CN1717478A - Be used for the feeder layer of hESC's vitro culture and the method for cultivating embryonic stem cell - Google Patents
Be used for the feeder layer of hESC's vitro culture and the method for cultivating embryonic stem cell Download PDFInfo
- Publication number
- CN1717478A CN1717478A CN02830086.6A CN02830086A CN1717478A CN 1717478 A CN1717478 A CN 1717478A CN 02830086 A CN02830086 A CN 02830086A CN 1717478 A CN1717478 A CN 1717478A
- Authority
- CN
- China
- Prior art keywords
- hesc
- vitro culture
- cell
- human fibroblasts
- feeder layer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/06—Animal cells or tissues; Human cells or tissues
- C12N5/0602—Vertebrate cells
- C12N5/0603—Embryonic cells ; Embryoid bodies
- C12N5/0606—Pluripotent embryonic cells, e.g. embryonic stem cells [ES]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2502/00—Coculture with; Conditioned medium produced by
- C12N2502/13—Coculture with; Conditioned medium produced by connective tissue cells; generic mesenchyme cells, e.g. so-called "embryonic fibroblasts"
- C12N2502/1323—Adult fibroblasts
Abstract
The present invention relates to be used for the feeder layer of hESC's vitro culture, and with this feeder layer vitro culture hESC's method.Feeder layer provided by the invention is made of the human fibroblasts.And the nutrient solution during with this feeder layer vitro culture hESC is KNOCK-OUTEMEM+KNOCK-OUTSR.The present invention successfully adopts the human fibroblasts as feeder cell, has fully solved the unfavorable factor that has mouse cell to participate in original culture systems.
Description
Feeder layer for hESC's in vitro culture
And the method for culture embryonic stem cell
Technical field
The present invention relates to the feeder layer for hESC's in vitro culture, and with the method for feeder layer in vitro culture hESC.Background technology：
HESC's (Embryonic stem cell, ES cells）Be successfully separated the impressive progress that culture is current life science.People's ES cells be from human embryo separation, can in vitro under felicity condition holding undifferentiated state a kind of stem cell.It has the potential for being divided into all cell tissues of body（The totipotency of differentiation）It can be used as " seed cell ", people can obtain the cell donor that substantial amounts of different types of cell is used as cell transplantation, tissue substitute and organ cloning from induction ES cell directionals differentiation, and unlimited cell derived is provided for many refractory diseases for the treatment of in the future mankind.Therefore in the clinical practice in future prospect extensively, this is the main application in people ES cell future.Other purposes of people's ES cells include：
1st, as the carrier of gene therapy, so as to reduce the potential hazard of original viral vector and improve the security of gene therapy；2nd, the model for studying mammalian developmental biology can be used as.In ES cells in vitro atomizations, certain precursor stage is necessarily first passed through.This provides ideal experimental system for the origin and characteristic for studying some precursors, energy influence that is qualitative or even quantitatively studying the factor such as some cell factors, extracellular matrix cell growth and differentiation, it is to avoid and reduce the complexity of various endogenous factors interference in overall embryo's research.
3rd, pharmacological research：People ES cells can provide the Normal human cells of any organization type, and a large amount of samples are provided for developing new drug, and available for screening medicine, the target gene site of identification new drug effect, screen gene for regeneration gene therapy.
Built on Human ES cells is referring to bibliography 1-11.
In the document of presently disclosed and external cellar culture, researcher substantially employs the fibroblast of Mouse Embryos separation（Mouse embryonic fibroblast, abbreviation mEFs) as foster cellular layer is watched, the latter can directly contact to act on ES cells by secrete cytokines and with ES cells, keep the ES cells of culture to be in undifferentiated state.Therefore due in culture, directly and mEFs contacts, and mEFs has a possible unknown pathogen to people ES cells, this factor by be people's DX-like centers application in future in, the big obstacle particularly in clinical practice.Therefore people are little by little attempting to replace Mouse feeder layers culture systems using without feeder layer culture systems.Once had and support layer to separate hESC as word using Human Oviductal Epithelial Cells, and failed final success（Document 11).There is the conditioning culture that research is cultivated using mEFs at present
Base cultivates people's ES cells（Document 7) so that people ES cells and mEFs are not directly contacted with to meet the application requirement in future.But just equally can also produce the query of clinical practice in future security to its because the culture medium that researcher cultivated in incubation with mEFs, culture medium and mEFs were also directly contacted.Therefore still it is necessary to set up the people's ES cell culture systems for watching foster cell of humanized.
