CN1302880A - Polypeptide-human shearing factor 25 and polynucleotide for coding it - Google Patents
Polypeptide-human shearing factor 25 and polynucleotide for coding it Download PDFInfo
- Publication number
- CN1302880A CN1302880A CN99119898A CN99119898A CN1302880A CN 1302880 A CN1302880 A CN 1302880A CN 99119898 A CN99119898 A CN 99119898A CN 99119898 A CN99119898 A CN 99119898A CN 1302880 A CN1302880 A CN 1302880A
- Authority
- CN
- China
- Prior art keywords
- polypeptide
- polynucleotide
- sequence
- factor
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
Landscapes
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Gastroenterology & Hepatology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Medicinal Chemistry (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Toxicology (AREA)
- Peptides Or Proteins (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
A new polypeptide-human shearing factor 25, the polynucleotide for encoding it, the process for preparing said polypeptide by DNA recombination, the application of said polypeptide to treating several diseases (cancer, HIV infection, etc.), the antagonist against the said polypeptide and its medical action, and the usage of said polynucleotide for encoding this polypeptide are disclosed.
Description
The invention belongs to biological technical field, specifically, the invention describes a kind of new polypeptide--human shear factor 25, and the polynucleotide sequence of this polypeptide of encoding.The invention still further relates to the preparation method and the application of these polynucleotide and polypeptide.
All have one group of identical gene expressing in the various cell of higher eucaryote, this group gene is called as housekeeping gene.The housekeeping gene of higher eucaryote has about 10000, and the function of these genes all is essential for each cell.But function, expression scope and the expression intensity of housekeeping gene in various cells has nothing in common with each other again, thereby they are bringing into play different separately functions in different histocytes.The gene of coding splicing factor 1 is the intravital housekeeping gene of higher organism, people have cloned and have obtained a plurality of essential HSF 1 genes, these splicing factors 1 are compared discovery, and they are the different protein products that formed through alternative splicing by common precursor mRNA.The gene of coding splicing factor 1 is about 15kb, and contains 14 exons, and the structure of its exon and interior apparent son and the sequence of splice site are high conservatives.Discover that further in the people, the SF1 expression of gene forms pattern 1 (MEN1) expression of gene corresponding [Kramer A., Quentin M.et al., Gene, 1998,211 (1): 29-37] with muitiple endocrine neoplasms.MEN1 is the gene of autosomal dominant inheritance disease-related, it shows as the hamartoplasia relevant with endocrine organ's (as: parathyroid gland, pancreas, incretory gland, prepituitary gland etc.) or relevant [Tatsushj Toda takes place tumour, Arioshi lida et al., Human MolecularGenetics, 1994,3 (3): 465-470].As from the foregoing, the generation with some tumours is relevant probably in vivo for splicing factor 1.
Gene people ZFM1 (zinc-finger motif 1) gene that is otherwise known as of coding splicing factor 1 in the people, it can produce splicing factor 1 protein products of different sizes by different alternative splicings.Different ZFM1/SF1 protein products is formed by tangible several structural domains, and these structural domains are that N-terminal contains a nucleus signal for locating; One hnRNP K (KH) structural domain; The zone of one zinc finger domain and proline rich.The splicing factor product of different sizes may contain different structural domains, and has different biological functions.Signal sequence is being controlled splicing factor in endonuclear correct location and transportation; The KH structural domain then relates to the synthetic and metabolism of regulating RNA, discovers that this structural domain differentiation with tumour cell in vivo is relevant, and the process after it may transcribe and transcribe by interference is come the differentiation of regulate tumor cell; Some SF1 albumen also have zinc finger protein KRAB structural domain, this structural domain relevant with tumor inhibition effect [Coyini N., Tamburin G., et al., European Journal of Neuroscience, 1999 (11): 781-787].Thereby SF1 albumen plays an important role in vivo, and it is relevant with the MEN1 expression of gene, is regulating the differentiation of organism inner tumour cell, with the generation of malignant diseases such as control tumour.Research is also found, splicing factor is high expression level in the caused brain injury tissue because of local asphyxia, its may with relevant [the Covini N. of reparation after the brain local asphyxia damage, Tamburin G., et al., European Journal of Neuroscience, 1999,11:781-787], this factor expression will cause the pathology of brain tissue unusually, thereby cause various brain malignant diseases.The SF1 factor also may play an important role in the generation of fetal development ovum and neural growth course, its abnormal expression will cause generation and neural disease [KramerA., Quentin M.et al., the Gene of some birth defects diseases, 1998,211:29-37].
New albumen of the present invention and people ZFM1/SF1 albumen and mouse ZFM1 albumen all have higher homology, and the N-terminal of its aminoacid sequence and people ZFM1/SF1 albumen and the proteic N-terminal of mouse ZFM1 are in full accord, contain a signal sequence and hnRNP K (KH) structural domain, thereby think that this new albumen is a new montage product of HSF's gene, with its called after HSF 25.And infer that with this its splicing factor different with the people is similar, have corresponding biological function by its constitutional features.
An object of the present invention is to provide isolating new polypeptide--human shear factor 25 with and fragment, analogue and derivative.
Another object of the present invention provides the polynucleotide of this polypeptide of coding.
Another object of the present invention provides the recombinant vectors of the polynucleotide that contain the human shear factor 25 of encoding.
Another object of the present invention provides the genetically engineered host cell of the polynucleotide that contain the human shear factor 25 of encoding.
Another object of the present invention provides the method for producing human shear factor 25.
Another object of the present invention provides at polypeptide of the present invention--the antibody of human shear factor 25.
Another object of the present invention has provided at polypeptide of the present invention--the simulated compound of human shear factor 25, antagonist, agonist, inhibitor.
Another object of the present invention provides the method for the unusual relevant disease of diagnoses and treatment and human shear factor 25.
In a first aspect of the present invention, novel isolated human shear factor 25 is provided, this polypeptide is the people source, and it comprises: have the polypeptide of SEQ ID NO:2 aminoacid sequence or its conservative property variation polypeptide or its active fragments or its reactive derivative, analogue.Preferably, this polypeptide is the polypeptide with SEQ ID NO:2 aminoacid sequence.
In a second aspect of the present invention, the polynucleotide of isolating these polypeptide of coding are provided, these polynucleotide comprise a nucleotide sequence, and this nucleotide sequence is shown at least 100% homogeny with a kind of nucleotides sequence that is selected from down group: (a) polynucleotide of the above-mentioned human shear factor 25 of coding; (b) with polynucleotide (a) complementary polynucleotide.Preferably, this polynucleotide encoding has the polypeptide of aminoacid sequence shown in the SEQ ID NO:2.More preferably, the sequence of these polynucleotide is be selected from down group a kind of: the sequence that (a) has 35-715 position among the SEQ ID NO:1; (b) has the sequence of 1-1183 position among the SEQ ID NO:1.
In a third aspect of the present invention, the carrier that contains above-mentioned polynucleotide is provided, and has been transformed or host cell of transduceing or the host cell that is directly transformed or transduce by above-mentioned polynucleotide by this carrier.
Others of the present invention are because disclosing of the technology of this paper is conspicuous to those skilled in the art.
As used herein, " isolating " are meant that material separates (if natural substance, primal environment promptly is a natural surroundings) from its primal environment.Do not have separation and purification as polynucleotide under the native state in the active somatic cell and polypeptide, but same polynucleotide or polypeptide as from native state with in other materials that exist separately, then for separation and purification.
As used herein, " isolating human shear factor 25 " is meant that human shear factor 25 is substantially free of natural relative other albumen, lipid, carbohydrate or other material.Those skilled in the art can use the purified technology of protein purifying human shear factor 25 of standard.Basically pure polypeptide can produce single master tape on non-reduced polyacrylamide gel.The purity of human shear factor 25 polypeptide can be used amino acid sequence analysis.
The invention provides a kind of new polypeptide--human shear factor 25, it is made up of the aminoacid sequence shown in the SEQ ID NO:2 basically.Polypeptide of the present invention can be recombinant polypeptide, natural polypeptides, synthetic polypeptide, preferred recombinant polypeptide.Polypeptide of the present invention can be the product of natural purifying, or the product of chemosynthesis, or uses recombinant technology to produce from protokaryon or eucaryon host (for example, bacterium, yeast, higher plant, insect and mammalian cell).The host used according to the recombinant production scheme, polypeptide of the present invention can be glycosylated, maybe can be nonglycosylated.Polypeptide of the present invention also can comprise or not comprise initial methionine residues.
The present invention also comprises fragment, derivative and the analogue of human shear factor 25.As used herein, term " fragment ", " derivative " and " analogue " are meant biological function or the active polypeptide that keeps human shear factor of the present invention 25 identical basically.The fragment of polypeptide of the present invention, derivative or analogue can be: (I) is a kind of like this, wherein one or more amino-acid residues are replaced by conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the amino acid that replaces can be also can not encoded by genetic codon; Perhaps (II) is a kind of like this, and certain group on wherein one or more amino-acid residues is replaced by other group and comprises substituting group; Perhaps (III) is a kind of like this, and wherein mature polypeptide and another kind of compound (such as the compound that prolongs the polypeptide transformation period, for example polyoxyethylene glycol) merge; Perhaps (IV) is a kind of like this, wherein additional aminoacid sequence is integrated into mature polypeptide and the peptide sequence that forms (as leader sequence or secretion sequence or be used for the sequence or the proteinogen sequence of this polypeptide of purifying) by the elaboration of this paper, such fragment, derivative and analogue are considered within those skilled in the art's ken.
The invention provides isolating nucleic acid (polynucleotide), substantially the polynucleotide that have a polypeptide of SEQ ID NO:2 aminoacid sequence by coding are formed.Polynucleotide sequence of the present invention comprises the nucleotide sequence of SEQ ID NO:1.Polynucleotide of the present invention are to find from the cDNA library of people's fetal brain tissue.The polynucleotide sequence total length that it comprises is 1183 bases, its open reading frame (35--715) 226 amino acid of having encoded.Find relatively that according to amino acid sequence homologous this polypeptide and people's ZFM1 albumen has 100% homology, deducibility goes out the 26S Proteasome Structure and Function that this human shear factor 25 has people's ZFM1 protein similar.
Polynucleotide of the present invention can be dna form or rna form.Dna form comprises the DNA of cDNA, genomic dna or synthetic.DNA can be strand or double-stranded.DNA can be coding strand or noncoding strand.The coding region sequence of encoding mature polypeptide can be identical with the coding region sequence shown in the SEQ ID NO:1 or the varient of degeneracy.As used herein, " varient of degeneracy " are meant that in the present invention coding has protein or the polypeptide of SEQ ID NO:2, but with the differentiated nucleotide sequence of coding region sequence shown in the SEQ ID NO:1.
The polynucleotide of the mature polypeptide of coding SEQ ID NO:2 comprise: the encoding sequence that has only mature polypeptide; The encoding sequence of mature polypeptide and various additional code sequence; Encoding sequence of mature polypeptide (with optional additional code sequence) and non-coding sequence.
Term " polynucleotide of coded polypeptide " is meant polynucleotide that comprise this polypeptide of encoding and the polynucleotide that comprise additional code and/or non-coding sequence.
The invention still further relates to the varient of foregoing description polynucleotide, its coding has the polypeptide of identical aminoacid sequence or segment, analogue and the derivative of polypeptide with the present invention.The varient of these polynucleotide can be the allelic variant of natural generation or the varient that non-natural takes place.These nucleotide diversity bodies comprise and replace varient, deletion mutation body and insert varient.As known in the art, allelic variant is the replacement form of polynucleotide, and it may be replacement, disappearance or the insertion of one or more Nucleotide, but can be from not changing the function of its encoded polypeptides in fact.
The invention still further relates to and the polynucleotide (have at least 50% between two sequences, preferably have 70% homogeny) of sequence hybridization described above.The present invention be more particularly directed under stringent condition and the interfertile polynucleotide of polynucleotide of the present invention.In the present invention, " stringent condition " is meant: (1) than hybridization under low ionic strength and the comparatively high temps and wash-out, as 0.2 * SSC, and 0.1%SDS, 60 ℃; Or (2) hybridization the time adds and to use denaturing agent, as 50% (v/v) methane amide, 0.1% calf serum/0.1%Ficoll, 42 ℃ etc.; Or (3) only at the homogeny between the two sequences at least more than 95%, be more preferably 97% and just hybridize when above.And the polypeptide of interfertile polynucleotide encoding has identical biological function and activity with the mature polypeptide shown in the SEQ ID NO:2.
The invention still further relates to nucleic acid fragment with sequence hybridization described above.As used herein, " nucleic acid fragment " length contain 10 Nucleotide at least, better be 20-30 Nucleotide at least, be more preferably 50-60 Nucleotide at least, preferably more than at least 100 Nucleotide.Nucleic acid fragment also can be used for the amplification technique (as PCR) of nucleic acid to determine and/or to separate the polynucleotide of coding human shear factor 25.
Polypeptide among the present invention and polynucleotide preferably provide with isolating form, more preferably are purified to homogeneous.
The special polynucleotide sequence of coding human shear factor 25 of the present invention can obtain with several different methods.For example, separate polynucleotide with hybridization technique well known in the art.These technology including, but not limited to: 1) with probe and genome or the hybridization of cDNA library to detect homologous polynucleotide sequence and 2) antibody screening of expression library to be to detect the polynucleotide passage of the clone with common structure feature.
Sequence dna fragment of the present invention also can obtain with following method: 1) separate double chain DNA sequence from genomic dna; 2) the chemical synthesising DNA sequence is to obtain the double-stranded DNA of described polypeptide.
In the above-mentioned method of mentioning, isolation of genomic DNA is least commonly used.The direct chemical of dna sequence dna is synthetic to be the method for often selecting for use.The more frequent method of selecting for use is the separation of cDNA sequence.The standard method that separates interested cDNA is from the donorcells separating mRNA of this gene of high expression level and carries out reverse transcription, forms plasmid or phage cDNA library.Extract the existing multiple proven technique of method of mRNA, test kit also can obtain (Qiagene) from commercial channels.And the construction cDNA library also is usual method (Sambrook, et al., MolecularCloning, A Laboratory Manual, Cold Spring Harbor Laboratory.New York, 1989).Also can obtain the cDNA library of commercial offers, as the different cDNA library of Clontech company.When being used in combination the polymeric enzyme reaction technology, even few expression product also can be cloned.
Available ordinary method is screened gene of the present invention from these cDNA libraries.These methods include, but is not limited to: (1) DNA-DNA or DNA-RNA hybridization; (2) appearance of marker gene function or forfeiture; (3) level of the transcript of mensuration human shear factor 25; (4), detect the protein product of genetic expression by immunological technique or mensuration biologic activity.Aforesaid method can singly be used, but also several different methods combined utilization.
In (1) kind method, hybridizing used probe is and any a part of homology of polynucleotide of the present invention that at least 10 Nucleotide of its length better are at least 30 Nucleotide, are more preferably at least 50 Nucleotide, preferably at least 100 Nucleotide.In addition, within 2000 Nucleotide, preferable is within 1000 Nucleotide to the length of probe usually.Probe used herein is the dna sequence dna of chemosynthesis on the basis of gene order information of the present invention normally.Gene of the present invention itself or fragment are certainly as probe.The mark of dna probe can be used radio isotope, fluorescein or enzyme (as alkaline phosphatase) etc.
In (4) kind method, detect the protein product of human shear factor 25 genetic expressions and can use immunological technique such as Western blotting, radioimmunoprecipitation, enzyme-linked immunosorbent assay (ELISA) etc.
Use method (Saiki, the et al.Science1985 of round pcr DNA amplification/RNA; 230:1350-1354) be optimized for acquisition gene of the present invention.When particularly being difficult to from the library, obtain the cDNA of total length, can preferably use RACE method (the terminal rapid amplifying method of RACE-cDNA), the primer that is used for PCR can suitably be selected according to polynucleotide sequence information of the present invention disclosed herein, and available ordinary method is synthetic.Available ordinary method is as the DNA/RNA fragment by gel electrophoresis separation and purifying amplification.
The gene of the present invention that obtains as mentioned above, perhaps the polynucleotide sequence of various dna fragmentations etc. can with ordinary method such as dideoxy chain termination (Sanger et al.PNAS, 1977,74:5463-5467) measure.This class polynucleotide sequence is measured also available commercial sequencing kit etc.In order to obtain the cDNA sequence of total length, order-checking need be carried out repeatedly.Sometimes need to measure a plurality of clones' cDNA sequence, just can be spliced into the cDNA sequence of total length.
The present invention also relates to comprise the carrier of polynucleotide of the present invention, and the host cell that produces through genetically engineered with the carrier of the present invention or the shearing factor 25 encoding sequence of directly choosing, and the method that produces polypeptide of the present invention through recombinant technology.
Among the present invention, the polynucleotide sequence of coding human shear factor 25 can be inserted in the carrier, contains the recombinant vectors of polynucleotide of the present invention with formation.Term " carrier " refers to that bacterial plasmid well known in the art, phage, yeast plasmid, vegetable cell virus, mammalian cell virus are as adenovirus, retrovirus or other carrier.The carrier of Shi Yonging includes but not limited in the present invention: and the expression vector based on the T7 promotor of in bacterium, expressing (Rosenberg, et al.Gene, 1987,56:125); The pMSXND expression vector of in mammalian cell, expressing (Lee and Nathans, J Bio Chem.263:3521,1988) and at the carrier that derives from baculovirus of expressed in insect cells.In a word, as long as can duplicate in host and stablize, any plasmid and carrier may be used to make up recombinant expression vector.A key character of expression vector is to contain replication origin, promotor, marker gene and translational control element usually.
Method well-known to those having ordinary skill in the art can be used to make up the dna sequence dna that contains the human shear factor 25 of encoding and the expression vector of suitable transcribing/translational control element.These methods comprise (Sambroook, et al.Molecular Cloning, a LaboratoryManual, cold Spring Harbor Laboratory.New York, 1989) such as extracorporeal recombinant DNA technology, DNA synthetic technology, the interior recombinant technologys of body.Described dna sequence dna can effectively be connected on the suitable promotor in the expression vector, and is synthetic to instruct mRNA.The representative example of these promotors has: colibacillary lac or trp promotor; The P of lambda particles phage
LPromotor; Eukaryotic promoter comprises LTRs and some other known may command gene expression promoter in prokaryotic cell prokaryocyte or eukaryotic cell or its virus of CMV immediate early promoter, HSV thymidine kinase promoter, early stage and late period SV40 promotor, retrovirus.Expression vector also comprises ribosome bind site that translation initiation is used and transcription terminator etc.Inserting enhancer sequence in carrier will make its transcribing in higher eucaryotic cells be enhanced.Enhanser is the cis acting factor that DNA expresses, and nearly 10 to 300 base pairs act on promotor transcribing with enhancing gene usually.Can for example be included in the SV40 enhanser of 100 to 270 base pairs of replication origin side in late period one, at the polyoma enhanser of replication origin side in late period one and adenovirus enhanser etc.
In addition, expression vector preferably comprises one or more selected markers, to be provided for selecting the phenotypic character of transformed host cells, cultivate Tetrahydrofolate dehydrogenase, neomycin resistance and the green fluorescent protein (GFP) of usefulness as eukaryotic cell, or be used for colibacillary tsiklomitsin or amicillin resistance etc.
Persons skilled in the art all know how to select appropriate carriers/transcriptional regulatory element (as promotor, enhanser etc.) and selected marker.
Among the present invention, the polynucleotide of coding human shear factor 25 or the recombinant vectors that contains these polynucleotide can transform or transduce into host cell, contain the genetically engineered host cell of these polynucleotide or recombinant vectors with formation.Term " host cell " refers to prokaryotic cell prokaryocyte, as bacterial cell; Or eukaryotic cell such as low, as yeast cell; Or higher eucaryotic cells, as mammalian cell.Representative example has: intestinal bacteria, streptomyces; Bacterial cell such as Salmonella typhimurium; Fungal cell such as yeast; Vegetable cell; Insect cell such as fruit bat S2 or Sf9; Zooblast such as CHO, COS or Bowes melanoma cells etc.
Can carry out with routine techniques well known to those skilled in the art with dna sequence dna of the present invention or the recombinant vectors transformed host cell that contains described dna sequence dna.When the host was prokaryotic organism such as intestinal bacteria, the competent cell that can absorb DNA can be used GaGl in exponential growth after date results
2Method is handled, and used step is well-known in this area.Alternative is to use MgCl
2If desired, transforming also the method for available electroporation carries out.When the host is an eukaryote, can select following DNA transfection method for use: coprecipitation of calcium phosphate method, perhaps conventional mechanical method such as microinjection, electroporation, liposome packing etc.
By the recombinant DNA technology of routine, utilize polynucleotide sequence of the present invention to can be used to express or produce human shear factor 25 (Science, 1984 of reorganization; 224:1431).In general following steps are arranged:
(1). with the polynucleotide (or varient) of everybody shearing factor 25 of coding of the present invention, or transform or the transduction proper host cell with the recombinant expression vector that contains these polynucleotide;
(2). in suitable medium, cultivate host cell;
(3). separation, protein purification from substratum or cell.
In step (2), according to used host cell, used substratum can be selected from various conventional substratum in the cultivation.Under the condition that is suitable for the host cell growth, cultivate.After host cell grows into suitable cell density, induce the promotor of selection with suitable method (as temperature transition or chemical induction), cell is cultivated for some time again.
In step (3), recombinant polypeptide can wrap and be expressed or be secreted into the extracellular in cell or on cytolemma.If desired, can utilize its physics, the separating by various separation methods with other characteristic and the albumen of purification of Recombinant of chemistry.These methods are well-known to those skilled in the art.These methods include, but are not limited to: conventional renaturation is handled, protein precipitant is handled (salt analysis method), centrifugal, the broken bacterium of infiltration, the combination of ultrasonication, super centrifugal, sieve chromatography (gel-filtration), adsorption chromatography, ion exchange chromatography, high performance liquid chromatography (HPLC) and other various liquid chromatography (LC) technology and these methods.
The antagonist of polypeptide of the present invention and this polypeptide, agonist and inhibitor can be directly used in disease treatment, for example, can treat malignant tumour, adrenal gland defect, tetter, all kinds of inflammation, HIV infection and immunological disease etc.
Specifically with regard to HSF 25 of the present invention, this proteic expression is corresponding with muitiple endocrine neoplasms formation pattern 1 expression of gene, and it is low excessively in the intravital expression of people, then may cause the generation of the tumour of some endocrine systems; Therefore polypeptide of the present invention can be used for the diagnosis and the treatment of a lot of diseases, as various associated endocrine system carcinomas, these diseases include but not limited to the following stated, pituitary adenoma, thyroid benign tumour, thyroid carcinoma, parathyroid adenoma, parathyroid carcinoma, suprarenal gland myelolipoma, pheochromocytoma, islet cells tumour, multiple endocrine neoplasm, thymus neoplasms etc.
HSF 25 of the present invention also plays an important role in generation of fetal development ovum and nervous system development process, its abnormal expression may cause some growth disorders and neural diseases, these diseases include but not limited to following these, spina bifida, the cranium fissure, anencephalia, the brain bulging, the hole deformity of brain, the Down syndromes, congenital hydrocephalus, the aqueduct deformity, achondroplastic dwarf's disease, spondyloepiphyseal dysplasia disease, pseudocartilage underdevelopment disease, the Langer-Giedion syndromes, chonechondrosteron, hypogenitalism, adrenal,congenital hyperplasia, epispadia, latent, with malformation syndrome of short and small stature such as Conradi syndromes and Danbolt-Closs syndromes, retinal development is unusual, atrophia nervi optici congenita, congenital sensory nerve hearing loss, monster, the Williams syndromes, the A1agille syndromes, shellfish syndrome Weis two, neurofibromatosis, tuberous sclerosis, encephalotrigeminal angiomatosis, ataxia telangiectasia, trigeminal neuralgia, facioplegia, bulbar paralysis, sciatica, Green-barre syndrome etc.
Research finds that also splicing factor is high expression level in the caused brain injury tissue because of local asphyxia, thereby, it also may relevant [Covini N., Tamburin G., et al. with the reparation after the brain injury, EuropeanJournal of Neuroscience, 1999 (11): 781-787].
The present invention also provides SCREENED COMPOUND to identify the method that improves (agonist) or check the medicament of (antagonist) human shear factor 25.Agonist improves human shear factor 25 biological function such as stimulate cellular proliferation, and antagonist prevention disorder such as the various cancer relevant with cell hyperproliferation with treatment.For example, can in the presence of medicine, the film preparation of mammalian cell or expressing human shearing factor 25 be cultivated with the human shear factor 25 of mark.Measure the medicine raising then or check this interactional ability.
The antagonist of human shear factor 25 comprises antibody, compound, acceptor disappearance thing and the analogue etc. that filter out.The antagonist of human shear factor 25 can combine and eliminate its function with human shear factor 25, or suppresses the generation of this polypeptide, or combines with the avtive spot of this polypeptide and to make this polypeptide can not bring into play biological function.
In screening during as the compound of antagonist, human shear factor 25 can be added during bioanalysiss measure, determine to interactional influence between human shear factor 25 and its acceptor whether compound is antagonist by measuring compound.With the same quadrat method of above-mentioned SCREENED COMPOUND, can filter out the acceptor disappearance thing and the analogue of antagonist action.Can be incorporated into the rondom polypeptide storehouse that solid formation forms by the various amino acid that may make up by screening with human shear factor 25 bonded peptide molecules obtains.During screening, generally tackle human shear factor 25 molecules and carry out mark.
The invention provides and use polypeptide, and fragment, derivative, analogue or their cell are as the method for antigen with production antibody.These antibody can be polyclonal antibody or monoclonal antibody.The present invention also provides the antibody at human shear factor 25 antigenic determinants.These antibody include, but is not limited to: the fragment that polyclonal antibody, monoclonal antibody, chimeric antibody, single-chain antibody, Fab fragment and Fab expression library produce.
The method of the available human shear factor 25 direct injection immune animals of the production of polyclonal antibody (as rabbit, mouse, rat etc.) obtains, and multiple adjuvant can be used for the enhancing immunity reaction, includes but not limited to freund's adjuvant etc.The technology of monoclonal antibody of preparation human shear factor 25 include but not limited to hybridoma technology (Kohler andMilstein.Nature, 1975,256:495-497), three knurl technology, people B-quadroma technology, EBV-hybridoma technology etc.With the variable region bonded chimeric antibody in human constant region and inhuman source can with existing technology production (Morrison et al, PNAS, 1985,81:6851).And the technology of existing manufacture order chain antibody (U.S.Pat No.4946778) also can be used for producing the single-chain antibody of anti-human shear factor 25.
The antibody of anti-human shear factor 25 can be used in the immunohistochemistry technology, detects the human shear factor 25 in the biopsy specimen.
With the also available labelled with radioisotope of human shear factor 25 bonded monoclonal antibodies, inject in the body and can follow the tracks of its position and distribution.This radiolabeled antibody can be used as a kind of atraumatic diagnostic method and is used for the location of tumour cell and has judged whether transfer.
Antibody also can be used for designing the immunotoxin at a certain privileged sites in the body.As the monoclonal antibody of human shear factor 25 high-affinities can with bacterium or plant poison (as diphtheria toxin, ricin, abrine etc.) covalent attachment.A kind of usual method is with sulfydryl linking agent such as SPDP, attacks the amino of antibody, by the exchange of disulfide linkage, toxin is incorporated on the antibody, and this hybrid antibody can be used for killing human shear factor 25 positive cells.
The disease that antibody among the present invention can be used for treating or prevention and human shear factor 25 are relevant.The antibody that gives suitable dosage can stimulate or block the generation or the activity of human shear factor 25.
The invention still further relates to the diagnostic testing process of quantitative and detection and localization human shear factor 25 levels.These tests are known in the art, and comprise that FISH measures and radioimmunoassay.Human shear factor 25 levels that detected in the test can be with laying down a definition the importance of human shear factor 25 in various diseases and be used to the disease of diagnosing human shear factor 25 to work.
Polypeptide of the present invention also can be used as the peptide spectrum analysis, for example, the polypeptide available physical, chemistry or enzyme carry out the specificity cutting, and carries out the two-dimentional or three-dimensional gel electrophoresis analysis of one dimension, be more preferably and carry out mass spectroscopy.
The polynucleotide of coding human shear factor 25 also can be used for multiple therapeutic purpose.Gene therapy technology can be used for treating because cell proliferation, growth or the metabolic disturbance due to the nothing expression of human shear factor 25 or the unusual/non-activity expression.The gene therapy vector (as virus vector) of reorganization can be designed for the human shear factor 25 of expressing variation, to suppress endogenic human shear factor 25 activity.For example, a kind of human shear factor 25 of variation can be the human shear factor 25 that shortens, lacked signal conduction function territory, though can combine with the substrate in downstream, lacks signaling activity.Therefore the gene therapy vector of reorganization can be used for treating the disease of human shear factor 25 expression or active caused by abnormal.Deriving from viral expression vector such as retrovirus, adenovirus, adeno-associated virus (AAV), hsv, parvovirus etc. can be used for the polynucleotide of coding human shear factor 25 are transferred in the cell.The method of recombinant viral vector that structure carries the polynucleotide of coding human shear factor 25 is found in existing document (Sambrook, et al.).The polynucleotide of reorganization coding human shear factor 25 can be packaged in the liposome and be transferred in the cell in addition.
Polynucleotide import tissue or intracellular method comprises: directly be injected into polynucleotide in the in-vivo tissue; Or external by carrier (as virus, phage or plasmid etc.) earlier with the polynucleotide transfered cell in, again cell is transplanted in the body etc.
Suppress the oligonucleotide (comprising sense-rna and DNA) of human shear factor 25 mRNA and ribozyme also within the scope of the invention.Ribozyme is the enzyme sample RNA molecule that a kind of energy specificity is decomposed specific RNA, and its mechanism of action is to carry out the endonuclease effect after ribozyme molecule and the hybridization of complementary target RNA-specific.The RNA of antisense and DNA and ribozyme can obtain with existing any RNA or DNA synthetic technology, as the technology widespread use of solid phase phosphoamide chemical synthesis synthetic oligonucleotide.Antisense rna molecule can be transcribed acquisition by the dna sequence dna of this RNA that encodes in external or body.This dna sequence dna has been incorporated into the downstream of rna polymerase promoter of carrier.In order to increase the stability of nucleic acid molecule, available several different methods is modified it, and as increasing the sequence length of both sides, the connection between the ribonucleoside is used phosphoric acid thioester bond or peptide bond but not phosphodiester bond.
The polynucleotide of coding human shear factor 25 can be used for the diagnosis with the relative disease of human shear factor 25.The unconventionality expression of the expression that the polynucleotide of coding human shear factor 25 can be used for detecting human shear factor 25 people's shearing factor 25 whether or under morbid state.As the dna sequence dna of the human shear factor 25 of encoding can be used for biopsy specimen is hybridized to judge the expression situation of human shear factor 25.Hybridization technique comprises the Southern blotting, Northern blotting, in situ hybridization etc.These technological methods all are disclosed mature technologies, and relevant test kit all can obtain from commercial channels.Part or all of polynucleotide of the present invention can be used as probe stationary on microarray (Microarray) or DNA chip (being called " gene chip " again), is used for analyzing the differential expression analysis and the gene diagnosis of tissue gene.The special primer of personnel selection shearing factor 25 carries out the transcription product that RNA-polymerase chain reaction (RT-PCR) amplification in vitro also can detect human shear factor 25.
The sudden change that detects human shear factor 25 genes also can be used for diagnosing the relevant disease of human shear factor 25.The form of human shear factor 25 sudden change comprises that the point mutation compared with normal wild type human shear factor 25 dna sequence dnas, transposition, disappearance, reorganization and other are any unusual etc.Available existing technology such as Southern blotting, dna sequence analysis, PCR and in situ hybridization detect sudden change.In addition, sudden change might influence proteic expression, therefore can judge indirectly that with Northern blotting, Western blotting gene has or not sudden change.
Sequence of the present invention identifies it also is valuable to karyomit(e).This sequence can be specifically at certain bar human chromosome particular location and and can with its hybridization.At present, need to identify the concrete site of each gene on the karyomit(e).Now, have only chromosomal marker thing seldom to can be used for the marker chromosomes position based on actual sequence data (repetition polymorphism).According to the present invention, for these sequences are associated with disease related gene, its important the first step is positioned these dna sequence dnas on the karyomit(e) exactly.
In brief, prepare PCR primer (preferred 15-35bp), sequence can be positioned on the karyomit(e) according to cDNA.Then, these primers are used for the somatocyte hybrid cell that the PCR screening contains each bar human chromosome.Have only those hybrid cells that contain corresponding to the people's gene of primer can produce the fragment of amplification.
The PCR localization method of somatocyte hybrid cell is that DNA is navigated to concrete chromosomal quick method.Use Oligonucleolide primers of the present invention,, can utilize one group to realize inferior location from specific chromosomal fragment or a large amount of genomic clone by similar approach.Other the similar strategy that can be used for chromosomal localization comprises in situ hybridization, uses the karyomit(e) prescreen and the hybridization preliminary election of the airflow classification of mark, thereby makes up the special cDNA storehouse of karyomit(e).
The cDNA clone is carried out fluorescence in situ hybridization (FISH) with Metaphase Chromosome, can in a step, accurately carry out chromosomal localization.The summary of this technology is referring to Verma etc., Human Chromosomes:a Manualof Basic Techniques, Pergamon Press, New York (1988).
In case sequence is positioned to chromosome position accurately, the physical location of this sequence on karyomit(e) just can be associated with the gene map data.These data for example are found in, V.Mckusick, MendelianInheritance in Man (can by with the online acquisition of Johns Hopkins University Welch Medical Library).Can pass through linkage analysis then, determine gene and navigated to relation between the disease on the chromosomal region already.
Then, need to measure ill and not cDNA between diseased individuals or genome sequence difference.If observe certain sudden change in some or all of diseased individuals, and this sudden change is not observed in any normal individual, then this sudden change may be the cause of disease of disease.More ill and diseased individuals not is usually directed at first seek the variation of structure in the karyomit(e), as from the horizontal visible of karyomit(e) or use based on detectable disappearance of the PCR of cDNA sequence or transposition.Resolving power according to present physical mapping and assignment of genes gene mapping technology, being accurately positioned to the cDNA of the chromosomal region relevant with disease, can be a kind of (the supposing that 1 megabasse mapping resolving power and every 20kb are corresponding to a gene) between 50 to 500 potential Disease-causing genes.
Polypeptide of the present invention, polynucleotide and stand-in thereof, agonist, antagonist and inhibitor and suitable pharmaceutical carrier combination back can be used.These carriers can be water, glucose, ethanol, salt, damping fluid, glycerine and their combination.Composition comprises the polypeptide or the antagonist of safe and effective amount and carrier and the vehicle that does not influence effect of drugs.These compositions can be used as medicine and are used for disease treatment.
The present invention also provides medicine box or the test kit that contains one or more containers, and one or more medicinal compositions compositions of the present invention are housed in the container.With these containers, can have by the given indicative prompting of government authorities of making, using or selling medicine or biological products, the government authorities that this prompting reflects production, uses or sells permits it to use on human body.In addition, polypeptide of the present invention can be used in combination with other treatment compound.
Pharmaceutical composition can be with mode administration easily, as by in part, intravenously, intraperitoneal, intramuscular, subcutaneous, the nose or the route of administration of intracutaneous.Human shear factor 25 comes administration with the amount that treats and/or prevents concrete indication effectively.The amount and the dosage range that are applied to patient's human shear factor 25 will depend on many factors, as administering mode, person's to be treated healthiness condition and diagnostician's judgement.
Following accompanying drawing is used to illustrate specific embodiments of the present invention, and is not used in qualification by the scope of the invention that claims defined.
Fig. 1 is the proteic amino acid sequence homology comparison diagram of inventor's shearing factor 25 and people's ZFM1.The top sequence is a human shear factor 25, and the below sequence is people's a ZFM1 albumen.Same amino acid represents with monocase amino acid that between two sequences similar amino acid is represented with "+".
Fig. 2 is the polyacrylamide gel electrophoresis figure (SDS-PAGE) of isolating human shear factor 25.25kDa is proteinic molecular weight.The arrow indication is isolated protein band.
Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in and limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, usually according to people such as normal condition such as Sambrook, molecular cloning: laboratory manual (New York:ColdSpring Harbor Laboratory Press, 1989) condition described in, or the condition of advising according to manufacturer.Embodiment 1: the clone of human shear factor 25
Extract the total RNA of people's tire brain with guanidinium isothiocyanate/phenol/chloroform single stage method.From total RNA, separate poly (A) mRNA with Quik mRNA Isolation Kit (Qiegene company product).2ug poly (A) mRNA forms eDNA through reverse transcription.CDNA fragment orientation is inserted on the multiple clone site of pBSK (+) carrier (Clontech company product) with Smart cDNA clone's test kit (available from Clontech), transforms DH5 α, bacterium forms the cDNA library.Measure all clones' 5 ' and 3 ' terminal sequence with Dyeterminate cycle reaction sequencing kit (Perkin-Elmer company product) and ABI 377 automatic sequencers (Perkin-Elmer company).CDNA sequence and the existing public dna sequence data storehouse (Genebank) measured are compared, found that the cDNA sequence of one of them clone 0891F03 is new DNA.By synthetic a series of primers the contained insertion cDNA fragment of this clone is carried out two-way mensuration.The result shows, the contained full-length cDNA of 0891F03 clone is 1183bp (shown in Seq ID NO:1), from 35bp to 715bp the open reading frame (ORF) of a 681bp, the new protein (shown in SeqID NO:2) of encoding arranged.We are with this clone's called after pBS-0891F03, encoded protein matter called after human shear factor 25.
Embodiment 2:cDNA clone's homology retrieval
With the sequence and the encoded protein sequence thereof of human shear factor 25 of the present invention, with Blast program (BasiclocalAlignment search tool) [Altschul, SF et al.J.Mol.Biol.1990; 215:403-10], carry out the homology retrieval at databases such as Genbank, Swissport.The gene the highest with human shear factor 25 homologys of the present invention is a kind of known people's ZFM1 albumen, and its encoded protein number is D26120 in the access of Genbank.Protein homology the results are shown in Fig. 1, both height homologies, and its homogeny is 100%; Similarity is 100%.Embodiment 3: with the gene of RT-PCR method clones coding human shear factor 25
Total RNA is a template with fetus brain cell, is that primer carries out the synthetic cDNA of reverse transcription reaction with oligo-dT, with behind the test kit purifying of Qiagene, carries out pcr amplification with following primer:
Primer1: 5’-AAAGCAGGTGCCGGTGCCTGTC-3’(SEQ?ID?NO:3)
Primer2: 5’-AAAAACCACACTGCTCTTTTAT-3’(SEQ?ID?NO:4)
Primer1 is the forward sequence that begins of 1bp that is positioned at the 5 ' end of SEQ ID NO:1;
Primer2 be SEQ ID NO:1 in 3 ' end reverse sequence.
The condition of amplified reaction: in the reaction volume of 50 μ l, contain 50mmol/L KCl, 10mmol/L Tris-Cl, (pH8.5), 1.5mmol/L MgCl
2, 200 μ mol/L dNTP, 10pmol primer, the Taq archaeal dna polymerase of 1U (Clontech company product).Go up by 25 cycles of following conditioned response at PE9600 type DNA thermal cycler (Perkin-Elmer company): 94 ℃ of 30sec; 55 ℃ of 30sec; 72 ℃ of 2min.When RT-PCR, establish the blank negative contrast of positive contrast of β-actin and template simultaneously.Amplified production is connected to (Invitrogen company product) on the pCR carrier with the test kit purifying of QIAGEN company with TA clone test kit.The dna sequence analysis result shows that the dna sequence dna of PCR product and the 1-1183bp shown in the SEQ ID NO:1 are identical.Embodiment 4:Northern blotting analyst shearing factor 25 expression of gene:
Extract total RNA[Anal.Biochem 1987,162,156-159 with single stage method].This method comprises acid guanidine thiocyanate phenol-chloroform extracting.Promptly use 4M guanidinium isothiocyanate-25mM Trisodium Citrate, 0.2M sodium acetate (pH4.0) carries out homogenate to tissue, adds the phenol of 1 times of volume and the chloroform-primary isoamyl alcohol (49: 1) of 1/5 volume, and is centrifugal after mixing.The sucking-off aqueous phase layer adds Virahol (0.8 volume) and with the centrifugal RNA precipitation that obtains of mixture.With RNA precipitation 70% washing with alcohol that obtains, dry and soluble in water.With 20 μ g RNA, on 1.2% sepharose that contains 20mM 3-(N-morpholino) propanesulfonic acid (pH7.0)-5mM sodium acetate-1mM EDTA-2.2M formaldehyde, carry out electrophoresis.Be transferred on the nitrocellulose filter then.With α-
32P dATP prepares by random priming
32The dna probe of P-mark.Used dna probe is human shear factor 25 coding region sequences (35bp to 715bp) of pcr amplification shown in Figure 1.Will
32The probe of P-mark (about 2 * 10
6Cpm/ml) spend the night in 42 ℃ of hybridization in a solution with the nitrocellulose filter that has shifted RNA, this solution comprises 50% methane amide-25mM KH
2PO
4(pH7.4)-5 * SSC-5 * Denhardt ' s solution and 200 μ g/ml salmon sperm DNAs.After the hybridization, filter membrane is washed 30min in 55 ℃ in 1 * SSC-0.1%SDS.Then, analyze with quantitative with Phosphor Imager.Embodiment 5: the vivoexpression of recombinant human shearing factor 25, separation and purifying
According to SEQ ID NO:1 and coding region sequence shown in Figure 1, design a pair of specificity amplification primer, sequence is as follows:
Primer3:5’-CCCCATATGATGGCGACCGGAGCGAACGCCAC-3’(Seq?ID?No:5)
Primer4:5’-CCCGGATCCTTAAAAAACCCCACGCTTTAAAC-3’(Seq?ID?No:6)
5 ' end of these two sections primers contains Nde I and BamH I restriction enzyme site respectively, be respectively the encoding sequence of target gene 5 ' end and 3 ' end thereafter, Nde I and BamH I restriction enzyme site are corresponding to expression vector plasmid pET-28b (+) (Novagen company product, Cat.No.69865.3) the selectivity restriction enzyme site on.With the pBS-0891F03 plasmid that contains the total length goal gene is template, carries out the PCR reaction.The PCR reaction conditions is: contain pBS-0891F03 plasmid 10pg, primer Primer-3 and Primer-4 among the cumulative volume 50 μ l and be respectively 10pmol, Advantage polymerase Mix (Clontech company product) 1 μ l.Loop parameter: 94 ℃ of 20s, 60 ℃ of 30s, 68 ℃ of 2min, totally 25 circulations.Respectively amplified production and plasmid pET-28 (+) are carried out double digestion with Nde I and BamH I, reclaim big fragment respectively, and connect with the T4 ligase enzyme.Connect product and transform, after the dull and stereotyped overnight incubation of the LB that contains kantlex (final concentration 30 μ g/ml), use the colony polymerase chain reaction (PCR) method screening positive clone, and check order with the big enterobacterial DH5 of Calcium Chloride Method α.Select the correct positive colony of sequence (pET-0891F03) with Calcium Chloride Method with recombinant plasmid transformed e. coli bl21 (DE3) plySs (Novagen company product).In the LB liquid nutrient medium that contains kantlex (final concentration 30 μ g/ml), host bacterium BL21 (pET-0891F03) is cultured to logarithmic phase at 37 ℃, adds IPTG to final concentration 1mmol/L, continues to cultivate 5 hours.Centrifugal collection thalline, through the broken bacterium of ultrasonic wave, centrifugal collection supernatant with carrying out chromatography with 6 Histidines (6His-Tag) bonded affinity column His.Bind Quick Cartridge (Novagen company product), has obtained the target protein human shear factor 25 of purifying.Through the SDS-PAGE electrophoresis, obtain a single band (Fig. 2) at the 25kDa place.This band is transferred on the pvdf membrane carries out the n terminal amino acid sequential analysis with the Edams hydrolysis method, 15 amino acid of N-end hold 15 amino-acid residues identical with the N-shown in the SEQ ID NO:2 as a result.Embodiment 6 anti-human shear factor 25 production of antibodies
Synthesize following human shear factor 25 specific polypeptide with Peptide synthesizer (PE company product):
NH
2-Met-Ala-Thr-Gly-Ala-Asn-Ala-Thr-Pro-Leu-Asp-Phe-Pro-Ser-Lys-COOH(SEQ?ID?NO:7)。Form compoundly with hemocyanin and bovine serum albumin coupling this polypeptide respectively, method is referring to Avrameas, et al.Immunochemistry, 1969; 6:43.Add the complete Freund's adjuvant immunizing rabbit with the above-mentioned hemocyanin polypeptide complex of 4mg, add the incomplete Freund's adjuvant booster immunization once with the hemocyanin polypeptide complex again after 15 days.Employing is done the titre that ELISA measures antibody in the rabbit anteserum through the titer plate of 15 μ g/ml bovine serum albumin polypeptide complex bag quilts.From the rabbit anteserum of antibody positive, separate total IgG with albumin A-Sepharose.Polypeptide is incorporated on the Sepharose4B post of cyanogen bromide-activated, from total IgG, separates anti-peptide antibody with affinity chromatography.Immuno-precipitation proof antibody purified can combine with human shear factor 25 specifically.
Sequence table (1) general information:
(ⅱ) denomination of invention: human shear factor 25 and encoding sequence thereof
(ⅲ) sequence number: the information of 7 (2) SEQ ID NO:1:
(ⅰ) sequence signature:
(A) length: 1183bp
(B) type: nucleic acid
(C) chain: two strands
(D) topological framework: linearity
(ⅱ) molecule type: cDNA
( ⅹⅰ ) :SEQ ID NO:1: 1 AAAGCAGGTGCCGGTGCCTGTCCCCGGGGGCGCCATGGCGACCGGAGCGAACGCCACGCC 61 GTTGGACTTCCCAAGTAAGAAGCGGAAGAGGAGCCGCTGGAACCAAGACACAATGGAACA121 GAAGACAGTGATTCCAGGAATGCCTACAGTTATTCCCCCTGGACTTACTCGAGAACAAGA181 AAGAGCTTATATAGTGCAACTGCAGATAGAAGACCTGACTCGTAAACTGCGCACAGGAGA241 CCTGGGCATCCCCCCTAACCCTGAGGACAGGTCCCCTTCCCCTGAGCCCATCTACAATAG301 CGAGGGGAAGCGGCTTAACACCCGAGAGTTCCGCACCCGCAAAAAGCTGGAAGAGGAGCG361 GCACAACCTCATCACAGAGATGGTTGCACTCAATCCGGATTTCAAGCCACCTGCAGATTA421 CAAACCTCCAGCAACACGTGTGAGTGATAAAGTCATGATTCCACAAGATGAGTACCCAGA481 AATCAACTTTGTGGGGCTGCTCATCGGGCCCAGAGGGAACACCCTGAAGAACATAGAGAA541 GGAGTGCAATGCCAAGATTATGATCCGGGGGAAAGGGTCTGTGAAAGAAGGGAAGGTTGG601 GCGCAAAGATGGTTTTGGGCAAGGGCTTTGGCCATTCATGTCAAGCTGGTTGTGGGTTTT661 TCAAGGTGCCATAGCCACCCCCAAATATGTTTGTTTAAAGCGTGGGGTTTTTTAATCTCT721 GCCACCCTTGTCAAGGGAGTCTTGTAAAGTTGCCGAGGATAGGTTCATCTCCAGGTTTCG781 GGATTCCCATCCGTCCTGGCGATCCTGCCAGCAGTGGGTGGGCAGCCTGAGCTCCCTCGG841 GCTCGCCTGCCAGCCTGGAGTTCTTCCTGTGCTCCTTGATCACCTGAGCTGCCTCAGATT901 CCATTTGGTCCTCTCCTTCCTGGAAGGCTTCCTTTTATGTTTTGTTTTAATCCCAAATGT 961 CTGAATGTTTTGCAGTGTGTAGGGGTTTGAGCCCCTTGTTCATTCTCCTTCCTTTTTCCT1021 CCCGCTTCCCTCTCCATGAAGTGATTCTGTTGACAATAATGTATACTGCGCGTTCTCTTC1051 ACTGGTTTATCTGCAGAAATTTCTCTGGGCTTTTTTCGGTGTTAGATTCAACACTGCGGT1141 AAAGCGGGGATGTTCCATTGAATAAAAGAGCAGTGTGGTTTTT ( 3 ) SEQ ID NO:2:
(ⅰ) sequence signature:
(A) length: 226 amino acid
(B) type: amino acid
(D) topological framework: linearity
(ⅱ) molecule type: polypeptide
( ⅹⅰ ) :SEQ ID NO:2: 1 Met Ala Thr Gly Ala Asn Ala Thr Pro Leu Asp Phe Pro Ser Lys 16 Lys Arg Lys Arg Ser Arg Trp Asn Gln Asp Thr Met Glu Gln Lys 31 Thr Val Ile Pro Gly Met Pro Thr Val Ile Pro Pro Gly Leu Thr 46 Arg Glu Gln Glu Arg Ala Tyr Ile Val Gln Leu Gln Ile Glu Asp 61 Leu Thr Arg Lys Leu Arg Thr Gly Asp Leu Gly Ile Pro Pro Asn 76 Pro Glu Asp Arg Ser Pro Ser Pro Glu Pro Ile Tyr Asn Ser Glu 91 Gly Lys Arg Leu Asn Thr Arg Glu Phe Arg Thr Arg Lys Lys Leu106 Glu Glu Glu Arg His Asn Leu Ile Thr Glu Met Val Ala Leu Asn121 Pro Asp Phe Lys Pro Pro Ala Asp Tyr Lys Pro Pro Ala Thr Arg136 Val Ser Asp Lys Val Met Ile Pro Gln Asp Glu Tyr Pro Glu Ile151 Asn Phe Val Gly Leu Leu Ile Gly Pro Arg Gly Asn Thr Leu Lys166 Asn Ile Glu Lys Glu Cys Ash Ala Lys Ile Met Ile Arg Gly Lys181 Gly Ser Val Lys Glu Gly Lys Val Gly Arg Lys Asp Gly Phe Gly196 Gln Gly Leu Trp Pro Phe Met Ser Ser Trp Leu Trp Val Phe Gln211 Gly Ala Ile Ala Thr Pro Lys Tyr Val Cys Leu Lys Arg Gly Val226 Phe ( 4 ) SEQ ID NO:3
(ⅰ) sequence signature
(A) length: 22 bases (B) type: nucleic acid (C) chain: strand (D) topological framework: linearity
(ⅱ) molecule type: oligonucleotide
(ⅹ ⅰ) sequence description: the information of SEQ ID NO:3:AAAGCAGGTGCCGGTGCCTGTC 22 (5) SEQ ID NO:4
(ⅰ) sequence signature
(A) length: 22 bases
(B) type: nucleic acid
(C) chain: strand
(D) topological framework: linearity
(ⅱ) molecule type: oligonucleotide
(ⅹ ⅰ) sequence description: the information of SEQ ID NO:4:AAAAACCACACTGCTCTTTTAT 22 (6) SEQ ID NO:5
(ⅰ) sequence signature
(A) length: 32 bases
(B) type: nucleic acid
(C) chain: strand
(D) topological framework: linearity
(ⅱ) molecule type: oligonucleotide
(ⅹ ⅰ) sequence description: the information of SEQ ID NO:5:CCCCATATGATGGCGACCGGAGCGAACGCCAC 32 (7) SEQ ID NO:6
(ⅰ) sequence signature
(A) length: 32 bases
(B) type: nucleic acid
(C) chain: strand
(D) topological framework: linearity
(ⅱ) molecule type: oligonucleotide
(ⅹ ⅰ) sequence description: the information of SEQ ID NO:6:CCCGGATCCTTAAAAAACCCCACGCTTTAAAC 32 (8) SEQ ID NO:7:
(ⅰ) sequence signature:
(A) length: 15 amino acid
(B) type: amino acid
(D) topological framework: linearity
(ⅱ) molecule type: polypeptide
(ⅹ ⅰ) sequence description: SEQ ID NO:7:Met-Ala-Thr-Gly-Ala-Asn-Ala-Thr-Pro-Leu-Asp-Phe-Pro-Ser-Lys 15
Claims (18)
1, a kind of isolated polypeptide-human shear factor 25 is characterized in that it includes: shown in the SEQ ID NO:2
The polypeptide of aminoacid sequence or active fragments, analogue or the derivative of its polypeptide.
2, polypeptide as claimed in claim 1 is characterized in that the amino acid of described polypeptide, analogue or derivative
Sequence has the homogeny with the aminoacid sequence at least 95% shown in the SEQ ID NO:2.
3, polypeptide as claimed in claim 2 is characterized in that it comprises and has the amino shown in the SEQ ID NO:2
The polypeptide of acid sequence.
4, a kind of isolating polynucleotide, it is characterized in that described polynucleotide comprise be selected from down the group in a kind of:
(a) coding have aminoacid sequence shown in the SEQ ID NO:2 polypeptide or its fragment, analogue, derive
The polynucleotide of thing; Or
(b) with polynucleotide (a) complementary polynucleotide.
5, polynucleotide as claimed in claim 4 is characterized in that described polynucleotide comprise coding and have SEQ
The polynucleotide of aminoacid sequence shown in the ID NO:2.
6, polynucleotide as claimed in claim 4 is characterized in that the sequence of described polynucleotide includes SEQ ID
The sequence of 1-1183 position among the sequence of 35-715 position or the SEQ ID NO:1 among the NO:1.
7, a kind of recombinant vectors that contains exogenous polynucleotide is characterized in that it is by appointing among the claim 4-6
The recombinant vectors that described polynucleotide of one claim and plasmid, virus or vehicle expression vector establishment form.
8, a kind of genetically engineered host cell that contains exogenous polynucleotide, it is characterized in that it be selected from following
A kind of host cell:
(a) host cell that transforms or transduce with the described recombinant vectors of claim 7; Or
(b) host cell that transforms or transduce with the described polynucleotide of the arbitrary claim among the claim 4-6.
9, a kind of preparation method with human shear factor 25 active polypeptide is characterized in that described method comprises:
(a) under expressing human shearing factor 25 condition, cultivate the described through engineering approaches host cell of claim 8;
(b) from culture, isolate and have human shear factor 25 active polypeptide.
10, a kind of can with polypeptide bonded antibody, it is characterized in that described antibody be can with human shear factor 25 specificitys
Bonded antibody.
11, an analoglike or regulate polypeptide active or the compound of expression, it is characterized in that they are simulations, promote,
The active compound of antagonism or inhibition human shear factor 25.
12, compound as claimed in claim 11 is characterized in that it is the multinuclear glycosides shown in the SEQ ID NO:1
Acid sequence or its segmental antisense sequences.
13, the described application of compound of a kind of claim 11 is characterized in that described compound is used for the mediator and cuts
Cut the factor 25 in vivo, the method for external activity.
14, a kind of detect with claim 1-3 in relevant disease or the disease-susceptible humans of the described polypeptide of arbitrary claim
The property method, it is characterized in that it comprises the described polypeptide expression amount that detects, perhaps detect the activity of described polypeptide,
Perhaps detect and cause described expression of polypeptides amount or active unusual nucleotide diversity in the polynucleotide.
15,, it is characterized in that it is applied to sieve as the application of polypeptide as described in the arbitrary claim among the claim 1-3
Choose stand-in, the agonist of shearing factor 25, antagonist or inhibitor; Perhaps be used for peptide finger printing mirror
Fixed.
16,, it is characterized in that its work as the application of the described nucleic acid molecule of arbitrary claim among the claim 4-6
For primer is used for nucleic acid amplification reaction, perhaps be used for hybridization as probe, perhaps be used to make gene chip
Or microarray.
17, as the described polypeptide of arbitrary claim, polynucleotide or compound in claim 1-6 and 11
Use, it is characterized in that with described polypeptide, polynucleotide or its stand-in, agonist, antagonist or inhibitor
Form as diagnosis or treatment and human shear factor 25 different with safe and effective dosage and pharmaceutically acceptable carrier
The pharmaceutical composition of normal disease of being correlated with.
18, the described polypeptide of arbitrary claim, polynucleotide or the compound among the claim 1-6 and 11 should
With, it is characterized in that being used for the treatment of as malignant tumour blood with described polypeptide, polynucleotide or compound
Disease, the medicine of HIV infection and immunological disease and all kinds of inflammation.
Priority Applications (3)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN99119898A CN1302880A (en) | 1999-10-28 | 1999-10-28 | Polypeptide-human shearing factor 25 and polynucleotide for coding it |
PCT/CN2000/000387 WO2001030825A1 (en) | 1999-10-28 | 2000-10-27 | A novel polypeptide-human splicing factor 25 and the polynucleotide encoding said polypeptide |
AU12650/01A AU1265001A (en) | 1999-10-28 | 2000-10-27 | A novel polypeptide-human splicing factor 25 and the polynucleotide encoding said polypeptide |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN99119898A CN1302880A (en) | 1999-10-28 | 1999-10-28 | Polypeptide-human shearing factor 25 and polynucleotide for coding it |
Publications (1)
Publication Number | Publication Date |
---|---|
CN1302880A true CN1302880A (en) | 2001-07-11 |
Family
ID=5281189
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN99119898A Pending CN1302880A (en) | 1999-10-28 | 1999-10-28 | Polypeptide-human shearing factor 25 and polynucleotide for coding it |
Country Status (3)
Country | Link |
---|---|
CN (1) | CN1302880A (en) |
AU (1) | AU1265001A (en) |
WO (1) | WO2001030825A1 (en) |
-
1999
- 1999-10-28 CN CN99119898A patent/CN1302880A/en active Pending
-
2000
- 2000-10-27 AU AU12650/01A patent/AU1265001A/en not_active Abandoned
- 2000-10-27 WO PCT/CN2000/000387 patent/WO2001030825A1/en active Application Filing
Also Published As
Publication number | Publication date |
---|---|
WO2001030825A1 (en) | 2001-05-03 |
AU1265001A (en) | 2001-05-08 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN1302897A (en) | Polypeptide-human phosphodiesterase 21 similar to acidic sphingomyelinase and polynucleotide for coding it | |
CN1302880A (en) | Polypeptide-human shearing factor 25 and polynucleotide for coding it | |
CN1302881A (en) | Polypeptide-human beta-galactoside binding protein and polynucleotide for coding it | |
CN1303939A (en) | Novel polypeptide-transcription factor 43 and polynucleotide coding said polypeptide | |
CN1470524A (en) | Polypeptide-human transcriptional elongation factor IIS51 and polynucleotide encoding this polypeptide | |
CN1303930A (en) | Novel polypeptide-zinc finger protein 57 and polynucleotide coding said polypeptide | |
CN1302879A (en) | Polypeptide-human F-actin binding factor 75 and polynucleotide for coding it | |
CN1292385A (en) | New polypeptide-human DNA-PK interaction protein 75 and polynucleotide coding this polypeptide | |
CN1302815A (en) | Polypeptide-human COP9 compound subunit 30 and polynucleotide for coding it | |
CN1302874A (en) | Polypeptide-translation initiation factor helper factor 28 and polynucleotide for coding it | |
CN1303944A (en) | Novel polypeptide-threonine synthetase 71 and polynucleotide coding said polypeptide | |
CN1296968A (en) | Polypeptide-human karyon regulatory protein 56 and polynucleotide for coding said polypeptide | |
CN1477123A (en) | A polypeptide-transcription factor 43 and polynucleotide coding said polypeptide | |
CN1303938A (en) | Novel polypeptide-human MATH37 and polynucleotide coding said polypeptide | |
CN1302886A (en) | Polypeptide-human cell wither correlated protein 12 and polynucleotide for coding it | |
CN1302867A (en) | Polypeptide-human transposase 105 and polynucleotide for coding it | |
CN1302871A (en) | Polypeptide-human vacuolus proton-adenosine triphosphatase C subunit 42 and polynucleotide for coding it | |
CN1302887A (en) | Polypeptide-dyein light-medium chain 58 and polynucleotide for coding it | |
CN1302882A (en) | Polypeptide-human ankyrin 27 and polynucleotide for coding it | |
CN1303865A (en) | Novel polypeptide-human vasicentric protein 69 and polynucleotide for coding said polypeptide | |
CN1302889A (en) | Polypeptide-human protein 70 containing plasmolemma regulation function and polynucleotide for coding it | |
CN1303936A (en) | Novel polypeptide-zinc finger protein 56 and polynucleotide coding said polypeptide | |
CN1302898A (en) | Polypeptide-human phosphatidase 14 and polynucleotide for coding it | |
CN1302885A (en) | Polypeptide-human autoimmune disease correlated protein 16 and polynucleotide for coding it | |
CN1303945A (en) | Novel polypeptide-serine/threonine kinase 39 and polynucleotide coding said polypeptide |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C06 | Publication | ||
PB01 | Publication | ||
C12 | Rejection of a patent application after its publication | ||
RJ01 | Rejection of invention patent application after publication |