CN1335410A - Biochip for typing non-coding region gene of hepatitis C virus HCV5' - Google Patents
Biochip for typing non-coding region gene of hepatitis C virus HCV5' Download PDFInfo
- Publication number
- CN1335410A CN1335410A CN 00122162 CN00122162A CN1335410A CN 1335410 A CN1335410 A CN 1335410A CN 00122162 CN00122162 CN 00122162 CN 00122162 A CN00122162 A CN 00122162A CN 1335410 A CN1335410 A CN 1335410A
- Authority
- CN
- China
- Prior art keywords
- virus
- ccg
- hepatitis
- gat
- coding region
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention discloses one kind of DNA chip for typing non-coding region gene of hepatitis C virus HCV5'. The 28 kinds of specific DNA probes designed for detecting hepatitis C virus and its over 30 kinds of subtypes are fixed onto glassslide, silicon chip, film or polymer material. Compared with available technology, the present invention can detect simultaneously about 30 kinds of hepatitis C virus subtypes fast and conveniently and is suitable for clinical virus typing. Each kinds of virus subtype has one kind of crossing signal mode and this results in high resolution and high specificity. It adopts fluorescent analysis method leading to high sensitivity.
Description
The present invention relates to a kind of biochip of hepatitis C virus HCV5 ' typing non-coding region gene.
Hepatitis C virus HCV is the single strand RNA virus of 9,600 Nucleotide.Contain coding 3011 amino acid whose ORF and 5 ' non-coding region (5 '-Non-coding region), 3 ' non-coding region.
HCV virus finds to have ten major types (HCV type1,2,3,4,5,6,7,8,9,10) now; Each major types has many hypotypes (subtypes) again, as HCV1a, and HCV2b etc.Different clinically hypotypes is for the treatment of α-IFN, and the generating process and the severity of hepatopathy are significant.The HCV different genotype also influences antibody diagnosis and the viral communication approach that HCV infects.α-IFN is that treatment HCV infects one of effective means, relevantly discovers that the hypotype that HCV is different has different results of treatment to α-IFN, as HCV 1a, 1b, 2a, the treatment LTR of 3a (long-term response) is respectively 20%, 7%, 17% and 16%.RIBAVIRIN is the medicine of treatment chronic hcv hepatitis, and frequent and α-IFN uses simultaneously, and the correlative study result is HCV 1b, and 2a, the LTR of 3a are respectively 20%, 40% and 75%.In addition, HCV 1b and 4 is than HCV 1a, 2a, and 3a infects behind operation transplantation, occurs chronic hepatopathy and cirrhosis complication sooner; And HCV 1b infects the also easier serious chronic hepatitis that causes, and cirrhosis and HCC (hepatocellular careinoma) form.
Human early stage practice in disease gene diagnosis (claiming molecular diagnosis again) starts from the initial stage seventies, but after the mid-80 PCR (polymerase chain reaction) technology was born, its application in medical diagnosis had just obtained development rapidly.Modern gene diagnosis is an applied molecular biology new and high technology-as technique means such as PCR, molecular hybridization and dna sequencings, by on molecular level test sample analysis being reached the purpose that diagnoses the illness.
At present human to human body gene and the pathogenic knowledge accumulation of pathogeny body gene, oneself makes the gene diagnosis technology be widely used in the diagnosis of the aspects such as numerous disease of human inheritance's disease, transmissible disease, tumour and other and gene-correlation.Compare with medically traditional laboratory diagnosis, the main advantage of gene diagnosis technology is the diagnostic result at cause of disease molecule that can obtain high degree of specificity, and for human inheritance's disease, bacterium, virus infection and some neoplastic disease, gene diagnosis result are examining finger veins marks really at last.Letter the accelerate development, the particularly appearance of biochip (biochip) technology recently of the reliable modern gene diagnostic new technology of speed, its development trend will inevitably substitute the many methods that have clinical labororatory now, and may change traditional medical diagnosis idea.
