the present invention can be used for producing enzyme and production is used for producing the alcoholic acid host cell from biomass.Can be converted into ethanol producing and ethanol in next life by the zymetology degraded of biomass and with the polysaccharide that discharges.This class ethanol is often referred to bio-ethanol or biofuel.It can be used as fuel dope or additive, and the content in mixture is from being lower than 1% until 100% (fuel substitute).

Method of the present invention also can be used for preparing enzyme and host cell, and it is the production of ethanol, plastics or other products or the intermediate product of chemistry or fermentation raw material that described enzyme and host cell are used for monose, disaccharides and polysaccharide.Enzyme can be a thick fermentation soup form of removing or do not remove cell, or the enzyme preparation form of half purifying or purifying.Alternatively, host cell of the present invention can be as the source of one or more enzymes in the biomass ferment process.

Biomass can include but not limited to timber resources, municipal solid waste material, waste paper and crop residues (referring to, for example, Wiselogel etc., 1995, Handbook on Bioethanol (editor CharlesE.Wyman), pp.105-118, Tayler and Francis, Washington D.C.; Wyman, 1994, Bioresource Technology 50:3-16; Lynd, 1990, Applied Biochemistry andLignocellulosics, in Advances in Biochemical Engineering/Biotechnology, T.Scheper, the responsible editor, Volume 65, pp.23-40, Springer-Verlag, New York).

Main biomass polysaccharide in the primary wall is a Mierocrystalline cellulose, second abundant be hemicellulose, the 3rd is pectin.The secondary cell wall that cell growth stopping back producing also comprises polysaccharide, and firmer by the covalent cross-linking of xylogen and hemicellulose.Mierocrystalline cellulose is the same aggressiveness of anhydro cellobiose, therefore be linear β-(1-4)-D-dextran, and hemicellulose comprises multiple compound, for example has to replace xylan, xyloglucan, pectinose sill glycan (arabinoxylans) and the mannosans that spectrographic exists with complicated branched structure.Although Mierocrystalline cellulose is generally polymorphic, find that its main insoluble crystal array with parallel dextran chain in plant tissue exists.Hemicellulose usually with hydrogen bonded in Mierocrystalline cellulose and other hemicellulose, to help stabilized cell wall array.

The main glycosylhydrolase of three classes is used to interrupt cellulose biomass:

(1) " 1,4-beta-glucan restriction endonuclease " or 1,4-callose-glucan hydrolase (EC3.2.1.4), it acts on solubility and insoluble 1,4-beta-glucan substrate randomly.

(2) " 1; 4-beta-glucan excision enzyme " comprises 1,4-callose glucose hydrolysis enzyme (EC3.2.1.74) and cellobiohydrolase (1,4-callose cellobiohydrolase, EC 3.2.1.91), 1,4-callose glucose hydrolysis enzyme is from 1, the 4-callose discharges D-glucose and slow hydrolysis D-Mierocrystalline cellulose, and cellobiohydrolase is from 1, and the 4-beta-glucan discharges the D-cellobiose.

(3) " β-D-Polyglucosidase " or β-D-glucoside glucose hydrolysis enzyme (EC 3.2.1.21), it is from cellobiose and soluble fiber dextrin, and a series of D-glucose units of release in the glycosides.

This three fermentoid acts synergistically together, and the natural cellulose of authigenic material decrystallizing and hydrolysis effectively in the future produces reducing sugar.

Method of the present invention also can be used for producing other enzymes, and these other enzyme is with the further hemicellulose components of degradation biological matter substrate of above-mentioned enzyme.(referring to, for example, Brigham etc., 195, Handbook on Bioethanol (Charles E.Wyman, editor), pp.119-141, Taylor and Francis, Washington D.C.; Lee, 1997, Journal of Biotechnology 56:1-24).These enzymes include but not limited to, degraded β-1,3-1, the enzyme of 4-dextran, β-1,3 (4)-endoglucanase for example, endoglucanase (beta-glucanase, cellulase) and beta-glucosidase enzyme; The enzyme of degraded xyloglucan, xyloglucanase enzymes for example, endoglucanase and cellulase; The enzyme of degradation of xylan, zytase for example, xylosidase, α-arabinofuranosidase (alpha-arabinofuranosidase), rhamno-galacturonic acid enzyme (rhamnogalacturonase), phammogalacturonane lyase (rhamnogalacturonan lyase) and phammogalacturonane acetylase (rhamnogalacturonan acetyl esterase); The enzyme of degraded xylogalacturonase (xylogalacturonan), xylogalacturonosidase for example, xylogalacturonase enzyme (xylogalacturonase) and phammogalacturonane lyase, enzyme with lignin degrading, lignin peroxidase for example, manganese dependency peroxidase, heterozygosis peroxidase, enzyme and laccase with lignin peroxidase and manganese dependency peroxidase combined characteristic.Other enzyme comprises esterase, lipase, oxydase, Phospholipid hydrolase, phytase, proteolytic enzyme and peroxidase.

Following embodiment further describes the present invention, but these embodiment should not be construed as limiting the scope of the invention.

Embodiment

Bacterial strain

(ATCC 13631 by Trichodermareesei (Trichoderma reesei) Qm6A; Mandels and Reese, 1957, J.Bacteriol 73:269-278) (ATCC 56765 to obtain Trichodermareesei RutC30; Montenecourt and Eveleigh, 1979, Adv, Chem.Ser.181:289-301).Trichodermareesei RutC30 and cereuisiae fermentum YNG318 (MAT α, ura3-52, leu-2 Δ 2, pep4 Δ l, his4-539) (W097/07205) is as the host cell of expressing the aspergillus oryzae beta-glucosidase enzyme.Aspergillus fumigatus PaHa34 is as the source of GH3A family beta-glucosidase enzyme.

Substratum and damping fluid

The YP substratum is made of the yeast extract of every liter of 10g and the bactopeptone of 20g.

Yeast selects substratum by the yeast nitrogen base (nitrogen base) of every liter of 6.7g, additional fully mixture (complete supplement mixture, CSM, Qbiogene, Inc., Carlsbad, the CA of 0.8g; Lack uridylic, contain the VITAMIN B4 of 40mg/ml), the 0.5M succinate of the pH 5.0 of the casamino acids (no amino acid) of 5g, 100ml, 50% glucose of 40ml, the 100mM CuSO of 1ml ₄, the ampicillin of 50mg and 25mg paraxin form.

Yeast selects plate culture medium to select substratum to add 5-bromo-4-chloro-3-indoles-β-D-glucopyranose glycosides (the glucopyranoside) (X-Glc of the bacterium of 20g with agar and 150mg by every liter of yeast, INALCO SPA, Milano, Italy), the substratum that lacks ampicillin and paraxin is formed.

COVE selects dull and stereotyped by the sucrose of every liter of 342.3g, the COVE salts solution of 20ml, the ethanamide of 10mM, the CsCl of 15mM ₂Form with the Noble agar of 25g.

COVE2 is made up of the sucrose of every liter of 30g, the COVE salts solution of 20ml, the ethanamide of 10mM and the Noble agar of 25g.

The COVE salts solution is by the KCl of every liter of 26g, the MgSO of 26g ₄7H ₂The KH of O, 76g ₂PO ₄, and the COVE trace-metal of 50ml form.

COVE trace-metal solution is by the NaB of every liter of 0.04g ₄O ₇10H ₂The CuSO of O, 0.4g ₄5H ₂The FeSO of O, 1.2g ₄7H ₂The MnSO of O, 0.7g ₄H ₂The Na of O, 0.8g ₂MoO ₂H ₂The ZnSO of O and 10g ₄7H ₂O forms.

The cellulase inducing culture is by Arbocel B800-native cellulose fibre (the J.Rettenmaier USA LP of every liter of 20g, Schoolcraft, Michigan), the corn syrup solids of 10g (corn steepsolids, Sigma Chemical Co., St.Louis, MO), (NH of 1.45g ₄) ₂SO ₄, 2.08g KH ₂PO ₄, 0.28g CaCl ₂, 0.42g MgSO ₄7H ₂The Trichodermareesei trace-metal of O, 0.42ml and 2 pluronic acid form; NaoH with 10N transfers to 6.0 with pH.

Trichodermareesei trace-metal solution is by the FeCl of every liter of 216g ₃6H ₂The ZnSO of O, 58g ₄7H ₂O, 27g MnSO ₄H ₂The CuSO of O, 10g ₄5H ₂The H of O, 2.4g ₃BO ₃, and the citric acid of 336g form.

The PEG damping fluid by the PEG 4000 of every liter of 500g (BDH, Poole, England), the CaCl of 10mM ₂, and the pH of 10mM be that 7.5 Tris-HCl (filtration sterilization) forms.

STC is by the CaCl of every liter of 1M sorbyl alcohol, 10mM ₂, and the pH of 10mM be that 7.5 Tris-HCl (filtration sterilization) forms.

Inoculation medium by the glucose of every liter of 20g, the corn syrup solids of 10g (Sigma ChemicalCo., St.Louis, MO), (NH of 1.45g ₄) ₂SO ₄, 2.08g KH ₂PO ₄, 0.28g CaCl ₂, 0.42g MgSO ₄7H ₂The Trichodermareesei trace-metal solution of O, 0.42ml and 2 pluronicacid form; Final pH is 5.0.

Fermention medium by the corn syrup solids of the glucose of every liter of 4g, 10g, the ArbocelB800-native cellulose fibre of 30g (J.Rettenmaier USA LP, Schoolcraft, Michigan), (NH of 3.8g ₄) ₂SO ₄, 2.8g KH ₂PO ₄, 2.08g CaCl ₂, 1.63g MgSO ₄7H ₂The Trichodermareesei trace-metal solution of O, 0.75ml and the pluronic acid of 1.8ml form.

Supplemented medium (Feed Medium) is by glucose, the Mierocrystalline cellulose B800 of 20g, the H of 35.5g of every liter of 600g ₃PO ₄Form with the pluronic acid of 5ml.

The beta-glucosidase activity test

0.5mg/ml p-nitrophenyl-β-D-glucopyranoside with 200 μ l in the 50mM succinate of pH 5.0 is a substrate, be used in a part of culture supernatant of the 25 μ l that dilute at 1: 10 in the 50mM succinate of pH 5.0, measure the beta-glucosidase activity of Trichodermareesei sample at normal temperatures.Behind the incubation 15 minutes, add the 1M Tris-HCl termination reaction of the pH 8.0 of 100 μ l, read light absorption value at the 405nm place with spectrophotometer.

For the cereuisiae fermentum sample, in 96 hole microtiter plates, with 0.6 times of dilution of 0.1M succinate culture supernatant sample of pH 5.0.The dilute sample of 25 μ l is taken out from each hole, add to 96 new orifice plates, it comprises 1mg/ml p-nitrophenyl-β-D-glucopyranoside substrate of 200 μ l.The incubation titer plate is 1.5 hours at normal temperatures, adds the 2M Tris-HCl termination reaction of pH 9.Read the light absorption value of titer plate then at the 405nm place with spectrophotometer.

The beta-glucosidase activity of a unit is equivalent at normal temperatures, during pH 5.0, and every liter of p-oil of mirbane of producing 1 μ mol of per minute.The aspergillus niger beta-glucosidase enzyme (Novozyme 188, NovozymesA/S, and Bagsvaerd is Denmark) as the enzyme standard.

Dna sequencing

(Applied Biosystems, Foster City carry out dna sequencing on CA) at ABI3700 to stop chemical method (Giesecke etal., 1992, Journal of Virol.Methods 38:47-60) with dyestuff.Adopt phred/phrap/consed (University of Washington, Seattle WA), assemble sequence with sequence specific primers.

The structure of embodiment 1:pAILo1 expression vector

Make up the pAILo1 expression vector by transforming pBANe6 (U.S. patent 6,461,837), pBANe6 comprises the NA2-tpi promotor, aspergillus niger amyloglucosidase terminator sequence (AMG terminator) and Aspergillus nidulans acetamidase gene (amdS).To the transformation of pBANe6, at first by site-directed mutagenesis, from three Nco I restriction sites of 2051,2722 and 3397 base positions deletion of amdS selective marker.All variations all are designed to " silence ", and the actual protein sequence of amdS gene product is remained unchanged.According to the explanation of manufacturer, use gene editing device site-directed mutagenesis test kit (Promega, Madison WI) remove this three sites simultaneously, use following primer (base that the Nucleotide representative of band underscore changes) in the operation:

AMDS3NcoMut(2050)：5′-GTGCCCCATG ATACGCCTCCGG-3′(SEQID?NO：1)

AMDS2NcoMut(2721)：5′-GAGTCGTATTTCCA AGGCTCCTGACC-3′(SEQ?ID?NO：2)

AMDSlNcoMut(3396)：5′-GGAGGCCATG AAGTGGACCAACGG-3′(SEQ?ID?NO：3)

(CA) site-directed mutagenesis comprises the plasmid of the sequence change of all three expectations for Stratagene, La Jolla, at the terminal 1643 positions deletion of AMG terminator Nco I restriction site with the QuickChange mutagenesis kit.Use following primer (base that the Nucleotide representative of band underscore changes) to carry out mutagenesis:

Upstream (upper) primer of mutagenesis aspergillus niger amyloglucosidase (AMG) terminator sequence:

5′-CACCGTGAAAGCCATG CTCTTTCCTTCGTGTAGAAGACCAGACAG-3′(SEQ?ID?NO：4)

Downstream (lower) primer of mutagenesis aspergillus niger amyloglucosidase (AMG) terminator sequence:

5′-CTGGTCTTCTACACGAAGGAAAGA GCATGGCTTTCACGGTGTCTG-3′(SEQ?ID?NO：5)

Last step of transforming pBANe6 is the section start at polylinker (polylinker), add new Nco I restriction site with QuickChange mutagenesis kit and following primer (base that the Nucleotide representative of band underscore changes), to obtain pAILo1 (Fig. 1).

The upstream primer of mutagenesis aspergillus niger amylase promotor (NA2-tpi):

5′-CTATATACACAACTGGATTTA CCATGGGCCCGCGGCCGCAGATC-3′(SEQ?ID?NO：6)

The downstream primer of mutagenesis aspergillus niger amylase promotor (NA2-tpi):

5′-GATCTGCGGCCGCGGGCCCA TGGTAAATCCAGTTGTGTATATAG-3′(SEQ?ID?NO：7)

AmdS gene and Aspergillus nidulans pyrG gene swapping with pAILo1.With the source of plasmid pBANe10 (Figure 14) as the pyrG gene, the pyrG gene is as selective marker.Analysis to the pBANe10 sequence shows that the pyrG marks packets is contained in Nsi I restriction fragment, does not comprise NcoI or Pac I restriction site.Because the amdS gene is also connected by Nsi I restriction site side, thereby the strategy of conversion selective marker is the simple switched of Nsi I restriction fragment.With the plasmid DNA of Restriction Enzyme Nsi I digestion, use the agarose gel electrophoresis purified product from pAILo1 and pBANE10.To be connected in the pAILo1 skeleton from the Nsi I fragment that comprises the pyrG gene of pBANe10, comprise the original Nsi I dna fragmentation of amdS gene with replacement.Analyze recombinant clone by restrictive diges-tion, have correct insertion and direction to measure it.The clone who selects the pyrG gene counterclockwise to be transcribed.New plasmid is appointed as pAILo2 (Figure 15).

The structure of embodiment 2:pMJ04 expression vector

By with following primer 993429 (antisense) and 993428 (justice is arranged) pcr amplification from the circumscribed lytic enzyme 1 gene (exocellobiohydrolase of the Trichodermareesei cellobiose of Trichodermareesei RutC30 genomic dna, cdhl) terminator comes construction of expression vector pMJ04.Antisense primer has been carried out the through engineering approaches processing, had Pac I site, had the SpeI site at the 3` end that adopted primer is arranged at its 5` end.

Primer 993429 (antisense):

5′-AACGTTAATTAAGGAATCGTTTTGTGTTT-3′(SEQ?ID?NO：8)

Primer 993428 (justice is arranged):

5′-AGTACTAGTAGCTCCGTGGCGAAAGCCTG-3′(SEQ?ID?NO：9)

(Qiagen, Chatsworth CA) separate Trichodermareesei RutC30 genomic dna with Dneasy Plant Maxi Kit.

Amplification reaction system (50 μ l) is by 1 * ThermoPol reaction buffer (New EnglandBiolabs, Beverly, MA), Vent polysaccharase (the NewEngland Biolabs of the primer 993428 of primer 993429, the 0.3 μ M of the Trichodermareesei RutC30 genomic dna of the dNTPs of 0.3mM, 100ng, 0.3 μ M and 2 units, Beverly MA) forms.Reaction system is at Eppendorf Mastercycler5333 (Eppendorf Scientific, Inc., Westbury, NY) incubation in, program is as follows: 94 ℃ 30 seconds, 50 ℃ 30 seconds, 72 ℃ 30 seconds, totally 5 circulations, then 94 ℃ 30 seconds, 65 ℃ 30 seconds, 72 ℃ 120 seconds, totally 25 circulations (extending at last 5 minutes).On 1.0% sepharose, use 40mMTris alkali-20mM sodium-acetate-1mM two sodium edtas (TAE) damping fluid reaction product isolated, explanation according to manufacturer, (QIAGEN, Chatsworth CA) downcut product band and the purifying of 229bp from glue with the QIAquick gel extraction kit.

With the PCR fragment of Pac I and Spe I digestion gained, (Roche, Indianapolis IN) are connected among the pAILo01 that digests with identical Restriction Enzyme, with preparation pMJ04 (Fig. 2) with connecting test kit fast.

The structure of embodiment 3:pCaHj568 expression vector

By pCaHj170 (U.S. patent 5,763,254) and pMT2188 construction expression plasmid pCaHj568.Plasmid pCaHj 170 comprises Humicola insolens endoglucanase V (EGV) coding region.Make up plasmid pMT2188 as follows: with following primer 142779 and 142780 from pCaHj483 (WO 98/00529) pcr amplification pUC19 replication orgin.Primer 142780 is introduced the BbuI site in the PCR fragment.

142779：5′-TTGAATTGAAAATAGATTGATTTAAAACTTC-3′(SEQ?IDNO：10)

142780：5′-TTGCATGCGTAATCATGGTCATAGC-3′(SEQ?ID?NO：11)

(Roche Molecular Biochemicals, Basel Switserland) are used for and ensuing pcr amplification herein with Expand PCR system according to the explanation of manufacturer.Separate the PCR product with the TAE damping fluid on 1% sepharose, (Genomed, Wielandstr Germany) separate also purifying 1160bp fragment with Jetquick Gel Extraction Spin test kit.

With following primer 140288 and 142778 from cereuisiae fermentum cloning vector pYES2 (Invitrogen, Carlsbad, CA) amplification URA3 gene.Primer 140288 is introduced Eco RI site in described PCR fragment.

