CN119736166A

CN119736166A - New strain of Acremonium darkii and application thereof

Info

Publication number: CN119736166A
Application number: CN202411721278.8A
Authority: CN
Inventors: 雷学俊; 张霞; 郑佳; 赵东; 苏建; 卢彦坪; 覃凤阳; 刘芳; 张清玫; 王晓妹; 黄箭; 李站胜
Original assignee: Wuliangye Yibin Co Ltd
Current assignee: Wuliangye Yibin Co Ltd
Priority date: 2024-11-28
Filing date: 2024-11-28
Publication date: 2025-04-01

Abstract

The invention belongs to the technical field of brewing microorganism fermentation, and particularly relates to a novel strain of Acremonium (Phaeoacremoumsp.) and application thereof. In order to further enrich beneficial microorganisms in the white spirit brewing environment, the invention separates and screens a new strain of Acremonium darkfield from the strong aromatic Daqu production environment, and the preservation number is CGMCC No.41536. The strain is used for preparing bran koji and Daqu, can produce various hydrolytic enzymes required by brewing, is simultaneously used for simulating the production of the reinforced Daqu, can produce alpha-GC and beta-GC hydrolytic enzymes with high yield, is used for simulating fermentation in a pit, can produce various flavor substances such as 4-ethylphenol, 4-ethylguaiacol and the like, provides a new choice for improving the flavor of white spirit in the brewing of the white spirit, and has wide application prospect and great application value.

Description

New strain of Acremonium darkii and application thereof

Technical Field

The invention belongs to the technical field of brewing microorganism fermentation, and particularly relates to a novel strain of Acremonium (Phaeoacremoumsp.) and application thereof.

Background

The production of Daqu is carried out in open and natural environment and is widely distributed in the environment of starter propagation air, water, raw materials, appliances, starter propagation room and the like. In the process of making yeast, these natural environment microorganisms are settled and concentrated on yeast blank made of starchy raw materials of wheat, etc., and through temperature-control and humidity-control culture, various beneficial brewing microorganism bacterial systems and enzyme systems are formed, and then stored to produce brewing yeast, so that it is a saccharifying agent and fermenting agent for brewing.

Acremonium (Phaeoacremonium sp.) is taxonomically a genus of fungi belonging to the kingdom eukaryote, the kingdom fungi, the phylum ascomycota, the phylum Deuteromycota, the class Hymenochaetaceae, togniniales, togniniaceae. The conidium of the new species of Acremonium darkly has the shape of cylinder, ellipse, urine sac and the like. Currently, there are only about 60 new species of Acremonium darkifolium microorganisms worldwide, distributed in 19 countries of south Africa, brazil, spanish, etc., of which 2 species of P.cratiese, P.fusiformosoum are derived from woods in Guangdong, guizhou, etc. Studies show that Phaeoacremonium is dominant fungus in agalloch eaglewood plants and ephedra roots, and can promote accumulation of sesquiterpene components in white wood callus and synthesis of biflavanoids in ephedra roots.

However, no report has been found concerning the use of Acremonium microorganisms in the environment of white spirit production, especially Daqu production.

Disclosure of Invention

In order to further enrich beneficial microorganisms in the white spirit brewing environment, the invention develops a novel saccharomyces cerevisiae which is a novel strain of acremonium darkii (Phaeoacremonium sp.) with the strain number of WLY-WMCC30120.

In order to achieve the purposes of the application, the technical scheme adopted by the invention is as follows:

In a first aspect, the invention provides a novel species of Acremonium (Phaeoacremonium sp.) having a strain number WLY-WMCC30120 and a preservation number CGMCC No.41536. The new strain is preserved for 2024, 10 and 11 days, and the preservation place is China general microbiological culture Collection center (CGMCC) with address of North Star Xiyu No. 1,3 of the Korean area North Star in Beijing city, and the post code of the microbiological institute of China academy of sciences is 100101. The classification was designated Phaeoacremonium sp.

Wherein the nucleotide sequence of ITS rRNA of the novel Acremonium darkly strain is shown as SEQ ID NO. 1.