The hypotype analysis of HCV now generally is to analyze 5 ' non-coding region (5 ' NCR), core (core) region sequence and NS5B sequence.The method of utilizing mainly contains (1) PCR-RFLP (restriction fragment lengthpolymorphism), this method is utilized multiple restriction enzyme that gene amplification product is carried out enzyme and is cut, different gene orders will produce different electrophoretograms (Davidson F et al, J Gen Virol 1995,76,1197-1204; Murphy D et al, J Infect Dis, 1994,169,473-475; Mellor Jet al, J Gen Virol, 1995,76,2493-2507), this method can only be applied to when sudden change has changed a certain restriction enzyme site.(2) probe hybridization method (Stuyver J et al, Virus Res, 1995,38,137-157; Tisminetzky SG et al, Int Hepatol Commun, 1994,2,105-142), testing gene is hybridized with the specific probe of 15-20bp mark respectively behind pcr amplification.This method need be carried out isotopic labeling or digoxin, vitamin H, and marks such as peroxidase, the analytic process complexity is not suitable for real-time analysis.(3) specific PCR primer amplification method (Okamoto H et al, J Gen Virol, 1992,73,673-679; Okamoto H et al, J Gen Virol, 1993,74,2385-2390), its principle is that the character according to the known mutations site designs a base mismatch in primer, makes it only can increase mutant or wild type gene.This method is comparatively fast and convenient.But once can only detect limited hypotype.(4) DNA enzyme immunoassay method (DNA enzyme immunoassay) (Viazov S et al, J Virol Methods, 1994,48,81-91).(5) dna sequencing method, this is the most directly perceived, the most accurately method.But technical sophistication costs an arm and a leg, can not be as ordinary method.(6) elisa assay method (Simmonds P et al, J ClinMicrobiol, 1993,31,1493-503; Bhattacherjee V et al, J Gen Virol, 1995,76,1737-48; Machida A et al, Hepatology, 1992,16,886-91; Tanaka T etal, Hepatology, 1994,19,1347-53), this method can only as HCV1 and HCV2, be classified to the main type (type) of HCV virus, can not analyze hypotype (subtype).
In sum, in the prior art of the diagnosis of relevant hepatitis C virus HCV and gene type, have trivial operations, required time is long, and cost is higher, is difficult to problems such as automatization and great amount of samples parallel analysis.Purpose of the present invention is exactly at the deficiencies in the prior art, proposes a kind of and the diverse relevant HCV genotyping diagnosis method of prior art.Utilize the DNA chip technology to detect HCV virus, and more than 30 kinds of hypotypes are carried out somatotype.
The purpose of this invention is to provide a kind of can the convenience, apace hepatitis C virus HCV5 ' the typing non-coding region gene biochip of the hypotype of the hepatitis C virus of about 30 kinds of one-time detection.
The present invention takes following measures in order to achieve the above object:
HCV5’、、、30DNA,：HCV1 ( 127-113 ) ATG CCT GGA GAT TTGHCV1 ( 168-154 ) TTG CCA GGA CGA CCGHCV1a ( 242-228 ) GTG TCG TGC AGC CTCHCV1b ( 106-92 ) CCC CCG CGA GAC T/CGCHCV1c ( 145-131 ) CTT GGA TTA ACC CGCHCV1d ( 144-130 ) TTG GAT AAC CCC GCTHCV1f ( 143-129 ) TGG ATC TAA CCG CTCHCV2 ( 139-125 ) TAA ACC CAC TCT ATGHCV2 ( 83-69 ) TAG CGT TGG GTT GCGHCV2a ( 128-114 ) TAT GCC CGG TCA TTTHCV2b ( 168-154 ) TTA CCG GAA AGA CTGHCV2c ( 126-112 ) TGC CCG GCC ATT TGGHCV2d ( 129-115 ) CTA TGC CTG GTC ATTHCV2e ( 101-87 ) GCA AGA CCG CTA GCCHCV3 ( 170-156 ) AAT CGC TGG GGT GACHCV3 ( 129-114 ) CAA TAC CCA GAA ATT THCV3 ( 103-89 ) CCG CGA GAT CAC TAGHCV3a ( 146-132 ) TCT TGG AGC AAC CCGHCV3d ( 145-132 ) CTT GGA ACA AAC CCGHCV3f ( 145-132 ) CTT GGA ATC AAC CCGHCV4 ( 244-229 ) GAG TGT TGT ACA GCC THCV4 ( 170-156 ) AAT CGC CGG GAT GACHCV4bg ( 127-113 ) ATG CCC GGC AAT TTGHCV4e ( 144-129 ) TTG GAT TAA ACC GCT CHCV5a ( 243-229 ) AGT GTC GAA CAG CCTHCV6ab ( 147-136 ) TTC CAT TGG ATC AAAHCV6a ( 242-228 ) GTG TCG TAC AGC CTCHCV10a ( 168-154 ) TCG CCG GGT TGA CCG
The present invention compared with prior art can make things convenient for, and the hypotype of the hepatitis C virus of about 30 kinds of one-time detection is very suitable for clinical gene typing apace.Each virus subtype has a kind of hybridization signal pattern, by the hybridization signal pattern analysis, judges the hypotype of virus to be detected, the resolving power height, and specificity is strong.It is maximum in the prior art once testing the virus subtype number that can detect.Adopt fluorescence analysis method, highly sensitive.Same chip can detect HCV1a simultaneously, HCV1b, HCV1c, HCV1d, HCV1e, HCV1f, HCV2a, HCV2b, HCV2c, HCV2d, HCV2e, HCV3a, HCV3b, HCV3c, HCV3d, HCV3e, HCV3f, HCV4a, HCV4b, HCV4c, HCV4d, HCV4e HCV4f, HCV4g, HCV5a, HCV6a, HCV6b, HCV10a.The present invention also is applicable to detection and the gene type of other viruses and microorganism, as the gene type of HBV.