140288：5′-TTGAATTCATGGGTAATAACTGATAT-3′(SEQ?ID?NO：12)

142778：5′-AAATCAATCTATTTTCAATTCAATTCATCATT-3′(SEQ?IDNO：13)

On 1% sepharose, separate the PCR product with the TAE damping fluid, separate and purifying 1126bp fragment with Jetquick GelExtraction Spin test kit.

Adopt lap splice method (overlap method splicing) (Horton etc., 1989, Gene 77:61-68), by mixing and, two PCR fragments being merged with above-mentioned primer 142780 and 140288 amplifications.On 1% sepharose, separate the PCR product with the TAE damping fluid, separate the also fragment of purifying 2263bp with Jetquick GelExtraction Spin test kit.

Digest the fragment of gained with Eco RI and Bbu I, and be connected to maximum segment with the pCaHj483 of identical enzymic digestion.The mixture that connects gained is used to transform the negative E.coli bacterial strain DB6507 (ATCC 35673) of pyrF, adopts Mandel and Higa, and 1970, the method for J.Mol.Biol.45:154 makes described bacterial strain become the competence bacterial strain.On solid M9 substratum, select transformant, the thiamines of the casamino acids of every liter of described culture medium supplemented 1g, 500 μ g and the kantlex of 10mg.Separated plasmid from a transformant, and with its called after pCaHj527 (Fig. 3).

Be present in NA2/tpi promotor on the pCaHj527 with simple PCR method rite-directed mutagenesis.Change 134-144 position Nucleotide into CCGTTAAATTT by GTACTAAAACC with mutant primer 141223:

Primer 141223:

5′-GGATGCTGTTGACTCCGGAAATTTAACGGTTTGGTCTTGCATCCC-3′(SEQ?ID?NO：14)

Change 423-436 position Nucleotide into CGGCAATTTAACGG by ATGCAATTTAAACT with mutant primer 141222:

Primer 141222:

5′-GGTATTGTCCTGCAGACGGCAATTTAACGGCTTCTGCGAATCGC-3′(SEQ?ID?NO：15)

Gained plasmid called after pMT2188 (Fig. 4).

Humicola insolens endoglucanase V coding region is transferred to the pMT2188 that digests with Bam HI and Xho I from pCaHj170 as Bam HI-Sal I fragment, obtains pCaHj568 (Fig. 5).

The structure of embodiment 4:pMJ05 expression vector

By making up the pMJ05 expression vector from pCaHj568PCR amplification Humicola insolens endoglucanase V coding region, following primer HiEGV-F and HiEGV-R are used in amplification.

HiEGV-F (justice is arranged): 5 '-AAGCTTAAGCATGCGTTCCTCCCCCCTCC-3 ' (SEQ ID NO:16)

HiEGV-R (antisense):

5′-CTGCAGAATTCTACAGGCACTGATGGTACCAG-3′(SEQ?ID?NO：17)

Amplification reaction system (50 μ l) is made up of the pCaHj568 plasmid of dNTPs, the 10ng/ μ l of 1 * ThermoPol reaction buffer, 0.3mM, the HiEGV-F primer of 0.3 μ M, the HiEGV-R primer of 0.3 μ M and the Vent polysaccharase of 2 units.Reaction system is incubation in Eppendorf Mastercycler5333, and program is as follows: 94 ℃ 30 seconds, 50 ℃ 30 seconds, 72 ℃ 60 seconds, totally 5 circulations, then 94 ℃ 30 seconds, 65 ℃ 30 seconds, 72 ℃ 120 seconds, totally 25 circulations (extending at last 5 minutes).On 1.0% sepharose,,, downcut product band and the purifying of 937bp from glue with the QIAquick gel extraction kit according to the explanation of manufacturer with TAE damping fluid reaction product isolated.

With this 937bp purifying fragment is that template DNA carries out amplification subsequently, and following primer is used in amplification:

HiEGV-R (antisense):

5-CTGCAGAATTCTACAGGCACTGATGGTACCAG-3′(SEQ?ID?NO：18)

HiEGV-F-overlapping (justice is arranged):

5′-ACCGCGGACTGCGCATC ATGCGTTCCTCCCCCCTCC-3′(SEQ?ID?NO：19)

The primer sequence that italic shows and the 17bp homology of Trichodermareesei cbhl promotor, the primer sequence of band underscore and the 29bp homology of Humicola insolens endoglucanase V coding region.The overlapping 994bp fragment that allows to comprise Trichodermareesei cbhl promotor of promotor and encoding sequence 36bp accurately merges with the 918bp fragment that comprises Humicola insolens endoglucanase V open reading frame.

Amplification reaction system (50 μ l) is made up of the 937bp purifying PCR fragment of dNTPs, the 1 μ l of 1 * ThermoPol reaction buffer, 0.3mM, the overlapping primer of HiEGV-F of 0.3 μ M, the HiEGV-R primer of 0.3 μ M and the Vent polysaccharase of 2 units.Reaction system is incubation in EppendorfMastercycler 5333, and program is as follows: 94 ℃ 30 seconds, 50 ℃ 30 seconds, 72 ℃ 60 seconds, totally 5 circulations, then 94 ℃ 30 seconds, 65 ℃ 30 seconds, 72 ℃ 120 seconds, totally 25 circulations (extending at last 5 minutes).On 1.0% sepharose,,, downcut product band and the purifying of 945bp from glue with the QIAquick gel extraction kit according to the explanation of manufacturer with TAE damping fluid reaction product isolated.

Implemented independent PCR with amplification Trichodermareesei cbhl promoter sequence, this sequence is extended from the ATG upstream from start codon 994bp of gene, described gene is from Trichodermareesei RutC30 genomic dna, following primer (through engineering approaches has adopted primer, makes its 5` end possess Sal I restriction site) is used in amplification:

TrCBH1pro-F (justice is arranged):

5′-AAACGTCGACCGAATGTAGGATTGTTATC-3′(SEQ?ID?NO：20)

TrCBH1pro-R (antisense): 5 '-GATGCGCAGTCCGCGGT-3 ' (SEQ ID NO:21)

Amplification reaction system (50 μ l) is made up of the Trichodermareesei RutC30 genomic dna of dNTPs, the 100ng of 1 * ThermoPol reaction buffer, 0.3mM, the TrCBH1pro-F primer of 0.3 μ M, the TrCBH1pro-R primer of 0.3 μ M and the Vent polysaccharase of 2 units.Reaction system is incubation in EppendorfMastercycler 5333, and program is as follows: 94 ℃ 30 seconds, 55 ℃ 30 seconds, 72 ℃ 120 seconds, totally 30 circulations (extending at last 5 minutes).On 1.0% sepharose,,, downcut product band and the purifying of 998bp from glue with the QIAquick gel extraction kit according to the explanation of manufacturer with TAE damping fluid reaction product isolated.

998bp purifying PCR fragment is as the template DNA in the amplification subsequently, and following primer is used in amplification:

TrCBH1pro-F：5′-AAACGTCGACCGAATGTAGGATTGTTATC-3′(SEQID?NO：22)

TrCBH1pro-R-is overlapping:

5′- GGAGGGGGGAGGAACGCATGATGCGC4GTCCGCGGT-3′(SEQ?ID?NO：23)

The primer sequence that italic shows and the 17bp homology of Trichodermareesei cbhl promotor, the primer sequence of band underscore and the 29bp homology of Humicola insolens endoglucanase V coding region.The overlapping 918bp fragment that allows to comprise Trichodermareesei cbhl promotor of promotor and encoding sequence 36bp accurately merges with the 918bp fragment that comprises Humicola insolens endoglucanase V open reading frame.

Amplification reaction system (50 μ l) is made up of the 998bp purifying PCR fragment of dNTPs, the 1 μ l of 1 * ThermoPol reaction buffer, 0.3mM, the TrCBH1pro-F primer of 0.3 μ M, the overlapping primer of TrCBH1pro-R of 0.3 μ M and the Vent polysaccharase of 2 units.Reaction system is incubation in Eppendorf Mastercycler 5333, and program is as follows: 94 ℃ 30 seconds, 50 ℃ 30 seconds, 72 ℃ 60 seconds, totally 5 circulations, then 94 ℃ 30 seconds, 65 ℃ 30 seconds, 72 ℃ 120 seconds, totally 25 circulations (extending at last 5 minutes).On 1.0% sepharose,,, downcut product band and the purifying of 1017bp from glue with the QIAquick gel extraction kit according to the explanation of manufacturer with TAE damping fluid reaction product isolated.

1017bp Trichodermareesei cbhl promotor PCR fragment and 945bp Humicola insolens endoglucanase V PCR fragment are as the template DNA in the amplification subsequently, following primer is used in amplification, by overlapping PCR the Humicolainsolens endoglucanase V coding region of 994bp Trichodermareesei cbhl promotor and 918bp is merged.

TrCBH1pro-F：5′-AAACGTCGACCGAATGTAGGATTGTTATC-3′(SEQID?NO：24)

HiEGV-R?：5′-CTGCAGAATTCTACAGGCACTGATGGTACCAG-3′(SEQ?ID?NO：25)

Amplification reaction system (50 μ l) is made up of the TrCBH1pro-F primer of dNTPs, the 0.3 μ M of 1 * ThermoPol reaction buffer, 0.3mM, the HiEGV-R primer of 0.3 μ M and the Vent polysaccharase of 2 units.Reaction system is incubation in Eppendorf Mastercycler 5333, and program is as follows: 94 ℃ 30 seconds, 50 ℃ 30 seconds, 72 ℃ 60 seconds, totally 5 circulations, then 94 ℃ 30 seconds, 65 ℃ 30 seconds, 72 ℃ 120 seconds, totally 25 circulations (extending at last 5 minutes).On 1.0% sepharose,,, downcut product band and the purifying of 1926bp from glue with the QIAquick gel extraction kit according to the explanation of manufacturer with TAE damping fluid reaction product isolated.

According to the scheme of manufacturer, with Zero Blunt TOPO PCR clone test kit (Invitrogen, Carlsbad, CA) with the 1926bp fragment cloning of gained to the pCR-Blunt-II-TOPO carrier.With the carrier of Not I and Sal I digestion gained, purifying 1926bp fragment also is connected in the pMJ04 expression vector, digests this carrier with same two Restriction Enzymes, obtains pMJ05 (Fig. 6).

The structure of embodiment 5:pSMai130 expression vector

With pJaL660 (WO 2002/095014) is template, with following primer 993467 (justice is arranged) and 993456 (antisenses) amplification 2586bp dna fragmentation, this fragment is crossed over aspergillus oryzae beta-glucosidase enzyme encoding sequence, and (SEQ ID NO:42 is the cDNA sequence, and SEQ ID NO:43 is a deduced amino acid; E.coli DSM 14240) part from the ATG initiator codon to the TAA terminator codon.The 5` that Spe I site is engineered to antisense primer holds, so that connect.The primer sequence that italic shows and the 24bp homology of Trichodermareesei cbhl promotor, the primer sequence of band underscore and the 22bp homology of aspergillus oryzae beta-glucosidase enzyme coding region.

Primer

993467：5′-ATAGTCAACCGCGGACTGCGCATC ATGAAGCTTGGTTGGATC GAGG-3′(SEQ?ID?NO：26)

Primer 993456:5 '-ACTAGTTTACTGGGCCTTAGGCAGCG-3 ' (SEQ IDNO:27)

Amplification reaction system (50 μ l) by the Pfx amplification buffer (Invitrogen, Carlsbad, CA), the primer 993456 of primer 993467, the 3.2 μ M of the pJaL660 plasmid of dNTPs, the 10ng of 0.25mM, 6.4 μ M, the MgCl of 1mM ₂, and the Pfx archaeal dna polymerase of 2.5 units form (Invitrogen, Carlsbad, California).Reaction system is incubation in Eppendorf Mastercycler 5333, and program is as follows: 94 ℃ 30 seconds, 55 ℃ 60 seconds, 72 ℃ 180 seconds, totally 30 circulations (extending at last 15 minutes).On 1.0% sepharose,,, downcut product band and the purifying of 2586bp from glue with the QIAquick gel extraction kit according to the explanation of manufacturer with TAE damping fluid reaction product isolated.

Implemented independent PCR with amplification Trichodermareesei cbhl promoter sequence, this sequence is extended from the ATG upstream from start codon 1000bp of gene, following primer 993453 (justice is arranged) and primer 993463 (antisense) are used in amplification, to produce 1000bp PCR fragment.The primer sequence that italic shows and the 24bp homology of Trichodermareesei cbhl promotor, the primer sequence of band underscore and the 22bp homology of aspergillus oryzae beta-glucosidase enzyme coding region.The overlapping 1000bp fragment that allows to comprise Trichodermareesei cbhl promotor of promotor and encoding sequence 46bp accurately merges with the 2586bp fragment that comprises aspergillus oryzae beta-glucosidase enzyme open reading frame.

Primer 993453:5 '-GTCGACTCGAAGCCCGAATGTAGGAT-3 ' (SEQ IDNO:28)

Primer

993463：5′- CCTCGATCCAACCAAGCTTCATGATGCGCAGTCCGCGGTTGACTA-3′(SEQ?ID?NO：29)

Amplification reaction system (50 μ l) is by the primer 993463 of primer 993453, the 3.2 μ M of the Trichodermareesei RutC30 genomic dna of dNTPs, the 10ng of Pfx amplification buffer, 0.25mM, 6.4 μ M, the MgCl of 1mM ₂, and the Pfx archaeal dna polymerase of 2.5 units form.Reaction system is incubation in Eppendorf Mastercycler 5333, and program is as follows: 94 ℃ 60 seconds, 55 ℃ 60 seconds, 72 ℃ 180 seconds, totally 30 circulations (extending at last 15 minutes).On 1.0% sepharose,,, downcut product band and the purifying of 1000bp from glue with the QIAquick gel extraction kit according to the explanation of manufacturer with TAE damping fluid reaction product isolated.

Use above-mentioned primer 993453 (justice is arranged) and primer 993456 (antisense), with described purifying fragment be subsequently the amplification in template DNA, by overlapping PCR method, the described 1000bp fragment that will comprise Trichodermareesei cbhl promotor accurately merges with the 2586bp fragment that comprises aspergillus oryzae beta-glucosidase enzyme open reading frame.

Amplification reaction system (50 μ l) is by the primer 993456 of primer 99353, the 3.2 μ M of dNTPs, the 6.4 μ M of Pfx amplification buffer, 0.25mM, the MgCl of 1mM ₂, and the Pfx archaeal dna polymerase of 2.5 units form.Reaction system is incubation in Eppendorf Mastercycler 5333, and program is as follows: 94 ℃ 60 seconds, 60 ℃ 60 seconds, 72 ℃ 240 seconds, totally 30 circulations (extending at last 15 minutes).

With the 3586bp fragment of Sal I and Spe I digestion gained and be connected among the pMJ04, digest with two identical Restriction Enzymes, to obtain pSMai130 (Fig. 7).

The structure of embodiment 6:pSMai135

With pJaL660 is template, and therefrom pcr amplification is from the aspergillus oryzae beta-glucosidase enzyme coding region of Lys-20 to TAA terminator codon (remove the natural signals sequence, see Fig. 8), and following primer 993728 (justice is arranged) and primer 993727 (antisense) are used in amplification.The sequence that italic shows and the 20bp homology of Humicola insolens endoglucanase V signal sequence, the sequence of band underscore and the 22bp homology of aspergillus oryzae beta-glucosidase enzyme coding region.Spe I site is engineered in the 5` end of antisense primer.

Primer

993728：5′-TGCCGGTGTTGGCCCTTGCC AAGGATGATCTCGCGTACTCCC-3′(SEQ?ID?NO：30)

Primer 993727:5 '-GACTAGTCTTACTGGGCCTTAGGCAGCG-3 ' (SEQ IDNO:31)

Amplification reaction system (5 μ l) is by the primer 993727 of primer 993728, the 3.2 μ M of pJal660, the 6.4 μ M of dNTPs, the 10ng/ μ l of Pfx amplification buffer, 0.25mM, the MgCl of 1mM ₂, and the Pfx archaeal dna polymerase of 2.5 units form.Reaction system is incubation in Eppendorf Mastercycler5333, and program is as follows: 94 ℃ 60 seconds, 55 ℃ 60 seconds, 72 ℃ 180 seconds, totally 30 circulations (extending at last 15 minutes).On 1.0% sepharose,,, downcut product band and the purifying of 2523bp from glue with the QIAquick gel extraction kit according to the explanation of manufacturer with TAE damping fluid reaction product isolated.

Use primer 993724 (justice is arranged) shown below and primer 993729 (antisense) to carry out independent pcr amplification, (the ATG initiator codon is to Ala-21 for the Trichodermareesei cbhl promotor of amplification 1000bp and the Humicolainsolens endoglucanase V signal sequence of inferring of 63bp, Fig. 9, SEQ IDNO:36).The primer sequence that italic shows and the 20bp homology of Humicola insolens endoglucanase V signal sequence, the primer sequence of band underscore and the 22bp homology of aspergillus oryzae beta-glucosidase enzyme coding region.Plasmid pMJ05 comprises the 1063bp fragment of Trichodermareesei cbhl promotor/Humicolainsolens endoglucanase V signal sequence fragment with preparation as template, described plasmid pMJ05 comprises Humicola insolens endoglucanase V coding region, and this coding region is under the control of cbhl promotor.The total 42bp of Trichodermareesei cbhl promotor/Humicola insolens endoglucanase V signal sequence and aspergillus oryzae encoding sequence overlaps and provides perfect between the ATG initiator codon of described promotor and 2523bp aspergillus oryzae beta-glucosidase enzyme and be connected.

Primer 993724:5-ACGCGTCGACCGAATGTAGGATTGTTATCC-3 ' (SEQID NO:32)

Primer 993729:

5′- GGGAGTACGCGAGATCATCCTTGGCAAGGGCCAACACCGGCA-3′(SEQ?ID?NO：33)

Amplification reaction system (50 μ l) is by the primer 993727 of primer 993728, the 3.2 μ M of pMJ05, the 6.4 μ M of dNTPs, the 10ng/ μ l of Pfx amplification buffer, 0.25mM, the MgCl of 1mM ₂, and the Pfx archaeal dna polymerase of 2.5 units form.Reaction system is incubation in Eppendorf Mastercycler5333, and program is as follows: 94 ℃ 60 seconds, 60 ℃ 60 seconds, 72 ℃ 240 seconds, totally 30 circulations (extending at last 15 minutes).On 1.0% sepharose,,, downcut product band and the purifying of 1063bp from glue with the QIAquick gel extraction kit according to the explanation of manufacturer with TAE damping fluid reaction product isolated.

Use above-mentioned primer 993724 (justice is arranged) and primer 993727 (antisense), with described purifying overlapping fragments serve as the amplification in template DNA, by overlapping PCR method, the 1063bp fragment that will comprise Trichodermareesei cbhl promotor/Humicola insolens endoglucanase V signal sequence accurately merges with the 2586bp fragment that comprises aspergillus oryzae beta-glucosidase enzyme open reading frame.

Amplification reaction system (50 μ l) is by the primer 993727 of primer 993724, the 3.2 μ M of dNTPs, the 6.4 μ M of Pfx amplification buffer, 0.25mM, the MgCl of 1mM ₂, and the PfxDNA polysaccharase of 2.5 units form.Reaction system is incubation in Eppendorf Mastercycler 5333, and program is as follows: 94 ℃ 60 seconds, 60 ℃ 60 seconds, 72 ℃ 240 seconds, totally 30 circulations (extending at last 15 minutes).On 1.0% sepharose,,, downcut product band and the purifying of 3591bp from glue with the QIAquick gel extraction kit according to the explanation of manufacturer with TAE damping fluid reaction product isolated.

With the 3591bp fragment of Sal I and Spe I digestion gained and be connected among the pMJ04, digest with two identical Restriction Enzymes, to obtain pSMai135 (Figure 10).

Embodiment 7: the expression of aspergillus oryzae beta-glucosidase enzyme in the Trichodermareesei of more natural and allos Humicola insolens endoglucanase V secretion signal

Conversion (Penttila etc. by the PEG-mediation, 1987, the same), plasmid pSMai130 or pSMai135 are imported Trichodermareesei RutC30, wherein plasmid pSMai130 is at cbhl promotor and natural secretion signal (Fig. 8, SEQ ID NO:34 (dna sequence dna) and 35 (deduced amino acid)) guiding express down the aspergillus oryzae beta-glucosidase enzyme, plasmid pSMai135 coding is connected to the ripe aspergillus oryzae beta-glucosidase enzyme of Humicolainsolens endoglucanase V secretion signal (Fig. 9, SEQ ID NO:36 (dna sequence dna) and 37 (deduced amino acid)).Two plasmids all comprise Aspergillus nidulans amdS gene, and transformant can be grown during as only nitrogen source at ethanamide.

27 ℃, under the 90rpm, Trichodermareesei RutC30 was cultivated 17 hours in the 25ml YP substratum that has added 2% (w/v) glucose and 10mM uridine.(Millipore, Bedford MA) filter the collection mycelium, with deionized water wash twice, with 1.2M sorbyl alcohol washed twice with Millipore ' s vacuum controlled recyclable (Disposable) filtering system.With washed mycelium suspended in the 1.2M of 20ml sorbyl alcohol, under 34 ℃ with 90rpm jog incubation 15-25 minute, obtain protoplastis, every ml sorbyl alcohol contains Glucanex (the Novozymes A/S of 15mg, Bagsvaerd, Denmark) and the chitinase of 0.36 unit (Sigma Chemical Co., St.Louis, MO).400 * g collected protoplastis in centrifugal 7 minutes, with ice-cold 1.2M sorbyl alcohol washed twice.Protoplastis is counted with hematimeter, be resuspended among the STC to final concentration be every ml 1 * 10 ⁸Protoplastis.Be stored under the remaining protoplastis-80 ℃ 1 ℃ of freezing container of Cryo (Nalgene, Rochester, NY).

The expression plasmid (pSMai130 or pSMai135) of about 7 μ g Pme I digestion is added to 100 μ l protoplastis solution, mix gently, then add 260 μ l PEG damping fluids, mix, incubation is 30 minutes under the room temperature.Add STC (3ml) then, mix, on the COVE flat board, draw flat board, select with Aspergillus nidulans amdS with described selection solution.Dull and stereotyped in 28 ℃ of incubation 5-7 days.The transformant subculture is on the COVE2 flat board, 28 ℃ of growths down.

Obtained 110 amdS positive transformants with pSMai130, obtained 65 transformant with pSMai135.Under 28 ℃, the transformant of being appointed as SMA135 that 20 transformant of being appointed as SMA130 that obtained by pSMai130 (natural secretion signal) and 67 are obtained by Smai135 (allos secretion signal) subculture 7 days on the fresh flat board of acetamide-containing allows it to form spore.

PH 6.0 times, by inoculating the spore of described transformant, described 20 SMA130 and 67 SMA135 Trichodermareesei transformant are incubated at 125ml band dividing plate (baffled) shake in the 25ml cellulase inducing culture that contains in the bottle, 28 ℃ of 200rpm cultivated 7 days down.Trichodermareesei RutC30 is with comparing.In the time of the 7th day, take out the culture broth sample.Centrifugal 5 minutes of every kind of culture broth of 1ml 15,700 * g in little whizzer, supernatant liquor goes to new test tube.4 ℃ of storage samples are tested until enzyme.As above-mentioned, as substrate, test the beta-glucosidase activity of supernatant liquor with p-nitrophenyl-β-D-glucopyranoside.

All 20 SMA130 transformant show the active suitable beta-glucosidase activity with host strain Trichodermareesei RutC30.In contrast to this, several SMA135 transformant have shown the active big several times beta-glucosidase activity than Trichodermareesei RutC30.Transformant SMA135-04 has produced the highest beta-glucosidase activity, likens active big 7 times that Trichodermareesei RutC30 into contrast produces to.

((BioRad, Hercules CA) carry out SDS-PAGE to gel to standard Tris-HCl CA) (5% dissolving) for BioRad, Hercules with having modular system.With 5 μ l the 7th day supernatant liquor (referring to above-mentioned) be suspended in 2 * spissated Laemmli sample buffer (BioRad, Hercules, CA) in, at 5% β-dredge in the presence of the basic ethanol and boiled 3 minutes.To polyacrylamide gel, is that mobile damping fluid (BioRad, Hercules CA) carry out electrophoresis with 1 * Tris/Glycine/SDS with sample on the supernatant samples.The gel of gained dyes with BioRad ' s Bio-Safe Coomassie Stain.

For Trichodermareesei SMA130 transformant culture broth supernatant liquor, can't see beta-glucosidase enzyme with SDS-PAGE.In contrast, 26 albumen that produce about 110kDa in 38 Trichodermareesei SMA135 transformant, it be can't see in Trichodermareesei RutC30 in contrast.Transformant Trichodermareesei SMA135-04 has produced the beta-glucosidase enzyme of highest level.

Embodiment 8: the fermentation of aspergillus oryzae SMA135-04

Aspergillus oryzae SMA135-04 is fermented to measure the generation level of its beta-glucosidase activity.Trichodermareesei RutC30 (host strain) is with comparing.The spore inoculating of Trichodermareesei SMA135-04 to the shaking in the bottle of 500ml, is shaken the inoculation medium that contains 100ml in the bottle.Under 28 ℃, will shake bottle and be positioned in the track wobbler about 48 hours, in the time of 48 hours, the culture of 50ml will be seeded in 1.8 liters of fermention medium (see above) in 2 liters of fermenting containers.Ferment and carry out under 5.0,28 ℃ of pH, during fermentation, the minimum dissolved oxygen under the stirring degree of 1.0VVM air-flow and 1100 is 25%.In the time of 18 hours, added supplemented medium 33 hours with 3.6g/ hour feed rate, add with 7.2g/ hour feed rate then.Fermentation was carried out 165 hours, and centrifugal final fermenting broth in the time of 165 hours is stored supernatant liquors till testing beta-glucosidase activity with aforesaid method in-20 ℃.

After measured, the beta-glucosidase activity of Trichodermareesei SMA135-04 fermented sample is than active high about 8 times of Trichodermareesei RutC30.

The structure of embodiment 9:pSATe111 and pALFd1 cereuisiae fermentum expression vector

With pJaL660 (WO 2002/095014) is template, therefrom pcr amplification comprises that (SEQ ID NO:42 is the cDNA sequence from aspergillus oryzae beta-glucosidase enzyme encoding sequence, SEQ ID NO:43 is the aminoacid sequence of inferring) the ATG initiator codon is to 2 of TAA termination codon subregion, the 605bp dna fragmentation, following primer 992127 (justice is arranged) and 992328 (antisenses) are used in amplification.

992127：5-GCAGATCTACCATGAAGCTTGGTTGGATCGAG-3′(SEQID?NO：38)

992328：5-GCCTCAGATTACTGGGCCTTAGGCAGCGAG-3(SEQ?IDNO：39)

Primer 992127 has Bgl II site, upstream, and primer 992328 has Xho I site, downstream.

Amplification reaction system (50 μ l) is by containing MgCl ₂1 * PCR damping fluid (Roche AppliedScience, Manheim, Germany), Pwo archaeal dna polymerase (the Roche Applied Science of the pJaL660 of the primer 992328 of primer 992127, the 50 μ M of the dNTPs of 0.25mM, 50 μ M, 80ng and 2.5 units, Manheim Germany) forms.Reaction system is incubation in EppendorfMastercycler 5333, and program is as follows: 94 ℃ 5 minutes, a circulation, then 94 ℃ 60 seconds, 55 ℃ 60 seconds, 72 ℃ 120 seconds, totally 25 circulations (extending at last 10 minutes).According to the explanation of manufacturer, use ZeroBlunt then ^TMTOPO PCR clone test kit (Invitrogen, Carlsbad, CA) with PCR product subclone to pCR-Blunt II-TOPO carrier, obtain plasmid pSATe101 (Figure 11).With Bgl II and Xho I digested plasmid pSATe101 to discharge the beta-glucosidase enzyme gene.On 1.0% sepharose,,, downcut product band and the purifying of 2.6kb from gel with the QIAquick gel extraction kit according to the explanation of manufacturer with TAE damping fluid reaction product isolated.

Digestion 2.6kb PCR product also is cloned among the Bam HI and Xho I site of the derivable 2 μ m Yeast expression carrier pCu426 (Labbe and Thiele, 1999, Methods Enzymol.306:145-53) of copper, obtains pSATe111 (Figure 12).

Made up plasmid pALFd1, to be determined at the production and the secretion that whether also can strengthen the aspergillus oryzae beta-glucosidase enzyme in the cereuisiae fermentum with Humicola insolens endoglucanase V signal peptide exchange aspergillus oryzae beta-glucosidase enzyme secretion signal.

With Xho I and Spe I digested plasmid pSATe111, to discharge 2.6kb (aspergillus oryzae beta-glucosidase enzyme) and 6kb (remainder of carrier) fragment.Separate the 6kb fragment and be connected to 2.6kb PCR fragment, comprise aspergillus oryzae beta-glucosidase enzyme coding region (removal secretory signal sequence) and Humicola insolens endoglucanase V signal sequence, it increases from pSMai135 with following primer 993950 and 993951.Described primer comprises Xho I and Spe I restriction site at its end, is used for subsequently subclone to Xho I and the Spe I restriction site of pSATe111.

Primer

993950：5′-AATCCGACTAGTGGATCTACCATGCGTTCCTCCCCCCTCC-3′(SEQ?ID?NO：40)

Primer 993951:5 '-GCGGGCCTCGAGTTACTGGGCCTTAGGCAGCG-3 ' (SEQ ID NO:41)

Amplification reaction system (100 μ l) is made up of the primer 993951 of primer 993950, the 50 μ M of the pSMai135 plasmid DNA of dNTPs, the 0.14 μ g of PCR Thermo Pol damping fluid, 0.20mM, 50 μ M and the Vent archaeal dna polymerase of 2 units.Reaction system is at RoboCyclerGradient 40 thermal cyclers (Stratagene, La Jolla, CA) middle incubation, program is as follows: 95 ℃ 1 minute, a circulation, 95 ℃ 1 minute, 60 ℃ or 64 ℃ 1 minute, 72 ℃ are 3 minutes then, totally 25 circulations (extending at last 10 minutes).Reaction product is used the video picture of TAE damping fluid on 0.7% sepharose.According to the explanation of manufacturer, with PCR MinElute PCR purification process (QIAGEN, Chatsworth, CA) the 2.6kb fragment band of purifying gained.The fragment of mixing purifying with Xho I and Spe I digestion, and is connected among the pSATe111 that digests with two same Restriction Enzymes, with preparation pALFd1 (Figure 13).

Embodiment 10: the expression of aspergillus oryzae beta-glucosidase enzyme in the cereuisiae fermentum of more natural and allos secretion signal

According to YEASTMAKER yeast conversion scheme, CLONTECH Laboratories, Inc., Palo Alto, CA is converted into plasmid pALFd1 (about 600ng) in the freshly prepd cereuisiae fermentum YNG318 competent cell.Cell transformed is selected to draw on the flat board dull and stereotyped at yeast, the dull and stereotyped every ml of described selection contains chromogenic substrate 5-bromo-4-chloro-3-indoles-β-D-galactoside of 0.15mg, and it produces blue clone when having beta-glucosidase enzyme.Described flat board was in 30 ℃ of following incubations 4 days.

Carry blue dark than clone of being cloned on the color generally of expression vector, show and secreted more aspergillus oryzae beta-glucosidase enzyme with Humicola insolens endoglucanase V secretion signal with Humicola insolens endoglucanase V secretion signal with natural rice aspergillus beta-glucosidase enzyme signal sequence.With automatically cloning select instrument (QPix, Genetix USA, Inc., Boston MA) has selected about 242 blue clones from two constructs.242 transformant are seeded to yeast to be selected in the substratum (it comprises copper), with the expression and the secretion of inducing the aspergillus oryzae beta-glucosidase enzyme.Taking out 96 hole culture meat soups from the 7th day from each of 245 clones, as stated above, is substrate test beta-glucosidase activity with p-nitrophenyl-β-D-glucopyranoside.The result shows, expresses the clone of the beta-glucosidase enzyme with allos signal sequence, and its activity is higher 6.6 times than the clone who transforms with the aspergillus oryzae beta-glucosidase enzyme with natural secretion signal.

Embodiment 11: the evaluation of glycosyl hydrolase family GH3A gene in the Aspergillus fumigatus genome sequence

Portion gene group sequence (The Institute for GenomicResearch to Aspergillus fumigatus, Rockville, MD) tblastn retrieval (Altschul etc. have been carried out, 1997, Nucleic AcidsRes.25:3389-3402), be used for inquiry from microorganism Aspergillus aculeatus (Aspergillus aculeatus) beta-glucosidase enzyme protein sequence (accession number No.P48825).Based on the height consistence of search sequence at amino acid levels, several genes are accredited as the GH3A family homologue of inferring.Have an about 3000bp genome area that is higher than 70% identity with search sequence at amino acid levels and be selected for further research.

Embodiment 12: the Aspergillus fumigatus extracting genome DNA

37 ℃, under the 240rpm rotating speed, make Aspergillus fumigatus PaHa34 grow in shaking in the 250ml potato glucose substratum in the bottle of band dividing plate.By filtering results mycelium, washed twice in TE damping fluid (10mMTris-1mM EDTA), liquid nitrogen freezing.Grind the refrigerated mycelium with mortar, smash into smalls to pieces, it is resuspended in the damping fluid of the pH 8.0 that contains 10mM Tris, 100mM EDTA, 1%Triton X-100,0.5M guanidine-HCl and 200mM NaCl.The concentration that adds RNaseA to the 20 μ g/ml of no DNase, 37 ℃ of following incubation lysates 30 minutes.The centrifugal cell debris of removing is with Qiagen Maxi 500 pillars (QIAGEN Inc., Chatsworth, CA) DNA isolation.With the described pillar of balance among the 30ml QC washed 10ml QBT, (all damping fluids are all from AIAGEN Inc., Chatsworth, CA) wash-out with the QF of 15ml.Deposit D NA in Virahol washs in 70% ethanol, centrifugal recovery.Described DNA is resuspended in the TE damping fluid.

The clone of embodiment 13:GH3A family beta-glucosidase enzyme gene and the structure of aspergillus oryzae expression vector

Designed two following synthetic oligonucleotide primer things, be used for prepared genomic dna pcr amplification Aspergillus fumigatus PaHa34 gene, this genes encoding GH3A family beta-glucosidase enzyme from embodiment 14.(BD Biosciences, Palo Alto CA) directly are cloned into described fragment among the expression vector pAILo2 (Figure 14), need not restrictive diges-tion and are connected to clone test kit with InFusion.

Forward primer: 5 '-ACTGGATTTACCATGAGATTCGGTTGGCTCG-3 ' (SEQID NO:44)

Reverse primer: 5 '-AGTCACCTCTAGTTACTAGTAGACACGGGGC-3 ' (SEQID NO:45)

Encoding sequence represented in bold-type letter.The insertion site homology of remaining sequence and pAILo2 is described in the embodiment 7.

In the PCR reaction system, use each 50 picomole of above-mentioned every kind of primer, in final volume is the described reaction system of 50 μ l, contain the mixture, the Pfx archaeal dna polymerase of 2.5 units, the 50mM MgSO of 1 μ l of dATP, dTTP, dGTP and dCTP of 10mM of Aspergillus fumigatus genomic dna, 1 * Pfx amplification buffer, the 1.5 μ l of 100ng ₄With 10 * pCR * enhanser solution of 2.5 μ l (Invitrogen, Carlsbad, CA).Reaction system is incubation in Eppendorf Mastercycler 5333, and program is as follows: 94 ℃ 2 minutes, a circulation; 94 ℃ 15 seconds, 55 ℃ 30 seconds, 68 ℃ 3 minutes, totally 30 circulations.Heat block enters 4 ℃ of insulation circulations then.

On 1.0% sepharose,,, downcut product band and the purifying of 3kb from glue with the QIAquick gel extraction kit according to the explanation of manufacturer with TAE damping fluid reaction product isolated.

Then with Infusion clone test kit with described fragment cloning to the pAILo2 expression vector.Digest described carrier with Nco I and Pac I.With gel electrophoresis and the described fragment of Qiaquick gel extraction method purifying.In the reaction, the carrier of described gene fragment and digestion links together, and obtains expression plasmid pEJG97 (Figure 15), and in this plasmid, GH3A family beta-glucosidase enzyme gene transcription is under the control of NA2-tpi promotor.Ligation system (50 μ l) is by 1 * InFusion damping fluid (BDBiosciences, Palo Alto, CA), 1 * BSA (BD Biosciences, Palo Alto, CA), the InFusion enzyme of 1 μ l (dilution in 1: 10) (BD Biosciences, Palo Alto, CA), the forming of 150ng with the pAILo2 of NcoI and Pac I digestion and the Aspergillus fumigatus beta-glucosidase enzyme purified pcr product of 50ng.With reaction system incubation 30 minutes at room temperature.With the reaction solution Transformed E .coli XL10Solopac Gold cell of 1 μ l (Stratagene, La Jolla, CA).By the restrictive diges-tion of plasmid DNA, detected the E.coli transformant that comprises the pEJG97 plasmid.

Embodiment 14: the evaluation of the Aspergillus fumigatus genome sequence of coding GH3A family beta-glucosidase enzyme

Adopt the primer step to move strategy, the Aspergillus fumigatus beta-glucosidase enzyme gene from pEJG97 is carried out dna sequencing by preceding method.Based on homogenic similarity from microorganism Aspergillus aculeatus, aspergillus niger and valley aspergillus (Aspergilluskawachii), made up the genetic model of Aspergillus fumigatus sequence.Nucleotide sequence (SEQ ID NO:46) and deduced amino acid (SEQ ID NO:47) are listed among Figure 16.863 amino acid whose polypeptide of described genomic fragment coding, by 62,55,58,63,58,58,63 and 8 introns of 51bp cut off.The G+C percentage composition of this gene is 54.3%.Predicted the signal peptide of 19 residues with SignalP software program (Nielsen etc., 1997, Protein Engineering 10:1-6).The maturation protein of being predicted contains 844 amino acid, and molecular weight is 91.7kDa.

Adopt LASERGENE ^TMMEGALIGN ^TMSoftware (DNASTAR, Inc., Madison, WI), by Clustal W method (Higgins, 1989, CABIOS 5:151-153) measured the comparative comparison of beta-glucosidase enzyme sequence, described software has identity table and following multisequencing comparison parameter: gap penalty is 10, room length point penalty is 10.The comparison parameter is Ktuple=1, room (gap) point penalty=3, window=5, diagonal lines (diagonal)=5 in pairs.Comparison shows that the beta-glucosidase enzyme of the aminoacid sequence of the Aspergillus fumigatus beta-glucosidase enzyme gene of derivation and microorganism Aspergillus aculeatus (accession number P48825), aspergillus niger (accession number 000089) and valley aspergillus (accession number P87076) has 78%, 76% and 76% identity.

Embodiment 15: the expression of Aspergillus fumigatus GH3A family beta-glucosidase enzyme gene in aspergillus oryzae JAL250

With reference to Christensen etc., 1988, the method for Bio/Technology 6:1419-1422 has prepared the protoplastis of aspergillus oryzae Jal250.PEJG97 (also having the pAILo2 of carrier in contrast) with 5 μ g transforms aspergillus oryzae JAL250.

Transform aspergillus oryzae Jal250 with pEJG97 and produced about 100 transformant.10 transformant are separated to one PDA flat board.

With 5 fusion PDA flat board wherein in 10 transformant of 0.01%Tween 20 washing of 5ml, be inoculated into 125ml glass separately and shake in the 25ml MDU2BP substratum in the bottle 34 ℃ of 250rpm incubations.Inoculate back 5 days, according to the explanation of manufacturer, with Tris-Glycine SDS-PAGE gel (Invitrogen, Carlsbad, CA) the supernatant liquor of analysis 0.5 μ l of 8-16% from each culture.The SDS-PAGE collection of illustrative plates of culture shows that one of them transformant (being appointed as transformant 1) has the main band of about 130kDa.

Embodiment 16: extract total RNA from aspergillus oryzae

Aspergillus oryzae transformant described in the embodiment 13 is chilled in the liquid nitrogen-80 ℃ of preservations.Next, at electric coffee beans grinding machine for grinding refrigerated tissue, add several dry ice in the grinding so that the powdered mycelium keeps ice-cold.Then, the substance transfer after will grinding with blade in the conical tube of 50ml sterilization, the Fenozol of the 20ml that packs in advance in the conical tube (Active Motif, Inc., Carlsbad, CA).The mixing mixture is so that the refrigerated material dissolves in strong solution, places 50 ℃ of water-baths 15 minutes fast.Adding 5ml does not have the chloroform of RNase, violent vortex.Mixture was left standstill under room temperature 10 minutes.Next, under the room temperature in Sorvall RT7 whizzer (Sorvall, Inc, Newtown, CT) in centrifugal 20 minutes of 1300 * g.Last phase transition to new conical tube, is added isopyknic phenol-chloroform-primary isoamyl alcohol (25: 24: 1).Vortex mixed thing also centrifugal 10 minutes.This program repeats twice, to finish 3 phenol-chloroform-primary isoamyl alcohol extractings.To go up phase transition then to new test tube, add isopyknic chloroform-primary isoamyl alcohol (24: 1).The vortex mixed thing is also centrifugal 10 minutes once more.After centrifugal, water (about 5ml) is transferred in the new Oak Ridge pipe, adds the 3M sodium-acetate of 0.5ml pH 5.2 and the Virahol of 6.25ml.With the mixture mixing, incubation is 15 minutes under room temperature.Next, with mixture in Sorvall RC5B (Sorvall, Inc, Newtown, CT) in centrifugal 30 minutes of 4 ℃ of 12,000 * g.After centrifugal, remove supernatant liquor, carefully 18ml 70% ethanol is added on the particle (pellet).Once more in 4 ℃ with 12,000 * g centrifugal 10 minutes.The careful supernatant liquor of removing makes particle in air drying.The RNA particle is resuspended in diethyl pyrocarbonate (DEPC) treated water of 500 μ l.65 ℃ the heating 10 minutes resuspended to help.Preserve total RNA in-80 ℃.(Englewood CO) goes up the quality that quantizes and assess RNA with the RNA chip at AgilentBioanalyzer 2100.All material that uses in this programme and reagent all are no RNAse's.

Embodiment 17: the clone of Aspergillus fumigatus beta-glucosidase enzyme cDNA sequence

With embodiment 16 described total RNA clone Aspergillus fumigatus beta-glucosidase enzyme cDNA sequences (SEQ IDNO:48 is the cDNA sequence, and SEQ ID NO:49 is a deduced amino acid).By the explanation of manufacturer, and usefulness Poly (A) Purist Mag test kit (Ambion, Inc., Austin, TX) purifying is from the mRNA of total RNA.Then, with the ProStar UltraHF RT-PCR (Stratagene of system, La Jolla, CA) amplification Aspergillus fumigatus beta-glucosidase enzyme cDNA sequence in two fragments, 1, the dna fragmentation of 337bp is from ATG initiator codon to 1,332 positions (being labeled as the 5` fragment), second 1, the dna fragmentation of 300bp (being labeled as the 3` fragment) is from 1,303 positions are until terminator codon, and amplification is undertaken by the scheme of manufacturer, for the reaction system of 50 μ l, poly-A mRNA with 200ng, being used for the segmental primer of 5` is Afuma (justice is arranged) and Afumc (antisense), and being used for the segmental primer of 3` is Afumd (justice is arranged) and Afumb (antisense), and described primer is as follows:

Afuma：5′-GGCTCATGAGATTCGGTTGGCTCGAGGTC-3′(SEQ?IDNO：50)

Afumc：5′-GCCGTTATCACAGCCGCGGTCGGGGCAGCC-3′(SEQ?IDNO：51)

Afumd：5′-GGCTGCCCCGACCGCGGCTGTGATAACGGC-3′(SEQ?IDNO：52)

Afumb：5′-GCTTAATTAATCTAGTAGACACGGGGCAGAGGCGC-3′(SEQ?ID?NO：53)

Primer Afuma has Bsp HI site, upstream, and primer Afumb has Pac I site, downstream.29 Nucleotide of 1,337 fragment 3` end are held overlapping with 1,303 fragment 5`.Unique Sac II site is arranged in the overlap.

By the scheme of manufacturer, use Zero Blunt ^TMTOPO PCR clone test kit with two fragments separately all subclone in the pCR-BluntII-TOPO carrier, to be used for order-checking, obtained plasmid pCR4Blunt-TOPOAfcDNA5 ' (Figure 17) and pCR4Blunt-TOPOAfcDNA3 ' (Figure 18), comprise 5` and 3` fragment respectively.

By with the every kind of plasmid DNA of 0.5 μ l and the following primer order-checking of 3.2pmol, two segmental whole coding regions of Aspergillus fumigatus beta-glucosidase enzyme have all obtained confirmation.

BGLU1. forward: 5 '-ACACTGGCGGAGAAGG-3 ' (SEQ ID NO:54)

BGLU2. forward: 5 '-GCCCAGGGATATGGTTAC-3 ' (SEQ ID NO:55)

BGLU3. forward: 5 '-CGACTCTGGAGAGGGTTTC-3 ' (SEQ ID NO:56)

BGLU4. reverse: 5 '-GGACTGGGTCATCACAAAG-3 ' (SEQ ID NO:57)

BGLU5. reverse: 5 '-GCGAGAGGTCATCAGCA-3 ' (SEQ ID NO:58)

The M13 forward: 5 '-GTAAAACGACGGCCAGT-3 ' (SEQ ID NO:59)

M13 is reverse: 5 '-CAGGAAACAGCTATGA-3 ' (SEQ ID NO:60)

When the Aspergillus fumigatus beta-glucosidase enzyme cDNA sequence that will obtain and by (the TheInstitute for Genomic Research of genome research institute, Rockville, when the Aspergillus fumigatus beta-glucosidase enzyme cDNA sequence that genomic data MD) derives out compared, the sequencing result demonstration existed several Nucleotide to change.In the position 500, T is replaced by C, makes encoding sequence GTT become GCT, and Xie Ansuan is replaced by L-Ala like this.In the position 903, T is replaced by C, make encoding sequence CCC become CCT, yet this variation is reticent.In the position 2,191, G is replaced by C, makes encoding sequence CAG become GAG, and L-glutamic acid is replaced by glutamine like this.At last, in the position 2,368, C is replaced by T, makes encoding sequence CTG become TTG, yet this variation also is reticent.

After two segmental order-checkings are finished, use every kind of plasmid DNA of about 9 μ g, comprise two clones of each fragment with Sac II and Pme I digestion.Obtain 3 with above-mentioned enzymic digestion pCR4Blunt-TOPOAfcDNA5 ' carrier, 956bp (major part that comprises carrier) and second 1, the fragment of 339bp (comprising Aspergillus fumigatus beta-glucosidase enzyme cDNA 5` fragment).Produce 5 with these identical enzymic digestions pCMBlunt-TOPOAfcDNA3 ' carrier, second fragment of the fragment of 227bp (major part and the Aspergillus fumigatus beta-glucosidase enzyme cDNA 3` fragment that comprise the pCR4BIunt-TOPO carrier) and 31bp.

With the pCR4Blunt-TOPOAfcDNA3 ' of shrimp alkaline phosphotase processing through digestion, with DNA product dephosphorylation with digestion, this processing is carried out in the following manner: shrimp alkaline phosphotase (the Roche Applied Science that adds 1 * SAP damping fluid and 1 μ l, Manheim, Germany), 37 ℃ of following incubation reaction systems 10 minutes, 85 ℃ of incubations made enzyme deactivation in 10 minutes then.Twice digestion is all carried out on 0.7% sepharose with the TAE damping fluid, according to the explanation of manufacturer, with QIAGEN gel-purified test kit purifying.Explanation according to manufacturer, with rapid DNA connect test kit (Roche AppliedScience, Manheim, Germany) will by pCR4Blunt-TOPOAfcDNA5 ' digestion produce 1, the 339bp band with produce by pCR4Blunt-TOPOAfcDNA3 ' digestion 5, the connection of 527bp fragment.(Stratagene, La Jolla CA), are converted into ligation liquid in the XL1-Blue E.coli subclone competent cell according to the explanation of manufacturer.During conversion, to from the order-checking of the plasmid DNA of separating clone, all by subclone in order, produced 6, the pCR4BIunt-TOPOAfcDNA carrier (Figure 19) of 566bp with the 5` that confirms Aspergillus fumigatus beta-glucosidase enzyme cDNA and 3` fragment.

The structure of embodiment 18:pALFd6 and pALFd7 cereuisiae fermentum expression vector

With following primer pcr amplification Aspergillus fumigatus beta-glucosidase enzyme full-length cDNA, 5` and the 3` sequence of described primer and pCu426 and Aspergillus fumigatus beta-glucosidase enzyme cDNA have homology:

AfumigatusBGUpper：

5′-CTTCTTGTTAGTGCAATATCATATAGAAGTCATCGACTAGTGGATCTACCATGAGATTCGGTT?GGCTCG-3′(SEQ?ID?NO：61)

The 5` end of ATGAGATTCGGTTGGCTCG and Aspergillus fumigatus cDNA has homology

AfumigatusBGLower：

5′-GCGTGAATGTAAGCGTGACATAACTAATTACATGACTCGAGCTAGTAGACACGGGGCAGAG-3′(SEQ?ID?NO：62)

The 3` end of CTAGTAGACACGGGGCAGAG and Aspergillus fumigatus cDNA has homology

Amplification reaction system (100 μ l) is by the 0.5 μ l pCR4BIunt-TOPOAfcDNA plasmid that comprises Aspergillus fumigatus cDNA sequence, 1 * Pfx amplification buffer, dATP, dCTP, dGTP and the dTTP of each 50 μ M, above-mentioned every kind of primer of each 50pmol, the MgSO of 1.5mM ₄, and the Platinum Pfx archaeal dna polymerase of 2.5 units form.Reaction system is incubation in RoboCycler Gradient 40, and program is as follows: 95 ℃ 5 minutes, a circulation; 95 ℃ 1 minute, 50 ℃ 1 minute, 72 ℃ 3 minutes, totally 25 circulations; Last 72 ℃ were extended 10 minutes.With QIAquick PCR purification kit (QIAGEN Inc., Valencia, CA) purifying PCR reactant.With DNA be eluted to 30 μ l the EB damping fluid (QIAGEN Inc., Valencia, CA) in.The PCR product comprises the homologous DNA sequence of 37bp, and its pCU426 with 1 μ l is mixed, and in embodiment 10 described cereuisiae fermentum YNG318 competent cells, described pCU426 cuts jagged with Spe I and Xho I with cotransformation.It is blue that these clones do not become, and being presented at has some order-checking mistakes in the Aspergillus fumigatus beta-glucosidase enzyme cDNA sequence.Further the order-checking of Aspergillus fumigatus cDNA sequence is presented at and has inserted extra Nucleotide in the cDNA sequence, and it has destroyed the open reading frame of enzyme.Therefore, must repair this construct.

In cereuisiae fermentum, express Aspergillus fumigatus beta-glucosidase enzyme cDNA, meanwhile, in order in cereuisiae fermentum, to express, exchanged Humicola insolens endoglucanase V signal sequence with the natural signals sequence of Aspergillus fumigatus cDNA sequence, with the expression of the enzyme that relatively has two signal sequences.With with pALFd1 in Humicola insolens endoglucanase V signal sequence have the primer PCR amplification Aspergillus fumigatus cDNA sequence of homology, the 5` of described primer and ripe Aspergillus fumigatus beta-glucosidase enzyme cDNA sequence holds also has homology.The primer that is used for Aspergillus fumigatus beta-glucosidase enzyme cDNA sequence amplification is aforesaid AfumigatusBGLower primer and following HiEGVAfumigatus primer:

HiEGVAfumigatus：

5′-CCGCTCCGCCGTTGTGGCCGCCCTGCCGGTGTTGGCCCTTGCCGAATTGGCTTTCTCTCC-3′(SEQ?ID?NO：63)

The 5` end of GAATTGGCTTTCTCTCC and Aspergillus fumigatus mature sequence has homology.

Amplification reaction system (100 μ l) is by the pCR4BIunt-TOPOAfcDNA plasmid of the 0.5 μ l that comprises Aspergillus fumigatus cDNA sequence, 1 * Pfx amplification buffer, dATP, dCTP, dGTP and the dTTP of each 50 μ M, the above-mentioned primer of each 50pmol, the MgSO of 1.5mM ₄, and the PlatinumPfx archaeal dna polymerase of 2.5 units form.Reaction system is incubation in RoboCycler Gradient 40, and program is as follows: 95 ℃ 5 minutes, a circulation; 95 ℃ 1 minute, 50 ℃ 1 minute, 72 ℃ 3 minutes, totally 25 circulations; Last 72 ℃ were extended 10 minutes.With QIAquick PCR purification kit purifying PCR reactant.DNA is eluted in the EB damping fluid of 10 μ l.The pure PCR product of 3ul is mixed with the pALFd1 of 1.8 μ l, and in the cereuisiae fermentum YNG318 competent cell described in the embodiment 10, described pALFd1 cuts jagged with Eco NI and Xho I with cotransformation.These clones become light blue.Yet a clone is very outstanding, demonstrates very blue color.Outside the yeast lysis buffer (1%SDS, 10mM Tris-HCl, 1mM EDTA pH 8) that uses 20 μ l, according to Kaiser and Auer, 1993, the scheme of BioTechniques 14:552 is implemented DNA rescue (DNA rescue) from this clone.Described plasmid is transformed into (Stratagene, La Jolla, CA) order-checking in E.coli SURE electroporation-competent cell.The total length order-checking shows that Aspergillus fumigatus beta-glucosidase enzyme cDNA sequence is correct.This plasmid is appointed as pALFd7 (Figure 20), and it comprises Aspergillus fumigatus beta-glucosidase enzyme cDNA sequence, and this cDNA sequence has the Humicola insolens endoglucanase V signal sequence that is used for yeast expression.

In order to prepare the Yeast expression carrier that comprises Aspergillus fumigatus cDNA sequence correct, that have its natural signals sequence, increase from the zone of containing the correct nucleotide sequence of Yeast expression carrier with above-mentioned BGLU.5 reverse primer and following primer PCR, this Yeast expression carrier comprises the Aspergillus fumigatus cDNA sequence (pALFd7) with Humicola insolens endoglucanase V signal sequence:

The BGL.7 forward: 5 '-CTGGCGTTGGCGCTGTC-3 ' (SEQ ID NO:64)

Amplification reaction system (100 μ l) is by the pALFd7 of 0.5 μ l, 1 * Pfx amplification buffer, dATP, dCTP, dGTP and the dTTP of each 50 μ M, the above-mentioned primer of each 50pmol, the MgSO of 1.5mM ₄, and the Platinum Pfx archaeal dna polymerase of 2.5 units form.Reaction system is incubation in RoboCyclerGradient 40, and program is as follows: 95 ℃ 5 minutes, a circulation; 95 ℃ 1 minute, 50 ℃ 1 minute, 72 ℃ 1 minute, totally 25 circulations; Last 72 ℃ were extended 10 minutes.

PCR fragment with QIAquick PCR purification kit purifying 701bp.DNA is eluted in the EB damping fluid of 10 μ l.The pure PCR product of 3ul is mixed with the Yeast expression carrier of 3 μ l and extra Nucleotide, with cotransformation in embodiment 10 described cereuisiae fermentum YNG318 competent cells, described Yeast expression carrier comprises the Aspergillus fumigatus cDNA sequence with natural signals sequence, and described extra Nucleotide is cut jagged with Sac II and Xma I carrier.These clones become blueness.As above-mentioned, the clone has implemented the DNA rescue from the blueness of a random choose, and described plasmid is transformed into (Stratagene, La Jolla, CA) order-checking in E.coli SURE electroporation-competent cell.The total length order-checking shows that Aspergillus fumigatus beta-glucosidase enzyme cDNA sequence is correct.This Yeast expression carrier called after pALFd6 (Figure 21), it comprises the Aspergillus fumigatus cDNA sequence with its natural signals sequence.

Embodiment 19: the expression of Aspergillus fumigatus beta-glucosidase enzyme in the cereuisiae fermentum of more natural and allos secretion signal

Plasmid pALFd6 (comprising the Aspergillus fumigatus with its natural signals sequence) and the pALFd7 (comprising the Aspergillus fumigatus with described allos signal sequence) of about 1 μ g are transformed in the freshly prepd cereuisiae fermentum YNG318 competent cell separately, select to draw on the flat board dull and stereotyped at yeast, as described in embodiment 10,30 ℃ of following incubations 4 days.