On the other hand, human fibroblast is widely used to as the healing mechanism of research skin burn, the transhipment mechanism of cell membrane, the experiment material of isolated cytokine by people, also the feeder cells of the in vitro cultures such as the substitute of skin scar reparation, and other cells such as melanocyte are used as come the survival in vitro rate of cell needed for improving（Document 12 is 19).The content of the invention
The technical scheme is that：Using feeder cells of the human fibroblasts as human embryo stem cell in vitro culture.
The source organized in view of people, above-mentioned human fibroblasts are preferably obtained from mankind's aborted fetus or adult foreskin.
One of separating and extracting process is：
(1) people remnant tissue is immersed in the antibiotic liquid of high concentration；
(2) ' cleaning after add trypsase/EDTA liquid, in 5%C02Digested in environment；
(3) digestion in Fibroblast culture solution with digestive juice is added again；
(4) cell suspension in sucking-off, in 5%C02Cultivated in environment.After isolated human fibroblasts, most handy Y-radiation exposure fibroblast, or handle fibroblast with mitomycin C.The purpose is to the fibroblast of active proliferation is lost mitotic capabilities.
Total radiation dose is 32- 35G during Y-radiation exposure fibroblast.With mitomycin C handle cell condition be：Mitomycin C concentration is lmg/ml,（02Concentration is 5%, 37 °C, 2. 5 hours.
In order to obtain substantial amounts of human fibroblasts, it is necessary to which human fibroblasts are carried out into Secondary Culture.Cultural method is-cultivate 3- cell growth converged after 5 days after, remove old culture medium, washed to eliminate influence of the serum to trypsase in waste and old culture medium with PBS.With 0.25% trypsase/EDTA, 37 times digestion.During digestion, if the effect of digestive juice is good, shake culture dish, cell be possible to it is agglomerating it is blocking be digested, in general, these cells are not dissipate, and are unfavorable for the passage of cell.If digestion is slightly worse, culture dish can be shaken, it will help digestion.If the effect of digestion is too poor, it separately need to add a certain amount of enzyme to digest.Become round at most cells edge, it is possible to add the effect with digestive juice in fresh culture.With 1：3- 5 is passed on.Typically need to change liquid before passage or freezing once.
Sometimes, it is necessary to by resulting human fibroblasts freezen protective.Fibroblastic freezing without irradiation or drug-treated should not be excessively dilute.Because DMS0 has toxic action to cell, cryovial is being distributed into
After should be immediately transferred in one 70 profound hypothermia refrigerators.It is transferred in liquid nitrogen in the domestic demand of one week and preserved for a long time.
Whether just isolated human fibroblasts or the chilled rear fibroblast thawed, survey its state, to differentiate if appropriate for as feeder layer preferably by picking up.
Human fibroblast's form is ribbon fibre shape, is arranged in paliform, helical form, or cross one another（See Fig. 1).Fibroblastic use algebraically of humanized can be higher, and we have reached eighth generation when in use.And the fibroblast of mouse was only capable of with the generations of 2- 3.In general, the feeder cells growth time of humanized is longer, can typically reach 14 days or so.This is longer as growth time when watching foster layer than MEC, and the latter is about after culture 7 days, and cell gradually comes off death.If this time can not be reached, it should suspect the quality of feeder cells.When foster cell is watched in preparation, the necessary growth conditions of fibroblast are good：The growth degree of converging of cell density 70% -90%, cell is in largely bar shaped or rope shape, does not occur special or heterocyst.It is observed that human fibroblasts are streak in significantly growing, cell proliferation rate is very fast.
Preferably liquid is changed in progress processing the previous day once, allow cell to reach best nutritional status.Need to exclude bacterium and mycoplasma contamination in every batch of cell for being ready for before processing（Bacteria Culture and Culture Mycoplasma）.