SEQ ID NO. 1 nucleotide sequence of ITS rRNA of novel species of Acremonium faciens:

ttgggaagtaaaagtcgtaacaaggtctccgttggtgaaccagcggagggatcattaccgagtctcgtactccaaaccctttgtgaacatacctgtttctcgttgcttcggcaggtgaaggcggagggcccccgggcccaatgccgccgccgggcgccccacttcgcggtgggggccgccgggcgggcctgccggagggacgcgcaaaactctgtattaaaacgtacatctctgagttatcttttacaaacaagtaaaaactttcaacaacggatctcttggttctggcatcgatgaagaacgcagcgaaatgcgataagtaatgtgaattgcagaattcagtgaatcatcgaatctttgaacgcacattgcgcccgccagtattctggcgggcatgcctgtccgagcgtcatttcaaccctcaggccccggttgcctggtgttggggcgccgcgcaccctcagcgggcgcgggccccgaaagtcagtggcgggctcgccaggactccgagcgcagtaattatctctcgctgtggagcgcctggtgggtttcccggccgtaaaacacccaaaactttccaaaggttgacctcggatcaggtaggaatacccgctgaacttaagcatatcaaaatcgggaaggaa.

The novel strain of Acremonium darkii is characterized in that hypha is not diaphragmatic and is rough, spore is formed, the spore is oblong, the center of a bacterial colony is black, the edge of the bacterial colony is white, the surface is flat, the texture is granular, and the edge of the bacterial colony is uniformly diffused.

Wherein the bran koji prepared from the novel species of Acremonium darkii can produce at least one of alpha-GC, beta-GC, alpha-GAL, beta-GAL, NAG, carE, AKP, ACP, NP, LPS, beta-GD, saccharifying enzyme, C1, alpha-L-Af, beta-xylosidase, CL, alpha-AL, beta-AL, pectase, P-SC, PG and AAT.

Wherein, the Daqu prepared by the new strain of Acremonium can produce at least one of alpha-GC, beta-GC, alpha-GAL, beta-GAL, NAG, carE, AKP, ACP, NP, LPS, beta-GD, saccharifying enzyme, C1, alpha-L-Af, beta-xylosidase, CL, alpha-AL, beta-AL, pectase, P-SC, PG and AAT.

Wherein the enhanced Daqu prepared from the novel species of Acremonium darkii can produce at least one of alpha-GC, beta-GC, alpha-GAL, beta-GAL, NAG, carE, AKP, ACP, NP, LPS, beta-GD, saccharifying enzyme, C1, alpha-L-Af, beta-xylosidase, CL, alpha-AL, beta-AL, pectase, P-SC, PG and AAT.

In a second aspect, the present invention provides a microbial agent comprising the novel species Acremonium darkii described above.

In a third aspect, the present invention provides the use of the novel species of Acremonium or microbial inoculant described above in the brewing of white spirit.

Wherein the white spirit is at least one of sauce flavor type, strong flavor type, faint scent type or rice flavor type.

In a fourth aspect, the present invention provides the use of the novel species or microbial inoculum of Acremonium darkii described above for the preparation of a bran koji, a Daqu, a fortified Daqu or a fermented grain.

Wherein the new strain or microbial agent of Acremonium can be metabolized to produce hydrolase, and the hydrolase is at least one of alpha-GC, beta-GC, alpha-GAL, beta-GAL, NAG, carE, AKP, ACP, NP, LPS, beta-GD, saccharifying enzyme, C1, alpha-L-Af, beta-xylosidase, CL, alpha-AL, beta-AL, pectase, P-SC, PG and AAT.

In a fifth aspect, the present invention provides the use of the novel species or microbial agents of Acremonium darkly described above for producing a wine flavor substance.

Wherein the flavor substance comprises at least one of 4-ethyl guaiacol, acetic acid, ethylphenol, isoamyl alcohol, caproic acid, ethyl acetate, isovaleric acid, phenethyl alcohol, isobutyric acid, 2, 4-di-tert-butylphenol, 2-methoxy-4-vinylphenol, phenylacetaldehyde, isovaleraldehyde, methyl oleate, 4-methylpentanoic acid, gamma-nonolactone, ethyl palmitate, benzoic acid, n-hexanol, benzaldehyde, butyric acid, n-valeric acid, p-hydroxystyrene, ethyl n-caproate, 2-propyl-1-pentanol, 2,3, 5-trimethylpyrazine, n-decanol, methyl maltol, methyl palmitoleate, isobutanol, palmitic acid, isooctanol or octanol.

In particular to the application of the novel strain of Acremonium or the microbial agent in producing 4-ethyl guaiacol.

Wherein the flavor substance is prepared by fermenting the new strain of Acremonium or microbial agent in potato glucose liquid culture medium or five-grain powder.

The method has the beneficial effects that the novel strain of Acremonium (Phaeoacremonium sp.) is obtained by separating and screening from the production environment of the aroma type Daqu, and the preservation number is CGMCC No.41536. The new strain is used for preparing bran koji and Daqu which can be metabolized to produce various hydrolytic enzymes, and is used for simulating the production of the reinforced Daqu which can produce beta-glucosidase with high yield, the activity is 1522.40U/g of dried yeast, the activity is improved by 2 times compared with that of unreinforced Daqu, and various flavor substances such as 4-ethylphenol, 4-ethylguaiacol and the like can be produced under the condition of simulating pit fermentation, so that the microbial sources for producing the 4-ethylguaiacol are widened, the microbial sources are not limited to yeasts and bacillus, the requirements of brewing white spirit, especially the brewing of multi-grain strong-flavor white spirit are met, a new choice is provided for improving the flavor of the white spirit in the brewing of the white spirit, and the new strain has wide application prospect and great application value.

Drawings

FIG. 1 is a phylogenetic tree constructed by a novel strain WLY-WMCC30120 of Acremonium darkii according to the invention based on the Neighbor-Joining method of ITS sequence;

FIG. 2 is a diagram showing a microscopic morphology of a strain WLY-WMCC30120 of Acremonium faciens of the present invention;

FIG. 3 is a colony morphology diagram of a novel strain WLY-WMCC30120 of Acremonium faciens of the present invention;

FIG. 4 is a graph showing the results of the preparation of moldy bran enzyme on the bran medium of novel Acremonium darkii strain WLY-WMCC30120 of the present invention;

FIG. 5 is a graph showing the results of preparing Daqu enzyme on pure wheat medium of novel Acremonium darkii strain WLY-WMCC30120 of the present invention;

FIG. 6 is a graph showing the results of the simulated enhanced Daqu enzyme production of the novel Acremonium sp WLY-WMCC30120 strain of the present invention.

The novel Acremonium darkii strain has a preservation number of CGMCC No.41536. The preservation time is 10 months and 11 days of 2024, the preservation center is China general microbiological culture Collection center, address is North Star Xiyu No. 1, 3 of the Korean area of Beijing, and the postal code is 100101, and the classification is Phaeoacremonium sp.

Detailed Description

In order to make the technical problems, technical schemes and beneficial effects to be solved more clear, the application is further described in detail below with reference to the embodiments. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art.

The enzyme appearing in the present invention is abbreviated as alpha-glucosidase (EC 3.2.1.20 abbreviated as alpha-GC), beta-glucosidase (EC 3.2.1.21 abbreviated as beta-GC), alpha-galactosidase (EC 3.2.1.22 abbreviated as alpha-GAL), beta-galactosidase (EC 3.2.1.23 abbreviated as beta-GAL), N-acetyl-beta-glucosidase (EC 3.2.1.52 abbreviated as NAG), carboxylesterase (EC 3.1.1.1 abbreviated as CarE), alkaline protease (EC 3.4.4.16 abbreviated as AKP), acid protease (EC 3.4.23.18 abbreviated as ACP), neutral protease (abbreviated as NP), lipase (EC 3.1.1.3 abbreviated as LPS), beta-glucuronidase (EC 3.2.1.31 abbreviated as beta-GD), saccharifying enzyme (EC 3.2.1.3), exo-beta-1, 4-glucosidase/cellobiosidase (EC 3.1.1.1.1), alpha-glucosidase (EC 3.2.1.1.1 abbreviated as C), alpha-glucosidase (EC 3.4.23 abbreviated as C), acid protease (EC 3.4.23.18 abbreviated as ACP), neutral protease (EC 3.2.2.1.3 abbreviated as neutral protease (EC), beta-glucuronidase (EC 3.1.1.3 abbreviated as beta-GD), beta-glucuronidase (EC), beta-glucosidase (EC 3.2.1.1.3 abbreviated as beta-2.3), beta-glucosidase (C3 abbreviated as beta-glucosidase (C), beta-1.1.3 abbreviated as beta-glucosidase (2.3 abbreviated as beta-2.3), beta-glucosidase (C), beta-glucosidase (2.1.1.1.1.3 abbreviated as alpha-glucosidase (2, beta-glucosidase, beta-2, beta-glucosidase (2.1.3 abbreviated as C), beta-glucosidase (2.1.1) Acyltransferases (EC 2.3.1. -abbreviated AAT).

In one embodiment of the invention, a novel species of Acremonium darkii is provided with a preservation number of CGMCC No.41536. The preservation time is 10 months and 11 days of 2024, the preservation center is China general microbiological culture Collection center, address is North Star Xiyu No. 1, 3 of the Korean area of Beijing, and the postal code is 100101, and the classification is Phaeoacremonium sp. The biological characteristics of the screening and separation are that the mycelium has no diaphragm and is rough, the spore has a shape of oblong, the colony is black at the center, the edge is white, the surface is flat, the texture is granular, and the edge is uniformly diffused.

Wherein, the nucleotide sequence of ITS rRNA of the new strain of Acremonium darkly is shown as SEQ ID NO. 1.

In one embodiment of the invention, the new species of Acremonium darkii is used to prepare a bran koji on a bran medium, which is capable of producing at least one of alpha-GC, beta-GC, alpha-GAL, beta-GAL, NAG, carE, AKP, ACP, NP, LPS, beta-GD, saccharifying enzyme, C1, alpha-L-Af, beta-xylosidase, CL, alpha-AL, beta-AL, pectase, P-SC, PG and AAT.

In one embodiment of the invention, the Daqu prepared from the novel strain of Acremonium darkii can produce at least one of alpha-GC, beta-GC, alpha-GAL, beta-GAL, NAG, carE, AKP, ACP, NP, LPS, beta-GD, saccharifying enzyme, C1, alpha-L-Af, beta-xylosidase, CL, alpha-AL, beta-AL, pectase, P-SC, PG and AAT.

In one embodiment of the present invention, the enhanced Daqu prepared from the novel species of Acremonium darkii is capable of producing at least one of alpha-GC, beta-GC, alpha-GAL, beta-GAL, NAG, carE, AKP, ACP, NP, LPS, beta-GD, saccharifying enzyme, C1, alpha-L-Af, beta-xylosidase, CL, alpha-AL, beta-AL, pectase, P-SC, PG, and AAT.

In one embodiment of the invention, the new strain of Acremonium darkii adopts potato glucose and five grain powder liquid state standing fermentation to simulate pit fermentation, and various flavor substances such as 4-ethylphenol, 4-ethylguaiacol and the like can be produced under the fermentation condition, so that the requirements of brewing the multi-grain strong-flavor white spirit are met, the flavor substance components and the content in the white spirit brewing are improved, and the foundation is provided for improving the flavor of the white spirit.

The following will illustrate the solution of the present invention by way of specific examples. It will be appreciated by those skilled in the art that the following examples are illustrative of the present invention and should not be construed as limiting the scope of the invention. The examples are not to be construed as limiting the specific techniques or conditions described in the literature in this field or as per the specifications of the product. The reagents or apparatus used were conventional products commercially available without the manufacturer's attention.

EXAMPLE 1 screening of novel bacterial species

1. Preliminary screening of new strains

Material is Yibin wuliangye limited company starter propagation environment

Culture medium Potato Dextrose Agar (PDA) commercially available as synthetic medium available from Guangdong Crypton microorganism technologies Co., ltd. Model 021052. Potato glucose liquid medium is commercially available as synthetic medium, commercially available from Guangdong Crypton microorganism technology Co., ltd, product model 021053.

2. The test method comprises the following steps:

A Yibin wuliangye Co-limited starter culture environment is selected, an FKC-1 planktonic bacteria sampler of Zhejiang su clean purification equipment Co-limited is adopted, a wort agar plate with the diameter of 9cm is placed in the sampler at a distance of 80cm from the ground, three parallel air flow rates are arranged each time, and the sampling time is 1min. And then the flat plate is placed in a 28 ℃ incubator to be cultivated for 3-4d, after the bacterial colony grows out, mould single bacterial colonies with different bacterial colony forms are selected in a PDA culture medium, numbering and streaking purification are carried out, and the purification is repeated for 2-3 times until the bacterial colonies on the flat plate are all in the same form. And (3) picking single bacterial colony to prepare a water immersion tablet, observing the cell morphology of the bacterial cells under a microscope, and preserving the inclined plane test tube in a refrigerator at 4 ℃.

EXAMPLE 2 morphological identification of novel species of Acremonium darkii of the invention

In each of the following experiments, newly activated cells were used, and a small amount of cells were selected and inoculated into PDA medium and cultured at 28℃for 3-5 days.

And (3) colony and fungus body shape observation:

Inoculating the activated Acremonium darkii new strain on PDA culture medium by inoculating loop streak, culturing at 28deg.C for 5-7d, observing colony morphology, picking small amount of thallus by inoculating needle, and observing thallus morphology by microscope.

As a result of observation of the mycelia, the mycelia were not diaphragmatic and were rough, and the spores were oblong. As shown in fig. 2.

And the colony observation result shows that the center of the colony is black, the edge of the colony is white, the surface is flat, the texture is granular, and the edge of the colony is uniformly diffused. As shown in fig. 3.

EXAMPLE 3 identification of molecular biology of novel species of Acremonium darkii according to the invention

Extracting genome DNA of new strain, amplifying the genome DNA with ITS universal primer pair forward primers ITS1, SEQ ID NO: 2:TCCGTAGGAACCTGCGG and ITS4, and SEQ ID NO: 3:TCCTCCGCTTATTGATATGATGC under the reaction conditions that 94 ℃ is pre-denatured for 4min, and then the following cycles are carried out, namely 94 ℃ denaturation 45s,55 ℃ annealing 45s,72 ℃ extension 60s,30 cycles and 72 ℃ extension 10min. The identification result by 2% agarose gel electrophoresis is good. Sequencing PCR amplified products by sending to a biological engineering (Shanghai) Co., ltd, comparing the sequencing results with BLAST sequences on NCBI database, wherein the homology of the novel strain WLY-WMCC30120 with Phaeoacremonium rubrigenum and Phaeoacremonium parasiticum ^T is 94.49 percent, the nucleotide sequence difference between the novel strain WLY-WMCC and the novel strain with closest relativity is 5.51 percent, the nucleotide sequence difference between the novel strain WLY-Phaeoacremonium parasiticum and the novel strain with Phaeoacremonium parasiticum mode is 6.57 percent, which is far greater than the sequence difference (-1 percent) between mould strains in the region, and determining a novel strain in Acremonium darkness by combining with colony morphology, thallus characteristics and ITS rDNA gene sequence analysis, and naming the novel strain as Phaeoacremonium sp. The new strain is preserved in China general microbiological culture Collection center (CGMCC) with the preservation number of CGMCC No.41536 and the preservation address of China academy of China general microbiological study (China academy of sciences) with the preservation number of North Star Xiyu No. 1 in the Korean area of Beijing city at day 11 of 2024.

The biological characteristics are that the mycelium has no diaphragm and is rough, the spore has bud spore, the spore is oblong, the center of the colony is black, the edge is white, the surface is flat, the texture is granular, and the edge is uniformly diffused.

Example 4 enzyme-producing Properties of novel Strain WLY-WMCC30120 of the present invention

The culture medium is an activation culture medium, namely a commercial synthetic culture medium, which is purchased from Guangdong Crypton microorganism technology Co., ltd, and the product model is 021053;

bran culture medium, 10g of bran, 8mL of distilled water, stirring uniformly, and autoclaving at 121 ℃ for 20min;

Daqu is prepared by wetting pure wheat with hot water, pulverizing according to the conventional yeast preparation process, adding water, mixing to obtain yeast embryo, and sterilizing at 121deg.C under high pressure for 20min;

simulation strengthening Daqu, namely crushing pure wheat according to the preparation process requirement of the prior strong aromatic Chinese liquor Daqu after hot water wetting, adding water and mixing to obtain a yeast embryo.

Analysis of enzymatic Properties 22 hydrolases, α -GC, β -GC, α -GAL, β -GAL, NAG, carE, AKP, ACP, NP, LPS, β -GD, glucoamylase, C1, α -L-Af, β -xylosidase, CL, α -AL, β -AL, pectinase, P-SC, PG and AAT were tested in the present invention. These 22 enzyme activities were all performed with reference to a quantitative kit (Beijing Box Co., ltd.).

Wherein the standard curve for α -GC is y=0.03dx+0.0068, r ² =0.9999; the standard curve of β -GAL is y=0.0033x+0.0045, r ² =0.9999, the standard curve of α -GAL is y=0.0034x-0.0008, r ² = 0.9996, the standard curve of β -GAL is y=0.0036x+0.0142, r ² =0.9994, the standard curve of saccharifying enzyme is y=3490x-0.1997, r 3494= 0.9933, the standard curve of α -L-Af is y=0.00733x+0.0195, r ² =0.9997, the standard curve of β -xylosidase is y=367x-0.0768, r ² =0.9959, the standard curve of α -AL and β -AL is y=1.991 x-0.1095, r ² =0.9999, the standard curve of pectinase is y=0.007x=0.0199, the standard curve of y=0. ² x=0.9959, the standard curve of β -GAL is y=3626 x-0.0726 x-0.996, the standard curve of p-p is y=36.9925, the standard curve of p=0.9926, the standard curve of p-p is y=36.9926 x=0.9959, the standard curve of p-p is y=60.9935, the standard curve of p.9935, the standard curve of p is y=6.9935, the standard curve of p-p is 6.9935, the standard curve of p.p.p.p.p is 6, the standard curve of p.p.p.p.p=3, and the standard curve is 6.

Wherein, according to the absorbance value, the corresponding substrate generation amount is calculated by combining a standard curve.

Wherein, the definition of alpha-GC enzyme activity unit is that 1nmol of p-nitrophenol is generated per minute in each mL system of Daqu is defined as an enzyme activity unit, the definition of beta-GC enzyme activity unit is that 1nmol of p-nitrophenol is generated per minute in each mL system of Daqu is defined as an enzyme activity unit, the definition of alpha-GAL enzyme activity unit is that 1nmol of p-nitrophenol is generated per minute in each mL system of Daqu is defined as an enzyme activity unit, the definition of beta-GAL enzyme activity unit is that 1nmol of p-nitrophenol is generated per minute in each mL system of Daqu is defined as an enzyme activity unit, the definition of NAG enzyme activity unit is that 1nmol of p-nitrophenol is generated per minute in each mL system of Daqu is defined as an enzyme activity unit, the definition of CarE enzyme activity unit is that a catalytic absorbance value is increased by 0.5 per minute under the condition of 37 ℃, the definition of AKP enzyme activity unit is that 30 ℃ liquid sample is produced by 1 mu mol of tyrosinase activity unit per minute in each mL system is defined as an enzyme activity unit of tyrosinase activity unit, the definition of liquid sample is produced by 1 mu m of tyrosine enzyme unit is produced under the condition that the liquid is produced by 30 mu m of liquid is defined as a sample activity unit of tyrosine enzyme unit under the condition that 1 mu m of liquid is produced by 30 mu m of liquid is produced by one mL of liquid is defined as a sample activity unit, oxidation of 1nmol of NADPH per minute per g of Daqu is defined as one unit of enzyme activity; the unit of the beta-GD enzyme activity is defined as the enzyme activity unit, wherein the enzyme quantity required for generating 1 mu mol phenolphthalein per g Daqu per hour is defined as one unit of the enzyme activity; the unit of enzyme activity of saccharifying enzyme is defined as one unit of enzyme activity, wherein 1mg of glucose is generated per g of Daqu per hour; the unit definition of C1 enzyme activity is that 1nmol of P-nitrophenol is generated per hour of each gram of Daqu, the unit definition of alpha-L-Af enzyme activity is that 1nmol of P-nitrophenol is generated per minute of each gram of Daqu, the unit definition of beta-xylosidase enzyme activity is that 1 mu mol of P-nitrophenol is generated per minute of each gram of Daqu is that one unit of enzyme activity, the unit definition of CL enzyme activity is that 1 mu g of glucose is generated per minute of each gram of Daqu is that one unit of enzyme activity, the unit definition of alpha-AL and beta-AL enzyme activity is that 1mg of glucose is generated per minute of each gram of Daqu is that one unit of enzyme activity, the unit definition of pectase activity is that 1 mu mol of galacturonic acid is that one unit of enzyme activity is generated per hour of each gram of Daqu under the condition of 50 DEG CpH 3.5, the unit definition of P-SC enzyme activity is that 1 mu g of sucrose is that one unit of enzyme activity is generated per minute of Daqu under the condition of catalyzing hydrolysis, the unit definition of PG enzyme activity is that 1 mu g of sucrose is that one unit of enzyme activity is that one unit is generated per minute of 1 mu g of glucose is that one unit of activity is defined under the condition of 6 DEG CpH of PG, the unit definition of 20 mg of galacturonic acid is that one unit is generated per minute of enzyme activity is that one unit of 20 mg of the system is that the enzyme activity is that one unit of 20 mg of absorbance is generated per minute of the enzyme is defined under the condition of 0 DEG of the condition of degrading enzyme system.

(1) Activating the target new strain WLY-WMCC30120 with an activation culture medium, inoculating the strain WLY-WMCC into a bran culture medium according to 10% of inoculation amount to prepare bran koji, and culturing at 28 ℃ for 5 days after confirming no pollution. And detecting the activity of the hydrolase after culture. Compared with a blank control group, the novel strain WLY-WMCC30120 can metabolize 10 hydrolases such as high-yield AAT, beta-GC, saccharifying enzyme, beta-GAL, NAG, C1, alpha-GAL, AKP, alpha-GC, alpha-L-Af and the like on a bran culture medium. Wherein, AAT (EC 2.3.1. -) activity reaches 5800U/g dry yeast, beta-GC (EC 3.2.1.21) activity reaches 2671.72U/g dry yeast, saccharifying enzyme (EC 3.2.1.3) activity reaches 1888.46U/g dry yeast, beta-GAL (EC 3.2.1.23) activity reaches 1129.82U/g dry yeast, NAG (EC 3.2.1.52) activity reaches 579.68U/g dry yeast, C1 (EC 3.2.1.91) activity reaches 438.59U/g dry yeast, alpha-GAL (EC 3.2.1.22) activity reaches 323.78U/g dry yeast), AKP (EC 3.4.4.16) activity reaches 319.43U/g dry yeast, alpha-GC (EC 3.2.1.20) activity reaches 222.98U/g dry yeast, alpha-L-Af (EC 3.2.1.55) activity reaches 154.25U/g dry yeast, as shown in FIG. 4.

(2) The target new strain WLY-WMCC30120 is activated by an activation culture medium, and inoculated into a pure wheat culture medium according to 10% of inoculation amount to prepare Daqu after confirming no pollution, and cultured for 5 days at 28 ℃. And detecting the activity of the hydrolase after culture. Compared with a blank control group, the Daqu prepared by the novel strain WLY-WMCC30120 can metabolize 4 hydrolases such as high-yield AAT, beta-GAL, beta-GC and AKP. Wherein, AAT (EC 2.3.1. -) activity reaches 1013.33U/g dry yeast, beta-GAL (EC 3.2.1.23) activity reaches 474.07U/g dry yeast, beta-GC (EC 3.2.1.21) activity reaches 215.42U/g dry yeast, AKP (EC 3.4.4.16) activity reaches 142.03U/g dry yeast, as shown in figure 5.

(3) Activating the target new strain WLY-WMCC30120 by using an activation culture medium, inoculating the strain WLY-WMCC into fresh yeast embryo according to 10% of inoculation amount to prepare reinforced yeast, and culturing for 5 days at 28 ℃. And detecting the activity of the hydrolase after culture. Compared with the unenhanced group, the enhanced Daqu prepared by the novel strain WLY-WMCC30120 can metabolize 2 hydrolases such as alpha-GC, beta-GC and the like with high yield. Wherein, the activity of the high-yield alpha-GC (EC 3.2.1.20) reaches 507.26U/g of dry yeast and the activity of the beta-GC (EC 3.2.1.21) reaches 1522.40U/g of dry yeast, which is improved by 2 times compared with the unreinforced yeast, as shown in figure 6.

EXAMPLE 5 analysis of Main flavor Components in fermentation broth of novel Strain WLY-WMCC30120 of the present invention

The culture medium is potato glucose liquid culture medium. Commercial synthetic media purchased from Guangdong Cryptographic, inc., product model 021053.

Culture medium is five-grain powder. Grinding five grains (sorghum accounting for 36%, rice accounting for 22%, glutinous rice accounting for 18%, wheat accounting for 16% and corn accounting for 8%) into fine powder, boiling according to the ratio of five grains powder to water=1:10, adding the fine five grains powder, boiling for about 40min (into porridge shape), cooling to about 60 ℃, simultaneously adding liquefying enzyme (5 g/3L) and saccharifying enzyme (5 g/3L), preserving heat, liquefying and saccharifying at 62 ℃ for 4h, stirring every 1h, standing for 4 ℃ for overnight in a refrigerator, filtering 8 layers of gauze, supplementing water, adding glucose to enable the sugar degree vitality to reach about 12 DEG Be, and carrying out sub-packaging sterilization for standby.

Inoculating seed solution of new strain WLY-WMCC30120 into potato glucose liquid culture medium and five-grain powder culture medium according to 1% inoculum size, filling 200mL/250mL triangular flask, sealing, making three groups of samples treated in the same way in parallel, and culturing and fermenting at 28deg.C for 5 days.

The pretreatment method of the flavor substances in the fermentation liquor comprises the steps of accurately sucking 1.0mL of fermentation liquor, filling the fermentation liquor into a headspace bottle, adding 0.3g of sodium chloride and 6 mu L of 4-octanol (with the concentration of 12 ppb), inserting the headspace bottle filled with the sample into an extraction column, placing the headspace bottle in a 50 ℃ water bath for 15min for extraction for 45min, and loading the headspace bottle to be tested.

The fermentation broth was pretreated to extract the flavor compounds, followed by HS-SPME analysis. The separation was performed according to the following procedure, DB-WAX capillary column (30 m. Times.250 μm. Times.0.25 μm), helium as carrier gas (purity. Gtoreq.99.999%), flow rate 1mL/min, sample introduction without split sample introduction, column temperature 60℃at initial temperature, 1min at 8℃to 200℃for 1min, 30℃to 280℃for 2min, sample introduction port temperature 250℃and auxiliary heating temperature 280 ℃.

Semi-quantitative analysis was performed using 4-octanol (12.0 ppb) as an internal standard by peak area normalization. The peak area of each compound was calculated using a Selective Ion (SIM), and the concentration of each compound was calculated as the ratio of the peak area to the peak area of the internal standard substance.

The measurement results are shown in Table 1, and it can be seen that the new strain mainly produces isopentyl aldehyde, acetic acid and isoamyl alcohol in potato dextrose liquid medium. The culture medium mainly produces 4-ethyl guaiacol, acetic acid, 4-ethylphenol, isoamyl alcohol, caproic acid, ethyl acetate, isovaleric acid, phenethyl alcohol and isobutyric acid. The main acetic acid and isoamyl alcohol are shared in the two culture mediums.

The current research reports that the 4-ethyl guaiacol is mainly yeast (Mouyong, he Liqin, sun Qixing, etc. the identification of 4-ethyl guaiacol-producing yeast and the application thereof in soy sauce [ J ]. Food science, 2021,42 (12): 138-144.) and bacillus (Guo Mingwei, geng Yuhuan. Screening and identification of a strain of 4-ethyl guaiacol-converting bacteria in soy sauce fermentation process [ J ]. Food and fermentation industry, 2021,47 (21): 18-23.DOI: 10.13995/j.cnki.11-1802/ts.026836.) are mainly reported, and the new strain of Acremonium darkicum is the first reported fungus metabolism product 4-ethyl guaiacol.

The 4-ethyl guaiacol has the odor of spicy, floral, clove, smoked, baked bread, cured pig hind legs and phenol, and widely exists in wine, beer, rum, whiskey, white ground orchid, white spirit, soy sauce and vinegar, the average content of the 4-ethyl guaiacol in the strong aromatic white spirit is 96.07 mug/L (Fan Wenlai, xu Yan. Wine flavor chemistry, chinese light industry publishing company, 2020.).

TABLE 1 flavoring substances of novel Strain WLY-WMCC30120 in different media

As can be seen from the above examples, the novel strain WLY-WMCC30120 of the present invention can be used for producing various hydrolases and various flavoring substances by fermentation, and can be used for brewing white spirit, so that the flavor of white spirit can be improved, white spirit with better flavor can be brewed, and the present invention has good application value.

Claims

1. A new strain of the genus Phaeoacremonium WLY-WMCC30120, characterized in that: its taxonomic name is Phaeoacremonium sp., and its deposit number is CGMCC No.41536.

2. A microbial agent, characterized in that it contains the new strain of the genus Acremonium as described in claim 1.

3. Use of the new strain of the genus Acremonium according to claim 1 or the microbial agent according to claim 2 in liquor brewing.

4. The use according to claim 3, characterized in that the liquor is at least one of a sauce-flavor type, a strong-flavor type, a light-flavor type or a rice-flavor type.

5. Use of the new strain of the genus Acremonium according to claim 1 or the microbial agent according to claim 2 in preparing bran koji, daqu, fortified daqu or fermented grains.

6. The use according to claim 5, characterized in that: the new strain of the genus Acremonium or the microbial agent can metabolize to produce a hydrolase, and the hydrolase is at least one of α-GC, β-GC, α-GAL, β-GAL, NAG, CarE, AKP, ACP, NP, LPS, β-GD, saccharifying enzyme, C1, α-L-Af, β-xylosidase, CL, α-AL, β-AL, pectinase, P-SC, PG and AAT.

7. Use of the new strain of the genus Acremonium as described in claim 1 or the microbial agent as described in claim 2 in producing wine flavor substances.

8. The use according to claim 7, characterized in that the flavor substances include at least one of 4-ethylguaiacol, acetic acid, ethylphenol, isopentanol, caproic acid, ethyl acetate, isovaleric acid, phenylethyl alcohol, isobutyric acid, 2,4-di-tert-butylphenol, 2-methoxy-4-vinylphenol, phenylacetaldehyde, isovaleraldehyde, methyl oleate, 4-methylvaleric acid, γ-nonalactone, ethyl palmitate, benzoic acid, n-hexanol, benzaldehyde, butyric acid, n-valeric acid, p-hydroxystyrene, ethyl hexanoate, 2-propyl-1-pentanol, 2,3,5-trimethylpyrazine, n-decanol, methyl maltol, methyl palmitoleate, isobutanol, palmitic acid, isooctyl alcohol or octanol.

9. The use according to claim 8, characterized in that the new strain of Acremonium genus or microbial agent is used to produce 4-ethylguaiacol.

10. The use according to claim 8 or 9, characterized in that the flavor substance is obtained by fermenting the new strain of Acremonium genus according to claim 1 or the microbial agent according to claim 2 in potato glucose liquid culture medium or five-grain flour.