Below in conjunction with drawings and Examples the present invention is elaborated.
Fig. 1 is hepatitis C virus (HCV) a 5 ' typing non-coding region gene biochip mode chart;
Fig. 2 detects HCV2a, the hybridization signal pattern diagram of 1b virus;
Fig. 3 is HCV1b, and HCV2a detects results of hybridization figure.
The object of the present invention is achieved like this.By the method for the pcr amplification of the 5 ' non-coding region (5 ' NCR) of HCV virus and specific probe hybridization being identified the genotype 1a of HCV virus, 1b, 1c, 1d, 1f, 1e, 2a, 2b, 2c, 2d, 2e, 3a, 3b, 3c, 3d, 3e, 3f, 4a, 4b, 4c, 4d, 4e, 4f, 4g, 4h, 4k, 5a, 6a, 6b and 10a.Nucleotide sequence (341bp) 5 ' the non-coding region of HCV-1 1a genome of 5 ' non-coding region (5 ' NCR)
(GenBank ACC No.D31603)
The pcr amplification primer (243bp) of 5 ' noncoding region (5 ' NCR): Primers of 5 ' non-coding region of HCV-1 1a genomeOLIGO tm gc% seqPrimerHCV1 59.37 50.00 cttcacgcagaaagcgtctaPrimerHCV2 60.42 55.00 gcaccctatcaggcagtacc probe design:search amount of literature data; The sequence of the 340bp of all types of comparison HCV and the 5 ' noncoding region (5 ' NCR) of hypotype; 30DNA,HCV1 ( 127-113 ) ATG CCT GGA GAT TTGHCV1 ( 168-154 ) TTG CCA GGA CGA CCGHCV1a ( 242-228 ) GTG TCG TGC AGC CTCHCV1b ( 106-92 ) CCC CCG CGA GAC T/CGCHCV1c ( 145-131 ) CTT GGA TTA ACC CGCHCV1d ( 144-130 ) TTG GAT AAC CCC GCTHCV1f ( 143-129 ) TGG ATC TAA CCG CTCHCV2 ( 139-125 ) TAA ACC CAC TCT ATGHCV2 ( 83-69 ) TAG CGT TGG GTT GCG HCV2a ( 128-114 ) TAT GCC CGG TCA TTTHCV2b ( 168-154 ) TTA CCG GAA AGA CTGHCV2c ( 126-112 ) TGC CCG GCC ATT TGGHCV2d ( 129-115 ) CTA TGC CTG GTC ATTHCV2e ( 101-87 ) GCA AGA CCG CTA GCCHCV3 ( 170-156 ) AAT CGC TGG GGT GACHCV3 ( 129-114 ) CAA TAC CCA GAA ATT THCV3 ( 103-89 ) CCG CGA GAT CAC TAGHCV3a ( 146-132 ) TCT TGG AGC AAC CCGHCV3d ( 145-132 ) CTT GGA ACA AAC CCGHCV3f ( 145-132 ) CTT GGA ATC AAC CCGHCV4 ( 244-229 ) GAG TGT TGT ACA GCC THCV4 ( 170-156 ) AAT CGC CGG GAT GACHCV4bg ( 127-113 ) ATG CCC GGC AAT TTGHCV4e ( 144-129 ) TTG GAT TAA ACC GCT CHCV5a ( 243-229 ) AGT GTC GAA CAG CCTHCV6ab ( 147-136 ) TTC CAT TGG ATC AAAHCV6a ( 242-228 ) GTG TCG TAC AGC CTCHCV10a ( 168-154 ) TCG CCG GGT TGA CCGDNA：
Amido modified dna probe (NH
2-(CH
2)
6-DNA oligo), 28 kinds of dna probes repeat to be fixed in more than 2 times carrier surface (slide glass, silicon chip, macromolecular material, film etc.) with every kind of probe more than.Sample preparation:
Get 1 milliliter of person's blood to be measured, utilize business-like RT-PCR (reverse transcription-polymerase chain reaction) amplification HCV virus 5 ' non-coding region (5 ' NCR), primer 5 ' end is modified with fluorescence.The PCR product adds the 3M pH5.2 acetate buffer solution of 1/10 volume, adds 100% ethanol of-20 ℃ of refrigerations of 2.5 times of volumes, behind the mixing, places 30 minutes for-20 ℃.Centrifugal 10 minutes of 13000rpm is with 70% washing with alcohol precipitation, drying.DNA chip surface crossover process:
(5 X SSC 0.2%SDS) dissolve above-mentioned DNA to 5 μ l hybridization buffers, and 95 ℃ of sex change 5 minutes are cooled to room temperature, drip the array surface in DNA, cover slide glass again, 42 ℃ of hybridization 4～8 hours.Hybridization signal detects and the signal mode analysis: detect DNA chip hybridization signal with confocal fluorescent microscope or fluorescent scanning instrument.By signal mode analysis and distinguishing HCV virus subtype.Signal mode discriminance analysis table HCV1a:1,2,3HCV1b:1,2,4HCV1c:1,2,5,3HCV1d:1,2,6HCV1e:1,2,27HCV1f:1,2,7HCV2a:8,9,10HCV2b:8,9,11HCV2c:8,9,12HCV2d:8,9,13HCV2e:8,9,14HCV3a:15,16,17,18,3HCV3b:17,3,22HCV3c:15,16,3HCV3d:15,16,17,3,19HCV3e:15,16,17,3HCV3f:3,20HCV4a:21HCV4b:21,22,23HCV4c:21,22HCV4d:21,22HCV4e:21,22,24HCV4f:21,20HCV4g:19,23HCV4h:20,22HCV4k:22HCV5a:25HCV6a:1,9,26,27HCV6b:1,2,3,9,26HCV10a:3,28
Fig. 1 is hepatitis C virus (HCV) 5 ' non-coding region (5 ' non-coding region, NCR) the biochip mode chart of gene type.1：HCV1(127-113)，2：HCV1(168-154)，3：HCV1a(242-228)，4：HCV1b(106-29)，5：HCV1c(145-131)，6：HCV1d(144-130)，7：HCV1f(143-129)，8：HCV2(139-125)，9：HCV2(83-69)，10：HCV2a(128-114)，11：HCV2b(168-154)，12：HCV2c(126-112)，13：HCV2d(129-115)，14：HCV2e(101-87)，15：HCV3(170-156)，16：HCV3(129-114)，17：HCV3(103-89)，18：HCV3a(146-132)，19：HCV3d(145-132)，20：HCV3f(145-132)，21：HCV4(244-229)，22：HCV4(170-156)，23：HCV4bg(127-113)，24：HCV4e(144-129)，25：HCV5a(243-229)，26：HCV6ab(149-135)，27：HCV6a(242-228)，28：HCV10a(168-154)。
Fig. 2 is for detecting HCV2a, the hybridization signal pattern of 1b virus.The signaling point of HCV2a is 8,9,10; The signaling point of HCV1b is 1,2,4.
Fig. 3 HCV2a, HCV1b detects results of hybridization figure
Utilize biochip test HCV 2a virus of the present invention.Get 1 milliliter of person's blood to be measured, with PCR (polymerase chain reaction) primer PrimerHCV1:cttcacgcagaaagcgtcta and the PrimerHCV2:FITC-gcaccctatcaggcagtacc and business-like RT-PCR (reverse transcription-polymerase chain reaction) the test kit amplification HCV virus 5 of design ' non-coding region (5 ' NCR).Get the gene segment of 243bp, add the 3M pH5.2 acetate buffer solution of 1/10 volume, add 100% ethanol of-20 ℃ of refrigerations of 2.5 times of volumes, behind the mixing, placed 30 minutes for-20 ℃.Centrifugal 10 minutes of 13000rpm is with 70% washing with alcohol precipitation, drying.(5 X SSC 0.2%SDS) dissolve above-mentioned DNA to 5 μ l hybridization buffers, and 95 ℃ of sex change 5 minutes are cooled to room temperature, drip the array surface in DNA, cover slide glass again, 42 ℃ of hybridization 4～8 hours.Detect DNA chip hybridization signal, the right figure of result such as Fig. 3 with the fluorescent scanning instrument.
Utilize biochip test HCV 1b virus of the present invention.Get 1 milliliter of person's blood to be measured, with PCR (polymerase chain reaction) primer PrimerHCV1:cttcacgcagaaagcgtcta and the PrimerHCV2:FITC-gcaccctatcaggcagtacc and business-like RT-PCR (reverse transcription-polymerase chain reaction) the test kit amplification HCV virus 5 of design ' non-coding region (5 ' NCR).Get the gene segment of 243bp, add the 3M pH5.2 acetate buffer solution of 1/10 volume, add 100% ethanol of-20 ℃ of refrigerations of 2.5 times of volumes, behind the mixing, placed 30 minutes for-20 ℃.Centrifugal 10 minutes of 13000rpm is with 70% washing with alcohol precipitation, drying.(5 X SSC 0.2%SDS) dissolve above-mentioned DNA to 5 μ l hybridization buffers, and 95 ℃ of sex change 5 minutes are cooled to room temperature, drip the array surface in DNA, cover slide glass again, 42 ℃ of hybridization 4～8 hours.Detect DNA chip hybridization signal, the left figure of result such as Fig. 3 with the fluorescent scanning instrument.
Claims (1)
1. the biochip of a HCV HCV5 ' typing non-coding region gene; 、、、30DNA,：HCV1 ( 127-113 ) ATG CCT GGA GAT TTGHCV1 ( 168-154 ) TTG CCA GGA CGA CCGHCV1a ( 242-228 ) GTG TCG TGC AGC CTCHCV1b ( 106-92 ) CCC CCG CGA GAC T/CGCHCV1c ( 145-131 ) CTT GGA TTA ACC CGCHCV1d ( 144-130 ) TTG GAT AAC CCC GCTHCV1f ( 143-129 ) TGG ATC TAA CCG CTCHCV2 ( 139-125 ) TAA ACC CAC TCT ATGHCV2 ( 83-69 ) TAG CGT TGG GTT GCGHCV2a ( 128-114 ) TAT GCC CGG TCA TTTHCV2b ( 168-154 ) TTA CCG GAA AGA CTGHCV2c ( 126-112 ) TGC CCG GCC ATT TGGHCV2d ( 129-115 ) CTA TGC CTG GTC ATTHCV2e ( 101-87 ) GCA AGA CCG CTA GCCHCV3 ( 170-156 ) AAT CGC TGG GGT GACHCV3 ( 129-114 ) CAA TAC CCA GAA ATT THCV3 ( 103-89 ) CCG CGA GAT CAC TAGHCV3a ( 146-132 ) TCT TGG AGC AAC CCGHCV3d ( 145-132 ) CTT GGA ACA AAC CCGHCV3f ( 145-132 ) CTT GGA ATC AAC CCGHCV4 ( 244-229 ) GAG TGT TGT ACA GCC THCV4 ( 170-156 ) AAT CGC CGG GAT GACHCV4bg ( 127-113 ) ATG CCC GGC AAT TTGHCV4e ( 144-129 ) TTG GAT TAA ACC GCT CHCV5a ( 243-229 ) AGT GTC GAA CAG CCTHCV6ab ( 147-136 ) TTC CAT TGG ATC AAAHCV6a ( 242-228 ) GTG TCG TAC AGC CTCHCV10a ( 168-154 ) TCG CCG GGT TGA CCG
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB001221620A CN1167812C (en) | 2000-07-23 | 2000-07-23 | Biochip for typing non-coding region gene of hepatitis C virus HCV5' |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB001221620A CN1167812C (en) | 2000-07-23 | 2000-07-23 | Biochip for typing non-coding region gene of hepatitis C virus HCV5' |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1335410A true CN1335410A (en) | 2002-02-13 |
| CN1167812C CN1167812C (en) | 2004-09-22 |
Family
ID=4589133
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNB001221620A Expired - Fee Related CN1167812C (en) | 2000-07-23 | 2000-07-23 | Biochip for typing non-coding region gene of hepatitis C virus HCV5' |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1167812C (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102766701A (en) * | 2012-07-04 | 2012-11-07 | 福州泰普生物科学有限公司 | Kit and method for genotyping of hepatitis C virus |
| CN105986040A (en) * | 2015-01-28 | 2016-10-05 | 苏州新波生物技术有限公司 | Kit for HCV virus genotyping detection and SNP locus detection of IL28B, use method and application thereof |
| CN105986038A (en) * | 2015-01-28 | 2016-10-05 | 苏州新波生物技术有限公司 | Kit for HCV virus genotyping detection, use method and application thereof |
| CN106011308A (en) * | 2016-02-15 | 2016-10-12 | 利多(香港)有限公司 | Hepatitis C virus genotyping detection kit, oligonucleotide and application thereof |
-
2000
- 2000-07-23 CN CNB001221620A patent/CN1167812C/en not_active Expired - Fee Related
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102766701A (en) * | 2012-07-04 | 2012-11-07 | 福州泰普生物科学有限公司 | Kit and method for genotyping of hepatitis C virus |
| CN105986040A (en) * | 2015-01-28 | 2016-10-05 | 苏州新波生物技术有限公司 | Kit for HCV virus genotyping detection and SNP locus detection of IL28B, use method and application thereof |
| CN105986038A (en) * | 2015-01-28 | 2016-10-05 | 苏州新波生物技术有限公司 | Kit for HCV virus genotyping detection, use method and application thereof |
| CN106011308A (en) * | 2016-02-15 | 2016-10-12 | 利多(香港)有限公司 | Hepatitis C virus genotyping detection kit, oligonucleotide and application thereof |
| CN106011308B (en) * | 2016-02-15 | 2021-12-24 | 利多(香港)有限公司 | Hepatitis C virus genotyping detection kit, oligonucleotide and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN1167812C (en) | 2004-09-22 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Smith et al. | Variation of the hepatitis C virus 5′ non-coding region: implications for secondary structure, virus detection and typing | |
| CA1339262C (en) | Detection of human papillomavirus by the polymerase chain reaction | |
| Davidson et al. | Survey of major genotypes and subtypes of hepatitis C virus using RFLP of sequences amplified from the 5′ non-coding region | |
| JP4920686B2 (en) | Method for detecting human papillomavirus using nucleic acid amplification method and carrier for immobilizing nucleic acid chain | |
| WO2005005658A1 (en) | Methods and compositions for detecting sars virus and other infectious agents | |
| Schroter et al. | Genotyping of hepatitis C virus types 1, 2, 3, and 4 by a one-step LightCycler method using three different pairs of hybridization probes | |
| WO2008018859A2 (en) | Diagnostic kit for determining genotypes of a human papilloma virus and method of using thereof | |
| CN1455819A (en) | Nucleic acid relating to disease | |
| Lindh et al. | Genotyping of hepatitis C virus by Taqman real-time PCR | |
| Gharizadeh et al. | Viral and microbial genotyping by a combination of multiplex competitive hybridization and specific extension followed by hybridization to generic tag arrays | |
| Kurkela et al. | Molecular diagnostic techniques | |
| Andonov et al. | Subtyping of hepatitis C virus isolates by a line probe assay using hybridization | |
| CN1335410A (en) | Biochip for typing non-coding region gene of hepatitis C virus HCV5' | |
| Hsia et al. | Microarray multiplex assay for the simultaneous detection and discrimination of hepatitis B, hepatitis C, and human immunodeficiency type-1 viruses in human blood samples | |
| Lareu et al. | Rapid and sensitive genotyping of hepatitis C virus by single-strand conformation polymorphism | |
| WO2010078291A1 (en) | Primers and probes for detecting hepatitis c virus | |
| Umlauft et al. | Hepatitis C virus detection by single-round PCR specific for the terminal 3'noncoding region | |
| Haushofer et al. | Genotyping of hepatitis C virus—comparison of three assays | |
| CN1059910A (en) | A kind of novel method that detects pathogenic agent with dna probe | |
| Krekulova et al. | Nested restriction site-specific PCR to detect and type hepatitis C virus (HCV): a rapid method to distinguish HCV subtype 1b from other genotypes | |
| Fox et al. | Rapid genotyping of hepatitis C virus isolates by dideoxy fingerprinting | |
| CN101333559A (en) | Hepatitis B e antigen immune escaping detecting gene chip and kit thereof | |
| CN201083740Y (en) | Hepatitis B e antigen immune escape detection gene chip and its reagent kit | |
| CN2909246Y (en) | Investigating kit of hepatitis five integral gene | |
| CN2901314Y (en) | Glass gene chip for detecting respiratory tract virus |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C06 | Publication | ||
| PB01 | Publication | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C19 | Lapse of patent right due to non-payment of the annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |