CN1751563A - Method for enhancing genetic transformation efficiency of wheat - Google Patents
Method for enhancing genetic transformation efficiency of wheat Download PDFInfo
- Publication number
- CN1751563A CN1751563A CN 200510094907 CN200510094907A CN1751563A CN 1751563 A CN1751563 A CN 1751563A CN 200510094907 CN200510094907 CN 200510094907 CN 200510094907 A CN200510094907 A CN 200510094907A CN 1751563 A CN1751563 A CN 1751563A
- Authority
- CN
- China
- Prior art keywords
- wheat
- genetic transformation
- genetic
- genus
- acceptor
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
A method for increasing the genetic transformation efficiency of wheat includes such steps as crossing between Nanda ''2419'' and Wangshuibair, F1 generation selfing, harvesting only one grain from a plant for reproduction from F2 generation to F7 generation, and choosing the high-quality plant as the breeding receptor in F8 generation.
Description
One, technical field
The present invention relates to a kind of method that improves genetic transformation efficiency of wheat, utilize wheat breed Nanjing University 2419 and wheat breed Wangshuibai and filial generation thereof to improve genetic transformation efficiency of wheat, belong to biotechnology breeding field and applying gene group research field.
Two, technical background
One of wheat conduct staple food crop in the world has maximum cultivated area and consuming population.For a long time, the breeding work person has extensively carried out the genetic improvement research of wheat, has promoted the continuous development of Wheat Production.But, improving constantly of The development in society and economy and people's living standard, Wheat Production has been proposed requirements at the higher level,, effectively realized there is big limitation aspect the modern breeding target though the conventional breeding method is being brought into play significant role aspect the seed selection of new varieties.With the genetic transformation is the application of the modern biotechnology of core content, and with the combining closely of traditional breeding method, for genetic improvement of wheat has represented wide prospect to higher level.Current, along with biological gene group progress of research, a large amount of functional genes are cloned, and become a reality by genetic transformation change growth and development of plant, adaptability, yield and quality to single or multiple genes.
Yet wheat belongs to one of cereal crop of difficult conversion, and the Study on Genetic Transformation progress is slower.At present, mainly contain the method that three wheat genetics transform: particle bombardment, pollen tube passage method and agrobacterium-mediated transformation.In early days noticeable is that Vasil (1992) obtains the transgenic wheat plant with particle bombardment first, subsequently, carry out the report that wheat genetic transforms success successively by this method, but transformation efficiency is lower: 0.2% (Weeks et al., 1993); 1.3% (Becker et al., 1994); 1.2% (Nehra etal., 1994); 0.15% (Zhou et al., 1995); 1.5% (Altpeter et al., 1996); 0.9% (Barro et al., 1997); 0.25-1.2% (Wirtzens et al., 1998); 0.2-1% (Iser et al., 1999); 5% (Pastori, 2001); 3.9 ± 1.6% (Gaunt S etal., 2003), in addition, the particle gun mediated method exists also that multicopy inserts, genetic stability difference and shortcoming such as cost an arm and a leg.Pollen tube passage method is the another one method that successfully obtains transgenic wheat, and the research of this method mainly concentrates on domestic (Yan Xinfu etc., 1994; Cheng Zhuomin etc., 1996; Guo Taibao etc., 1996; Ni Jianfu etc., 1999; Wang Lixin etc., 2001; Liu Xuechun etc., 2002), though academia remains dispute to this method, it does not need expensive equipment and complicated cultured in vitro process, is a transformation system that is worth research on the quantitative character that shifts controlled by multiple genes.The third method is an agrobacterium-mediated transformation, compares with particle bombardment, pollen tube passage method, and the agrobacterium-mediated transformation cost is low, can transform the dna sequence dna of big fragment, and single copy integration rate height and foreign gene are Mendelian inheritance in the transfer-gen plant offspring.Nineteen eighty-three, first strain is come out by the transgene tobacco that agrobacterium-mediated transformation obtains, and very fast this method just becomes the predominant methods of dicotyledon genetic transformation.Meanwhile, some scientists have designed the infection experiment of Agrobacterium for the feasibility of checking Agrobacterium-mediated Transformation wheat specially, but have proved convertibility (Grave, 1988 of wheat cell; Mooney, 1991).Then, Hess etc. (1992) report directly is inoculated into Agrobacterium the wheat small ear and obtains to have antibiotic resistance and hybridize the transgenosis plant in the present age of proof through Southern Blot, and foreign gene still can be detected in the part individuality of T1 and T2.Yet Langridge etc. (1992) but fail to detect the existence of foreign gene in the use the same method T1 that obtains and T2.Up to 1997, just obtained breakthrough: Cheng etc. (1997) on the one hand at this and tentatively set up agriculture bacillus mediated wheat genetic transformed technology system through years of researches, obtained the transfer-gen plant of genetic stability.Photosensitive (Xia of summer, 1999) being acceptor with two months to 2 years WHEAT CALLUS of subculture also, is donor with the AglI agrobacterium strains, utilize the agrobacterium-mediated transformation success acquisition transfer-gen plant, transformation efficiency is 3.7%-5.9%, a little more than the 0.14%-4.3% of last experiment.2003, Hu T (2003) etc. carried out a large amount of transgenic wheat tests, has obtained the transgenic wheat of strain more than 3000 plant, and average transgene efficiency only is 4.4%.At present the wheat transformation efficiency of report not have above 6% (above transformation efficiency refers to that all the quantity of the transfer-gen plant that obtains accounts for the percentage of the callus sum of conversion), 96% (Liu Mei well below paddy rice (long-grained nonglutinous rice), 2004) and 30% (Ishida Y, 1996) of corn.Exactly because the transformation efficiency of wheat is very low, the application of transgenic wheat in breeding has been subjected to very big restriction.In addition, so far, the report that success obtains the transgenic wheat plant also only is confined in a few genotype, for the wheat that maximum cultivated area is arranged, the person's that can't satisfy the breeding work far away demand is to influence the another one limiting factor that biotechnology breeding is used in wheat.
In genome research, the functional analysis of gene need be carried out the function complementation experiment based on transgenosis, and gene identification system such as various enhancer, promotor and gene trap or DNA insert sudden change all will rely on highly effectively transformation system.In wheat, the foundation of efficient transformation system is the basis of said gene identification system, and at present too low conversion ratio can't be used to develop a kind of gene label system that is based upon on the conversion base.
In sum, the discovery of wheat cdna and functional analysis be unable to do without the foundation of genetic conversion system efficiently, utilize the wheat biotechnology breeding to create high yield, high-quality, how anti-new variety of wheat or new varieties with potential industrial value also be unable to do without genetic conversion system efficiently.
Three, summary of the invention
Technical problem
The objective of the invention is the low and narrow present situation of acceptor gene type at present genetic transformation efficiency of wheat, by long-term gene research with to a large amount of genotypic screenings, obtained to be fit to carry out the acceptor material that wheat genetic transforms, utilized this receptor material to carry out genetic transformation and can obtain higher genetic transformation efficiency.
Technical scheme
The present invention relates to a kind of method that improves genetic transformation efficiency of wheat, its embodiment is as follows:
With wheat breed Nanjing University 2419 and the hybridization of wheat breed Wangshuibai, F1 is for selfing; Play F7 from F2 generation and only receive one for each individual plant and breed, in F8 generation, mixes and receives, and breeds the different pure lines of various genetic constitutions; Select plant height 120-130cm at F8 in for pure lines, in the material of anti-(disease tassel yield is 40-50%) head blight transform the acceptor material of breeding as wheat genetic.
The material that said method obtains carries out the genetic transformation breeding as acceptor, can directly utilize genes such as disease-resistant, degeneration-resistant, pest-resistant, high-quality in other wheat breeds (strain) or other species, material is carried out genetic improvement, obtain fast to produce the kind that directly to utilize or provide good gene as the breeding resource.
Above-mentioned material carries out the breeding method of genetic transformation as acceptor, the mature embryo, rataria, root, the tip of a root, ovary, flower pesticide, bud, bud point, stem, blade that can utilize material as acceptor as genetic transformation; Perhaps utilize callus that the mature embryo, rataria, root, the tip of a root, ovary, flower pesticide, bud, bud point, stem, blade of material obtain genetic transformation as acceptor.Genetic transforming method comprises the method that the foreign gene of agrobacterium-mediated transformation, particle bombardment, electric shocking method, ovary injection method, poly-different glycol method shifts; The genetic transformation used carrier comprises various dna fragmentations and the plasmid that is fit to carry out genetic transformation.
The material and the parent's back cross breeding that utilize said method to obtain can obtain new suitable genetic transformation and economical character material preferably, have widened the acceptor gene type of wheat biotechnology breeding.
The material and other wheat breeds or the nearly edge species cross-breeding that utilize said method to obtain, nearly edge species comprise that Triticum, Aegilops, Agropyron, lyme grass genus, roegneria kamoji genus, couchgrass genus, leymus, new wheat straw genus, Hordeum, Secale, haynaldia villosa genus, non-irrigated wheat straw genus, awnless brome genus, special-shaped Pittosporum, rib axle grass belong to, in the acceptor gene type of having widened the wheat biotechnology breeding, distant hybridization breeding and biotechnology breeding can be combined, improve breeding efficiency.
Beneficial effect:
The present invention relates to a kind of method that improves genetic transformation efficiency of wheat, utilize wheat breed Nanjing University 2419 and wheat breed Wangshuibai and filial generation thereof to improve genetic transformation efficiency of wheat and have following advantage and good effect:
The present invention is by studying for a long period of time and a large amount of genotypic screenings, finally wheat breed Nanjing University 2419 has been obtained the new wheat genotypes material that can carry out genetic transformation with the hybridization of wheat breed Wangshuibai, widened the acceptor gene type that wheat genetic transforms, for the breeding work person provides new selection, can be directly as transgenic acceptor.
The transgenic acceptor that the inventive method obtained can utilize the excellent genes of other species or the nearly edge species of wheat to improve its economical character such as disease-resistant, pest-resistant, degeneration-resistant by genetic transformation, and this is the advantage that conventional breeding does not have.In addition, also can obtain the high progeny material of genetic transformation efficiency, this is carried out genetic transformation, obtain improved seeds fast, improve breeding efficiency, make the application of wheat transgenic breeding kind on producing become possibility by hybridizing with breeding material.
The present invention brings up to 31.4% with the genetic transformation efficiency of wheat by present about 5%, has solved a critical technical problems of restriction wheat biotechnology breeding and functional genome research, for biotechnology breeding is laid a good foundation in Application in Wheat.Simultaneously, the acquisition of efficient transformation system makes and utilizes various enhancers, promotor and gene trap or DNA to insert that the extensive Study of recognition of wheat cdna is carried out in sudden change and application becomes possibility.
Four, embodiment
Embodiment 1
(1) is used for carrying out the acquisition of the vegetable material of genetic transformation
1. with wheat breed Nanjing University 2419 and the hybridization of wheat breed Wangshuibai, F1 is for selfing.Playing F7 from F2 generation only receives one for each individual plant and breeds.F8 receives for mixing, and breeds the different pure lines of various genetic constitutions.
2. in the different pure lines of various genetic constitutions, select about plant height 120-130cm in May, 2004, in the material of anti-(disease tassel yield is 40-50%) head blight, be numbered N2, N3, N4 and check variety raise wheat 158, when Bobwhite is bloomed 15 days left and right sides, the wheat head (comprising the stem stalk about the following 10cm of fringe base portion) with each strain system of scissors clip and check variety, stem stalk bottom is immersed in the distilled water, handled three days for 4 ℃.
Wheat breed Nanjing University 2419, wheat breed Wangshuibai, raise wheat 158, Bobwhite (external recommended variety, domestic breeder is public, our unit can externally provide, the document Weeks et al. that sees reference, 1993; Becker et al., 1994; Zhou eh al., 1995) be public kind.
3. be taken at 4 ℃ of wheat heads of handling three days, strip seed with tweezers under the room temperature, with 70% alcohol disinfecting 10 minutes, aseptic water washing 3-4 time, 2%NaClO sterilization 20 minutes, aseptic water washing 5-6 time, sterile working strips rataria (size is about 1-2mm) on superclean bench, scultellum upwards on the MS inducing culture, in 25 ℃ of dark cultivations, begins to form callus after about 3 days.MS inducing culture: MS+2,4-D (2mg/L)+agar powder (8g/L)+sucrose (30g/L), pH=5.8.
4. 25 ℃ of dark cultivations after one month, with the callus subculture to identical MS inducing culture.In this period, the genotype material N3 and the check variety that are screened are raised wheat 158 and are compared, and the state of callus does not have notable difference, and the percentage that its embryo callus accounts for total callus is about 80%.After 25 ℃ of dark 1 weeks of cultivation, picking embryo callus wherein aseptic condition on superclean bench is cut into the fritter of the about 2-3mm of diameter, place on the MS differential medium and cultivate in advance, 25 ℃ of illumination cultivation (12 hours illumination/skies), acquisition can directly be used for carrying out the graininess fritter callus of genetic transformation.MS differential medium: MS+KT (1mg/L)+agar powder (8g/L)+sucrose (30g/L), pH=5.8.
(2) structure of genetic transformation used carrier (the double base conversion-expression vector pBIAC of the crt gene of in plant, expressing)
Be used to make up double base conversion-expression vector plasmid pBI121 be to transform by T-DNA, wherein remove T-DNA 25bp repetitive sequence (LB and RB), outside promotor of rouge alkali synthetase gene (P-nos) and the terminator (T-nos), also have nptI that uses as selected marker in prokaryotes (bacterium) and the nptII that uses as selected marker in eucaryote (plant), the antibiotic that is used to select is respectively kanamycin and G418.The promotor 35S (p35S) and beta-Glucuronidase (Gus) the gene uidA that in carrier, also have the cauliflower mosaic virus of expressing in addition eucaryote.Genes of interest crt gene (accession number AAW0279801) is inserted on the p35S of pBI121 plasmid and the polyclone restriction enzyme site between the uidA by the restriction enzyme site of restriction enzyme XbaI and BamHI, obtains recombinant plasmid pBIC.
For improving the expression efficiency of nptII gene in monocotyledon, the present invention be used in the higher ActI promotor of expression efficiency in the monocotyledon replace nptII gene itself among the recombinant plasmid pBIC promotor P-nos, obtain being used for the carrier of genetic transformation of the present invention: pBIAC.
The used ActI promotor of the present invention is to be template with oryza sativa genomic dna, obtains by pcr amplification, and the primer is:
ActIF：CATGAAGCTTCGAGGTCATTCATATGCTTGAG
ActIR：GTACCTGCAGTCTTCTACCTACAAAAAAGCTCCG
The PCR reaction volume is 25 μ l, 10 * buffer, 2.5 μ l wherein, 25mM MgCl
21.5 μ l, 2.5mM dNTPs 2 μ l, Taq enzyme 5U/ μ l 0.2 μ l, template DNA 20ng adds water to 25 μ l.
The PCR response procedures is: behind 94 ℃ of pre-sex change 3min, and 94 ℃ of sex change 1min, 65 ℃ of annealing 1min, 72 ℃ are extended exhibition 0.5min, circulate 35 times, and last 72 ℃ are extended 10min.
Used restriction enzyme XbaI of the present invention and BamHI are restriction enzymes commonly used, all can buy from biotech company, and used binary vector pBI121 is public carrier (Jefferson, R.A., Kavanash, T.A ﹠amp; Bevan, 1987).
(3) preparation method of the used thalline of genetic transformation comprises:
1. utilize the calcium chloride suspension method to prepare Agrobacterium Agl I competent cell, concrete grammar is with reference to " molecular cloning experiment instruction " (third edition).
2. utilize the thermal shock method that recombinant plasmid pBIAC is transferred in the Agrobacterium Agl I competent cell, adding glycerine is preserved stand-by in ultra low temperature freezer, and concrete grammar is with reference to " molecular cloning experiment instruction " (third edition).
3. take out the frozen Agrobacterium Agl I that contains the pBIAC plasmid in ultra low temperature freezer, coated plate was secretly cultivated 36 hours for 25 ℃ on the LB solid culture medium.
4. the monoclonal on the picking LB solid culture medium is in the LB liquid nutrient medium, and 25 ℃, the 150rpm concussion is cultured to OD
600=0.6.
5. get OD
600=0.6 Agrobacterium bacterium liquid divides on superclean bench in the aseptic centrifuge tube that installs to 1.5mL, every pipe packing 800 μ L, 4000rpm, 25 ℃ made bacterial sediment in centrifugal 10 minutes, then, outwelled the LB liquid nutrient medium, with an amount of dip-dye medium suspension thalline, make bacterial concentration keep OD
600=0.6, acquisition can be used for carrying out the agrobacterium suspension of genetic transformation.LB solid culture medium: NaCl (10g/L)+yeast extract (5g/L)+tyrosine hydrolysis thing (10g/L)+agar powder (15g/L)+kanamycin (50mg/L)+rifampin (50mg/L); LB liquid nutrient medium: NaCl (10g/L)+yeast extract (5g/L)+tyrosine hydrolysis thing (10g/L)+kanamycin (50mg/L)+rifampin (50mg/L); Contaminate medium: 1/2MS+AS (100 μ mol/L) pH=5.2.
Bacterial strain uses therefor Agl I of the present invention carries out monocotyledon genetic transformation bacterial strain commonly used (Xia, 1998), can directly buy from biotech firm, and our unit also can externally provide.
(4) be the genetic transforming method of acceptor with the callus, comprise:
The fritter graininess callus that to cultivate in advance on differential medium 3 days is soaked in the agrobacterium suspension, 25 ℃ leave standstill half an hour on superclean bench, outwell bacterium liquid, callus after contaminating placed to inhale on the aseptic filter paper remove unnecessary bacterium liquid, be placed into and contaminated on the moistening filter paper of medium, cultivated altogether 3 days for 25 ℃.
(5) screening technique behind the genetic transformation comprises:
1. the callus that will cultivate altogether after 3 days is used aseptic water washing 3-5 time that contains cephalosporin (200-500mg/L), place screening culture medium I to go up 1 week of screening, go up 1 week of screening in screening culture medium II, go up screening about 2 months in screening culture medium III.
2. in screening during 20 days left and right sides, can obviously observe out the genotype material N3 that screened and the difference of Yang Mai 158 resistant plant regeneration aspects.After on screening culture medium III, screening about 2 months, plant is placed one week of culture of rootage on the root media, transplant.Screening culture medium I:MS differential medium+cephalosporin (200-500mg/L); Screening culture medium II:MS differential medium+cephalosporin (200-500mg/L)+G418 (40-50mg/L); Screening culture medium III:MS differential medium+cephalosporin (200-500mg/L)+G418 (20-30mg/L).Root media: MS+IAA (1mg/L)+agar powder (8g/L)+sucrose (30g/L), pH=5.8.It is as shown in table 1 that the different genotype material obtains the resistant plant percentage:
The resistant plant regeneration statistics of table 1:2004 different genotype material
| The genotype material | Raise wheat 158 | Bobwhite | N2 | N3 | N4 |
| The callus quantity resistant plant that transforms accounts for the percentage (%) of the callus sum of conversion | 138 2.9 | 102 0.6 | 86 0 | 78 64.1 | 33 45.7 |
(6) PCR of transfer-gen plant detects, and comprising:
1. the blade of getting the transfer-gen plant of transplant survival utilizes the SDS method to extract genomic DNA, and extracting method is with reference to Ma et al., (1995).The DNA that extracts is after λ DNA is quantitative, as the template of pcr amplification and Southern hybridization.
2.PCR the target fragment that detects is the T-nos that is positioned on the carrier, according to the used primer of T-nos gene design PCR reaction.
3.PCR reaction volume is 25 μ l, 10 * buffer, 2.5 μ l wherein, 25mM MgCl
21.5 μ 1,2.5mM dNTPs 2 μ l, and Taq enzyme 5U/ μ l 0.2 μ l, template DNA 20ng adds water to 25 μ l.
4.PCR response procedures is: behind 94 ℃ of pre-sex change 3min, 94 ℃ of sex change 1min, 65 ℃ of annealing 1min, 72 ℃ are extended exhibition 0.5min, circulate 35 times, and last 72 ℃ are extended 10min.
5. in the enterprising performing PCR amplification of PTC-225 amplification instrument, amplified production carries out electrophoretic separation on 0.8% non-denaturing polyacrylamide gel, takes a picture the record result then on ultraviolet transilluminator.Have only 65 strains amplifications to obtain special object tape in the plant behind the 67 strain genetic transformations, wherein the resistant plant of two N3 object tape that do not increase.According to the pcr amplification result, the transformation efficiency of this experiment of primary Calculation, the transfer-gen plant quantity that adopt to obtain accounts for the transformation efficiency that the percentage of sum of the callus of conversion calculates as standard, and wherein higher material N3 and the N4 of transformation efficiency is the filial generation of wheat breed Nanjing University 2419 and wheat breed Wangshuibai; The comparing data of raising wheat 158 with other genotype and check variety is as shown in table 2.
The genetic transformation efficiency of table 2:2004 different genotype material
| The genotype material | Raise wheat 158 | Bobwhite | N2 | N3 | N4 |
| The callus quantity transformation efficiency (%) that transforms | 138 2.9 | 102 0.6 | 86 0 | 78 58.9 | 33 45.7 |
As can be seen from Table 2, the material of doing genetic transformation comprised that the genetic transformation efficiency of N3 and N4 is the highest and can reach 58.9% and 45.7% respectively being fit to of filtering out from the filial generation of wheat breed Nanjing University 2419 and wheat breed Wangshuibai, and raised the genetic transformation efficiency-2.9% and 0.6% of wheat 158 and Bobwhite considerably beyond the material that generally is used for doing genetic transformation at present.
(7) Southern of transfer-gen plant hybridization detects, and comprises
1. the enzyme of genomic DNA is cut, electrophoresis and commentaries on classics film
Cutting digestion by the genomic DNA of extraction mentioned above with restriction enzyme HindIII enzyme spends the night.Per 30 μ l reaction comprises 15 μ g DNA, 3 μ l, 10 * buffer solution, 33mM DTT, 4mM Spermdine, 30U restriction enzyme.DNA after enzyme is cut on 0.9% Ago-Gel with 1 * NEB (12.1g/L Tris, 0.336g/L EDTANa
2, 1.7g/L NaAc3H
2O, PH=8.1) electrophoretic buffer carries out electrophoretic separation.Before the commentaries on classics film gel is immersed 0.25N HCl and jiggle about 10 minutes of processing, after the distilled water rinsing, in 0.4NNaOH, use on capillary siphoning method transfer printing DNA to the Hybond-N+ nylon membrane transfer printing 12 hours, dry after at last film being placed 2 * SSC to sway washing 20min, 4 ℃ of preservations are standby.
2.Southern crossover process
Before the hybridization, transfer film in 65 ℃ of hybridization solutions (sodium phosphate of 0.5M pH 7.2, the salmon sperm dna of 7% SDS and 1% BSA and the pre-sex change of 200 μ g) prehybridization 3-6 hour earlier.Probe is to utilize method that enzyme cuts to reclaim GUS code area on the carrier, and its mark adopts random primer extension method (Feinberg andVogelsstein, 1983).The probe that mark is good is used 0.4N NaOH sex change 10 minutes, then the probe for preparing is added prehybridization solution, hybridizes 24 hours for 65 ℃.
3. wash film after the hybridization, exposure and developing a film
After the hybridization with film respectively contain 2 of 0.1%SDS *, 1 *, 65 ℃ of washings are 15-20 minute in 0.5 * SSC film washing liquid, according to the signal strength signal intensity on the film, on X-ray film in-70 ℃ of exposures 3 days, with x mating plate machine automatic processor.
Southern hybridization back result: be used for carrying out having 16 samples that tangible Southern hybridization signal is arranged in 30 samples of Southern hybridization, the result and the pcr amplification result of Southern hybridization are not quite identical.Cause this result's main cause possibility following: first reason may be because pcr amplification has the part false positive, false positive rate reaches 46.7%, then the genetic transformation efficiency of material N3 reality is 58.9% * (1-46.7%)=31.4%, second reason may be because chimeric existence, make some position of plant not have the integration of foreign gene, thereby cause the phenomenon that does not have hybridization signal or signal quite weak.The 3rd reason may be because this test used carrier is bigger, nearly 14Kb, enter plant cell or be incorporated in the process on the cell chromosome at foreign DNA, have only part T-DNA to enter into plant cell or have only part T-DNA to be incorporated into plant chromosome, and T-nos has two copies on the diverse location of T-DNA, make to expand when utilizing pcr amplification T-nos target stripe, and do not have the appearance of hybridization signal when detecting as probe hybridization in the code area that utilizes Gus.In addition, according to research reports, utilizing antibiotic marker gene NPTII on the antibiotic G418 screening vector in wheat is effective method (Zhang Wenwei the most, 2004), the suitable concentration of G418 is 25-50mg/L (leaf make the country prosperous etc., 2001), and the survival of false positive plant is seldom arranged when concentration is 25mg/L, (Cheng et al., 1996; B.T.Campbell et al., 2000; Liu Weihua etc., 2003).This is tested the G418 concentration that we use and has reached 50mg/L, should reach desirable screening effect, and it is very little that false positive rate reaches 46.7% possibility, therefore, we think that the possibility that first reason exists is smaller, and the actual transformation efficiency of material N3 should surpass 31.4%.
This shows that the genetic transformation efficiency of the genotype material N3 that we filter out can reach more than 31.4% at least, considerably beyond about 5% transformation efficiency of present report.
Embodiment 2
In May, 2005, get N2 once more, N3, the rataria of N4 and Yang Mai 158 carries out tissue culture and genetic transformation, purpose sheet in the genetic transformation carrier is replaced the crt gene by tom7 gene (number of landing AY667409), and all the other concrete experimental techniques are all identical with embodiment ().Containing on the medium of G418 screening after two months, it is as shown in table 3 that the resistant plant that obtains accounts for the percentage of callus sum of conversion:
The resistant plant regeneration statistics of table 3:2005 different genotype material
| The genotype material | Raise wheat 158 | N2 | N3 | N4 |
| The callus quantity resistant plant that transforms accounts for the percentage (%) of the callus sum of conversion | 159 7.5 | 51 5.8 | 214 72.3 | 121 47.9 |
Experimental result table 3 with 2005 and the same period in 2004 experiment record table 1 is as a result compared, and the percentage of sum that the resistant plant that material in 2004 is raised wheat 158, N2, N3 and N4 accounts for the callus of conversion is respectively: 2.6; 0.9; 64.1 and 45.7; And accounting for the percentage of sum of the callus of conversion, the resistant plant that material in 2005 is raised wheat 158, N2, N3 and N4 is respectively: 7.5; 5.8; 72.3 and 47.9.This shows that experimental result in 2004 is recursive, and transformation efficiency do not limit by the genes of interest on the carrier, a kind of method that improves genetic transformation efficiency of the present invention has stability and repeatability.
Claims (7)
1, a kind of method that improves genetic transformation efficiency of wheat is characterized in that:
With wheat breed Nanjing University 2419 and the hybridization of wheat breed Wangshuibai, F1 is for selfing; Playing F7 from F2 generation only receives one for each individual plant and breeds; F8 mixes for individual plant and receives, and breeds the different pure lines of various genetic constitutions; Select plant height 120-130cm at F8 in being sheerly, middle anti gibberellic disease, head blight disease tassel yield are the acceptor material that the material of 40-50% transforms as wheat genetic.
2, the material that utilizes the described method of claim 1 to obtain carries out the breeding method of genetic transformation as acceptor.
3, utilize material that the described method of claim 1 obtains to carry out the breeding method of genetic transformation according to claim 2 is described, it is characterized in that as acceptor:
Utilize the mature embryo, rataria, root, the tip of a root, ovary, flower pesticide, bud, bud point, stem, blade etc. of the described material of claim 1 genetic transformation as acceptor;
Perhaps utilize callus that the mature embryo, rataria, root, the tip of a root, ovary, flower pesticide, bud, bud point, stem, blade etc. of the described material of claim 1 obtain genetic transformation as acceptor.
4, describedly utilize material that the described method of claim 1 obtains to carry out the breeding method of genetic transformation according to claim 2 or 3, it is characterized in that as acceptor:
Genetic transforming method comprises the method that the foreign gene of agrobacterium-mediated transformation, particle bombardment, electric shocking method, ovary injection method, poly-different glycol method shifts; The genetic transformation used carrier comprises various dna fragmentations and the plasmid that is fit to carry out genetic transformation.
5, utilize the material of the described method acquisition of claim 1 and the method for parent's back cross breeding.
6, utilize the material of the described method acquisition of claim 1 and the method for other wheat breeds or strain or nearly edge species crossbreeding.
7, according to the described method of claim 6, it is characterized in that described nearly edge species comprise that Triticum, Aegilops, Agropyron, lyme grass genus, roegneria kamoji genus, couchgrass genus, leymus, new wheat straw genus, Hordeum, Secale, haynaldia villosa genus, non-irrigated wheat straw genus, awnless brome genus, special-shaped Pittosporum, rib axle grass belong to.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 200510094907 CN1751563A (en) | 2005-10-20 | 2005-10-20 | Method for enhancing genetic transformation efficiency of wheat |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 200510094907 CN1751563A (en) | 2005-10-20 | 2005-10-20 | Method for enhancing genetic transformation efficiency of wheat |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN1751563A true CN1751563A (en) | 2006-03-29 |
Family
ID=36678661
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 200510094907 Pending CN1751563A (en) | 2005-10-20 | 2005-10-20 | Method for enhancing genetic transformation efficiency of wheat |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1751563A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102229946A (en) * | 2011-05-30 | 2011-11-02 | 山东农业大学 | Improved transforming method of wheat young ears mediated by agrobacterium tumefaciens and application thereof |
| CN111742837A (en) * | 2020-07-14 | 2020-10-09 | 甘肃省农业科学院经济作物与啤酒原料研究所（甘肃省农业科学院中药材研究所） | Breeding method of Guanghong barley |
-
2005
- 2005-10-20 CN CN 200510094907 patent/CN1751563A/en active Pending
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102229946A (en) * | 2011-05-30 | 2011-11-02 | 山东农业大学 | Improved transforming method of wheat young ears mediated by agrobacterium tumefaciens and application thereof |
| CN102229946B (en) * | 2011-05-30 | 2013-06-19 | 山东农业大学 | Improved transforming method of wheat young ears mediated by agrobacterium tumefaciens and application thereof |
| CN111742837A (en) * | 2020-07-14 | 2020-10-09 | 甘肃省农业科学院经济作物与啤酒原料研究所（甘肃省农业科学院中药材研究所） | Breeding method of Guanghong barley |
| CN111742837B (en) * | 2020-07-14 | 2022-05-17 | 甘肃省农业科学院经济作物与啤酒原料研究所（甘肃省农业科学院中药材研究所） | Breeding method of Guanghong barley |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107129993B (en) | Modified glyphosate-resistant gene and cultivation method of glyphosate-resistant rice | |
| CN1198655A (en) | Transformation of cotton plants | |
| CN102220277B (en) | Method for building high-efficiency regenerating and transforming system of Oryza sativaL. subsp. japonica 11 | |
| CN102732554B (en) | A kind of method improving plant anti-insect ability | |
| CN1884518A (en) | Directional gene transfer method of cabbage type rape C chromosome set | |
| CN102154364A (en) | Method for agrobacterium tumefaciens-mediated genetic transformation of sugarcane | |
| CN101011027B (en) | Method for converting cotton germ by agrobacterium with ultrasonic wave aid | |
| CN102634522B (en) | Gene for controlling rice fertility, encoded protein and application thereof | |
| CN104004781A (en) | Preparation method of glyphosate resistant transgenic rice | |
| CN111247255A (en) | Nucleic acid sequence for detecting soybean plant DBN8007 and detection method thereof | |
| CN111406117A (en) | Nucleic acid sequence for detecting soybean plant DBN8002 and detection method thereof | |
| CN104046636A (en) | Codon vegetalization-transformed PMI gene and applications thereof | |
| CN112322631B (en) | Cultivation method of glyphosate-resistant transgenic soybean | |
| CN117004649B (en) | Agrobacterium-mediated broom corn millet efficient genetic transformation method | |
| CN1751563A (en) | Method for enhancing genetic transformation efficiency of wheat | |
| CN1338001A (en) | I (agrobacterium)-medicated transformation of cotton with novel explants | |
| CN1888071A (en) | Chuancao-II Laomangmai wheat pest-resisting gene genetically modifying technology | |
| CN114350673B (en) | Rice KOB1 gene for regulating and controlling seed vigor and regulating and controlling method thereof | |
| CN102031270A (en) | Method for culturing apple seedling by agrobacterium-mediated high-efficiency transformation system | |
| CN106554398B (en) | Rice-derived protein OsGIF1 and application of related biological material thereof in regulation and control of plant organ size | |
| CN110951776B (en) | Agrobacterium-mediated pepper genetic transformation method | |
| CN1277928C (en) | Improved wheat shoot apex transformation method induced by agrobacterium | |
| CN103215307A (en) | Genetic transformation method of agrobacterium-induced plum blossom mature cotyledon regeneration system | |
| CN103320463B (en) | Method for obtaining rice sterile line by utilizing RNAi (Ribose Nucleic Acid interfere) technology to control rice fertile gene | |
| CN114134155B (en) | MLO gene mutant and preparation method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |