CN1276777C - SARS vaccine of adenovirus vector and preparation method, application of coronavirus S gene - Google Patents

Abstract

The present invention belongs to the field of genetic engineering, particularly relates to adenoviral vector SARS vaccines, their preparation and coronavirus S genes in SARS (SARS) on vaccines for the prophylaxis. By means of biological engineering, the coronavirus S gene in combination with deficient recombinant adenovirus, the protective immunogen protein or polypeptide expressed therein, through expansion culture, purification, and formulation to prepare a mucosal immunogenicity can cause the gene vaccine, respiratory mucosal immune response induced by the body to produce antibodies against the virus infection. Specific conditions of the present invention, compared with conventional inactivated virus particle vaccine, safe, easy to use, without limitation intramuscular, have broad clinical applications.

Description

Adenoviral vector vaccine and its preparation method SARS coronavirus S gene with

I. Technical Field The present invention belongs to the field of genetic engineering, particularly relates to adenoviral vector SARS vaccines, their preparation and coronavirus S gene disclosed in the application of the preparation of vaccines against SARS (SARS).

Second, the technical background

China Guangdong region from the end of last year, the outbreak of atypical pneumonia (atypical pneumonia), the incidence of acute, contagious, antibiotic treatment ineffective. At present, the disease has spread to more than 30 countries and regions, WHO has been named for severe acute respiratory syndrome (severe acuterespiratory syndrome, SARS).

At present, scientists in many countries around the world independently isolated from different patient serum to a new type of coronavirus (coronavirus), viral gene sequence analysis showed that they are known coronavirus 50% to 60% homology, world Health Organization (WHO) has announced that the SARS pathogen is causing mutant coronavirus.

Is a non-segmental coronavirus positive strand RNA viruses whose genome near 30KB, can be spread in humans and animals, primary infection of the respiratory system in humans and animals, a coronavirus having an inner core particles and coating the capsule virus, there are four structural proteins: a spike protein (spike, S), membrane protein (membrance, M), envelope proteins (envelop, E), and nucleoprotein (nucleoprotein, N). Because coronavirus is an RNA virus, very unstable and prone to mutation to evade the host's immune surveillance and exclusion. Therefore, we must find a good SARS-associated coronavirus in stability and has a protective immune antigen for the development of relevant vaccines.

Currently rarely used viral particles inactivated vaccine, because the whole virus particles carrying the virus genome, larger security concerns. Although previous coronavirus easy to obtain in vitro, but the SARS-associated coronavirus highly toxic and genetic background is not entirely clear, and therefore large scale production of coronavirus particles is not feasible. The development of genetic engineering technology provides great convenience for the development of subunit vaccines, biological and operability and safety of subunit vaccines is good. If viral antigen screening immunogenic determinants, combined with genetic engineering techniques, can easily be modified to epitopes in order to enhance its stability, immunogenicity, biological safety. Clearly, the aid of genetic engineering techniques, can easily effective subunit vaccine preparation.

The present study shows that the four known coronavirus structural proteins, spike protein (spike S) is a structural protein of inducing a protective immune response, some scholars studies have confirmed the structure of coronavirus spike protein C-terminus antigenic determinants where, at the same time, SARS-associated coronavirus infection caused by respiratory tract, but has yet to have a vaccine to prevent SARS.

Further, the data show, the adenovirus itself is susceptible to respiratory mucosa, respiratory mucosa easier to induce an immune response, and immune adenoviral expression vector for expression in a host cell original, processing, folding, modification, presenting substantially maintained immunogen native conformation, high biological activity.

The condition provides a solid theoretical foundation for the use of defective adenovirus as a vector development and production of adenovirus SARS vaccine.

III. SUMMARY OF THE INVENTION

A first object of the present invention is to provide adenoviral vaccine can prevent SARS epidemic "SARS", the better to prevent "SARS" the occurrence and spread; a further object of the present invention to provide a using as deficient adenoviral vector, by cloning, recombinant and other means, adenoviral vector disclosed SARS vaccine preparation and use of vaccines SARS-associated coronavirus S gene in the manufacture.

Object of the present invention is achieved: by means of biological engineering, the S gene of SARS-associated coronavirus (CoV total of four structural gene, wherein one of the S gene, see detailed description below) in combination with deficient recombinant adenovirus, constitute a gene vaccine can cause mucosal immunogenicity.

As used Spike gene fragment sequence: Using the S gene sequence (Gene bank accession number: gbAY278554.2) Gene bank as published as a template, in accordance with the sequence PCR primers were designed as follows: V1 GGTCTAGAGT TGTGGTTTCA AGTGATV2 TTTCTAGACC ATGGGTTGTG TCCTTGCTV3 TTTCTAGACC ATGGCATATA GGTTCAATGV4 TAGGTACCAA TGCCAGTAGT GGTGV5 TTGGTACCTC CGCCTCGACT TTV6 CCGGTACCAT AAGTTCGTTT ATGTGT wherein a pair of V1 and V4, the S gene amplified N-terminal fragment; V2 and V5 as a pair of primers, M S gene amplified fragment; V3 and V6 to a pair of primers, amplification of gene S C-terminal fragment (FIG. 1), the structure of Figure 2 after amplification.

Preparation of adenovirus SARS vaccine: First, collect co rehabilitation patient serum separation, total RNA was obtained by separation and extraction of coronavirus, the S gene obtained by reverse transcription, sequencing, selection and other steps. Subsequently, the S gene was cloned into the plasmid pShuttle resulting clone (Accession: China Center for Type Culture Collection; Date of Deposit: May 17, 2003; deposit number: CCTCC M 203036 E.coliDH5a / pShuttle-SN and CCTCC M 203037 E.coli DH5a / pShuttle-SC), which is then connected to the adenoviral backbone plasmid (pAdeno-XTM) (wherein pShuttle, pAdeno-X were purchased from CLONTECH Laboratory, Inc, USA). After co-transfected 293 cells is connected, after further purification identification, a large number of amplification in 293 cells, the virus was collected, separated and purified, namely adenovirus SARS vaccine. It may be made of other forms of agents or spray. The main technical route shown in Figure 4.

The present invention is a genetically engineered vaccine, i.e., using a gene-defective adenovirus vaccine vector, which per se is susceptible to respiratory mucosal epithelium as adenoviral vectors, the protective immunogen protein or polypeptide expressed therein, induced respiratory mucosal immune response; mucosal immunity by inducing a reaction, the body to produce antibodies against the virus infection. Present invention compared with the conventional vaccine inactivated virus particles, it is safe, and easy to use, certain other conditions are not restricted by intramuscular injection.

Currently, SARS spread rapidly around the world, as a viral infection, has not yet found the drug can now be effectively treated, in this case, prevention is the best means. It has been proved antigenic determinants where the SARS-associated coronavirus spike protein for its C-terminus. Accordingly, the present invention is based on this discovery, the synthesis of SARS-associated coronavirus spike protein gene was cloned into an adenovirus vector, culturing after amplification, purification, formulation is made effective to produce an antibody capable of inducing mucosal, humoral immunity to prevent virus infection of the body, with a wide range of clinical applications.

IV BRIEF DESCRIPTION

Figure 1 is a schematic view of the S gene amplified fragment.

FIG 2 is a recombinant defective adenovirus having a configuration diagram of the S gene (Spike-S) of.

FIG 3 is pShuttle-Sc, pShuttle-SM, pShuttle-SN recombinant enzyme results.

FIG 4 is a pShuttle-Sc, pShuttle-SM, pShuttle-SN recombinant sequencing results.

FIG 5 is a test result of FIG expression by RT-PCR, and Ad-SN Ad-SM 6 is a test result of the expression of Ad-SN FIG. 7 is a Western blot analysis Ad-SN are injected or induced respiratory female rats immunized to produce antibodies (IgG) the results of the in vivo expression of FIG. 8 is expressed in vivo test results of FIG Ad-SN are injected or respiratory immunity was induced in male rats to produce specific antibody (IgG) 9 is a roadmap of the vaccine preparation of the present invention.

V. DETAILED DESCRIPTION

The following will further illustrate specific embodiments of the present invention.

Example 1 Preparation method of adenoviral vector vaccine embodiment of SARS: after obtaining the SARS-associated coronavirus spike (SF, SN, SM, SC) Gene: Construction of pre-: Preparation of adenovirus vector construct SARS vaccine pre and post-amplification is divided into two parts , by PCR amplification, by PCR after digestion with Xbal + Kpnl 37 ℃, while the pShuttle digested with this enzyme, ligation, transformation of E. coli DH5a, kanamycin (the KanR) screening positive clones resistant, culture, after purification pSF / SN / SM / SC-Shuttle, with l-Ceul + Pl-Scel enzyme, while the enzyme digested with pAdeno-XTM, the ligated, transformed into E. coli DH5a, using ampicillin (Amp + ) to obtain positive clones resistant pAd-SF / SN / SM / SC.

Expanding culture: obtained pAd-SF / SN / SM / SC after then by Pacl digested plasmid was transfected into a packaging cell warps, the packaging cell is a C alkylene integrated type 5 adenovirus (the Ad5) gene region E1 cells line (line), for example, 293 cells. After plaque screening, PCR identification of Ad-SF / SN / SM / SC, a large number of cultured 293 cells with Ad-SF / SN / SM / SC 293 infected cells, was purified by cesium chloride, preparations step, i.e., adenovirus get SARS vaccine.

SARS vaccine containing SARS-associated coronavirus gene and S and deficient adenovirus. Deficient adenovirus E1 region is completely deleted subclass C adenovirus type 5, i.e., Ad5. The deficient adenoviral E3 region may be partially or completely deleted or without deletion. Built-deficient adenovirus The CMV promoter and BGHpolyA.

Ad-SF / SN / SM / SC is cloned into a SARS-associated coronavirus S gene of the full-length adenoviral vector.

Cloned into the adenoviral vector comprises a sequence including the S1 domain of SARS-associated coronavirus S gene.

Cloned into the adenoviral vector comprises a sequence including the S2 domain of SARS-associated coronavirus S gene.

Cloned into the adenoviral vector is a SARS-associated coronavirus S gene comprising S1, S2 domain including the sequence (number of bases: 49 to 3585).

Cloned into the adenoviral vector is a SARS-associated coronavirus S gene transmembrane region (base numbers: 3686 ~ 3648) and a C-terminal fragment.

Example 2 Cloning of the SARS-associated coronavirus S gene N terminal fragment of the adenoviral vector. Remaining the same as in Example 1.

Example 3 Cloning of the S gene of coronavirus is SARS-associated middle segment of the adenoviral vector. Remaining the same as in Example 1.

Cloned into the adenoviral vector is a SARS-associated coronavirus S gene C-terminal fragment of the fourth embodiment.

Remaining the same as in Example 1.

Example 5S gene transfer and identification of plasmid pShuttle: 37 [deg.] C with a water bath Kpnl + Xbal digestion conditions, while pShuttle digested with this enzyme, ligation, transformation of E. coli DH5a, culture, kanamycin (the KanR) positive resistance screening clones, respectively pShuttle-Sc, pShuttle-SM, pShuttle-SN, via conventional agar gel electrophoresis and detection sequence identification, results shown in Figure 3, Figure 4.

Example 6 clones obtained Ad-SN / SM in vitro expression experiments.

With 2.5 ~ 40MOI VeroE6 infected cells, the virus suspension was discarded, the cell culture medium was added, cultured at 37 ℃, 5% CO2 conditions at 48h post-infection in the culture supernatants were collected, Ad-Sn were detected by RT-PCR method, and Ad-Snm expression level detected in Ad-Sn expression levels by Western blot results shown in Figure 5, FIG. 6.

Example 7 Ad-SN clones was subjected to in vivo expression experiments.

The test objects grouped in the following manner: Ad-Sn intranasal group, Ad-lacZ intranasal group (control, first with 3% pentobarbital anesthesia abdominal injection, intranasal 0.5mL / only), Ad-Sn tail vein injected group, Ad-lacZ injected intravenously (control, tail vein injection 0.5mL / only) blank control group (no treatment). Then the following manner of administration: administered once a week for three weeks; bled one week after the start from the first administration, 2 weeks after the last administration the animals were sacrificed and blood tissues of rats was measured by ELISA anti-SARS IgG concentration, the results shown in Figure 7, FIG.

Example 8 green monkey kidney cells (Vero E6) SARS attack cells from 1 to Vero E6 cells were seeded a 96 well plate, 2 × 104 / hole embodiment.

2. After 24 hours, the adenovirus SARS vaccine inoculation, method: press 4 with 1640-fold diluted viral stock solution, when a 96 well plate were seeded first aspirated broth was discarded, the wells were washed once with PBS, were added different dilutions virus solution, each dilution plus five holes, 50μL / hole. While 1640 (virus-free) as a negative control. After 1 hour incubation at 37 ℃, 5% CO2, saturated humidity, was added 1640 containing 5% newborn calf serum, 200μL / well and cultured at 37 ℃, 5% CO2, saturated humidity.

3. After 24 hours, the SARS virus inoculation, method: 1640 dilution to the SARS virus 100TCID50, when the first seeded in 96-well plates were aspirated and the culture was discarded, the wells were washed once with PBS, were added different dilutions of the virus solution, each a dilution plus five holes, 50μL / hole. While 1640 (virus-free) as a negative control. After 1 hour incubation at 37 ℃, 5% CO2, saturated humidity, was added 1640 containing 5% newborn calf serum, 200μL / well and cultured at 37 ℃, 5% CO2, saturated humidity.

4. After every 12 to 24 hours the cells were observed and recorded lesions, the calculation result of each dilution are added per well cytopathic ratings, stars cytopathic index, the average of each group, as follows:

& Lt; 110 & gt; Cancer Center of Zhongshan University & lt; 120 & gt; adenoviral vector SARS vaccine and its preparation method, coronavirus S gene with & lt; 160 & gt; 4 & lt; 210 & gt; 1 & lt; 211 & gt; 3780 & lt; 212 & gt; DNA & lt; 213 & gt; virus species & lt; 220 & gt;

tgtccgtggt 300tgggtttttg 1atgtttattt tcttattatt tcttactctc actagtggta gtgaccttga ccggtgcacc 60acttttgatg atgttcaagc tcctaattac actcaacata cttcatctat gaggggggtt 120tactatcctg atgaaatttt tagatcagac actctttatt taactcagga tttatttctt 180ccattttatt ctaatgttac agggtttcat actattaatc atacgtttgg caaccctgtc 240atacctttta aggatggtat ttattttgct gccacagaga aatcaaatgt; & lt; 221 & gt; CDS & lt; 222 & gt; (1) ... (3780) & lt; 400 & gt gttctaccat gaacaacaag tcacagtcgg tgattattat taacaattct 360actaatgttg ttatacgagc atgtaacttt gaattgtgtg acaacccttt ctttgctgtt 420tctaaaccca tgggtacaca gacacatact atgatattcg ataatgcatt taattgcact 480ttcgagtaca tatctgatgc cttttcgctt gatgtttcag aaaagtcagg taattttaaa 540cacttacgag agtttgtgtt taaaaataaa gatgggtttc tctatgttta taagggctat 600

caacctatag atgtagttcg tgatctacct tctggtttta acactttgaa acctattttt 660aagttgcctc ttggtattaa cattacaaat tttagagcca ttcttacagc cttttcacct 720gctcaagaca tttggggcac gtcagctgca gcctattttg ttggctattt aaagccaact 780acatttatgc tcaagtatga tgaaaatggt acaatcacag atgctgttga ttgttctcaa 840aatccacttg ctgaactcaa atgctctgtt aagagctttg agattgacaa aggaatttac 900cagacctcta atttcagggt tgttccctca ggagatgttg tgagattccc taatattaca 960aacttgtgtc cttttggaga ggtttttaat gctactaaat tcccttctgt ctatgcatgg 1020gagagaaaaa aaatttctaa ttgtgttgct gattactctg tgctctacaa ctcaacattt 1080ttttcaacct ttaagtgcta tggcgtttct gccactaagt tgaatgatct ttgcttctcc 1140aatgtctatg cagattcttt tgtagtcaag ggagatgatg taagacaaat agcgccagga 1200caaactggtg ttattgctga ttataattat aaattgccag atgatttcat gggttgtgtc 1260cttgcttgga atactaggaa cattgatgct acttcaactg gtaattataa ttataaatat 1320aggtatctta gacatggcaa gcttaggccc tttgagagag acatatctaa tgtgcctttc 1380tcccctgatg gcaaaccttg caccccacct gctcttaatt gttattggcc attaaatgat 1440tatggttttt acaccactac tggcattggc taccaacctt acagagttgt agtactttct 1500tttgaacttt taaatgcacc ggccacggtt tgtggaccaa aattatccac tgaccttatt 1560aagaaccagt gtgtcaattt taattttaat ggactcactg gtactggtgt gttaactcct 1620tcttcaaaga gatttcaacc atttcaacaa tttggccgtg atgtttctga tttcactgat 1680tccgttcgag atcctaaaac atctgaaata ttagacattt caccttgcgc ttttgggggt 1740gtaagtgtaa ttacacctgg aacaaatgct tcatctgaag ttgctgttct atatcaagat 1800gttaactgca ctgatgtttc tacagcaatt catgcagatc aactcacacc agcttggcgc 1860atatattcta ctggaaacaa tgtattccag actcaagcag gctgtcttat aggagctgag 1920

catgtcgaca cttcttatga gtgcgacatt cctattggag ctggcatttg tgctagttac 1980catacagttt ctttattacg tagtactagc caaaaatcta ttgtggctta tactatgtct 2040ttaggtgctg atagttcaat tgcttactct aataacacca ttgctatacc tactaacttt 2100tcaattagca ttactacaga agtaatgcct gtttctatgg ctaaaacctc cgtagattgt 2160aatatgtaca tctgcggaga ttctactgaa tgtgctaatt tgcttctcca atatggtagc 2220ttttgcacac aactaaatcg tgcactctca ggtattgctg ctgaacagga tcgcaacaca2280cgtgaagtgt tcgctcaagt caaacaaatg tacaaaaccc caactttgaa atattttggt 2340ggttttaatt tttcacaaat attacctgac cctctaaagc caactaagag gtcttttatt 2400gaggacttgc tctttaataa ggtgacactc gctgatgctg gcttcatgaa gcaatatggc 2460gaatgcctag gtgatattaa tgctagagat ctcatttgtg cgcagaagtt caatggactt 2520acagtgttgc cacctctgct cactgatgat atgattgctg cctacactgc tgctctagtt 2580agtggtactg ccactgctgg atggacattt ggtgctggcg ctgctcttca aatacctttt 2640gctatgcaaatggcatatag gttcaatggc attggagtta cccaaaatgt tctctatgag 2700aaccaaaaac aaatcgccaa ccaatttaa c aaggcgatta gtcaaattca agaatcactt 2760acaacaacat caactgcatt gggcaagctg caagacgttg ttaaccagaa tgctcaagca 2820ttaaacacac ttgttaaaca acttagctct aattttggtg caatttcaag tgtgctaaat 2880gatatccttt cgcgacttga taaagtcgag gcggaggtacaaattgacag gttaattaca 2940ggcagacttc aaagccttca aacctatgta acacaacaac taatcagggc tgctgaaatc 3000agggcttctg ctaatcttgc tgctactaaa atgtctgagt gtgttcttgg acaatcaaaa 3060agagttgact tttgtggaaa gggctaccac cttatgtcct tcccacaagc agccccgcat 3120ggtgttgtct tcctacatgt cacgtatgtg ccatcccagg agaggaactt caccacagcg 3180ccagcaattt gtcatgaagg caaagcatac ttccctcgtg aaggtgtttt tgtgtttaat 3240

ggcacttctt ggtttattac acagaggaac ttcttttctc cacaaataat tactacagac 3300aatacatttg tctcaggaaa ttgtgatgtc gttattggca tcattaacaa cacagtttat 3360gatcctctgc aacctgagct tgactcattc aaagaagagc tggacaagta cttcaaaaat 3420catacatcac cagatgttga tcttggcgac atttcaggca ttaacgcttc tgtcgtcaac 3480attcaaaaag aaattgaccg cctcaatgag gtcgctaaaa atttaaatga atcactcatt 3540gaccttcaag aattgggaaa atatgagcaa tatattaaat ggccttggta tgtttggctc 3600ggcttcattg ctggactaat tgccatcgtc atggttacaa tcttgctttg ttgcatgact 3660agttgttgca gttgcctcaa gggtgcatgctcttgtggtt cttgctgcaa gtttgatgag 3720gatgactctg agccagttct caagggtgtc aaattacattacacataaac gaacttatgg3780 & lt; 210 & gt; 2 & lt; 211 & gt; 50 & lt; 212 & gt; DNA & lt; 213 & gt; artificial sequence & lt; 220 & gt;

& Lt; 223 & gt; the N-terminus of the spike gene amplification primers (one pair) & lt spike gene The nucleotide sequence designed for PCR; 400 & gt; 2ggtctagagt tgtggtttca agtgattaggtaccaa tgccagtagt ggtg & lt; 210 & gt; 3

& Lt; 211 & gt; 50 & lt; 212 & gt; DNA & lt; 213 & gt; artificial sequence & lt; 220 & gt;

& Lt; 223 & gt; amplification M terminal spike gene primers (one pair) & lt according spike gene nucleotide sequence designed for PCR; 400 & gt; 3tttctagacc atgggttgtg tccttgctttggtacctc cgcctcgact tt & lt; 210 & gt; 4 & lt; 211 & gt; 50 & lt; 212 & gt; DNA & lt; 213 & gt; artificial sequence & lt; 220 & gt;

ggttcaatg 4tttctagacc atggcatata; 400 & gt; - & lt;; 223 & gt (pair) & lt amplification M spike end spike gene primers were designed for the nucleotide sequence of PCR

ccggtaccat aagttcgttt atgtgt

Claims (18)

A SARS vaccine, characterized in that it comprises a SARS-associated coronavirus S genes and replication deficient adenovirus.

2. SARS vaccine according to claim 1, characterized in that the C subclass deficient adenovirus E1 region is completely deleted adenovirus type 5.

3. The SARS vaccine according to claim 2, characterized in that the C subclass deficient adenovirus E3 region is completely deleted adenovirus type 5.

The SARS vaccine according to claim 2, characterized in that the defective adenovirus deleted for the E3 region portion C subclass of adenovirus type 5.

5. SARS vaccine according to claim 2, characterized in that the C subclass deficient adenovirus is not deleted E3 region of adenovirus type 5.

6. SARS vaccine of claim 1 or claim 2, characterized in that the built-deficient adenovirus The CMV promoter and BGHpolyA.

SARS vaccine according to claim 1 or claim 2, characterized in that it comprises the SARS-associated coronavirus S full-length gene.

SARS vaccine according to claim 1 or claim 2, wherein cloned into the adenoviral vector is a SARS-associated coronavirus S gene sequences include domains including S1.

SARS vaccine according to claim 1 or claim 2, wherein cloned into the adenoviral vector is a SARS-associated coronavirus S gene sequences, including domains comprising S2.

SARS vaccine according to claim 1 or claim 2, wherein cloned into the adenoviral vector is a SARS-associated coronavirus S gene comprises a sequence S1, S2 including the domain.

SARS vaccine according to claim 1 or claim 2, wherein cloned into the adenoviral vector in base No. SARS-associated coronavirus S gene transmembrane region and C-terminal fragments of 3686 ~ 3648.

12. A method for the preparation of SARS vaccines, comprising (1) obtaining a SARS-associated coronavirus S gene; (2) combined with the S gene deficient recombinant adenovirus; (3) transfecting packaging cells; (4) the enlarged increase, isolated, purified, formulated.

13. SARS vaccine production method according to claim 12, characterized in that after extraction of the S gene, cloned into the plasmid pshuttle, and then combined with the connector adenovirus backbone plasmid.

14. The preparation method according to claim SARS vaccine, wherein the S gene sequence was designed according to the following PCR primers: v1 GGTCTAGAGT TGTGGTTTCA AGTGATv2 TTTCTAGACC ATGGGTTGTG TCCTTGCTV3 TTTCTAGACC ATGGCATATA GGTTCAATGV4 TAGGTACCAA TGCCAGTAGT GGTGV5 TTGGTACCTC CGCCTCGACT TTV6 CCGGTACCAT AAGTTCGTTT ATGTGT

15. SARS vaccine production method according to claim 12, characterized in that the packaging cell is a C alkylene integrated type 5 adenovirus Ad5 E1 region of cell lines or cell lines gene.

16. SARS vaccine production method according to claim 15, wherein the packaging cell is a 293 cell.

17. The method of preparing SARS vaccine according to claim 12, wherein said formulation is an injection or a spray.

Application vaccine against SARS in 18.SARS associated coronavirus S gene in preparation.