Select two blue clones by hand, it is inoculated into yeast selects in the substratum (substratum comprises copper), with the expression and the secretion of inducing the aspergillus oryzae beta-glucosidase enzyme from two constructs.As above-mentioned, make substrate then, test the beta-glucosidase activity of the 5th day meat soup, repeat once with p-nitrophenyl-β-D-glucopyranoside.Expression has the beta-glucosidase enzyme that the culture of the beta-glucosidase enzyme of allos signal sequence produces and Duos 2.5 times than the culture of expressing the beta-glucosidase enzyme with its natural signals sequence.

The preservation of biomaterial

Clause according to budapest treaty, following biomaterial has been preserved in farming research service patent culture collection center, north district research centre (Agricultural Research Service PatentCulture Collection, Northern Regional Research Center), 1815 University Street, Peoria, Illinois, 61604, provided following preserving number:

Preservation thing preserving number preservation date

E.coli TOP10 (pEJG113) NRRL B-30695 on October 17th, 2003

This bacterial strain preservation under following condition: guarantee during present patent application is unsettled, can obtain this culture according to the people that 37C.F.R. § 1.14 and 35U.S.C. § 122 authorize by the Patent ﹠ Trademark committee member.This preservation thing is the pure basically culture of institute's preservation strain.At the copy of having submitted this application to, or the country of its follow-up text, according to the requirement of this foreign patent law, can obtain this preservation thing.Yet, should be appreciated that the acquisition of preservation thing does not constitute implementing permission of the present invention, implementing the present invention is the infringement of patent right that action by government is authorized.

Herein, described in the invention is not to be to come limited range with specified scheme disclosed herein with what require, because the purpose of these schemes is will be as the explanation of the several aspects of the present invention.The scheme of any equivalence all will be within the scope of the present invention.In fact, by the description of front, except that herein shown and describe, to multiple modification of the present invention, all will be obviously for those skilled in the art.Such modification also will drop within the scope of appended claim.Chong Tu situation will be explained by this specification sheets that comprises definitional part therewith.

This paper has quoted many reference, and wherein disclosed full content in the lump as a reference.

Explanation about microbial preservation

(detailed rules and regulations 13 two)

PCt/RO/134 shows (in July, 1998)

Sequence table

＜110〉Novozymes Biotech Inc. (NOVOZYMES BIOTECH, INC.)

Maiyiran，Suchindra

Fidantsef，Ana

Brody，Howard

 

＜120〉prepare the method for secreted polypeptides

 

<130>10375.204-WO

 

<150>60/467,766

<151>2003-05-02

 

<160>64

 

<170>PatentIn?version?3.2

 

<210>1

<211>22

<212>DNA

＜213〉aspergillus oryzae (Aspergillus oryzae)

 

<400>1

gtgccccatg?atacgcctcc?gg 22

 

<210>2

<211>26

<212>DNA

＜213〉aspergillus oryzae (Aspergillus oryzae)

 

<400>2

gagtcgtatt?tccaaggctc?ctgacc 26

 

<210>3

<211>24

<212>DNA

＜213〉aspergillus oryzae (Aspergillus oryzae)

 

<400>3

ggaggcca?tg?aagtggacca?acgg 24

 

<210>4

<211>45

<212>DNA

＜213〉aspergillus niger (Aspergillus niger)

 

<400>4

caccgtgaaa?gccatgctct?ttccttcgtg?tagaagacca?gacag 45

 

<210>5

<211>45

<212>DNA

＜213〉aspergillus niger (Aspergillus niger)

    

<400>5

ctggtcttct?acacgaagga?aagagcatgg?ctttcacggt?gtctg 45

 

<210>6

<211>44

<212>DNA

＜213〉aspergillus oryzae (Aspergillus oryzae)

 

<400>6

ctatatacac?aactggattt?accatgggcc?cgcggccgca?gatc 44

 

<210>7

<211>44

<212>DNA

＜213〉aspergillus oryzae (Aspergillus oryzae)

 

<400>7

gatctgcggc?cgcgggccca?tggtaaatcc?agttgtgtat?atag 44

 

<210>8

<211>29

<212>DNA

＜213〉Trichodermareesei (Trichoderma reesei)

 

<400>8

aacgttaatt?aaggaatcgtt?ttgtgttt 29

 

<210>9

<211>29

<212>DNA

＜213〉Trichodermareesei (Trichoderma reesei)

 

<400>9

agtactagta?gctccgtggc?gaaagcctg 29

 

<210>10

<211>31

<212>DNA

<213>Humicola?insolens

 

<400>10

ttgaattgaa?aatagattga?tttaaaactt?c 31

 

<210>11

<211>25

<212>DNA

<213>Humicola?insolens

 

<400>11

ttgcatgcgt?aatcatggtc?atagc 25

 

<210>12

<211>26

<212>DNA

＜213〉cereuisiae fermentum (Saccharomyces cerevisiae)

 

<400>12

ttgaattcat?gggtaataac?tgatat 26

 

<210>13

<211>32

<212>DNA

＜213〉cereuisiae fermentum (Saccharomyces cerevisiae)

 

<400>13

aaatcaatct?attttcaatt?caattcatca?tt 32

 

<210>14

<211>45

<212>DNA

＜213〉aspergillus oryzae (Aspergillus oryzae)

 

<400>14

ggatgctgtt?gactccggaa?atttaacggt?ttggtcttgc?atccc 45

 

<210>15

<211>44

<212>DNA

＜213〉aspergillus oryzae (Aspergillus oryzae)

 

<400>15

ggtattgtcc?tgcagacggc?aatttaacgg?cttctgcgaa?tcgc 44

 

<210>16

<211>29

<212>DNA

<213>Humicola?insolens

 

<400>16

aagcttaagc?atgcgttcct?cccccctcc 29

 

<210>17

<211>32

<212>DNA

<213>Humicola?insolens

 

<400>17

ctgcagaatt?ctacaggcac?tgatggtacc?ag 32

 

<210>18

<211>32

<212>DNA

<213>Humicola?insolens.

 

<400>18

ctgcagaatt?ctacaggcac?tgatggtacc?ag 32

<210>19

<211>36

<212>DNA

<213>Humicola?insolens

 

<400>19

accgcggact?gcgcatcatg?cgt?tcctccc?ccctcc 36

 

<210>20

<211>29

<212>DNA

＜213〉Trichodermareesei (Trichoderma reesei)

 

<400>20

aaacgtcgac?cgaatgtagg?attgttatc 29

 

<210>21

<211>17

<212>DNA

＜213〉Trichodermareesei (Trichoderma reesei)

 

<400>21

gatgcgcagt?ccgcggt 17

 

<210>22

<211>29

<212>DNA

＜213〉Trichodermareesei (Trichoderma reesei)

 

<400>22

aaacgtcgac?cgaatgtagg?attgttatc 29

 

<210>23

<211>36

<212>DNA

＜213〉Trichodermareesei (Trichoderma reesei)

 

<400>23

ggagggggga?ggaacgcatg?atgcgcagtc?cgcggt 36

 

<210>24

<211>29

<212>DNA

＜213〉Trichodermareesei (Trichoderma reesei)

 

<400>24

aaacgtcgac?cgaatgtagg?attgttatc 29

 

<210>25

<211>32

<212>DNA

＜213〉Trichodermareesei (Trichoderma reesei)

<400>25

ctgcagaatt?ctacaggcac?tgatggtacc?ag 32

 

<210>26

<211>46

<212>DNA

＜213〉Trichodermareesei (Trichoderma reesei)

 

<400>26

atagtcaacc?gcggactgcg?catcatgaag?cttggttgga?tcgagg 46

 

<210>27

<211>26

<212>DNA

＜213〉Trichodermareesei (Trichoderma reesei)

 

<400>27

actagtttac?tgggccttag?gcagcg 26

 

<210>28

<211>26

<212>DNA

＜213〉Trichodermareesei (Trichoderma reesei)

 

<400>28

gtcgactcga?agcccgaatg?taggat 26

 

<210>29

<211>45

<212>DNA

＜213〉Trichodermareesei (Trichoderma reesei)

 

<400>29

cctcgatcca?accaagcttc?atgatgcgca?gtccgcggtt?gacta 45

 

<210>30

<211>42

<212>DNA

＜213〉aspergillus oryzae (Aspergillus oryzae)

 

<400>30

tgccggtgtt?ggcccttgcc?aaggatgatc?tcgcgtactc?cc 42

 

<210>31

<211>28

<212>DNA

＜213〉aspergillus oryzae (Aspergillus oryzae)

 

<400>31

gactagtctt?actgggcctt?aggcagcg 28

 

<210>32

<211>30

<212>DNA

＜213〉aspergillus oryzae (Aspergillus oryzae)

 

<400>32

acgcgtcgac?cgaatgtagg?attgttatcc 30

 

<210>33

<211>42

<212>DNA

＜213〉aspergillus oryzae (Aspergillus oryzae)

 

<400>33

gggagtacgc?gagatcatcc?ttggcaaggg?ccaacaccgg?ca 42

 

<210>34

<211>57

<212>DNA

＜213〉aspergillus oryzae (Aspergillus oryzae)

 

<400>34

atgaagcttg?gttggatcga?ggtggccgca?ttggcggctg?cctcagtagt?cagtgcc 57

 

<210>35

<211>19

<212>PRT

＜213〉aspergillus oryzae (Aspergillus oryzae)

 

<400>35

Met?Lys?Leu?Gly?Trp?Ile?Glu?Val?Ala?Ala?Leu?Ala?Ala?Ala?Ser?Val

1 5 10 15

Val?Ser?Ala

  

<210>36

<211>63

<212>DNA

<213>Humicola?insolens

 

<400>36

atgcgttcct?cccccctcct?ccgctccgcc?gttgtggccg?ccctgccggt?gttggccctt 60

gcc 63

 

<210>37

<211>21

<212>PRT

<213>Humicola?insolens

 

<400>37

 

Met?Arg?Ser?Ser?Pro?Leu?Leu?Arg?Ser?Ala?Val?Val?Ala?Ala?Leu?Pro

1 5 10 15

Val?Leu?Ala?Leu?Ala

20

 

<210>38

<211>32

<212>DNA

＜213〉aspergillus oryzae (Aspergillus o ryzae)

 

<400>38

gcagatctac?catgaagctt?ggttggatcg?ag 32

 

<210>39

<211>30

<212>DNA

＜213〉aspergillus oryzae (Aspergillus oryzae)

 

<400>39

gcctcagatt?actgggcctt?aggcagcgag 30

 

<210>40

<211>40

<212>DNA

<213>Humicola?insolens

 

<400>40

aatccgacta?gtggatctac?catgcgttcc?tcccccctcc 40

 

<210>41

<211>32

<212>DNA

<213>Humicola?insolens

 

<400>41

gcgggcctcg?agttactggg?ccttaggcag?cg 32

 

<210>42

<211>2586

<212>DNA

＜213〉aspergillus oryzae (Aspergillus oryzae)

 

<220>

<221>CDS

<222>(1)..(2583)

 

<400>42

atg?aag?ctt?ggt?tgg?atc?gag?gtg?gcc?gca?ttg?gcg?gct?gcc?tca?gta 48

Met?Lys?Leu?Gly?Trp?Ile?Glu?Val?Ala?Ala?Leu?Ala?Ala?Ala?Ser?Val

1 5 10 15

gtc?agt?gcc?aag?gat?gat?ctc?gcg?tac?tcc?cct?cct?ttc?tac?cct?tcc 96

Val?Ser?Ala?Lys?Asp?Asp?Leu?Ala?Tyr?Ser?Pro?Pro?Phe?Tyr?Pro?Ser

20 25 30

cca?tgg?gca?gat?ggt?cag?ggt?gaa?tgg?gcg?gaa?gta?tac?aaa?cgc?gct 144

Pro?Trp?Ala?Asp?Gly?Gln?Gly?Glu?Trp?Ala?Glu?Val?Tyr?Lys?Arg?Ala

35 40 45

gta?gac?ata?gtt?tcc?cag?atg?acg?ttg?aca?gag?aaa?gtc?aac?tta?acg 192

Val?Asp?Ile?Val?Ser?Gln?Met?Thr?Leu?Thr?Glu?Lys?Val?Asn?Leu?Thr

50 55 60

act?gga?aca?gga?tgg?caa?cta?gag?agg?tgt?gtt?gga?caa?act?ggc?agt 240

Thr?Gly?Thr?Gly?Trp?Gln?Leu?Glu?Arg?Cys?Val?Gly?Gln?Thr?Gly?Ser

65 70 75 80

gtt?ccc?aga?ctc?aac?atc?ccc?agc?ttg?tgt?ttg?cag?gat?agt?cct?ctt 288

Val?Pro?Arg?Leu?Asn?Ile?Pro?Ser?Leu?Cys?Leu?Gln?Asp?Ser?Pro?Leu

85 90 95

ggt?att?cgt?ttc?tcg?gac?tac?aat?tca?gct?ttc?cct?gcg?ggt?gtt?aat 336

Gly?Ile?Arg?Phe?Ser?Asp?Tyr?Asn?Ser?Ala?Phe?Pro?Ala?Gly?Val?Asn

100 105 110

gtc?gct?gcc?acc?tgg?gac?aag?acg?ctc?gcc?tac?ctt?cgt?ggt?cag?gca 384

Val?Ala?Ala?Thr?Trp?Asp?Lys?Thr?Leu?Ala?Tyr?Leu?Arg?Gly?Gln?Ala

115 120 125

atg?ggt?gag?gag?ttc?agt?gat?aag?ggt?att?gac?gtt?cag?ctg?ggt?cct 432

Met?Gly?Glu?Glu?Phe?Ser?Asp?Lys?Gly?Ile?Asp?Val?Gln?Leu?Gly?Pro

130 135 140

gct?gct?ggc?cct?ctc?ggt?gct?cat?ccg?gat?ggc?ggt?aga?aac?tgg?gaa 480

Ala?Ala?Gly?Pro?Leu?Gly?Ala?His?Pro?Asp?Gly?Gly?Arg?Asn?Trp?Glu

145 150 155 160

ggt?ttc?tca?cca?gat?cca?gcc?ctc?acc?ggt?gta?ctt?ttt?gcg?gag?acg 528

Gly?Phe?Ser?Pro?Asp?Pro?Ala?Leu?Thr?Gly?Val?Leu?Phe?Ala?Glu?Thr

165 170 175

att?aag?ggt?att?caa?gat?gct?ggt?gtc?att?gcg?aca?gct?aag?cat?tat 576

Ile?Lys?Gly?Ile?Gln?Asp?Ala?Gly?Val?Ile?Ala?Thr?Ala?Lys?His?Tyr

180 185 190

atc?atg?aac?gaa?caa?gag?cat?ttc?cgc?caa?caa?ccc?gag?gct?gcg?ggt 624

Ile?Met?Asn?Glu?Gln?Glu?His?Phe?Arg?Gln?Gln?Pro?Glu?Ala?Ala?Gly

195 200 205

tac?gga?ttc?aac?gta?agc?gac?agt?ttg?agt?tcc?aac?gtt?gat?gac?aag 672

Tyr?Gly?Phe?Asn?Val?Ser?Asp?Ser?Leu?Ser?Ser?Asn?Val?Asp?Asp?Lys

210 215 220

act?atg?cat?gaa?ttg?tac?ctc?tgg?ccc?ttc?gcg?gat?gca?gta?cgc?gct 720

Thr?Met?His?Glu?Leu?Tyr?Leu?Trp?Pro?Phe?Ala?Asp?Ala?Val?Arg?Ala

225 230 235 240

gga?gtc?ggt?gct?gtc?atg?tgc?tct?tac?aac?caa?atc?aac?aac?agc?tac 768

Gly?Val?Gly?Ala?Val?Met?Cys?Ser?Tyr?Asn?Gln?Ile?Asn?Asn?Ser?Tyr

245 250 255

ggt?tgc?gag?aat?agc?gaa?act?ctg?aac?aag?ctt?ttg?aag?gcg?gag?ctt 816

Gly?Cys?Glu?Asn?Ser?Glu?Thr?Leu?Asn?Lys?Leu?Leu?Lys?Ala?Glu?Leu

260 265 270

ggt?ttc?caa?ggc?ttc?gtc?atg?agt?gat?tgg?acc?gct?cat?cac?agc?ggc 864

Gly?Phe?Gln?Gly?Phe?Val?Met?Ser?Asp?Trp?Thr?Ala?His?His?Ser?Gly

275 280 285

gta?ggc?gct?gct?tta?gca?ggt?ctg?gat?atg?tcg?atg?ccc?ggt?gat?gtt 912

Val?Gly?Ala?Ala?Leu?Ala?Gly?Leu?Asp?Met?Ser?Met?Pro?Gly?Asp?Val

290 295 300

acc?ttc?gat?agt?ggt?acg?tct?ttc?tgg?ggt?gca?aac?ttg?acg?gtc?ggt 960

Thr?Phe?Asp?Ser?Gly?Thr?Ser?Phe?Trp?Gly?Ala?Asn?Leu?Thr?Val?Gly

305 310 315 320

gtc?ctt?aac?ggt?aca?atc?ccc?caa?tgg?cgt?gtt?gat?gac?atg?gct?gtc 1008

Val?Leu?Asn?Gly?Thr?Ile?Pro?Gln?Trp?Arg?Val?Asp?Asp?Met?Ala?Val

325 330 335

cgt?atc?atg?gcc?gct?tat?taca?ag?gtt?ggc?cgc?gac?acc?aaa?tac?acc 1056

Arg?Ile?Met?Ala?Ala?Tyr?Tyr?Lys?Val?Gly?Arg?Asp?Thr?Lys?Tyr?Thr

340 345 350

cct?ccc?aac?ttc?agc?tcg?tgg?acc?agg?gac?gaa?tat?ggt?ttc?gcg?cat 1104

Pro?Pro?Asn?Phe?Ser?Ser?Trp?Thr?Arg?Asp?Glu?Tyr?Gly?Phe?Ala?His

355 360 365

aac?cat?gtt?tcg?gaa?ggt?gct?tac?gag?agg?gtc?aac?gaa?ttc?gtg?gac 1152

Asn?His?Val?Ser?Glu?Gly?Ala?Tyr?Glu?Arg?Val?Asn?Glu?Phe?Val?Asp

370 375 380

gtg?caa?cgc?gat?cat?gcc?gac?cta?atc?cgt?cgc?atc?ggc?gcg?cag?agc 1200

Val?Gln?Arg?Asp?His?Ala?Asp?Leu?Ile?Arg?Arg?Ile?Gly?Ala?Gln?Ser

385 390 395 400

act?gtt?ctg?ctg?aag?aac?aag?ggt?gcc?ttg?ccc?ttg?agc?cgc?aag?gaa 1248

Thr?Val?Leu?Leu?Lys?Asn?Lys?Gly?Ala?Leu?Pro?Leu?Ser?Arg?Lys?Glu

405 410 415

aag?ctg?gtc?gcc?ctt?ctg?gga?gag?gat?gcg?ggt?tcc?aac?tcg?tgg?ggc 1296

Lys?Leu?Val?Ala?Leu?Leu?Gly?Glu?Asp?Ala?Gly?Ser?Asn?Ser?Trp?Gly

420 425 430

gct?aac?ggc?tgt?gat?gac?cgt?ggt?tgc?gat?aac?ggt?acc?ctt?gcc?atg 1344

Ala?Asn?Gly?Cys?Asp?Asp?Arg?Gly?Cys?Asp?Asn?Gly?Thr?Leu?Ala?Met

435 440 445

gcc?tgg?ggt?agc?ggt?act?gcg?aat?ttc?cca?tac?ctc?gtg?aca?cca?gag 1392

Ala?Trp?Gly?Ser?Gly?Thr?Ala?Asn?Phe?Pro?Tyr?Leu?Val?Thr?Pro?Glu

450 455 460

cag?gcg?att?cag?aac?gaa?gtt?ctt?cag?ggc?cgt?ggt?aat?gtc?ttc?gcc 1440

Gln?Ala?Ile?Gln?Asn?Glu?Val?Leu?Gln?Gly?Arg?Gly?Asn?Val?Phe?Ala

465 470 475 480

gtg?acc?gac?agt?tgg?gcg?ctc?gac?aag?atc?gct?gcg?gct?gcc?cgc?cag 1488

Val?Thr?Asp?Ser?Trp?Ala?Leu?Asp?Lys?Ile?Ala?Ala?Ala?Ala?Arg?Gln

485 490 495

gcc?agc?gta?tct?ctc?gtg?ttc?gtc?aac?tcc?gac?tca?gga?gaa?ggc?tat 1536

Ala?Ser?Val?Ser?Leu?Val?Phe?Val?Asn?Ser?Asp?Ser?Gly?Glu?Gly?Tyr

500 505 510

ctt?agt?gtg?gat?gga?aat?gag?ggc?gat?cgt?aac?aac?atc?act?ctg?tgg 1584

Leu?Ser?Val?Asp?Gly?Asn?Glu?Gly?Asp?Arg?Asn?Asn?Ile?Thr?Leu?Trp

515 520 525

aag?aac?ggc?gac?aat?gtg?gtc?aag?acc?gca?gcg?aat?aac?tgt?aac?aac 1632

Lys?Asn?Gly?Asp?Asn?Val?Val?Lys?Thr?Ala?Ala?Asn?Asn?Cys?Asn?Asn

530 535 540

acc?gtt?gtc?atc?atc?cac?tcc?gtc?gga?cca?gtt?ttg?atc?gat?gaa?tgg 1680

Thr?Val?Val?Ile?Ile?His?Ser?Val?Gly?Pro?Val?Leu?Ile?Asp?Glu?Trp

545 550 555 560

tat?gac?cac?ccc?aat?gtc?act?ggt?att?ctc?tgg?gct?ggt?ctg?cca?ggc 1728

Tyr?Asp?His?Pro?Asn?Val?Thr?Gly?Ile?Leu?Trp?Ala?Gly?Leu?Pro?Gly

565 570 575

cag?gag?tct?ggt?aac?tcc?att?gcc?gat?gtg?ctg?tac?ggt?cgt?gtc?aac 1776

Gln?Glu?Ser?Gly?Asn?Ser?Ile?Ala?Asp?Val?Leu?Tyr?Gly?Arg?Val?Asn

580 585 590

cct?ggc?gcc?aag?tct?cct?ttc?act?tgg?ggc?aag?acc?cgg?gag?tcg?tat 1824

Pro?Gly?Ala?Lys?Ser?Pro?Phe?Thr?Trp?Gly?Lys?Thr?Arg?Glu?Ser?Tyr

595 600 605

ggt?tct?ccc?ttg?gtc?aag?gat?gcc?aac?aat?ggc?aac?gga?gcg?ccc?cag 1872

Gly?Ser?Pro?Leu?Val?Lys?Asp?Ala?Asn?Asn?Gly?Asn?Gly?Ala?Pro?Gln

610 615 620

tct?gat?ttc?acc?cag?ggt?gtt?ttc?atc?gat?tac?cgc?cat?ttc?gat?aag 1920

Ser?Asp?Phe?Thr?Gln?Gly?Val?Phe?Ile?Asp?Tyr?Arg?His?Phe?Asp?Lys

625 630 635 640

ttc?aat?gag?acc?cct?atc?tac?gag?ttt?ggc?tac?ggc?ttg?agc?tac?acc 1968

Phe?Asn?Glu?Thr?Pro?Ile?Tyr?Glu?Phe?Gly?Tyr?Gly?Leu?Ser?Tyr?Thr

645 650 655

acc?ttc?gag?ctc?tcc?gac?ctc?cat?gtt?cag?ccc?ctg?aac?gcg?tcc?cga 2016

Thr?Phe?Glu?Leu?Ser?Asp?Leu?His?Val?Gln?Pro?Leu?Asn?Ala?Ser?Arg

660 665 670

tac?act?ccc?acc?agt?ggc?atg?act?gaa?gct?gca?aag?aac?ttt?ggt?gaa 2064

Tyr?Thr?Pro?Thr?Ser?Gly?Met?Thr?Glu?Ala?Ala?Lys?Asn?Phe?Gly?Glu

675 680 685

att?ggc?gat?gcg?tcg?gag?tac?gtg?tat?ccg?gag?ggg?ctg?gaa?agg?atc 2112

Ile?Gly?Asp?Ala?Ser?Glu?Tyr?Val?Tyr?Pro?Glu?Gly?Leu?Glu?Arg?Ile

690 695 700

cat?gag?ttt?atc?tat?ccc?tgg?atc?aac?tct?acc?gac?ctg?aag?gca?tcg 2160

His?Glu?Phe?Ile?Tyr?Pro?Trp?Ile?Asn?Ser?Thr?Asp?Leu?Lys?Ala?Ser

705 710 715 720

tct?gac?gat?tct?aac?tac?ggc?tgg?gaa?gac?tcc?aag?tat?att?ccc?gaa 2208

Ser?Asp?Asp?Ser?Asn?Tyr?Gly?Trp?Glu?Asp?Ser?Lys?Tyr?Ile?Pro?Glu

725 730 735

ggc?gcc?acg?gat?ggg?tct?gcc?cag?ccc?cgt?ttg?ccc?get?agt?ggt?ggt 2256

Gly?Ala?Thr?Asp?Gly?Ser?Ala?Gln?Pro?Arg?Leu?Pro?Ala?Ser?Gly?Gly

740 745 750

gcc?gga?gga?aac?ccc?ggt?ctg?tac?gag?gat?ctt?ttc?cgc?gtc?tct?gtg 2304

Ala?Gly?Gly?Asn?Pro?Gly?Leu?Tyr?Glu?Asp?Leu?Phe?Arg?Val?Ser?Val

755 760 765

aag?gtc?aag?aac?acg?ggc?aat?gtc?gcc?ggt?gat?gaa?gtt?cct?cag?ctg 2352

Lys?Val?Lys?Asn?Thr?Gly?Asn?Val?Ala?Gly?Asp?Glu?Val?Pro?Gln?Leu

770 775 780

tac?gtt?tcc?cta?ggc?ggc?ccg?aat?gag?ccc?aag?gtg?gta?ctg?cgc?aag 2400

Tyr?Val?Ser?Leu?Gly?Gly?Pro?Asn?Glu?Pro?Lys?Val?Val?Leu?Arg?Lys

785 790 795 800

ttt?gag?cgt?att?cac?ttg?gcc?cct?tcg?cag?gag?gcc?gtg?tgg?aca?acg 2448

Phe?Glu?Arg?Ile?His?Leu?Ala?Pro?Ser?Gln?Glu?Ala?Val?Trp?Thr?Thr

805 810 815

acc?ctt?acc?cgt?cgt?gac?ctt?gca?aac?tgg?gac?gtt?tcg?gct?cag?gac 2496

Thr?Leu?Thr?Arg?Arg?Asp?Leu?Ala?Asn?Trp?Asp?Val?Ser?Ala?Gln?Asp

820 825 830

tgg?acc?gtc?act?cct?tac?ccc?aag?acg?atc?tac?gtt?gga?aac?tcc?tca 2544

Trp?Thr?Val?Thr?Pro?Tyr?Pro?Lys?Thr?Ile?Tyr?Val?Gly?Asn?Ser?Ser

835 840 845

cgg?aaa?ctg?ccg?ctc?cag?gcc?tcg?ctg?cct?aag?gcc?cag?taa 2586

Arg?Lys?Leu?Pro?Leu?Gln?Ala?Ser?Leu?Pro?Lys?Ala?Gln

850 855 860

 

<210>43

<211>861

<212>PRT

＜213〉aspergillus oryzae (Aspergillus oryzae)

 

<400>43

 

Met?Lys?Leu?Gly?Trp?Ile?Glu?Val?Ala?Ala?Leu?Ala?Ala?Ala?Ser?Val

1 5 10 15

Val?Ser?Ala?Lys?Asp?Asp?Leu?Ala?Tyr?Ser?Pro?Pro?Phe?Tyr?Pro?Ser

20 25 30

Pro?Trp?Ala?Asp?Gly?Gln?Gly?Glu?Trp?Ala?Glu?Val?Tyr?Lys?Arg?Ala

35 40 45

Val?Asp?Ile?Val?Ser?Gln?Met?Thr?Leu?Thr?Glu?Lys?Val?Asn?Leu?Thr

50 55 60

Thr?Gly?Thr?Gly?Trp?Gln?Leu?Glu?Arg?Cys?Val?Gly?Gln?Thr?Gly?Ser

65 70 75 80

Val?Pro?Arg?Leu?Asn?Ile?Pro?Ser?Leu?Cys?Leu?Gln?Asp?Ser?Pro?Leu

85 90 95

Gly?Ile?Arg?Phe?Ser?Asp?Tyr?Asn?Ser?Ala?Phe?Pro?Ala?Gly?Val?Asn

100 105 110

Val?Ala?Ala?Thr?Trp?Asp?Lys?Thr?Leu?Ala?Tyr?Leu?Arg?Gly?Gln?Ala

115 120 125

Met?Gly?Glu?Glu?Phe?Ser?Asp?Lys?Gly?Ile?Asp?Val?Gln?Leu?Gly?Pro

130 135 140

Ala?Ala?Gly?Pro?Leu?Gly?Ala?His?Pro?Asp?Gly?Gly?Arg?Asn?Trp?Glu

145 150 155 160

Gly?Phe?Ser?Pro?Asp?Pro?Ala?Leu?Thr?Gly?Val?Leu?Phe?Ala?Glu?Thr

165 170 175

Ile?Lys?Gly?Ile?Gln?Asp?Ala?Gly?Val?Ile?Ala?Thr?Ala?Lys?His?Tyr

180 185 190

Ile?Met?Asn?Glu?Gln?Glu?His?Phe?Arg?Gln?Gln?Pro?Glu?Ala?Ala?Gly

195 200 205

Tyr?Gly?Phe?Asn?Val?Ser?Asp?Ser?Leu?Ser?Ser?Asn?Val?Asp?Asp?Lys

210 215 220

Thr?Met?His?Glu?Leu?Tyr?Leu?Trp?Pro?Phe?Ala?Asp?Ala?Val?Arg?Ala

225 230 235 240

Gly?Val?Gly?Ala?Val?Met?Cys?Ser?Tyr?Asn?Gln?Ile?Asn?Asn?Ser?Tyr

245 250 255

Gly?Cys?Glu?Asn?Ser?Glu?Thr?Leu?Asn?Lys?Leu?Leu?Lys?Ala?Glu?Leu

260 265 270

Gly?Phe?Gln?Gly?Phe?Val?Met?Ser?Asp?Trp?Thr?Ala?His?His?Ser?Gly

275 280 285

Val?Gly?Ala?Ala?Leu?Ala?Gly?Leu?Asp?Met?Ser?Met?Pro?Gly?Asp?Val

290 295 300

Thr?Phe?Asp?Ser?Gly?Thr?Ser?Phe?Trp?Gly?Ala?Asn?Leu?Thr?Val?Gly

305 310 315 320

Val?Leu?Asn?Gly?Thr?Ile?Pro?Gln?Trp?Arg?Val?Asp?Asp?Met?Ala?Val

325 330 335

Arg?Ile?Met?Ala?Ala?Tyr?Tyr?Lys?Val?Gly?Arg?Asp?Thr?Lys?Tyr?Thr

340 345 350

Pro?Pro?Asn?Phe?Ser?Ser?Trp?Thr?Arg?Asp?Glu?Tyr?Gly?Phe?Ala?His

355 360 365

Asn?His?Val?Ser?Glu?Gly?Ala?Tyr?Glu?Arg?Val?Asn?Glu?Phe?Val?Asp

370 375 380

Val?Gln?Arg?Asp?His?Ala?Asp?Leu?Ile?Arg?Arg?Ile?Gly?Ala?Gln?Ser

385 390 395 400

Thr?Val?Leu?Leu?Lys?Asn?Lys?Gly?Ala?Leu?Pro?Leu?Ser?Arg?Lys?Glu

405 410 415

Lys?Leu?Val?Ala?Leu?Leu?Gly?Glu?Asp?Ala?Gly?Ser?Asn?Ser?Trp?Gly

420 425 430

Ala?Asn?Gly?Cys?Asp?Asp?Arg?Gly?Cys?Asp?Asn?Gly?Thr?Leu?Ala?Met

435 440 445

Ala?Trp?Gly?Ser?Gly?Thr?Ala?Asn?Phe?Pro?Tyr?Leu?Val?Thr?Pro?Glu

450 455 460

Gln?Ala?Ile?Gln?Asn?Glu?Val?Leu?Gln?Gly?Arg?Gly?Asn?Val?Phe?Ala

465 470 475 480

Val?Thr?Asp?Ser?Trp?Ala?Leu?Asp?Lys?Ile?Ala?Ala?Ala?Ala?Arg?Gln

485 490 495

Ala?Ser?Val?Ser?Leu?Val?Phe?Val?Asn?Ser?Asp?Ser?Gly?Glu?Gly?Tyr

500 505 510

Leu?Ser?Val?Asp?Gly?Asn?Glu?Gly?Asp?Arg?Asn?Asn?Ile?Thr?Leu?Trp

515 520 525

Lys?Asn?Gly?Asp?Asn?Val?Val?Lys?Thr?Ala?Ala?Asn?Asn?Cys?Asn?Asn

530 535 540

Thr?Val?Val?Ile?Ile?His?Ser?Val?Gly?Pro?Val?Leu?Ile?Asp?Glu?Trp

545 550 555 560

Tyr?Asp?His?Pro?Asn?Val?Thr?Gly?Ile?Leu?Trp?Ala?Gly?Leu?Pro?Gly

565 570 575

Gln?Glu?Ser?Gly?Asn?Ser?Ile?Ala?Asp?Val?Leu?Tyr?Gly?Arg?Val?Asn

580 585 590

Pro?Gly?Ala?Lys?Ser?Pro?Phe?Thr?Trp?Gly?Lys?Thr?Arg?Glu?Ser?Tyr

595 600 605

Gly?Ser?Pro?Leu?Val?Lys?Asp?Ala?Asn?Asn?Gly?Asn?Gly?Ala?Pro?Gln

610 615 620

Ser?Asp?Phe?Thr?Gln?Gly?Val?Phe?Ile?Asp?Tyr?Arg?His?Phe?Asp?Lys

625 630 635 640

Phe?Asn?Glu?Thr?Pro?Ile?Tyr?Glu?Phe?Gly?Tyr?Gly?Leu?Ser?Tyr?Thr

645 650 655

Thr?Phe?Glu?Leu?Ser?Asp?Leu?His?Val?Gln?Pro?Leu?Asn?Ala?Ser?Arg

660 665 670

Tyr?Thr?Pro?Thr?Ser?Gly?Met?Thr?Glu?Ala?Ala?Lys?Asn?Phe?Gly?Glu

675 680 685

Ile?Gly?Asp?Ala?Ser?Glu?Tyr?Val?Tyr?Pro?Glu?Gly?Leu?Glu?Arg?Ile

690 695 700

His?Glu?Phe?Ile?Tyr?Pro?Trp?Ile?Asn?Ser?Thr?Asp?Leu?Lys?Ala?Ser

705 710 715 720

Ser?Asp?Asp?Ser?Asn?Tyr?Gly?Trp?Glu?Asp?Ser?Lys?Tyr?Ile?Pro?Glu

725 730 735

Gly?Ala?Thr?Asp?Gly?Ser?Ala?Gln?Pro?Arg?Leu?Pro?Ala?Ser?Gly?Gly

740 745 750

Ala?Gly?Gly?Asn?Pro?Gly?Leu?Tyr?Glu?Asp?Leu?Phe?Arg?Val?Ser?Val

755 760 765

Lys?Val?Lys?Asn?Thr?Gly?Asn?Val?Ala?Gly?Asp?Glu?Val?Pro?Gln?Leu

770 775 780

Tyr?Val?Ser?Leu?Gly?Gly?Pro?Asn?Glu?Pro?Lys?Val?Val?Leu?Arg?Lys

785 790 795 800

Phe?Glu?Arg?Ile?His?Leu?Ala?Pro?Ser?Gln?Glu?Ala?Val?Trp?Thr?Thr

805 810 815

Thr?Leu?Thr?Arg?Arg?Asp?Leu?Ala?Asn?Trp?Asp?Val?Ser?Ala?Gln?Asp

820 825 830

Trp?Thr?Val?Thr?Pro?Tyr?Pro?Lys?Thr?Ile?Tyr?Val?Gly?Asn?Ser?Ser

835 840 845

Arg?Lys?Leu?Pro?Leu?Gln?Ala?Ser?Leu?Pro?Lys?Ala?Gln

850 855 860

 

<210>44

<211>31

<212>DNA

＜213〉Aspergillus fumigatus (Aspergillus fumigatus)

 

<400>44

actggattta?ccatgagatt?cggttggctc?g 31

 

<210>45

<211>31

<212>DNA

＜213〉Aspergillus fumigatus (Aspergillus fumigatus)

 

<400>45

agtcacctct?agttactagtagacacgggg?c 31

 

<210>46

<211>3060

<212>DNA

＜213〉Aspergillus fumigatus (Aspergillus fumigatus)

 

<400>46

atgagattcg?gttggctcga?ggtggccgct?ctgacggccg?cttctgtagc?caatgcccag 60

gtttgtgatg?ctttcccgtc?attgtttcgg?atatagttga?caatagtcat?ggaaataatc 120

aggaattggc?tttctctcca?ccattctacc?cttcgccttg?ggctgatggc?cagggagagt 180

gggcagatgc?ccatcgacgc?gccgtcgaga?tcgtttctca?gatgacactg?gcggagaagg 240

ttaaccttac?aacgggtact?gggtgggttg?cgactttttt?gttgacagtg?agctttcttc 300

actgaccatc?tacacagatg?ggaaatggac?cgatgcgtcg?gtcaaaccgg?cagcgttccc 360

aggtaagctt?gcaattctgc?aacaacgtgc?aagtgtagtt?gctaaaacgc?ggtggtgcag 420

acttggtatc?aactggggtc?tttgtggcca?ggattcccct?ttgggtatcc?gtttctgtga 480

gctatacccg?cggagtcttt?cagtccttgt?attatgtgct?gatgattgtc?tctgtatagc 540

tgacctcaac?tccgccttcc?ctgctggtac?taatgtcgcc?gcgacatggg?acaagacact 600

cgcctacctt?cgtggcaagg?ccatgggtga?ggaattcaac?gacaagggcg?tggacatttt 660

gctggggcct?gctgctggtc?ctctcggcaa?atacccggac?ggcggcagaa?tctgggaagg 720

cttctctcct?gatccggttc?tcactggtgt?acttttcgcc?gaaactatca?agggtatcca 780

agacgcgggt?gtgattgcta?ctgccaagca?ttacattctg?aatgaacagg?agcatttccg 840

acaggttggc?gaggcccagg?gatatggtta?caacatcacg?gagacgatca?gctccaacgt 900

ggatgacaag?accatgcacg?agttgtacct?ttggtgagta?gttgacactg?caaatgagga 960

ccttgattga?tttgactgac?ctggaatgca?ggccctttgc?agatgctgtg?cgcggtaaga 1020

ttttccgtag?acttgacctc?gcgacgaaga?aatcgctgac?gaaccatcgt?agctggcgtt 1080

ggcgctgtca?tgtgttccta?caatcaaatc?aacaacagct?acggttgtca?aaacagtcaa 1140

actctcaaca?agctcctcaa?ggctgagctg?ggcttccaag?gcttcgtcat?gagtgactgg 1200

agcgctcacc?acagcggtgt?cggcgctgcc?ctcgctgggt?tggatatgtc?gatgcctgga 1260

gacatttcct?tcgacgacgg?actctccttc?tggggcacga?acctaactgt?cagtgttctt 1320

aacggcaccg?ttccagcctg?gcgtgtcgat?gacatggctg?ttcgtatcat?gaccgcgtac 1380

tacaaggttg?gtcgtgaccg?tcttcgtatt?ccccctaact?tcagctcctg?gacccgggat 1440

gagtacggct?gggagcattc?tgctgtctcc?gagggagcct?ggaccaaggt?gaacgacttc 1500

gtcaatgtgc?agcgcagtca?ctctcagatc?atccgtgaga?ttggtgccgc?tagtacagtg 1560

ctcttgaaga?acacgggtgc?tcttcctttg?accggcaagg?aggttaaagt?gggtgttctc 1620

ggtgaagacg?ctggttccaa?cccgtggggt?gctaacggct?gccccgaccg?cggctgtgat 1680

aacggcactc?ttgctatggc?ctggggtagt?ggtactgcca?acttccctta?ccttgtcacc 1740

cccgagcagg?ctatccagcg?agaggtcatc?agcaacggcg?gcaatgtctt?tgctgtgact 1800

gataacgggg?ctctcagcca?gatggcagat?gttgcatctc?aatccaggtg?agtgcgggct 1860

cttagaaaaa?gaacgttctc?tgaatgaagt?tttttaacca?ttgcgaacag?cgtgtctttg 1920

gtgtttgtca?acgccgactc?tggagagggt?ttcatcagtg?tcgacggcaa?cgagggtgac 1980

cgcaaaaatc?tcactctgtg?gaagaacggc?gaggccgtca?ttgacactgt?tgtcagccac 2040

tgcaacaaca?cgattgtggt?tattcacagt?gttgggcccg?tcttgatcga?ccggtggtat 2100

gataacccca?acgtcactgc?catcatctgg?gccggcttgc?ccggtcagga?gagtggcaac 2160

tccctggtcg?acgtgctcta?tggccgcgtc?aaccccagcg?ccaagacccc?gttcacctgg 2220

ggcaagactc?gggagtctta?cggggctccc?ttgctcaccg?agcctaacaa?tggcaatggt 2280

gctccccagg?atgatttcaa?cgagggcgtc?ttcattgact?accgtcactt?tgacaagcgc 2340

aatgagaccc?ccatttatga?gtttggccat?ggcttgagct?acaccacctt?tggttactct 2400

caccttcggg?ttcaggccct?caatagttcg?agttcggcat?atgtcccgac?tagcggagag 2460

accaagcctg?cgccaaccta?tggtgagatc?ggtagtgccg?ccgactacct?gtatcccgag 2520

ggtctcaaaa?gaattaccaa?gtttatttac?ccttggctca?actcgaccga?cctcgaggat 2580

tcttctgacg?acccgaacta?cggctgggag?gactcggagt?acattcccga?aggcgctagg 2640

gatgggtctc?ctcaacccct?cctgaaggct?ggcggcgctc?ctggtggtaa?ccctaccctt 2700

tatcaggatc?ttgttagggt?gtcggccacc?ataaccaaca?ctggtaacgt?cgccggttat 2760

gaagtccctc?aattggtgag?tgacccgcat?gttccttgcg?ttgcaatttg?gctaactcgc 2820

ttctagtatg?tttcactggg?cggaccgaac?gagcctcggg?tcgttctgcg?caagttcgac 2880

cgaatcttcc?tggctcctgg?ggagcaaaag?gtttggacca?cgactcttaa?ccgtcgtgat 2940

ctcgccaatt?gggatgtgga?ggctcaggac?tgggtcatca?caaagtaccc?caagaaagtg 3000

cacgtcggca?gctcctcgcg?taagctgcct?ctgagagcgc?ctctgccccg?tgtctactag 3060

 

<210>47

<211>863

<212>PRT

＜213〉Aspergillus fumigatus (Aspergillus fumigatus)

 

<400>47

 

Met?Arg?Phe?Gly?Trp?Leu?Glu?Val?Ala?Ala?Leu?Thr?Ala?Ala?Ser?Val

1 5 10 15

Ala?Asn?Ala?Gln?Glu?Leu?Ala?Phe?Ser?Pro?Pro?Phe?Tyr?Pro?Ser?Pro

20 25 30

Trp?Ala?Asp?Gly?Gln?Gly?Glu?Trp?Ala?Asp?Ala?His?Arg?Arg?Ala?Val

35 40 45

Glu?Ile?Val?Ser?Gln?Met?Thr?Leu?Ala?Glu?Lys?Val?Asn?Leu?Thr?Thr

50 55 60

Gly?Thr?Gly?Trp?Glu?Met?Asp?Arg?Cys?Val?Gly?Gln?Thr?Gly?Ser?Val

65 70 75 80

Pro?Arg?Leu?Gly?Ile?Asn?Trp?Gly?Leu?Cys?Gly?Gln?Asp?Ser?Pro?Leu

85 90 95

Gly?Ile?Arg?Phe?Ser?Asp?Leu?Asn?Ser?Ala?Phe?Pro?Ala?Gly?Thr?Asn

100 105 110

Val?Ala?Ala?Thr?Trp?Asp?Lys?Thr?Leu?Ala?Tyr?Leu?Arg?Gly?Lys?Ala

115 120 125

Met?Gly?Glu?Glu?Phe?Asn?Asp?Lys?Gly?Val?Asp?Ile?Leu?Leu?Gly?Pro

130 135 140

Ala?Ala?Gly?Pro?Leu?Gly?Lys?Tyr?Pro?Asp?Gly?Gly?Arg?Ile?Trp?Glu

145 150 155 160

Gly?Phe?Ser?Pro?Asp?Pro?Val?Leu?Thr?Gly?Val?Leu?Phe?Ala?Glu?Thr

165 170 175

Ile?Lys?Gly?Ile?Gln?Asp?Ala?Gly?Val?Ile?Ala?Thr?Ala?Lys?His?Tyr

180 185 190

Ile?Leu?Asn?Glu?Gln?Glu?His?Phe?Arg?Gln?Val?Gly?Glu?Ala?Gln?Gly

195 200 205

Tyr?Gly?Tyr?Asn?Ile?Thr?Glu?Thr?Ile?Ser?Ser?Asn?Val?Asp?Asp?Lys

210 215 220

Thr?Met?His?Glu?Leu?Tyr?Leu?Trp?Pro?Phe?Ala?Asp?Ala?Val?Arg?Ala

225 230 235 240

Gly?Val?Gly?Ala?Val?Met?Cys?Ser?Tyr?Asn?Gln?Ile?Asn?Asn?Ser?Tyr

245 250 255

Gly?Cys?Gln?Asn?Ser?Gln?Thr?Leu?Asn?Lys?Leu?Leu?Lys?Ala?Glu?Leu

260 265 270

Gly?Phe?Gln?Gly?Phe?Val?Met?Ser?Asp?Trp?Ser?Ala?His?His?Ser?Gly

275 280 285

Val?Gly?Ala?Ala?Leu?Ala?Gly?Leu?Asp?Met?Ser?Met?Pro?Gly?Asp?Ile

290 295 300

Ser?Phe?Asp?Asp?Gly?Leu?Ser?Phe?Trp?Gly?Thr?Asn?Leu?Thr?Val?Ser

305 310 315 320

Val?Leu?Asn?Gly?Thr?Val?Pro?Ala?Trp?Arg?Val?Asp?Asp?Met?Ala?Val

325 330 335

Arg?Ile?Met?Thr?Ala?Tyr?Tyr?Lys?Val?Gly?Arg?Asp?Arg?Leu?Arg?Ile

340 345 350

Pro?Pro?Asn?Phe?Ser?Ser?Trp?Thr?Arg?Asp?Glu?Tyr?Gly?Trp?Glu?His

355 360 365

Ser?Ala?Val?Ser?Glu?Gly?Ala?Trp?Thr?Lys?Val?Asn?Asp?Phe?Val?Asn

370 375 380

Val?Gln?Arg?Ser?His?Ser?Gln?Ile?Ile?Arg?Glu?Ile?Gly?Ala?Ala?Ser

385 390 395 400

Thr?Val?Leu?Leu?Lys?Asn?Thr?Gly?Ala?Leu?Pro?Leu?Thr?Gly?Lys?Glu

405 410 415

Val?Lys?Val?Gly?Val?Leu?Gly?Glu?Asp?Ala?Gly?Ser?Asn?Pro?Trp?Gly

420 425 430

Ala?Asn?Gly?Cys?Pro?Asp?Arg?Gly?Cys?Asp?Asn?Gly?Thr?Leu?Ala?Met

435 440 445

Ala?Trp?Gly?Ser?Gly?Thr?Ala?Asn?Phe?Pro?Tyr?Leu?Val?Thr?Pro?Glu

450 455 460

Gln?Ala?Ile?Gln?Arg?Glu?Val?Ile?Ser?Asn?Gly?Gly?Asn?Val?Phe?Ala

465 470 475 480

Val?Thr?Asp?Asn?Gly?Ala?Leu?Ser?Gln?Met?Ala?Asp?Val?Ala?Ser?Gln

485 490 495

Ser?Ser?Val?Ser?Leu?Val?Phe?Val?Asn?Ala?Asp?Ser?Gly?Glu?Gly?Phe

500 505 510

Ile?Ser?Val?Asp?Gly?Asn?Glu?Gly?Asp?Arg?Lys?Asn?Leu?Thr?Leu?Trp

515 520 525

Lys?Asn?Gly?Glu?Ala?Val?Ile?Asp?Thr?Val?Val?Ser?His?Cys?Asn?Asn

530 535 540

Thr?Ile?Val?Val?Ile?His?Ser?Val?Gly?Pro?Val?Leu?Ile?Asp?Arg?Trp

545 550 555 560

Tyr?Asp?Asn?Pro?Asn?Val?Thr?Ala?Ile?Ile?Trp?Ala?Gly?Leu?Pro?Gly

565 570 575

Gln?Glu?Ser?Gly?Asn?Ser?Leu?Val?Asp?Val?Leu?Tyr?Gly?Arg?Val?Asn

580 585 590

Pro?Ser?Ala?Lys?Thr?Pro?Phe?Thr?Trp?Gly?Lys?Thr?Arg?Glu?Ser?Tyr

595 600 605

Gly?Ala?Pro?Leu?Leu?Thr?Glu?Pro?Asn?Asn?Gly?Asn?Gly?Ala?Pro?Gln

610 615 620

Asp?Asp?Phe?Asn?Glu?Gly?Val?Phe?Ile?Asp?Tyr?Arg?His?Phe?Asp?Lys

625 630 635 640

Arg?Asn?Glu?Thr?Pro?Ile?Tyr?Glu?Phe?Gly?His?Gly?Leu?Ser?Tyr?Thr

645 650 655

Thr?Phe?Gly?Tyr?Ser?His?Leu?Arg?Val?Gln?Ala?Leu?Asn?Ser?Ser?Ser

660 665 670

Ser?Ala?Tyr?Val?Pro?Thr?Ser?Gly?Glu?Thr?Lys?Pro?Ala?Pro?Thr?Tyr

675 680 685

Gly?Glu?Ile?Gly?Ser?Ala?Ala?Asp?Tyr?Leu?Tyr?Pro?Glu?Gly?Leu?Lys

690 695 700

Arg?Ile?Thr?Lys?Phe?Ile?Tyr?Pro?Trp?Leu?Asn?Ser?Thr?Asp?Leu?Glu

705 710 715 720

Asp?Ser?Ser?Asp?Asp?Pro?Asn?Tyr?Gly?Trp?Glu?Asp?Ser?Glu?Tyr?Ile

725 730 735

Pro?Glu?Gly?Ala?Arg?Asp?Gly?Ser?Pro?Gln?Pro?Leu?Leu?Lys?Ala?Gly

740 745 750

Gly?Ala?Pro?Gly?Gly?Asn?Pro?Thr?Leu?Tyr?Gln?Asp?Leu?Val?Arg?Val

755 760 765

Ser?Ala?Thr?Ile?Thr?Asn?Thr?Gly?Asn?Val?Ala?Gly?Tyr?Glu?Val?Pro

770 775 780

Gln?Leu?Tyr?Val?Ser?Leu?Gly?Gly?Pro?Asn?Glu?Pro?Arg?Val?Val?Leu

785 790 795 800

Arg?Lys?Phe?Asp?Arg?Ile?Phe?Leu?Ala?Pro?Gly?Glu?Gln?Lys?Val?Trp

805 810 815

Thr?Thr?Thr?Leu?Asn?Arg?Arg?Asp?Leu?Ala?Asn?Trp?Asp?Val?Glu?Ala

820 825 830

Gln?Asp?Trp?Val?Ile?Thr?Lys?Tyr?Pro?Lys?Lys?Val?His?Val?Gly?Ser

835 840 845

Ser?Ser?Arg?Lys?Leu?Pro?Leu?Arg?Ala?Pro?Leu?Pro?Arg?Val?Tyr

850 855 860

 

<210>48

<211>2592

<212>DNA

＜213〉Aspergillus fumigatus (Aspergillus fumigatus)

 

<400>48

atgagattcg?gttggctcga?ggtggccgct?ctgacggccg?cttctgtagc?caatgcccag 60

gaattggctt?tctctccacc?attctaccct?tcgccttggg?ctgatggcca?gggagagtgg 120

gcagatgccc?atcgacgcgc?cgtcgagatc?gtttctcaga?tgacactggc?ggagaaggtt 180

aaccttacaa?cgggtactgg?atgggaaatg?gaccgatgcg?tcggtcaaac?cggcagcgtt 240

cccagacttg?gtatcaactg?gggtctttgt?ggccaggatt?cccctttggg?tatccgtttc 300

tctgacctca?actccgcctt?ccctgctggt?actaatgtcg?ccgcgacatg?ggacaagaca 360

ctcgcctacc?ttcgtggcaa?ggccatgggt?gaggaattca?acgacaaggg?cgtggacatt 420

ttgctggggc?ctgctgctgg?tcctctcggc?aaatacccgg?acggcggcag?aatctgggaa 480

ggcttctctc?ctgatccggt?tctcactggt?gtacttttcg?ccgaaactat?caagggtatc 540

caagacgcgg?gtgtgattgc?tactgccaag?cattacattc?tgaatgaaca?ggagcatttc 600

cgacaggttg?gcgaggccca?gggatatggt?tacaacatca?cggagacgat?cagctccaac 660

gtggatgaca?agaccatgca?cgagttgtac?ctttggccct?ttgcagatgc?tgtgcgcgct 720

ggcgttggcg?ctgtcatgtg?ttcctacaat?caaatcaaca?acagctacgg?ttgtcaaaac 780

agtcaaactc?tcaacaagct?cctcaaggct?gagctgggct?tccaaggctt?cgtcatgagt 840

gactggagcg?ctcaccacag?cggtgtcggc?gctgccctcg?ctgggttgga?tatgtcgatg 900

cctggagaca?tttccttcga?cgacggactc?tccttctggg?gcacgaacct?aactgtcagt 960

gttcttaacg?gcaccgttcc?agcctggcgt?gtcgatgaca?tggctgttcg?tatcatgacc 1020

gcgtactaca?aggttggtcg?tgaccgtctt?cgtattcccc?ctaacttcag?ctcctggacc 1080

cgggatgagt?acggctggga?gcattctgct?gtctccgagg?gagcctggac?caaggtgaac 1140

gacttcgtca?atgtgcagcg?cagtcactct?cagatcatcc?gtgagattgg?tgccgctagt 1200

acagtgctct?tgaagaacac?gggtgctctt?cctttgaccg?gcaaggaggt?taaagtgggt 1260

gttctcggtg?aagacgctgg?ttccaacccg?tggggtgcta?acggctgccc?cgaccgcggc 1320

tgtgataacg?gcactcttgc?tatggcctgg?ggtagtggta?ctgccaactt?cccttacctt 1380

gtcacccccg?agcaggctat?ccagcgagag?gtcatcagca?acggcggcaa?tgtctttgct 1440

gtgactgata?acggggctct?cagccagatg?gcagatgttg?catctcaatc?cagcgtgtct 1500

ttggtgtttg?tcaacgccga?ctctggagag?ggtttcatca?gtgtcgacgg?caacgagggt 1560

gaccgcaaaa?atctcactct?gtggaagaac?ggcgaggccg?tcattgacac?tgttgtcagc 1620

cactgcaaca?acacgattgt?ggttattcac?agtgttgggc?ccgtcttgat?cgaccggtgg 1680

tatgataacc?ccaacgtcac?tgccatcatc?tgggccggct?tgcccggtca?ggagagtggc 1740

aactccctgg?tcgacgtgct?ctatggccgc?gtcaacccca?gcgccaagac?cccgttcacc 1800

tggggcaaga?ctcgggagtc?ttacggggct?cccttgctca?ccgagcctaa?caatggcaat 1860

ggtgctcccc?aggatgattt?caacgagggc?gtcttcattg?actaccgtca?ctttgacaag 1920

cgcaatgaga?cccccattta?tgagtttggc?catggcttga?gctacaccac?ctttggttac 1980

tctcaccttc?gggttcaggc?cctcaatagt?tcgagttcgg?catatgtccc?gactagcgga 2040

gagaccaagc?ctgcgccaac?ctatggtgag?atcggtagtg?ccgccgacta?cctgtatccc 2100

gagggtctca?aaagaattac?caagtttatt?tacccttggc?tcaactcgac?cgacctcgag 2160

gattcttctg?acgacccgaa?ctacggctgg?gaggactcgg?agtacattcc?cgaaggcgct 2220

agggatgggt?ctcctcaacc?cctcctgaag?gctggcggcg?ctcctggtgg?taaccctacc 2280

ctttatcagg?atcttgttag?ggtgtcggcc?accataacca?acactggtaa?cgtcgccggt 2340

tatgaagtcc?ctcaattgta?tgtttcactg?ggcggaccga?acgagcctcg?ggtcgttctg 2400

cgcaagttcg?accgaatctt?cctggctcct?ggggagcaaa?aggtttggac?cacgactctt 2460

aaccgtcgtg?atctcgccaa?ttgggatgtg?gaggctcagg?actgggtcat?cacaaagtac 2520

cccaagaaag?tgcacgtcgg?cagctcctcg?cgtaagctgc?ctctgagagc?gcctctgccc 2580

cgtgtctact?ag 2592

 

<210>49

<211>863

<212>PRT

＜213〉Aspergillus fumigatus (Aspergillus fumigatus)

 

<400>49

 

Met?Arg?Phe?Gly?Trp?Leu?Glu?Val?Ala?Ala?Leu?Thr?Ala?Ala?Ser?Val

1 5 10 15

Ala?Asn?Ala?Gln?Glu?Leu?Ala?Phe?Ser?Pro?Pro?Phe?Tyr?Pro?Ser?Pro

20 25 30

Trp?Ala?Asp?Gly?Gln?Gly?Glu?Trp?Ala?Asp?Ala?His?Arg?Arg?Ala?Val

35 40 45

Glu?Ile?Val?Ser?Gln?Met?Thr?Leu?Ala?Glu?Lys?Val?Asn?Leu?Thr?Thr

50 55 60

Gly?Thr?Gly?Trp?Glu?Met?Asp?Arg?Cys?Val?Gly?Gln?Thr?Gly?Ser?Val

65 70 75 80

Pro?Arg?Leu?Gly?Ile?Asn?Trp?Gly?Leu?Cys?Gly?Gln?Asp?Ser?Pro?Leu

85 90 95

Gly?Ile?Arg?Phe?Ser?Asp?Leu?Asn?Ser?Ala?Phe?Pro?Ala?Gly?Thr?Asn

100 105 110

Val?Ala?Ala?Thr?Trp?Asp?Lys?Thr?Leu?Ala?Tyr?Leu?Arg?Gly?Lys?Ala

115 120 125

Met?Gly?Glu?Glu?Phe?Asn?Asp?Lys?Gly?Val?Asp?Ile?Leu?Leu?Gly?Pro

130 135 140

Ala?Ala?Gly?Pro?Leu?Gly?Lys?Tyr?Pro?Asp?Gly?Gly?Arg?Ile?Trp?Glu

145 150 155 160

Gly?Phe?Ser?Pro?Asp?Pro?Val?Leu?Thr?Gly?Val?Leu?Phe?Ala?Glu?Thr

165 170 175

Ile?Lys?Gly?Ile?Gln?Asp?Ala?Gly?Val?Ile?Ala?Thr?Ala?Lys?His?Tyr

180 185 190

Ile?Leu?Asn?Glu?Gln?Glu?His?Phe?Arg?Gln?Val?Gly?Glu?Ala?Gln?Gly

195 200 205

Tyr?Gly?Tyr?Asn?Ile?Thr?Glu?Thr?Ile?Ser?Ser?Asn?Val?Asp?Asp?Lys

210 215 220

Thr?Met?His?Glu?Leu?Tyr?Leu?Trp?Pro?Phe?Ala?Asp?Ala?Val?Arg?Ala

225 230 235 240

Gly?Val?Gly?Ala?Val?Met?Cys?Ser?Tyr?Asn?Gln?Ile?Asn?Asn?Ser?Tyr

245 250 255

Gly?Cys?Gln?Asn?Ser?Gln?Thr?Leu?Asn?Lys?Leu?Leu?Lys?Ala?Glu?Leu

260 265 270

Gly?Phe?Gln?Gly?Phe?Val?Met?Ser?Asp?Trp?Ser?Ala?His?His?Ser?Gly

275 280 285

Val?Gly?Ala?Ala?Leu?Ala?Gly?Leu?Asp?Met?Ser?Met?Pro?Gly?Asp?Ile

290 295 300

Ser?Phe?Asp?Asp?Gly?Leu?Ser?Phe?Trp?Gly?Thr?Asn?Leu?Thr?Val?Ser

305 310 315 320

Val?Leu?Asn?Gly?Thr?Val?Pro?Ala?Trp?Arg?Val?Asp?Asp?Met?Ala?Val

325 330 335

Arg?Ile?Met?Thr?Ala?Tyr?Tyr?Lys?Val?Gly?Arg?Asp?Arg?Leu?Arg?Ile

340 345 350

Pro?Pro?Asn?Phe?Ser?Ser?Trp?Thr?Arg?Asp?Glu?Tyr?Gly?Trp?Glu?His

355 360 365

Ser?Ala?Val?Ser?Glu?Gly?Ala?Trp?Thr?Lys?Val?Asn?Asp?Phe?Val?Asn

370 375 380

Val?Gln?Arg?Ser?His?Ser?Gln?Ile?Ile?Arg?Glu?Ile?Gly?Ala?Ala?Ser

385 390 395 400

Thr?Val?Leu?Leu?Lys?Asn?Thr?Gly?Ala?Leu?Pro?Leu?Thr?Gly?Lys?Glu

405 410 415

Val?Lys?Val?Gly?Val?Leu?Gly?Glu?Asp?Ala?Gly?Ser?Asn?Pro?Trp?Gly

420 425 430

Ala?Asn?Gly?Cys?Pro?Asp?Arg?Gly?Cys?Asp?Asn?Gly?Thr?Leu?Ala?Met

435 440 445

Ala?Trp?Gly?Ser?Gly?Thr?Ala?Asn?Phe?Pro?Tyr?Leu?Val?Thr?Pro?Glu

450 455 460

Gln?Ala?Ile?Gln?Arg?Glu?Val?Ile?Ser?Asn?Gly?Gly?Asn?Val?Phe?Ala

465 470 475 480

Val?Thr?Asp?Asn?Gly?Ala?Leu?Ser?Gln?Met?Ala?Asp?Val?Ala?Ser?Gln

485 490 495

Ser?Ser?Val?Ser?Leu?Val?Phe?Val?Asn?Ala?Asp?Ser?Gly?Glu?Gly?Phe

500 505 510

Ile?Ser?Val?Asp?Gly?Asn?Glu?Gly?Asp?Arg?Lys?Asn?Leu?Thr?Leu?Trp

515 520 525

Lys?Asn?Gly?Glu?Ala?Val?Ile?Asp?Thr?Val?Val?Ser?His?Cys?Asn?Asn

530 535 540

Thr?Ile?Val?Val?Ile?His?Ser?Val?Gly?Pro?Val?Leu?Ile?Asp?Arg?Trp

545 550 555 560

Tyr?Asp?Asn?Pro?Asn?Val?Thr?Ala?Ile?Ile?Trp?Ala?Gly?Leu?Pro?Gly

565 570 575

Gln?Glu?Ser?Gly?Asn?Ser?Leu?Val?Asp?Val?Leu?Tyr?Gly?Arg?Val?Asn

580 585 590

Pro?Ser?Ala?Lys?Thr?Pro?Phe?Thr?Trp?Gly?Lys?Thr?Arg?Glu?Ser?Tyr

595 600 605

Gly?Ala?Pro?Leu?Leu?Thr?Glu?Pro?Asn?Asn?Gly?Asn?Gly?Ala?Pro?Gln

610 615 620

Asp?Asp?Phe?Asn?Glu?Gly?Val?Phe?Ile?Asp?Tyr?Arg?His?Phe?Asp?Lys

625 630 635 640

Arg?Asn?Glu?Thr?Pro?Ile?Tyr?Glu?Phe?Gly?His?Gly?Leu?Ser?Tyr?Thr

645 650 655

Thr?Phe?Gly?Tyr?Ser?His?Leu?Arg?Val?Gln?Ala?Leu?Asn?Ser?Ser?Ser

660 665 670

Ser?Ala?Tyr?Val?Pro?Thr?Ser?Gly?Glu?Thr?Lys?Pro?Ala?Pro?Thr?Tyr

675 680 685

Gly?Glu?Ile?Gly?Ser?Ala?Ala?Asp?Tyr?Leu?Tyr?Pro?Glu?Gly?Leu?Lys

690 695 700

Arg?Ile?Thr?Lys?Phe?Ile?Tyr?Pro?Trp?Leu?Asn?Ser?Thr?Asp?Leu?Glu

705 710 715 720

Asp?Ser?Ser?Asp?Asp?Pro?Asn?Tyr?Gly?Trp?Glu?Asp?Ser?Glu?Tyr?Ile

725 730 735

Pro?Glu?Gly?Ala?Arg?Asp?Gly?Ser?Pro?Gln?Pro?Leu?Leu?Lys?Ala?Gly

740 745 750

Gly?Ala?Pro?Gly?Gly?Asn?Pro?Thr?Leu?Tyr?Gln?Asp?Leu?Val?Arg?Val

755 760 765

Ser?Ala?Thr?Ile?Thr?Asn?Thr?Gly?Asn?Val?Ala?Gly?Tyr?Glu?Val?Pro

770 775 780

Gln?Leu?Tyr?Val?Ser?Leu?Gly?Gly?Pro?Asn?Glu?Pro?Arg?Val?Val?Leu

785 790 795 800

Arg?Lys?Phe?Asp?Arg?Ile?Phe?Leu?Ala?Pro?Gly?Glu?Gln?Lys?Val?Trp

805 810 815

Thr?Thr?Thr?Leu?Asn?Arg?Arg?Asp?Leu?Ala?Asn?Trp?Asp?Val?Glu?Ala

820 825 830

Gln?Asp?Trp?Val?Ile?Thr?Lys?Tyr?Pro?Lys?Lys?Val?His?Val?Gly?Ser

835 840 845

Ser?Ser?Arg?Lys?Leu?Pro?Leu?Arg?Ala?Pro?Leu?Pro?Arg?Val?Tyr

850 855 860

 

<210>50

<211>29

<212>DNA

＜213〉Aspergillus fumigatus (Aspergillus fumigatus)

 

<400>50

ggctcatgag?attcggttgg?ctcgaggtc 29

 

<210>51

<211>30

<212>DNA

＜213〉Aspergillus fumigatus (Aspergillus fumigatus)

 

<400>51

gccgttatcacagccgcggt?cggggcagcc 30

 

<210>52

<211>30

<212>DNA

＜213〉Aspergillus fumigatus (Aspergillus fumigatus)

 

<400>52

ggctgccccg?accgcggctg?tgataacggc 30

 

<210>53

<211>35

<212>DNA

＜213〉Aspergillus fumigatus (Aspergillus fumigatus)

 

<400>53

gcttaattaa?tctagtagac?acggggcaga?ggcgc 35

<210>54

<211>16

<212>DNA

＜213〉Aspergillus fumigatus (Aspergillus fumigatus)

 

<400>54

acactggcgg?agaagg 16

 

<210>55

<211>18

<212>DNA

＜213〉Aspergillus fumigatus (Aspergillus fumigatus)

 

<400>55

gcccagggat?atggttac 18

 

<210>56

<211>19

<212>DNA

＜213〉Aspergillus fumigatus (Aspergillus fumigatus)

 

<400>56

cgactctgga?gagggtttc 19

 

<210>57

<211>19

<212>DNA

＜213〉Aspergillus fumigatus (Aspergillus fumigatus)

 

<400>57

ggactgggtc?atcacaaag 19

 

<210>58

<211>17

<212>DNA

＜213〉Aspergillus fumigatus (Aspergillus fumigatus)

 

<400>58

gcgagaggtc?atcagca 17

 

<210>59

<211>17

<212>DNA

＜213〉Aspergillus fumigatus (Aspergillus fumigatus)

 

<400>59

gtaaaacgac?ggccagt 17

 

<210>60

<211>16

<212>DNA

＜213〉Aspergillus fumigatus (Aspergillus fumigatus)

<400>60

caggaaacag?ctatga 16

 

<210>61

<211>69

<212>DNA

＜213〉Aspergillus fumigatus (Aspergillus fumigatus)

 

<400>61

cttcttgtta?gtgcaatatc?atatagaagt?catcgactag?tggatctacc?atgagattcg 60

gttggctcg 69

 

<210>62

<211>61

<212>DNA

＜213〉Aspergillus fumigatus (Aspergillus fumigatus)

 

<400>62

gcgtgaatgt?aagcgtgaca?taactaatta?catgactcga?gctagtagac?acggggcaga 60

g 61

 

<210>63

<211>60

<212>DNA

＜213〉Aspergillus fumigatus (Aspergillus fumigatus)

 

<400>63

ccgctccgcc?gttgtggccg?ccctgccggt?gttggccctt?gccgaattgg?ctttctctcc 60

 

<210>64

<211>17

<212>DNA

＜213〉Aspergillus fumigatus (Aspergillus fumigatus)

 

<400>64

ctggcgttgg?cgctgtc 17

Claims (23)

1. produce the method for secrete polypeptide, comprising:

(a) in helping producing the substratum of described polypeptide, cultivate fungal host cells, wherein said fungal host cells comprises nucleic acid construct, this nucleic acid construct comprises first nucleotide sequence that can operate the coded signal peptide that links to each other with second nucleotide sequence of coding said polypeptide, wherein first nucleotide sequence is an external source to second nucleotide sequence, the upstream of the 3` end next-door neighbour second nucleotide sequence initiator codon of first nucleotide sequence, described first nucleotide sequence is selected from down group:

Sequence shown in the SEQ ID NO:36, or the nucleotide sequence of coding SEQ ID NO:37 wherein are different from the nucleotide sequence of SEQ ID NO:36 owing to the degeneracy of genetic code; With

(b) from substratum, separate described secrete polypeptide,

When under identical working condition, cultivating, with respect to the fungal cell who comprises with the exercisable natural natural signals peptide sequence that links to each other of second nucleotide sequence of coded polypeptide, the secrete polypeptide that described fungal host cells is produced at least many about 25%.

2. the process of claim 1 wherein the first nucleotide sequence coded signal peptide, this signal peptide is made up of the aminoacid sequence of SEQID NO:37.

3. the process of claim 1 wherein that first nucleotide sequence is made up of SEQ ID NO:36.

4. the process of claim 1 wherein that first nucleotide sequence is contained in the endoglucanase V gene of Humicola insolensDSM 1800.

5. the process of claim 1 wherein second nucleotide sequence coded polypeptide, this polypeptide is natural or allogenic for fungal host cells.

6. the process of claim 1 wherein that described fungal host cells comprises second nucleotide sequence of one or more copies.

7. the process of claim 1 wherein that described polypeptide is hormone or hormonal variations body, enzyme, acceptor or its part, antibody or its part or reporter protein.

8. the method for claim 7, wherein said enzyme is oxydo-reductase, transferring enzyme, lytic enzyme, lyase, isomerase or ligase enzyme.

9. the method in the claim 8, wherein said enzyme is endoglucanase, cellobiohydrolase or beta-glucosidase enzyme.

10. the process of claim 1 wherein that described polypeptide is a beta-glucosidase enzyme.

11. the process of claim 1 wherein that described fungal host cells is filamentous fungus or yeast cell.

12. the process of claim 1 wherein that described nucleic acid construct further comprises with first and second nucleotide sequences can operate the promotor that links to each other.

13. the method for claim 12, wherein said promotor is selected from down group: Trichodermareesei cellobiohydrolase I gene promoter, Trichodermareesei cellobiohydrolase II gene promoter, Trichodermareesei xylanase I genes promotor, Trichodermareesei xylanase I I gene promoter or Trichodermareesei xylobiase gene promoter.

14. the method for claim 1, when under identical working condition, cultivating, with respect to the fungal host cells that comprises with the exercisable natural natural signals peptide sequence that links to each other of second nucleotide sequence of coded polypeptide, the secrete polypeptide that described fungal host cells is produced at least many about 50%.

15. the method for claim 14, when under identical working condition, cultivating, with respect to the fungal host cells that comprises with the exercisable natural natural signals peptide sequence that links to each other of second nucleotide sequence of coded polypeptide, the secrete polypeptide that described fungal host cells is produced at least many about 75%.

16. the method for claim 15, when under identical working condition, cultivating, with respect to the fungal host cells that comprises with the exercisable natural natural signals peptide sequence that links to each other of second nucleotide sequence of coded polypeptide, the secrete polypeptide that described fungal host cells is produced at least many about 100%.

17. the method for claim 16, when under identical working condition, cultivating, with respect to the fungal host cells that comprises with the exercisable natural natural signals peptide sequence that links to each other of second nucleotide sequence of coded polypeptide, the secrete polypeptide that described fungal host cells is produced at least many about 200%.

18. the method for claim 17, when under identical working condition, cultivating, with respect to the fungal host cells that comprises with the exercisable natural natural signals peptide sequence that links to each other of second nucleotide sequence of coded polypeptide, the secrete polypeptide that described fungal host cells is produced at least many about 300%.

19. the method for claim 18, when under identical working condition, cultivating, with respect to the fungal cell who comprises with the exercisable natural natural signals peptide sequence that links to each other of second nucleotide sequence of coded polypeptide, the secrete polypeptide that described fungal host cells is produced at least many about 400%.

20. nucleic acid construct, this nucleic acid construct comprises first nucleotide sequence that can operate the coded signal peptide that links to each other with second nucleotide sequence of coded polypeptide, wherein first nucleotide sequence is an external source to second nucleotide sequence, the upstream of the 3` end next-door neighbour second nucleotide sequence initiator codon of first nucleotide sequence, described first nucleotide sequence is selected from down group:

Sequence shown in the SEQ ID NO:36, or the nucleotide sequence of the aminoacid sequence of coding SEQ ID NO:37, but be different from the nucleotide sequence of SEQ ID NO:36 owing to the degeneracy of genetic code.

21. the constructs of claim 20, wherein first nucleotide sequence is contained in the endoglucanase V gene contained among the Humicolainsolens DSM 1800.

22. comprise the recombinant expression vector of the nucleic acid construct of claim 20.

23. comprise the recombinant host cell of the nucleic acid construct of claim 20.

Images