The invention provides a kind of new human embryo stem cell extracorporeal culturing method, i.e., ES cell transplantations are spouted to go in the feeder layer obtained as stated above and cultivated.Its cultural method and condition can be according to the methods provided in the prior art.Nutrient solution can be selected from KNOCK-OUT DMEM+KN0CK-0UT SR and DMEM+hyclone
Grown it is found by the applicant that KNOCK-OUT DMEM+KN0CK-0UT SR are more suitable for people ES cells than DMEM+hyclone on the foster cellular layer of word of humanized
The present invention ° successfully supports cell using human fibroblasts as word, successfully people ES cells are continued on the basis of original to pass for 14 generations, significant antigen SSEA- 4, the TRA-1-60 of the undifferentiated state of people's ES cells and AKP detection of expression are positive, prove that people ES cells can keep undifferentiated state in this culture systems, fully solve the unfavorable factor for having mouse cell to participate in original culture systems.
The human fibroblasts of brief description of the drawings-Fig. 1 cultures（ 100 X ) ：Human fibroblast's form is ribbon fibre shape, is arranged in paliform, helical form, or cross one another；
Fig. 2 is grown in the people ES cells (40X) on the foster layer of human fibroblasts word；
The alkaline phosphatase detection of Fig. 3 people's ES cells（ 100 X ) ：Positive findings is that cell clone is dyed to red, and it is not colored that fibroblast word supports layer；
The SSEA-4 antigens detection of Fig. 4 people's ES cells（ 200 X ):Positive colony shows apple green under 450nm exciting light；
The TRA- 1- 60 of Fig. 5 people's ES cells are detected（ 200 X )：Positive gram
It is grand to show apple green under 450nm exciting light；
The plastidogenetic embryoid bodies of Fig. 6 people ES（ 40X );
The detection of expression of OCT- 4 of Fig. 7 people's ES cells： Linel：β-actin internal references； Line2：Without RT internal references； Line3 :HES-1 ； Line4:HES - 2.Embodiment
Material
1st, people ES cells：This laboratory is separately cultured from mankind's blastaea and by the 19th generation cell of identification；
2nd, ES cell culture mediums：(SR, GIBC0-BRL companies provide 80% N0CK-0UT DMEM, 20%KNOCK-OUT serum replacement）, ImM l-GLUTAMINEs, Ο Ι π ι Μ beta -mercaptoethanols, 1% nonessential amino acid（GIBC0- BRL companies）With human recombinant basic fibroblast growth factor（BFGF, GIBC0-BRL company）；Or 80%DMEM (high sugar）, (GIBC0-BRL companies provide 20% hyclone）, ImM l-GLUTAMINEs, 0. ImM beta -mercaptoethanols, 1% nonessential amino acid（GIBC0-BRL companies）With human recombinant leukemia's growth inhibitory factor（HLIF, Sigma company）；
3rd, embryoid body culture medium：80%DMEM, 20% hyclone, ImM l-GLUTAMINEs, 0. ImM beta -mercaptoethanols, 1% nonessential amino acid (GIBC0-BRL companies）；
4th, fibroblast culture medium：85%DMEM, 15% hyclone；
5th, the DMSO frozen solutions of 10%：Set freezing n pipes fibroblast (amount of liquid filled per cryovial is as 1ml), total amount of liquid is n ml, required DMS0 amounts are the ml of n/10, power mouthful enters 4n/10ml hyclone, and mixing is that DMS0 content is 20%.The cell of freezing needed for being resuspended with the DMEM of the hyclones of n/2 ml 10%, add it is above-mentioned contain 20 % DMS0 match somebody with somebody liquid.
6th, 0.1% gelatin is prepared：Certain gelatin is weighed, gelatin is poured into and cleaned up in the vial with lid.Autoclaving.4 °C of temperature refrigerators are put to save backup.
7th, mitomycin C:Lmg/ml concentration is made into PBS liquid, 4 °C save backup.
8th, the monoclonal antibodies of Anti-SSEA -1.
9th, (Peter professors Andrews of Sheffield universities give the monoclonal antibodies of Anti-SSEA-4 and An t i-TRA- 1-60）.
10th, the rabbit anti-mouse IgG of FITC marks.Method
1st, human fibroblasts are separated：
1) fetal tissue that induced abortion is obtained（Remove internal organ and head tissue）, remnant tissue is immersed in the penicillin/streptomycin liquid of 20 times of concentration 30 minutes.Using sterile saline or P B S cleaning and removing residual tissue repeatedly.Remnant tissue is transferred in sterile petri dish, 0.25% trypsase/EDTA liquid is added（The table of the full ware of lid
Face）, and shredded tissue block with sterile cut；Again plus digestive juice is 37,5%C02Digested 5-10 minutes in environment.Blow and beat tissue block, cell dispersion repeatedly with suction pipe；Again plus in 5_10ml Fibroblast culture solutions and digestive juice digestion.After suction pipe piping and druming uniformly, liquid is moved on in sterile centrifugation tube and stands 3-10 minutes.Upper cell suspension is suctioned out, is planted in sterile culture flask or culture dish.37 °C, 5 °/.C02Cultivated in environment.3- changes liquid once in 4 days, typically changes 1/2-2/3 liquid.
2) the adult prepuce tissues of surgery excision are first immersed in the penicillin/streptomycin liquid of 20 times of concentration 30 minutes.Rinsed repeatedly using sterile saline or P B S.Prepuce tissues are transferred in sterile petri dish, 0.25% trypsase/0.53MEDTA liquid is added, is stored in 4 °C of refrigerators 15-24 hours.Prepuce tissues are moved on in culture dish, careful separation epidermis simultaneously abandons it.PBS cleans the dermis graft of foreskin again.Tissue is fully shredded in clostridiopetidase A and is digested 0.5-1.5 hours in 37 °C.Blow and beat tissue block, cell dispersion repeatedly with suction pipe.Cell suspension is moved into sterile centrifugation tube, 3- 10 minutes are stood, upper cell suspension is suctioned out, move on in sterile centrifugation tube, 800 revs/min centrifuge 5-10 minutes, remove supernatant, fresh culture is added, after being blown and beaten uniformly with Pasteur's pipe, is planted in sterile culture flask or culture dish.37 °C, 5%C02Cultivated in environment.Change liquid once within 3-4 days, typically change 1/2- 2/3 liquid.
2nd, human fibroblasts passage and Cryopreservation
1) culture 3- removes old culture medium, is washed to eliminate influence of the serum to trypsase in waste and old culture medium with PBS after cell growth is converged after 5 days.0.25% trypsase/EDTA is added, is shaken up, makes the full culture dish of digestive juice lid or culture bottle surface, 37 °C of digestion.During digestion, if the effect of digestive juice is good, shake culture dish, cell be possible to it is agglomerating it is blocking be digested, in general, these cells are not dissipate, and are unfavorable for the passage of cell.If digestion is slightly worse, culture dish can be shaken, it will help digestion.If the effect of digestion is too poor, it separately need to add a certain amount of enzyme to digest.Become round at most cells edge, it is possible to add the effect with digestive juice in fresh culture 5-10ml.Bottle wall or ware floor cells are blown and beaten with aseptic straw and are mixed.With 1:3- 5 is passed on.Typically need to change liquid before passage or freezing once.
2) if necessary to freeze, the cell suspension of digestion is moved in sterile centrifugation tube, and 5- is centrifuged 10 minutes with 800 revs/min.Supernatant fluid is removed, addition fresh culture, piping and druming is uniform, adding the frozen solution of equivalent, then mixed hook, be frozen in 1ml cell suspensions in a sterile cryo pipe（ 2Ι 1).Fibroblastic freezing without irradiation or drug-treated should not be excessively dilute.Because DMS0 has toxic action to cell, it should be immediately transferred in one 70 °C of profound hypothermia refrigerators being distributed into after cryovial.It is transferred in liquid nitrogen in the domestic demand of one week and preserved for a long time.Mark need to be carried out simultaneously：Cell type, cell algebraically, cell lot number and cooling time etc..
3) defrosting of fibrocyte：Heated water bath case, it is 37-40 °C to make water temperature constant.Take out the cell that need to be thawed rapidly from liquid nitrogen container, tighten lid
Aobvious shape changes non-% and frozen, quick to shake to accelerate to thaw.Support after close amount glue divides thawing X days when needing dayization fine is pasted with the born of the same parents of the dimension thin glue of the amount of going well 1-2 foot is outer, the liquid for washing cryovial, the one upper training that goes out on ^ clock and watch are smeared with alcohol and beats what is carefully pasted more than mark-on expansion phase cell wall born of the same parents without thin once born of the same parents leaching,, interior 13 Λ
Behaviour outwards winding cryovial lid under spiral shell existing a S length, alcolhol burner, enters that the clear thin block foam enhancing in face of empty foster born of the same parents is even to be remembered bacterium to criticize during big layer cell wall, interior, 2/suspension is drawn into pipe, it is another add into the fine special bar % aqueous vapors lyolysis of class rotation and train the even volume of cold born of the same parents six inhale Λ really by small after mixed, it is number thin.When, four., even, 800 leave the heart 5-10 minutes.
U is into the different rope of shape.Add into fiber
Relatively bathe support freeze the setting-up hole hole even born of the same parents of self-purchased degree pipe it is permanent when give birth to, i.e. cell culture;Even, centrifugation plus i are fine again, or shape is given birth to and fully mixed into Fibroblast culture solution, according to freezing
The right total plate plate of liquid more than ^ casees will be advised more carefully only can be thin., 3-dimensional or long different, the culture of plant or blake bottle number.Plus middle tubule cell born of the same parents, mutual remittance shape 5% ^C 00 many fine2Culture
High ^ is dry, and number connects six born of the same parents' classes good cold frozen ground point and examines radicula,
Close kind of hole when ^ born of the same parents' phase born of the same parents close thin.Born of the same parents' type is spread after patch and carefully freezes height, according to the preparation of cell
<
^, which increases, hands over shape degree born of the same parents' state ribbon fibre shape, and being arranged in fence, upper wooden partition is close with about spending, what foster born of the same parents crossed, when fork is shown in Fig. 1).Cell density 70 needs 0 to train and is added in shape close 2
E born of the same parents are in largely bar shaped or rope shape when spending this thin pipe, and I need the foster t less of S temperature jelly
It is thin by four that cold born of the same parents enter states,：、：See bright, observe human fibroblasts and be in
The thin 2 hole Dong Chuanni holes born of the same parents of quick change gear are grown, comparatively fast.Carry out before processing one it is heaven-made from bag ^, combine in from
Nutrient solution,
Total irradiation
(after 2 y-radiation exposure,：；4/lattice side liquid patch freezes thin, trains small thin
Separate the born of the same parents of the heart 61
Small, the liquid in cell pipe
When planting density from energy-absorbing is inhaled,
Cold its is needed after frozen pipe slice except foster number number will ask born of the same parents several after jelly to make thin bright
6
2 element C processing cell preparations are watched foster
When cell goes up full the 80% of four pavings of enzyme point, it can be cultivated with six orifice plate 60mm
)
Not
32 make a call to 67 is taken as it is thin .5 hour except treatment fluid, ' add mono- point of scattered hole o of 20 ml P with born of the same parents six
EDTA vitellophags
3 digestion situations, when the close need of shape.,
When
Fibre,
Cell
It is adherent
P
.Born of the same parents train
37
Born of the same parents
5th, E S property Α Κ Ρ) inspection | cold 80% ethanol determines 2-：Water 2 is with the dyestuff newly prepared after 8
Dyeing, when dyeing relatively satisfactory, is washed 2 times with distillation, then soaks observation coloration result with D- PBS.AKP detects dyeing liquor：25mg Fast Red TR+5mg alpha-Naphthol+44.6ml distilled water+0.3ml 10%MgCl2The Boratexes of+5ml 4.5%.It is most of to be cloned in the AKP positives（Positive findings is that cell clone is dyed to red, and the foster layer of fibroblast word is not colored, and noble cells clone is also not colored）（See Fig. 3).
6th, the cell undifferentiated property detections of ES：Detected using indirect immunofluorescence cytochemical methods.Another lj is divided to use anti-SSEA-l, anti-SSEA-4
( 1:3-4) with anti-TRA- 1- 60, (1:3- 4) as primary antibody, the rabbit anti-mouse IgG (l marked using FITC:50) the ES cells of culture are detected as secondary antibody.Wherein SSEA-1 and TRA-1-60 detections are fixed using 100% ethanol, and the detections of SSEA- 4 steam hydropexis using two containing 90% acetone.After fixation, heterogenetic antigen is closed with Normal Goat Serum, is washed with PBS twice, it is every all over 5 minutes, primary antibody is added, is incubated 30 minutes, PBS is washed twice, it is every all over 5 minutes.Secondary antibody is added, is incubated 30 minutes, PBS is washed twice.Under fluorescence microscope（450nm) observe the testing result of cell clone.(positive colony shows apple green under 450nm exciting light by SSEA- 4 and TRA-1-60）Detection on be positive（See Fig. 4-5), SSEA- 1 is detected as feminine gender.Illustrate that the ES cells grown in people's feeder layer can keep undifferentiated state.
7th, prepared by embryoid body：Such as routine passage people's ES cellular processes vitellophags, by people's ES cell culture in the Micro-Organism Culture Dish without feeder cells.Culture medium is embryoid body culture medium.We have found that：The suspension culture after feeder layer is departed from of people ES cells can form embryoid body（See Fig. 6).
8th, OCT- 4 is detected：Using
(5') (3') GGAAAGGCTTCCCCCTCAGGGAAAGG be bow with AAGAACATGTGTAAGCTGCGGCCC, 60 °C of annealing, RT-PCR detections（See Fig. 7).Show to grow on the fibroblast feeder layer of people, people ES cells can keep undifferentiated state.
Bibliography
I、 Thomson JA, It skovi tz-Eldor J, Shapiro SS, e t al.
Embr y o i c stem cell lines derived from human blastocysts. Science. 1998, 282： 1145-7.
2、 Reubinoff BE, Per a MF, Chui-Yee Fong, et al.
Embryonic stem cell lines from human blastocysts：Somatic differentiation in vitro. Nature Biotech 2000,18 (4):399-404.
3、 Robertson EJ. Embryo-derived stem cell lines. In " Teratocarcinoma and embryonic stem cells- A
Practical Approach" . IRL Press, Washington, DC. 1987, 77-78
4th, Xue Qing philanthropist compiles.The philosophy and technique of in vitro culture（The first edition）.Beijing-Science Press., 446-447 in 2001.
5、 Carpenter MK, Inokuma MS, Denham J, e t al .
Enr i chment of nerons and neural precursors from human embryonic stem cells. Exp N e u r o 2001, 172:383-397.
6th, Buehr M, Mclaren A. Isolation and culture of primordial germ cells. Methods Enzymo 1
1993, 225:58-76.
7、 Chunhui Xu, Inokuma MS, Denham J, et al.
Fr eeder-f r ee growth of undifferentiated human embryonic stem cells. Nature Biotech 2001, 19:971-974.
8th, Cooper gangsters, Tamura RN, the i nt e gr i n. J Cell Biol 1991,115 of 6 β of Quaran ta V. The major laminin receptor of mouse embryonic stem cells is a novel i sof orm of a 1:843-850.
9、 Belkin AM and Stepp MA. Integrins as receptors for laminins. Micro Res Tech 2000, 51： 280-301.
10th, C. Hansisl, J. Hum Reprod 2000,6 (11) of A. Grifo and L. C. Krey Oct -4 expression in inner cell mass and trophectoderm of human blastocysts. Mo 1:999-1004
II、 Bongso A, Fong CY, Ng SC, et al. Isolation and culture of inner cell mass cells from human blastocysts. Hum Reprod. 1994； 9 (11) :2110-7.
12、 Flyckt L, Venizelos N, Edman G, et al . Aberrant tyrosine transport across the cell membrane in patients with schizophrenia. Arch Gen Psychiatry 2001 Oct ; 58 (10) :953-8
13rd, the gene therapy of cancer by per i tumoral injection of transduced autologous fibroblasts of Rang K, Park C, Yoon HL, et al. Interleukin 12： outcome of a phase I study. Hum Gene Ther 2001 Apr
10; 12 (6) :671-84
、 Phillips J, Gawkr odger D J, Caddy CM, e t al . Keratinocytes suppress TRP - 1 expression and reduce cell number of co~cul tured melanocytes - implications for grafting of patients with vitiligo. Pigment Cell Res 2001 Apr； 14(2)：116-25, Xue H, McCaul ey RL, the Mar-Apr of 1 eukin-6 expression in fibroblasts from hypertrophic burn scars. J Burn Car e Rehab i of Zhang W, et al. Altered inter 1 2000; 21 (2)： 142-6
、 Wang X, Wang J, Wu J. Manufacture and application of a' new composite allograft Zhongguo X i u Fu Chong Jian Wai Ke Za Zhi 1997 Mar ; 11 (2) : 100-2
, Hehenberger K, Hei lborn JD, Br i smar K, et al Inhibited proliferation of fibroblasts derived from chronic diabetic wounds and normal dermal； fibroblasts treated with high glucose is associated with increased formation of 1 - lactate. Wound Repair Regen 1998 Mar-Apr ;6 (2) : 135-41
, Hansbr ough JF, Moz i ngo DW, Keal ey GP, the Clinical trials of a biosynthetic temporary skin replacement of et a 1., the Jan-Feb of Dermagraft-Transitional Covering, compared with cryopr eserved human cadaver skin for temporary coverage of excised burn wounds J Burn Care Rehabil 1997； 18(1 Pt 1)：43-51, Wetzel s AM, Van der Auwer a I, the Jan of Basti aans BA, et al. Sperm functional changes and fertilization i n vitro in co-culture with human skin fibroblasts. Hum Repr od 1995; 10(1) : 137-41
Claims (1)
- Claim, the feeder layer for hESC's in vitro culture are made up of human fibroblasts., the word for hESC's in vitro culture according to claim 1 support cellular layer, it is characterised in that the human fibroblasts are separated from mankind's aborted fetus or adult foreskin., the feeder layer for hESC's in vitro culture according to claim 1 or 2, it is characterised in that the human fibroblasts are obtained as follows：(1) people remnant tissue is immersed in the antibiotic liquid of high concentration,(2) trypsase/EDTA liquid is added after cleaning, in 5%C02Digested in environment；(3) digestion in Fibroblast culture solution with digestive juice is added again；(4) cell suspension in sucking-off, in 5%C02Cultivated in environment., the word for hESC's in vitro culture according to one of claim 1 to 3 support cellular layer, it is characterised in that be used as word support cellular layer human fibroblasts cell density 70% -90% growth degree of converging., the feeder layer for hESC's in vitro culture according to one of claim 1 to 3, it is characterised in that the human fibroblasts change nutrient solution once being used as feeder cells the previous day., the feeder layer for hESC's in vitro culture according to one of claim 1 to 3, it is characterised in that the human fibroblasts are by Y-radiation exposure.7, the feeder layer for hESC's in vitro culture according to claim 6, it is characterised in that Y-ray total radiation dose is 32-35G., the word for hESC's in vitro culture according to one of claim 1 to 3 support cellular layer, it is characterised in that the human fibroblasts are handled by mitomycin C., the hESC's in vitro culture that is used for according to claim 8 watch foster cellular layer, it is characterised in that the condition for handling cell with mitomycin C is：Mitomycin C concentration is lmg/ml, C02Concentration is 5%, 37 °C, 2.5 hours.0th, human embryo stem cell extracorporeal culturing method, it is characterised in that support cellular layer from the word described in one of claim 1 to 91st, the human embryo stem cell extracorporeal culturing method according to claim 10, it is characterised in that nutrient solution is selected from KN0CK-0UT DMEM+KNOC-OUT SR and DMEM+hyclone2nd, the method for the feeder layer vitro culture of human embryo stem cell according to claim 11, it is characterised in that nutrient solution is KN0CK-0UT DMEM+KNOCK-OUT SR.
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| PCT/CN2002/000753 WO2004038012A1 (en) | 2002-10-25 | 2002-10-25 | The feeder cell layer for in vitro culturing human embryonic stem cells and the method for culturing embryonic stem cells |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN1717478A true CN1717478A (en) | 2006-01-04 |
Family
ID=32111536
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN02830086.6A Pending CN1717478A (en) | 2002-10-25 | 2002-10-25 | Be used for the feeder layer of hESC's vitro culture and the method for cultivating embryonic stem cell |
Country Status (3)
| Country | Link |
|---|---|
| CN (1) | CN1717478A (en) |
| AU (1) | AU2002344527A1 (en) |
| WO (1) | WO2004038012A1 (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110669726A (en) * | 2019-09-19 | 2020-01-10 | 上海长征医院 | Cell strain capable of being passaged for long time after gamma ray irradiation of human skin fibroblasts and construction method thereof |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5843780A (en) * | 1995-01-20 | 1998-12-01 | Wisconsin Alumni Research Foundation | Primate embryonic stem cells |
| AU3881499A (en) * | 1998-09-01 | 2000-03-21 | Wisconsin Alumni Research Foundation | Primate embryonic stem cells with compatible histocompatibility genes |
| US7005252B1 (en) * | 2000-03-09 | 2006-02-28 | Wisconsin Alumni Research Foundation | Serum free cultivation of primate embryonic stem cells |
-
2002
- 2002-10-25 AU AU2002344527A patent/AU2002344527A1/en not_active Abandoned
- 2002-10-25 CN CN02830086.6A patent/CN1717478A/en active Pending
- 2002-10-25 WO PCT/CN2002/000753 patent/WO2004038012A1/en not_active Application Discontinuation
Also Published As
| Publication number | Publication date |
|---|---|
| WO2004038012A1 (en) | 2004-05-06 |
| AU2002344527A1 (en) | 2004-05-13 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Ouhibi et al. | Culture of epithelial cells derived from the oviduct of different species | |
| US6921632B2 (en) | Human embryonic stem cells derived from frozen-thawed embryo | |
| US20020160509A1 (en) | Embryonic stem cells | |
| JP5750130B2 (en) | A novel population of pluripotent non-contracting cardiac progenitor cells derived from human blastocyst-derived stem cells | |
| JP2008017840A (en) | Growth of embryonic stem cell | |
| EA025532B1 (en) | Method for isolation of precursor cells from human umbilical cord | |
| JP2006525006A (en) | Cryopreservation method of stem cells derived from human blastocysts using the closed straw vitrification method | |
| Dergilev et al. | Comparison of cardiac stem cell sheets detached by Versene solution and from thermoresponsive dishes reveals similar properties of constructs | |
| JP5426073B2 (en) | Efficient transfer method of human blastocyst-derived stem cells (hBS cells) from feeder support to culture system without feeder | |
| US20050233448A1 (en) | Materials and methods to produce stem cells | |
| CN113025565B (en) | Establishment of salmon sperm primitive stem cell line and induced differentiation method thereof | |
| CN101538553A (en) | Method for separating, purifying, culturing and proliferating totipotent stem cell from tissue of early aborted fetus of human being | |
| Parsons et al. | Defining conditions for sustaining epiblast pluripotence enables direct induction of clinically-suitable human myocardial grafts from biologics-free human embryonic stem cells | |
| Camarasa et al. | Optimized protocol for derivation of human embryonic stem cell lines | |
| Akutsu et al. | Human embryonic stem cells | |
| CN1717478A (en) | Be used for the feeder layer of hESC's vitro culture and the method for cultivating embryonic stem cell | |
| CN102206609A (en) | Separation culture method for female germline stem cells derived from ovarian | |
| WO2009148622A1 (en) | Compositions and methods for growing embryonic stem cells | |
| Carnegie et al. | Fertilization and early embryolgoy: Can Matrigel substitute for Vero cells in promoting the in-vitro development of mouse embryos? | |
| CN1788079A (en) | Method for separating and cultiviting human multifunctional embryo stem cell | |
| Mohaqiq et al. | Investigation of slow freezing of human testicular tissue on proliferation, colonization and viability of human spermatogonial stem cells | |
| De Miguel et al. | Isolation and culture of embryonic germ cells | |
| AU764684B2 (en) | Embryonic stem cells | |
| CN116200331A (en) | Suspension type method for culturing testis tissue organoids | |
| WO2019148395A1 (en) | Artificial hair follicle, preparation method therefor and use thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |