CN118620078B - Antibodies against human CD45RA protein, antibody conjugates and their applications - Google Patents

Antibodies against human CD45RA protein, antibody conjugates and their applications Download PDF

Info

Publication number
CN118620078B
CN118620078B CN202410915325.6A CN202410915325A CN118620078B CN 118620078 B CN118620078 B CN 118620078B CN 202410915325 A CN202410915325 A CN 202410915325A CN 118620078 B CN118620078 B CN 118620078B
Authority
CN
China
Prior art keywords
antibody
seq
protein
cd45ra
variable region
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202410915325.6A
Other languages
Chinese (zh)
Other versions
CN118620078A (en
Inventor
王新文
吴海
刘红龙
胡文娟
张云
黄长青
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Wuhan Abclonal Inc
Original Assignee
Wuhan Abclonal Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Wuhan Abclonal Inc filed Critical Wuhan Abclonal Inc
Priority to CN202410915325.6A priority Critical patent/CN118620078B/en
Publication of CN118620078A publication Critical patent/CN118620078A/en
Application granted granted Critical
Publication of CN118620078B publication Critical patent/CN118620078B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/289—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against CD45
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/577—Immunoassay; Biospecific binding assay; Materials therefor involving monoclonal antibodies binding reaction mechanisms characterised by the use of monoclonal antibodies
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6893—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids related to diseases not provided for elsewhere
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/30—Immunoglobulins specific features characterized by aspects of specificity or valency
    • C07K2317/33—Crossreactivity, e.g. for species or epitope, or lack of said crossreactivity
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/51—Complete heavy chain or Fd fragment, i.e. VH + CH1
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/515—Complete light chain, i.e. VL + CL
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/56—Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/56—Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
    • C07K2317/565—Complementarity determining region [CDR]
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • C07K2317/76—Antagonist effect on antigen, e.g. neutralization or inhibition of binding
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/90—Immunoglobulins specific features characterized by (pharmaco)kinetic aspects or by stability of the immunoglobulin
    • C07K2317/92—Affinity (KD), association rate (Ka), dissociation rate (Kd) or EC50 value
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
    • G01N2333/705—Assays involving receptors, cell surface antigens or cell surface determinants
    • G01N2333/70589—CD45

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Immunology (AREA)
  • Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Urology & Nephrology (AREA)
  • Hematology (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Biochemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • General Physics & Mathematics (AREA)
  • Biotechnology (AREA)
  • Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • Cell Biology (AREA)
  • Microbiology (AREA)
  • Food Science & Technology (AREA)
  • Pathology (AREA)
  • Organic Chemistry (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Peptides Or Proteins (AREA)

Abstract

本发明属于抗体制备技术领域，尤其涉及抗人CD45RA蛋白的抗体、抗体偶联物及其应用。所述抗体轻链可变区上CDR1‑3的氨基酸序列分别如SEQ ID NO.3‑5所示，重链可变区上CDR1‑3的氨基酸序列分别如SEQ ID NO.8‑10所示。本发明提供的具备上述CDR序列的抗体可以特异性识别基因工程表达得到的重组CD45RA蛋白以及细胞或组织中表达的天然CD45RA蛋白，且与同型蛋白无交叉反应，具有良好的特异性和较高的亲和性，能够有效抗细胞组分干扰，显著提升免疫检测CD45RA蛋白的准确性、灵敏度和可靠性，在流式细胞等免疫检测领域具有广阔的应用前景。

The present invention belongs to the technical field of antibody preparation, and in particular to antibodies, antibody conjugates and applications thereof against human CD45RA proteins. The amino acid sequences of CDR1-3 on the light chain variable region of the antibody are shown in SEQ ID NO.3-5, respectively, and the amino acid sequences of CDR1-3 on the heavy chain variable region are shown in SEQ ID NO.8-10, respectively. The antibodies with the above CDR sequences provided by the present invention can specifically recognize the recombinant CD45RA protein expressed by genetic engineering and the natural CD45RA protein expressed in cells or tissues, and have no cross-reaction with isotype proteins, have good specificity and high affinity, can effectively resist interference from cellular components, significantly improve the accuracy, sensitivity and reliability of immunodetection of CD45RA protein, and have broad application prospects in immunodetection fields such as flow cytometry.

Description

Antibody against human CD45RA protein, antibody conjugate and application thereof
Technical Field
The invention relates to the technical field of antibody preparation, in particular to an antibody for resisting human CD45RA protein, an antibody conjugate and application thereof.
Background
CD45, also known as type C Protein Tyrosine Phosphatase Receptor (PTPRC), is a leukocyte surface common antigen (leukocyte common antigen, LCA), belongs to type I transmembrane protein, is expressed in all hematopoietic stem cell lineages except mature erythrocytes and platelets, including T cells, B cells, natural killer cells, macrophages, etc., and is an important regulator of T and B cell antigen receptor-mediated activation. The cytoplasmic segment of CD45 has the function of protein tyrosine phosphatase, can dephosphorylate tyrosine on a substrate to activate, is a key molecule for signal transmission on a cell membrane, and has important significance in development and maturation of lymphocytes, function regulation and signal transmission.
CD45 consists of a class of structurally similar, relatively large molecular weight transmembrane proteins, and multiple CD45 subtypes can be produced by alternative splicing of exons 4 (A), 5 (B) and 6 (C) in the extracellular domain, with the isotype expressing only exon A being referred to as CD45RA, the isotype expressing only exon B being referred to as CD45RB, the isotype expressing only exon C being referred to as CD45RC, and the isotype lacking the three exons being referred to as CD45RO. The changes in CD45 subtype change with T cell activation and affect intracellular signal transduction, so the distribution of CD45 subtype is often used as a classification marker for certain T cell subsets. T lymphocytes express different CD45 subtypes in a relationship with their functional differences, typically CD45RO is expressed in memory T cells and CD45RA is expressed in naive T cells. Memory helper T cells produce cytokine equivalent factors under antigen stimulation, helper B cells produce antibodies, primary T cells proliferate under antigen stimulation, their surface CD45RA expression is reduced, and CD45RO is converted to CD45RO to enhance immune response, so CD45RA/CD45RO is also considered as an important subtype of CD45 as an ideal marker for distinguishing primary T cells from memory T cells, which plays a key role in immune response, viral infection and autoimmune disease.
CD45RA + and CD45RO + T cells differ in phenotype, function, etc., and knowledge of the changes in their subpopulations helps to understand the pathogenesis, clinical status, and prognosis of many diseases. It has now been found that significant changes in the expression of CD45RA in Systemic Lupus Erythematosus (SLE), rheumatoid arthritis, allergic purpura and the like, myeloid leukemia, shingles, bronchial asthma, anemia, colorectal cancer, gastric cancer and the like can be used as a basis for clinical diagnosis, and the therapeutic effect of high-efficiency antiretroviral therapy (HAART) in the course of AIDS can be evaluated by detecting the cell number of CD4 +CD45RA+. Thus, the detection of the expression level of CD45RA has important scientific research value and clinical significance.
In the field of living cell detection, the identification of cell subsets, which is critical in the development of anti-CD 45RA antibodies, is mainly by Flow Cytometry (FC). At present, antibodies to CD45RA are developed on the market, detection applications mainly meet immunoblotting (WB), immunohistochemistry (IHC) and the like, and few antibodies meet FC analysis applications. This is because the target antigen CD45RA is low in content and has many interference factors in the FC detection process, and there are many homotype proteins, and the low specificity and/or affinity of the antibody easily results in non-specific binding, so there are few monoclonal antibodies on the market that meet the FC analysis application. Therefore, the development of the CD45RA antibody with high specificity, which can meet the application scene of flow cytometry analysis, has very important significance.
Disclosure of Invention
Aiming at the problems that the anti-human CD45RA protein antibody in the prior art has poor specificity, affinity and/or interference resistance and is difficult to be used for living cell detection, especially living cell flow cytometry detection and the like, the invention provides an anti-human CD45RA protein antibody and an antibody conjugate thereof, and further provides application of the antibody or the antibody conjugate in preparing a human CD45RA protein immunodetection reagent and/or a kit, and a related immunodetection reagent and/or a kit. The antibody provided by the invention can specifically identify and combine human CD45RA protein, has high affinity with a target point, has no cross reaction on other CD45 protein subtypes, and can be applied to the field of immunological detection. In order to achieve the above purpose, the present invention is specifically realized by the following technical scheme:
the first aspect of the invention provides an antibody against human CD45RA protein, comprising a light chain variable region and a heavy chain variable region, wherein the amino acid sequences of complementarity determining regions CDR1, CDR2 and CDR3 on the light chain variable region are respectively shown as SEQ ID NO.3, SEQ ID NO.4 and SEQ ID NO. 5; the amino acid sequences of complementarity determining regions CDR1, CDR2 and CDR3 on the heavy chain variable region are shown in SEQ ID NO.8, SEQ ID NO.9 and SEQ ID NO.10, respectively.
Further, the amino acid sequence of the light chain variable region is shown as SEQ ID NO.2, and the amino acid sequence of the heavy chain variable region is shown as SEQ ID NO. 7.
Further, the antibody further comprises a light chain constant region and a heavy chain constant region; wherein the light chain constant region and the light chain variable region form a complete light chain, and the amino acid sequence of the light chain is shown as SEQ ID NO. 1; the heavy chain constant region and the heavy chain variable region form a complete heavy chain, and the amino acid sequence of the heavy chain is shown as SEQ ID NO. 6.
Further, the antibody is a full length antibody or an antigen binding region thereof; the antigen binding region is selected from at least one of a Fab fragment, a F (ab) 2 fragment, an Fv fragment, an (Fv) 2 fragment, an scFv fragment, and an sc (Fv) 2 fragment.
In a second aspect the invention provides an antibody conjugate comprising an antibody as described above against human CD45RA protein, and a detection label attached to said antibody.
In a third aspect the invention provides a nucleic acid molecule encoding an antibody as described above against human CD45RA protein, a recombinant vector comprising said nucleic acid molecule or a host cell comprising said nucleic acid molecule.
Further, the nucleic acid sequence of the light chain variable region of the antibody is shown as SEQ ID NO.16 or a sequence complementary thereto, and the nucleic acid sequence of the heavy chain variable region is shown as SEQ ID NO.18 or a sequence complementary thereto.
Further, the nucleic acid sequence of the light chain of the antibody is shown as SEQ ID NO.15 or the sequence complementary to the light chain, and the nucleic acid sequence of the heavy chain is shown as SEQ ID NO.17 or the sequence complementary to the heavy chain.
In a fourth aspect, the invention provides the use of an antibody or antibody conjugate as described above against human CD45RA protein in the preparation of a human CD45RA protein immunoassay reagent and/or kit.
In a fifth aspect the invention provides a human CD45RA protein immunoassay reagent and/or kit comprising an antibody or antibody conjugate as described above against a human CD45RA protein.
Further, the immunodetection method includes at least one of an enzyme immunoassay, an enzyme-linked immunosorbent assay, an immunofluorescence method, an immunoblotting method, and a flow cytometry.
The invention has the advantages and positive effects that:
The antibody with the CDR sequence provided by the invention can specifically identify recombinant CD45RA protein obtained by genetic engineering expression and natural CD45RA protein expressed in cells or tissues, has no cross reaction with homotype proteins, has good specificity and higher affinity, can effectively resist interference of cell components, remarkably improves the accuracy, sensitivity and reliability of immunodetection of the CD45RA protein, and has wide application prospect in the immunodetection field of flow cells and the like.
Drawings
In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings required for the description of the embodiments will be briefly described below, and it is apparent that the drawings in the following description are only some embodiments of the present invention, and other drawings may be obtained according to these drawings without inventive effort for a person skilled in the art.
FIG. 1 is a graph showing the results of detecting rabbit immune serum titer by ELISA in example 1 of the present invention;
FIG. 2 is a graph showing the results of detecting binding of rabbit immune serum to positive cells Jurkat by flow cytometry in example 1 of the present invention, wherein the serum dilutions are 1: 500. 1:1000 and 1:2000;
FIG. 3 is a graph showing the results of detecting binding of rabbit immune serum to negative cells 293T by flow cytometry in example 1 of the present invention, wherein the serum dilutions were 1: 500. 1:1000 and 1:2000;
FIG. 4 shows a map of a mammalian expression vector pRB322 used for constructing an anti-human CD45RA protein antibody according to example 1 of the present invention, which is a vector carrying in advance the light chain constant region and the heavy chain constant region of the antibody, respectively, from left to right;
FIG. 5 is a graph showing the results of detecting the binding of an anti-human CD45RA protein antibody to a positive cell Daudi by flow cytometry in accordance with example 3 of the present invention, wherein the fluorescent label is ABflo 488, Left panel is negative cell 293T, right panel is positive cell Daudi;
FIG. 6 is a graph showing the results of detecting binding of an anti-human CD45RA protein antibody to a positive cell Jurkat by flow cytometry in example 3 of the present invention, wherein the fluorescent label is ABflo 647, Left panel is negative cell 293T and right panel is positive cell Jurkat.
Detailed Description
In order to make the objects, technical solutions and advantages of the present invention more apparent, the present invention will be described in further detail with reference to the following examples. The examples described herein are intended to illustrate the invention only and are not intended to limit the invention.
Various modifications to the precise description of the invention will be readily apparent to those skilled in the art from the information contained herein without departing from the spirit or scope of the appended claims. It is to be understood that the scope of the invention is not limited to the defined processes, properties or components, as these embodiments, as well as other descriptions, are merely illustrative of specific aspects of the invention. Indeed, various modifications of the embodiments of the invention which are obvious to those skilled in the art or related fields are intended to be within the scope of the following claims.
For a better understanding of the present invention, and not to limit its scope, all numbers expressing quantities, percentages and other values used in the present invention are to be understood as being modified in all instances by the term "about". Accordingly, unless indicated otherwise, the numerical parameters set forth in the specification and attached claims are approximations that may vary depending upon the desired properties sought to be obtained. Each numerical parameter should at least be construed in light of the number of reported significant digits and by applying ordinary rounding techniques.
In addition, it is noted that unless otherwise defined, in the context of the present invention, scientific and technical terms used should have meanings commonly understood by one of ordinary skill in the art.
The terms "comprising," "including," "having," and the like are intended to be non-limiting, as other steps and other ingredients not affecting the result may be added. The term "and/or" should be taken to refer to a specific disclosure of each of the two specified features or components with or without the other. For example, "a and/or B" is considered to include the following: (i) A, (ii) B, and (iii) A and B.
The terms "rabbit monoclonal antibody", "rabbit antibody" and "rabbit monoclonal antibody" and the like have the same meaning and refer to antibodies that specifically bind Human (Human) CD45RA unless otherwise specified. The modifier "rabbit" means that the Complementarity Determining Regions (CDRs) of the antibody are derived from a rabbit immunoglobulin sequence.
An antibody is an immunoglobulin molecule capable of specifically binding to an antigen or epitope of interest through at least one antigen recognition site located in the variable region of the immunoglobulin molecule. In the present invention, the term "antibody" is to be interpreted in the broadest sense and includes different antibody structures, including but not limited to so-called full length antibodies, antibody fragments, and genetic or chemical modifications thereof, as long as they exhibit the desired antigen binding activity.
A typical antibody molecule (full length antibody) consists of two identical light chains (L) and two identical heavy chains (H). Light chains can be divided into two types, kappa and lambda chains, respectively; heavy chains can be categorized into five, μ, δ, γ, α and ε chains, respectively, and antibodies are defined as IgM, igD, igG, igA and IgE, respectively. The amino acid sequences of the heavy and light chains near the N-terminus vary greatly, the other portions of the amino acid sequences are relatively constant, the region of the light and heavy chains near the N-terminus, where the amino acid sequences vary greatly, is referred to as the variable region (V), and the region near the C-terminus, where the amino acid sequences are relatively stable, is referred to as the constant region (C). Heavy chain variable regions (VH) and light chain variable regions (VL) are typically the most variable parts of antibodies and contain antigen recognition sites. The VH and VL regions can be further subdivided into hypervariable regions (hypervariable region, HVR) also known as Complementarity Determining Regions (CDRs) which are circular structures, and Framework Regions (FR) where the heavy and light chain CDRs are held closely together and cooperate with one another by the FR regions to form surfaces complementary to the three-dimensional structure of the antigen or epitope of interest, determining the specificity of the antibody, and are the sites for antibody recognition and binding to the antigen. The FR region is the more conserved part of VH and VL, which are generally in the β -sheet configuration, joined by three CDRs forming a connecting loop. Each VH and VL is typically composed of three CDRs and four FRs arranged from amino-terminus to carboxy-terminus in the following order: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4.
CDRs and FR can be identified according to Kabat definition, chothia definition, a combination of both Kabat definition and Chothia definition, abM definition, contact definition, IMGT unique number definition and/or conformational definition, or any CDR determination method known in the art. As used herein, is defined by the Kabat numbering system.
The light chain constant region (CL) and the heavy chain constant region (CH) are not directly involved in binding of an antibody to an antigen, but they exhibit different effector functions, such as participation in antibody-dependent cytotoxicity of an antibody. CL lengths of different classes of igs (κ or λ) are substantially identical, but CH lengths of different classes of igs are different, e.g. IgG, igA and IgD include CH1, CH2 and CH3, while IgM and IgE include CH1, CH2, CH3 and CH4. The amino acid sequences of the antibody heavy and light chain constant regions are well known in the art.
Full length antibodies are the most complete antibody molecular structure, having a typical Y-type molecular structure, and thus, "full length antibodies", "complete antibodies" and "Y-type antibodies" are used interchangeably in the context of the present invention.
An antibody fragment is one or more portions or fragments of a full length antibody that substantially retains the same biological function or activity as the full length form, in particular, an antibody fragment comprises at least the same CDR regions, more preferably the same variable regions, as the full length antibody, thereby retaining intact antigen recognition and binding sites capable of binding to the same antigen, particularly to the same epitope, as the full length antibody. In typical examples, the antibody fragments include: fab, F (ab) 2、Fab'、F(ab')2、Fv、(Fv)2、scFv、sc(Fv)2, which may be obtained by techniques conventional in the art.
(I) Fab: antigen binding fragments (Fab) monovalent fragments consisting of the complete light chain (variable and constant regions) and part of the heavy chain (variable and first constant regions) are obtained by proteolytic cleavage of full length antibodies to give Fab, F (ab ') 2, fab' fragments and the like. For example, igG can be degraded into two Fab fragments and one Fc fragment by papain; igG can be degraded into a F (ab ') 2 fragment and a pFC' fragment by pepsin. The F (ab ') 2 fragment was further reduced to form two Fab' fragments. Because the Fab has an antigen binding region and a partial constant region, the Fab not only has the antibody-antigen affinity like scFv, excellent tissue penetrating power and the like, but also has a more stable structure.
(Ii) F (ab) 2: comprising a bivalent fragment consisting of two Fab's linked by a disulfide bridge in the hinge region.
(Iii) Fv: the variable fragment (Fv) is located at the N-terminus of the antibody Fab fragment, contains only the variable region, and consists of one light chain and one heavy chain variable region, is a dimer of one VH and one VL that are non-covalently bound (VH-VL dimer), and the 3 CDRs of each variable region interact to form an antigen binding site on the surface of the VH-VL dimer, with the ability to recognize and bind antigen, although with less affinity than the whole antibody.
(Iv) (Fv) 2: consists of two Fv fragments covalently linked together.
(V) scFv: the Single chain antibody (scFv) is an Fv fragment consisting of a Single polypeptide chain, which is formed by joining a heavy chain variable region (VH) and a light chain variable region (VL) via a flexible linker (linker, typically consisting of 10 to 25 amino acids), which retains the binding specificity of the original antibody to an antigen, and the linker in the present invention is not particularly limited as long as it does not interfere with the expression of the antibody variable regions joined at both ends thereof. Compared with full-length antibodies, scFv has the characteristic of small molecular weight, thus having higher penetrability and lower immune side reaction.
(Vi) The sc (Fv) 2 fragment is formed by connecting two heavy chain variable regions and two light chain variable regions by a linker or the like.
In some embodiments, the full length sequence of an antibody or antibody fragment of the invention may comprise Complementarity Determining Regions (CDRs) and Framework Regions (FRs) from a rabbit immunoglobulin sequence. In other embodiments, the antibodies may comprise amino acid residues encoded by non-rabbit immunoglobulin sequences, e.g., humanized antibodies, chimeric antibodies, etc., to reduce body rejection while maintaining the desired specificity, affinity. The term "chimeric antibody" refers to an antibody in which a portion is derived from a particular source or species, while the remainder is derived from a different source or species. The term "humanized antibody" is a chimeric antibody in which the CDR regions of a non-human antibody, such as a rabbit antibody, and the FR regions derived from a mouse, in some cases the variable regions of a non-human antibody bind to the constant regions of a human antibody, e.g., a mouse rabbit chimeric antibody; in other cases, the CDR regions of a non-human antibody are combined with FR regions and constant regions derived from human antibody sequences by grafting the CDR regions of a non-human antibody onto murine antibody Framework (FR) sequences derived from single or multiple other murine antibody variable region framework sequences. In the present invention, the CDR regions in the chimeric or humanized antibody are derived from rabbit-derived CDR regions.
The terms "monoclonal antibody" or "mab" and the like are used interchangeably and refer to a homogeneous population of antibodies, i.e., the individual antibodies comprising the population are identical except for small amounts of mutations and/or post-translational modifications (e.g., isomerization, amidation) that may occur naturally. "monoclonal antibodies" are highly specific, exhibiting a single binding specificity and affinity for the same or substantially the same epitope on an antigen. The modifier "monoclonal" indicates the antibody is obtained from a substantially homogeneous population of antibodies and is not to be construed as limiting the source or manner of preparation of the antibody. The antibodies can be prepared by a variety of methods including, but not limited to, hybridoma methods, phage display methods, yeast display methods, recombinant DNA methods, single cell screening, or single cell sequencing methods.
The term "specific binding" is a term well known in the art that exhibits "specific binding," "specific binding," or is referred to as "preferential binding" if a molecule reacts more frequently, more rapidly, longer in duration, and/or with greater affinity to a particular antigen or epitope of interest than to other antigens or epitopes of interest, and does not necessarily require (although may include) exclusive binding.
In order that the above-recited objects, features and advantages of the present invention will become more readily apparent, a more particular description of the invention briefly described above will be rendered by reference to specific embodiments thereof which are illustrated in the appended drawings.
The embodiment of the invention provides an antibody for resisting human CD45RA protein, which comprises a light chain variable region and a heavy chain variable region, wherein the light chain variable region and the heavy chain variable region comprise 3 Complementarity Determining Regions (CDRs) which are respectively named as CDR1, CDR2 and CDR3, wherein the amino acid sequences of the complementarity determining regions 1 (CDR 1), the complementarity determining regions 2 (CDR 2) and the complementarity determining regions 3 (CDR 3) on the light chain variable region are respectively shown as SEQ ID NO.3, SEQ ID NO.4 and SEQ ID NO. 5; the amino acid sequences of complementarity determining region 1 (CDR 1), complementarity determining region 2 (CDR 2) and complementarity determining region 3 (CDR 3) on the heavy chain variable region are shown in SEQ ID NO.8, SEQ ID NO.9 and SEQ ID NO.10, respectively.
The anti-human CD45RA protein antibody with the CDR sequence provided by the invention can specifically identify recombinant CD45RA protein obtained by genetic engineering expression and natural CD45RA protein expressed on cells, and the reactivity of the antibody to the recombinant CD45RA protein and the homotype protein thereof is detected by an enzyme-linked immunosorbent assay, and the antibody only identifies and binds the CD45RA protein and has no cross reaction with the homotype protein; further, the antibody of the invention has obvious fluorescence transition on positive cells expressing CD45RA protein and single signal intensity, and has no signal in negative cells. The results prove that the antibody has good specificity and higher affinity to the CD45RA protein, can effectively resist the interference of cell components, obviously improves the accuracy, sensitivity and reliability of immunodetection of the CD45RA protein, and has wide application prospect in the immunodetection fields of flow cells and the like.
Alternatively, the light chain variable region and the heavy chain variable region each comprise 4 Framework Regions (FR), 4 FR and 3 CDRs sequentially staggered to form the variable region. The amino acid sequence of the light chain variable region (VL) of the antibody is shown as SEQ ID NO.2, and the amino acid sequence of the heavy chain variable region (VH) is shown as SEQ ID NO. 7.
Optionally, the antibodies of the invention further comprise a light chain constant region and a heavy chain constant region, CL and VL comprising the complete light chain (FL), CH and VH comprising the complete heavy chain (FH). The constant regions of antibodies are typically obtained by public interrogation, such as: the rabbit source IGG GAMMA C REIGN was searched for CH and the rabbit source IGG KAPPA C REIGN was searched for CL via IMGT online database (www.imgt.org). Specifically, the amino acid sequence of the antibody light chain is shown as SEQ ID NO.1, and the amino acid sequence of the heavy chain is shown as SEQ ID NO. 6.
Alternatively, the first antibody and/or the second antibody is a full length antibody (having a typical Y-type molecular structure) or is an antigen binding region of the full length antibody; the antigen binding region refers to a polypeptide that retains substantially the same biological function or activity as the full length form of the antibody, in particular, the antigen binding region comprises CDR regions as described above, more preferably has variable regions as described above, thereby retaining intact antigen recognition and binding sites that are capable of binding to the same antigen, particularly to the same epitope, as the full length antibody. Optionally, the antigen binding region is selected from at least one of Fab, F (ab) 2、Fab'、F(ab')2、Fv、(Fv)2, scFv, and sc (Fv) 2. These antigen binding regions can be obtained by techniques conventional in the art.
In yet another embodiment, the invention provides an antibody conjugate comprising an antibody as described above against human CD45RA protein, and a detection label attached to the antibody.
The detection mark is used for generating identifiable signal changes so as to identify a sample to be detected according to the signal changes. Detection labels include, but are not limited to: biotin, fluorescent dyes (e.g., umbelliferone, fluorescein isothiocyanate, rhodamine, dichlorotriazinylamine fluorescein, dansyl chloride), fluorescent proteins (e.g., isophthalocyanin, phycoerythrin, perCP, and phycocyanin), enzymes (e.g., alkaline phosphatase, acid phosphatase, beta-galactosidase, glucose oxidase, horseradish peroxidase, acetylcholinesterase, avidin), colloidal gold, colored magnetic beads, latex particles, radionuclides, detection antibodies, or combinations thereof.
Another embodiment of the invention provides a nucleic acid molecule for encoding an antibody against human CD45RA protein as described above, a recombinant vector comprising said nucleic acid molecule or a host cell comprising said nucleic acid molecule.
The nucleic acid molecule may be in the form of DNA (e.g., cDNA or genomic DNA or synthetic DNA) or RNA (e.g., mRNA or synthetic RNA). The DNA may be single-stranded or double-stranded, or may be a coding strand or a non-coding strand.
The sequence of the nucleic acid molecule is deduced from the antibody AA sequence by conventional means such as codon encoding rules. The full-length sequence of the nucleic acid molecule or a fragment thereof can be obtained by PCR amplification, recombinant methods or artificial synthesis. The obtained nucleic acid molecules are inserted into an expression vector, then introduced into a host cell, and cultured under specific conditions, so that the antibody can be obtained by expression.
Illustratively, the antibody light chain variable region has a nucleic acid sequence as shown in or complementary to SEQ ID NO.16, and the heavy chain variable region has a nucleic acid sequence as shown in or complementary to SEQ ID NO. 18.
Illustratively, the antibody light chain has a nucleic acid sequence shown in or complementary to SEQ ID NO.15, and the heavy chain has a nucleic acid sequence shown in or complementary to SEQ ID NO. 17.
It will be appreciated by those skilled in the art that nucleic acid molecules other than those exemplified above may equally encode an antibody of the invention due to the degeneracy of the genetic code, and therefore the nucleic acid molecules exemplified above should not be taken as limiting the scope of the invention.
The original vector from which the recombinant vector is constructed is a variety of vectors conventional in the art, as long as it is capable of harboring the nucleic acid molecule. Typical vectors include plasmids (e.g., pBR322, pUC series, pET series, pGEX series), viral vectors, phages (e.g., λgt4λB, λ -Charon, λΔz1 and M13), cosmids and minichromosomes. The vector may be a cloning vector (i.e., for transferring the nucleic acid molecule into a host and for mass propagation in a host cell) or an expression vector (i.e., comprising the necessary genetic elements to allow expression of the nucleic acid molecule inserted into the vector in a host cell). The nucleic acid molecules of the invention may be inserted into a suitable vector to form a cloning vector or an expression vector carrying the nucleic acid molecule. This is well known in the art and will not be described in detail herein.
The nucleic acid molecules encoding antibodies FL and FH of the present invention may be inserted into two vectors, respectively, which may be introduced into the same or different host cells. When the heavy and light chains are expressed in different host cells, each chain may be isolated from the host cell in which it is expressed and the isolated heavy and light chains mixed and incubated under appropriate conditions to form the antibody. In other embodiments, antibodies FL and FH nucleic acid molecules can also be cloned into a vector, each nucleic acid sequence connected to the appropriate promoter downstream; for example, each nucleic acid sequence encoding a heavy chain and a light chain may be operably linked to a different promoter, or the nucleic acid sequences encoding the heavy chain and the light chain may be operably linked to a single promoter such that both the heavy chain and the light chain are expressed from the same promoter. The choice of expression vector/promoter depends on the type of host cell used to produce the antibody.
Transfection or transformation of the recombinant vector into the host cell is performed using conventional techniques. When the host is a prokaryote such as E.coli, competent cells capable of absorbing DNA are obtained after the exponential growth phase and treated with CaCl 2 or MgCl 2; or by microinjection, electroporation, or liposome encapsulation. When the host is eukaryotic, the following DNA transfection methods may be used: the gene transfer is realized by adopting a calcium phosphate coprecipitation method, a microinjection method, an electroporation method, liposome packaging or particle bombardment method and the like.
The host cell may be a prokaryotic or eukaryotic cell. Examples of prokaryotic host cells useful in the present invention include, but are not limited to, E.coli (e.g., DH 5. Alpha., JM109, BL21, W3110), bacillus (e.g., bacillus subtilis, bacillus thuringiensis), enterobacteriaceae strains (e.g., salmonella typhimurium, serratia marcescens), and Pseudomonas. Examples of eukaryotic host cells that can be used for transformation include, but are not limited to, yeast, insect cells, and animal cells, such as Drosophila S2 or Sf9 cells, mammalian CHO, CHO DG44, CHO-S, COS-7, 293 series cells, hepG2, huh7, 3T3, RIN, MDCK, and HEK293 cell lines. After obtaining the host cell transfected or transformed with the recombinant vector as described above, the antibody can be expressed by culturing under appropriate conditions, and then isolated to obtain the purified antibody.
In a preferred embodiment, the recombinant vector is the mammalian expression vector pBR322 and the host cell is a human kidney epithelial cell (293F cell).
In a further embodiment, the invention provides the use of an antibody or antibody conjugate against human CD45RA protein as described above for the preparation of a human CD45RA protein immunoassay reagent and/or kit.
The application advantages of the anti-human CD45RA protein antibody or antibody conjugate in preparing the human CD45RA protein immunoassay reagent and/or kit are the same as those of the anti-human CD45RA protein antibody described above in comparison with the prior art, and are not described in detail herein.
The embodiment of the invention also provides a human CD45RA protein immunodetection reagent and/or a kit, which comprises the antibody or the antibody conjugate for resisting the human CD45RA protein.
The antibody of the present invention may be used alone or may be conjugated or coupled to a detection label to form an antibody conjugate. In some embodiments, the antibodies of the invention are used as antigen binding antibodies that specifically recognize and bind to CD45RA protein in a sample to be tested, and then qualitative or quantitative detection of CD45RA protein is achieved by producing a recognizable signal change by a detection label attached thereto, in other embodiments, the anti-human CD45RA protein antibody (as primary or capture antibody) is not labeled, and a detection label is conjugated to a primary antibody (as detection antibody) or other molecule, e.g., if the anti-human CD45RA protein antibody is a rabbit IgG antibody, the secondary antibody may be an anti-rabbit IgG antibody, whereby a recognizable signal change is produced after specific binding of the antibody of the invention by conjugation of the detection labeled secondary antibody, thereby achieving qualitative or quantitative detection.
The above-described immunoassay methods include, but are not limited to: enzyme immunoassay (Enzyme immunoassay, EIA), enzyme-linked immunosorbent assay (Enzyme linked immunosorbent assay, ELISA), enzyme-linked immunosorbent assay (Enzyme-linked Immunospot, ELISPOT), immunohistochemistry (Immunohistochemistry, IHC), immunofluorescence (IF), immunoblotting (Western blot, WB), immunoprecipitation (Immunoprecipitation, IP) and Flow Cytometry (FC). The test subjects include recombinantly expressed CD45RA protein and naturally secreted or expressed CD45RA protein. Test samples include, but are not limited to, serum, plasma, urine, cell culture fluid, and tissue homogenates.
In a preferred embodiment, the immunoassay is a flow cytometry and the detection reagent and/or kit is a flow cytometry detection reagent and/or kit.
The invention will be further illustrated with reference to specific examples. The experimental methods in which specific conditions are not specified in the following examples are generally conducted under conventional conditions, for example, those described in the molecular cloning Experimental guidelines (fourth edition) published in Cold spring harbor laboratory, or are generally conducted under conditions recommended by the manufacturer.
EXAMPLE 1 preparation of rabbit monoclonal antibody against human CD45RA protein
The immunogen adopted is Human recombinant CD45RA protein, the sequence of Human CD45RA protein 26aa-482aa is constructed into pYURK-Chis vector, the sequence of Human CD45RA protein is shown as Uniprot number P08575-8, and the sequence of Gene is shown as Uniprot number Gene ID:5788. the pYURK-Chis vector is transferred into 293F cells, and recombinant Human CD45RA mature protein 26aa-482aa with biological activity is expressed in the 293F cells. Methods for expression and purification of CD45RA protein are routinely practiced in the art.
The immunogen is adopted to immunize New Zealand white rabbits to obtain immunopotentiated B lymphocytes, and then monoclonal antibody development technology based on single B lymphocyte screening and culture is adopted to obtain the antibody of the anti-human CD45RA protein. The sequencing work was performed by Jin Kairui Biotechnology Inc., the Amino Acid (AA) and nucleic acid (DNA) sequences of the antibodies are shown in Table 1, wherein LCDR1-3 represents light chain CDRs 1-3, respectively, and HCDR1-3 represents heavy chain CDRs 1-3, respectively.
TABLE 1 sequence information of Rabbit monoclonal antibodies of this example
1.1 Immunization of animals
Taking recombinant Human CD45RA protein as immunogen to respectively immunize 4 New Zealand white rabbits; each white rabbit was immunized with 200 μg of immunogen, and the immunogen was mixed with an equivalent amount of complete Freund's adjuvant (purchased from Sigma Co.) to prepare an emulsifier prior to the first immunization, and injected subcutaneously in the abdomen and back of the rabbits at multiple points; 100 μg of immunogen was mixed with an equal amount of incomplete Freund's adjuvant (purchased from Sigma company) every 3 weeks after the first immunization to prepare an emulsifier, which was subcutaneously injected at the abdomen and back of rabbits at multiple points to boost the immunization twice. Serum samples of rabbits were collected after three immunizations, at 1: titers against Human CD45RA were determined by ELISA after 243000 dilution, rabbits with OD450nm exceeding 0.2 were boosted once with 200. Mu.g of immunogen by subcutaneous multipoint injection, and spleens were sacrificed three days later. The specificity and affinity of serum to positive samples were determined by FC method.
1.2 Rabbit immune serum titre coupled immunosorbent assay (ELISA) detection
Immune serum titer is detected by indirect enzyme-linked immunosorbent assay (ELISA), and the specific operation comprises: 1) Coating Human CD45RA: recombinant Human CD45RA protein diluted with 1 XPBS buffer (final concentration 1. Mu.g/mL), diluted Human CD45RA protein was added at 25. Mu.L/well to 384-well plates, and after balancing 384-well plates, plates were briefly centrifuged (stopped after reaching 1000 rpm) and incubated overnight at 4 ℃; 2) Closing: the overnight plates at 4℃were removed and washed 5 times with 75. Mu.L of wash buffer (PBS containing 0.05% (v/v) Tween-20) added to each well with a plate washer; blocking buffer (PBS containing 1% BSA, 0.5% gelatin and 5% sucrose) was then added at 50. Mu.L/well and incubated for 1h at room temperature for blocking unrelated binding sites; 3) Gradient dilution and sample adding of serum to be tested: the plate wash procedure of 2) was repeated, the serum to be tested was diluted in a gradient in 96-well plates and diluted with dilution buffer (PBS containing 1% bsa) at 1:1000, carrying out triple dilution, namely 8 gradients, wherein the dilution ratio can be adjusted according to actual conditions; 4) Secondary antibody incubation: the plate washing procedure of 2) was repeated and the plate was washed and horseradish peroxidase (HRP) -conjugated goat anti-rabbit IgG (ex Jackson, cat No. 111-035-045) was diluted with dilution buffer at a dilution ratio of 1:5000, adding diluted goat anti-rabbit IgG-HRP into the plate according to 25 mu L/hole, for binding the target protein in the plate, and incubating for 1h at room temperature in a dark place; 5) Termination reaction and color development: repeating the step 2) to wash the pore plate, adding TMB for developing at 100 mu L/hole, keeping away from light at 37 ℃ for 10min, adding 0.5M oxalic acid solution at 100 mu L/hole to stop the reaction, measuring the absorption value at 450nm, taking the rabbit serum before immunization as negative control, and judging the titer of the immune serum by taking the ratio of the measured value to the control value as positive, wherein the ratio is more than or equal to 2.1.
The serum titer test results are shown in fig. 1, and it can be seen that the rabbit developed a stronger immune response after the third immunization and the fourth booster immunization, and the titer of the neutralizing antibodies was higher.
1.3 Rabbit immune serum Flow Cytometry (FC) detection
The specificity of immune serum and a cell sample to be tested adopts a Flow Cytometry (FC) method, and the method comprises the following steps: 1) And (3) disinfection: ultraviolet irradiation sterilization super clean bench for 15-20min, and blower fan for 5min, preparing for aseptic work; 2) Cell viability detection: collecting and washing cells to be detected, measuring the total number of the cells, checking whether the activity of the cells is about 95% and not lower than 90%, re-suspending the cells to about 3X 10 6-5×106 cells/mL by using 1X PBS solution, distributing the cells into 96-well V-shaped plates, and 50 mu L of each well; 3) Incubation resistance: the immune serum diluted with 1 XSain buffer (PBS containing 0.5% BSA, BSA available from Biofrox, cat. No. 4240GR 500) was dispensed into a 96-well V-plate at 50. Mu.L per well, and the cells in each well were resuspended and mixed; adding an equal volume of station buffer into the negative control, re-suspending cells in each well, and mixing; wrapping the V-shaped 96-hole plates with aluminum foil paper, and gently mixing the V-shaped 96-hole plates on a micro-hole plate vibration mixing instrument for 30min; centrifuging at 400g for 5min, discarding supernatant, and washing with Stain buffer for 2 times; 4) Secondary antibody incubation: 100 μl per well will be buffered with a station buffer at 1:200 diluted Fluorescein (FITC) AffiniPure F (ab') 2Fragment Goat Anti-Rabbit IgG (purchased from jackson, cat# 111-096-046) was dispensed into 96-well V-plates, cells in each well resuspended, and mixed; wrapping with aluminum foil paper, and gently mixing on a microplate vibration mixer for 30min; washing with Stain buffer for 2 times; each well of cells was resuspended with 200 μl FACS buffer and stored in the dark; 5) Flow analysis: analysis was performed as per Beckman cytoflex flow analyser usage and maintenance instructions. Isotype control antibody was from ABclonal, cat No. a24173.
The cell samples comprise positive cells of human T lymphocyte leukemia cells Jurkat, human B lymphocyte Daudi and negative cells of human kidney epithelial cells 293T, wherein the positive cells highly express CD45RA, and the negative cells do not express CD45RA. The FC detection results of the diluted rabbit immune serum and positive and negative cells are shown in fig. 2-3, and the serum dilutions are 1: 500. 1:1000 and 1:2000, the abscissa in the figure shows fluorescence brightness, the ordinate shows cell number, the red curve is negative control, the blue curve is isotype control, and the yellow curve is serum to be tested. As can be seen from the figure, the positive fluorescence signal transitions of each serum dilution are better, the animal is determined to be immunized better, antibodies which can be used for flow detection are generated in vivo, and the animal can enter the stage of separating spleen cells.
1.4 Isolation of B lymphocytes from spleen and B lymphocyte sorting
B lymphocytes in spleen are separated by adopting a conventional method, and antigen-specific B lymphocytes are obtained by sorting, and related methods are disclosed in published patent (publication number: CN110016462A, publication date: 2019-07-16) and a B lymphocyte in vitro culture system and application (publication number: CN111518765A, publication date: 2020-08-11).
1.5 Cloning and expression of Gene encoding Rabbit-derived monoclonal antibody
The cultured B cell supernatants were used to identify positive clones by antigen coated ELISA. Cells of positive clones were collected and lysed, and RNA was extracted using Quick-RNA TM MicroPrep kit (available from ZYMO, cat. No. R1051) and reverse transcribed into cDNA. The cDNA is used as a template, a PCR method is adopted to amplify the light chain variable region (VL) and heavy chain variable region (VH) genes of the naturally paired rabbit monoclonal antibodies from the cDNA of the corresponding positive clone, and a plurality of clones are selected for sequencing. Wherein, the PCR reaction system is as follows: 4. Mu.L of cDNA, 1. Mu.L of forward primer (10 mM), 1. Mu.L of reverse primer (10 mM), 12.5. Mu.L of 2X GloriaHiFi (from ABclonal, cat. RK 20717) and 6.5. Mu. L H2O. The PCR amplification procedure included: the reaction mixture was subjected to preliminary denaturation at 98℃for 30s, followed by 40 cycles at 98℃for 10s,64℃for 30s, and 72℃for 30s, and finally kept at 72℃for 5min, and the resulting reaction mixture was kept at 4 ℃. The sequences of the forward and reverse primers are shown below:
VL-F:5'-tgaattcgagctcggtacccatggacacgagggcccccac-3' (see SEQ ID NO. 11);
VL-R:5'-cacacacacgatggtgactgttccagttgccacctgatcag-3' (see SEQ ID NO. 12);
VH-F:5'-tgaattcgagctcggtacccatggagactgggctgcgctg-3' (see SEQ ID NO. 13);
VH-R:5'-gtagcctttgaccaggcagcccagggtcaccgtggagctg-3' (see SEQ ID NO. 14).
The light and heavy chain encoding genes are loaded on an expression vector. The mammalian expression vector pBR322 used previously carried rabbit light chain constant region (CL) and heavy chain constant region (CH) sequences. The pBR322 pattern is shown in FIG. 4, in which pBR322origin and f1origin are replication promoters, AMPCILLIN is a resistance gene, CMV promoter is a transcription promoter, SV40PA terminator is a tailing signal, LIGHT CHAIN constant is a nucleic acid sequence of CL (left panel), and HEAVY CHAIN constant is a nucleic acid sequence of CH (right panel). CL, CH CL is obtained by searching IMGT database (www.imgt.org), searching rabbit source IGG GAMMA C REIGN for CH, and searching rabbit source IGG KAPPA C REIGN for CL.
The antibody variable region genes containing the signal peptide obtained by the PCR amplification are purified, pBR322 plasmids containing rabbit CL and CH are respectively subjected to conventional linearization treatment by using NheI and XbaI restriction enzymes, the heavy chain variable region genes and the light chain variable region genes are respectively connected into the corresponding plasmids by adopting a homologous recombination mode, and the sequence is determined by sequencing, and the sequencing work is completed by Jin Kairui biotechnology Co, so that the rabbit monoclonal antibody against the Human CD45RA protein is obtained and is named as 3B2.
The signal peptide of this example may be expressed by using an antibody commonly used in the art, such as a rabbit monoclonal antibody against Human interferon alpha 2 and its use (publication No. CN116063487A, publication No. 2023-05-05) "and a rabbit monoclonal antibody against high affinity Human IL-5 and its use (publication No. CN115819578A, publication No. 2023-03-21)" having a signal peptide of "MDTRAPTQLLGLLLLWLPGATF" upstream of VL (the encoding gene may be ATGGAC ACGAGGGCCCCCACTCAGCTGCTGGGCCTGCTGCTTCTGTGGCTTCCTGGAGCCACCTT T) and a signal peptide of "METGLRWLLLVAVLKGVQC" upstream of VH (the encoding gene may be ATGGAGACTG GGCTGCGCTGGCTTCTCCTGGTTGCAGTGCTGAAAGGAGTCCAGTGC).
And (3) transfecting the successfully constructed expression vector containing the light chain (FL) gene and the heavy chain (FH) gene into 293F cells, and culturing for 72-96h after transfection to obtain the recombinant antibody recognizing the human CD45RA protein contained in culture supernatant. The antibody of interest 3B2 was purified from the culture supernatant using a proteona affinity gel resin (purchased from world and cat No. SA 023100). The experimental procedure was as follows: the culture supernatant was transferred to a sterile 50mL centrifuge tube, centrifuged at 1000g and 4℃for 10min and the supernatant was collected. The pretreated ProteinAAgarose suspension was added to the centrifuged cell supernatant and incubated with shaking for 3-4h (room temperature) or overnight at 4 ℃. After incubation, 1000g of the solution is centrifuged for 10min, proteinAAgarose of the suspension is transferred to an adsorption column, and the solution is centrifuged for 1min at normal temperature to separate solid from liquid, and the flow-through solution is collected. 10 times Protein AAgarose volumes of wash buffer was added and the particles resuspended, centrifuged in a centrifuge, and the wash solution was collected and washed twice more. Adding an l volume of elution buffer solution into an adsorption column, centrifuging to obtain an antibody supernatant, loading the antibody supernatant into a dialysis bag, dialyzing overnight to obtain a purified antibody 3B2, verifying the purity of the antibody by using 12% SDS-PAGE gel electrophoresis, subpackaging after the antibody is verified to be qualified, and preserving at a low temperature of-20 ℃ for later use, wherein the concentration of the obtained antibody is 2mg/mL, and the purity is more than 95%.
EXAMPLE 2 detection of antibody recognition specificity of rabbit monoclonal antibody 3B2
2.1, Indirect enzyme-linked immunosorbent assay (ELISA) for determining Cross-reactivity
Determination of whether 3B2 antibody specifically recognizes CD45RA protein by indirect enzyme-linked immunosorbent assay (ELISA), the specific procedure is as in example 1, except that immune serum is replaced with antibody 3B2, which is used as a 1:1000 starts and a triple dilution is performed for a total of 8 gradients. The isotype protein Human CD45RB (Uniprot No. P08575-9, preparation method was the same as in example 1, expression segment was 26-463 aa), human CD45RO (Uniprot No. P08575-4, preparation method was the same as in example 1, expression segment was 27-120 aa) was used as negative screen control, pre-immune rabbit serum was used as negative control, other rabbit antibodies (from Abclonal, cat No. A23507) which did not recognize CD45RA were used as irrelevant control, NC represents blank control without immune serum/antibody to be tested, with buffer (1 XPBS containing 1% BSA) alone, and the results of titer detection are shown in Table 2.
TABLE 2 results of titer detection for rabbit monoclonal antibody 3B2 of this example
As can be seen from Table 2, antibody 3B2 was higher in only human CD45RA protein, and no titer was detected in CD45RB and CD45 RO. The specific recognition of CD45RA, the non-recognition and the combination of CD45RB and CD45RO by the antibody are proved to have high specificity and excellent specificity.
2.2 Measurement of antibody affinity by flow cytometry
The cell samples of this example include positive samples Jurkat, daudi and negative samples 293T, the positive samples refer to the corresponding cells or tissues expressing CD45RA protein, and the negative samples refer to the corresponding cells or tissues not expressing CD45RA protein. The assay method is described in example 1, wherein the primary antibody is rabbit monoclonal antibody 3B2 of the invention, the concentration of the antibody is 0.2 mug/mL, and the fluorescent secondary antibody is ABflo488 (Fluorescein (FITC) AffiniPure F (ab') 2Fragment Goat Anti-Rabbit IgG, fcgamma FRAGMENT SPECIFIC, available from jackson under the accession number 115-096-071) or ABflo647(Alexa 647AffiniPure Goat Anti-Rabbit IgG, fcgamma FRAGMENT SPECIFIC, available from jackson under accession number 115-605-071) to verify the suitability of antibodies for different fluorescence. The antibody 3B2 of the invention recognizes CD45RA protein, the fluorescent secondary antibody 3B2 can judge the specificity and affinity of the primary antibody by recognizing the fluorescence intensity (fluorescence transition) and the fluorescence cell ratio, the result is shown in figures 5-6, a negative cell sample and a positive cell sample are respectively from left to right, and figure 5 is a positive cell Daudi (fluorescence signal ABflo488 FIG. 6 shows a positive cell Jurkat (fluorescence signal ABflo)647 The abscissa in the figure shows the fluorescence intensity of 647 or 488, the ordinate shows the cell number, the red curve is a negative control, the blue curve is a isotype control, and the yellow curve is the antibody 3B2 to be measured.
The result shows that when the antibody 3B2 detects CD45RA protein secreted naturally on the cell surface, fluorescence transition is good, which indicates that the antibody recognition target human CD45RA protein has high affinity, a unique peak exists positively, no background signal exists on a negative sample, the antibody has high specificity, the method has the advantages of high analysis sensitivity, strong anti-interference capability and the like, and the adaptability to 488 and 647 fluorescence detection signals is good, so that the antibody can meet the detection characteristic of multiple fluorescence.
The foregoing description of the preferred embodiments of the invention is not intended to be limiting, but rather is intended to cover all modifications, equivalents, and alternatives falling within the spirit and principles of the invention.

Claims (10)

1. An antibody for resisting human CD45RA protein is characterized by comprising a light chain variable region and a heavy chain variable region, wherein the amino acid sequences of complementarity determining regions CDR1, CDR2 and CDR3 on the light chain variable region are respectively shown as SEQ ID NO.3, SEQ ID NO.4 and SEQ ID NO. 5; the amino acid sequences of complementarity determining regions CDR1, CDR2 and CDR3 on the heavy chain variable region are shown in SEQ ID NO.8, SEQ ID NO.9 and SEQ ID NO.10, respectively.
2. The antibody against human CD45RA protein according to claim 1, wherein the amino acid sequence of the light chain variable region is shown in SEQ ID No.2 and the amino acid sequence of the heavy chain variable region is shown in SEQ ID No. 7.
3. The antibody against human CD45RA protein of claim 2, wherein the antibody further comprises a light chain constant region and a heavy chain constant region; wherein the light chain constant region and the light chain variable region form a complete light chain, and the amino acid sequence of the light chain is shown as SEQ ID NO. 1; the heavy chain constant region and the heavy chain variable region form a complete heavy chain, and the amino acid sequence of the heavy chain is shown as SEQ ID NO. 6.
4. The antibody against human CD45RA protein according to claim 1, wherein the antibody is a full length antibody or an antigen binding region thereof; the antigen binding region is selected from at least one of a Fab fragment, a F (ab) 2 fragment, an Fv fragment, an (Fv) 2 fragment, an scFv fragment, and an sc (Fv) 2 fragment.
5. An antibody conjugate comprising an antibody to human CD45RA protein according to any one of claims 1-4, and a detection label attached to the antibody.
6. A nucleic acid molecule encoding an antibody against the human CD45RA protein according to any one of claims 1-4.
7. The nucleic acid molecule of claim 6, wherein the light chain variable region of said antibody has a nucleic acid sequence as shown in or complementary to SEQ ID No.16 and the heavy chain variable region has a nucleic acid sequence as shown in or complementary to SEQ ID No. 18.
8. The nucleic acid molecule of claim 7, wherein the antibody light chain has a nucleic acid sequence as shown in or complementary to SEQ ID No.15 and the heavy chain has a nucleic acid sequence as shown in or complementary to SEQ ID No. 17.
9. Use of an antibody against human CD45RA protein according to any one of claims 1-4 or an antibody conjugate according to claim 5 for the preparation of a human CD45RA protein immunoassay and/or kit.
10. A human CD45RA protein immunoassay reagent and/or kit comprising an antibody against a human CD45RA protein according to any one of claims 1-4, or an antibody conjugate according to claim 5.
CN202410915325.6A 2024-07-09 2024-07-09 Antibodies against human CD45RA protein, antibody conjugates and their applications Active CN118620078B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202410915325.6A CN118620078B (en) 2024-07-09 2024-07-09 Antibodies against human CD45RA protein, antibody conjugates and their applications

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202410915325.6A CN118620078B (en) 2024-07-09 2024-07-09 Antibodies against human CD45RA protein, antibody conjugates and their applications

Publications (2)

Publication Number Publication Date
CN118620078A CN118620078A (en) 2024-09-10
CN118620078B true CN118620078B (en) 2024-11-19

Family

ID=92606543

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202410915325.6A Active CN118620078B (en) 2024-07-09 2024-07-09 Antibodies against human CD45RA protein, antibody conjugates and their applications

Country Status (1)

Country Link
CN (1) CN118620078B (en)

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN120535635B (en) * 2025-07-29 2025-11-21 杭州华大生命科学研究院 Detection of anti-CD45 antibodies against common leukocyte antigens by flow cytometry and their applications
CN120554516B (en) * 2025-07-30 2025-10-24 杭州华大生命科学研究院 Anti-CD 45 antibody and application thereof

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107810199A (en) * 2015-06-24 2018-03-16 豪夫迈·罗氏有限公司 Anti-transferrin receptor antibodies with custom affinity
CN117736332A (en) * 2023-12-20 2024-03-22 武汉爱博泰克生物科技有限公司 Anti-human CD142 protein rabbit monoclonal antibody and application thereof

Family Cites Families (19)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101831434B (en) * 2009-07-27 2012-05-09 浙江大学 Anti-human CD45RA rat immune globulin variable region gene and application
CN101706507B (en) * 2009-07-27 2013-05-01 浙江大学 Application of anti-human CD45RA monoclonal antibody marked by fluorescein isothiocyanate
US9255154B2 (en) * 2012-05-08 2016-02-09 Alderbio Holdings, Llc Anti-PCSK9 antibodies and use thereof
EP3026060A1 (en) * 2014-11-26 2016-06-01 Miltenyi Biotec GmbH Humanized antibody or fragment thereof specific for CD45R0
RS63384B1 (en) * 2015-01-08 2022-08-31 BioNTech SE AGONIST AGENTS FOR BINDING TNF RECEPTORS
US9434785B1 (en) * 2015-04-30 2016-09-06 Kymab Limited Anti-human OX40L antibodies and methods of treating graft versus host disease with the same
US11136609B2 (en) * 2015-11-09 2021-10-05 National University Corporation Kyoto Institute Of Technology Separating agent for human serum-derived IgG polyclonal antibodies, and method for separating human serum-derived IgG polyclonal antibodies using same
CN106046163A (en) * 2016-06-24 2016-10-26 安徽未名细胞治疗有限公司 Complete-human-derived anti-CD45 all-molecule IgG antibody and application thereof
HUE067040T2 (en) * 2017-05-16 2024-09-28 Byondis Bv Anti-sirpalpha antibodies
EP3676294A4 (en) * 2017-08-28 2021-12-22 Systimmune, Inc. ANTI-CD ANTIBODIES AND THEIR MANUFACTURING AND USE PROCEDURES
CN110938146B (en) * 2019-11-20 2024-04-12 华中农业大学 TIM-3 single domain antibodies and uses thereof
WO2022140388A1 (en) * 2020-12-21 2022-06-30 Allogene Therapeutics, Inc. Protease-activating cd45-gate car
CN113621069B (en) * 2021-09-06 2023-03-10 福州迈新生物技术开发有限公司 Anti-HER-2 protein monoclonal antibody and its preparation method and application
EP4433512A4 (en) * 2021-11-19 2025-12-31 Univ Pennsylvania MANIPULATED PAN LEUKCYTE ANTIGENE CD45 TO Facilitate CAR-T CELL THERAPY
CN119256014A (en) * 2022-03-24 2025-01-03 锕医药有限责任公司 Humanized anti-CD45 antibody
US20250326856A1 (en) * 2022-05-31 2025-10-23 Fred Hutchison Cancer Center Humanized anti-cd45 antibodies and uses thereof
WO2024055040A2 (en) * 2022-09-09 2024-03-14 Actinium Pharmaceuticals, Inc. Humanized anti-cd45 antibodies
EP4590713A1 (en) * 2022-09-20 2025-07-30 Vor Biopharma Inc. Anti-cd45-ign antibody drug conjugates and uses thereof
CN116143925A (en) * 2023-03-13 2023-05-23 武汉云克隆科技股份有限公司 A CD45 recombinant antibody

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107810199A (en) * 2015-06-24 2018-03-16 豪夫迈·罗氏有限公司 Anti-transferrin receptor antibodies with custom affinity
CN117736332A (en) * 2023-12-20 2024-03-22 武汉爱博泰克生物科技有限公司 Anti-human CD142 protein rabbit monoclonal antibody and application thereof

Also Published As

Publication number Publication date
CN118620078A (en) 2024-09-10

Similar Documents

Publication Publication Date Title
CN118620078B (en) Antibodies against human CD45RA protein, antibody conjugates and their applications
CN117700552B (en) Anti-human CD93 protein rabbit monoclonal antibody and application thereof
CN116813780B (en) Anti-human CD31 rabbit monoclonal antibody and application thereof
CN117487018B (en) Rabbit monoclonal antibody against human epididymis secretory protein 4 and its application
CN117069848B (en) Anti-human CD146 rabbit monoclonal antibody and its application
CN118638236B (en) Antibody against human CD127 protein, antibody conjugate and application thereof
CN118344476B (en) Human C reactive protein monoclonal antibody, antibody pair, and detection reagent or kit and application thereof
CN118373914B (en) Anti-human E-cadherin antibody, antibody conjugate and immunoassay reagent and their application
CN120081938B (en) Monoclonal antibody against human transcription factor PU.1 and application thereof
CN118440194B (en) Antibodies, antibody pairs, and detection reagents or kits for detecting mouse interleukin-2
CN120058924B (en) Antibody against human keratin 8, antibody conjugate and uses thereof
CN119039439B (en) Anti-human intercellular adhesion molecule-1 antibodies, antibody pairs and their applications
CN119638830B (en) Antibodies, antibody pairs, and kits targeting human S100A7 protein and their uses
CN119684454B (en) Antibodies, antibody pairs, and kits targeting human MCP-1 protein and their uses
CN119039437B (en) Rabbit monoclonal antibody against human follicle-stimulating hormone and its application
CN117777295B (en) Rabbit monoclonal antibody against human CD44 protein and its application
CN120081941A (en) Rabbit antibody and antibody conjugate against human PSGL-1 protein and their application
CN118440198B (en) Anti-human CD69 protein rabbit monoclonal antibody and application thereof
CN119684449B (en) Monoclonal antibody of anti-p 21 protein, antibody conjugate and application thereof
CN118561998B (en) Anti-sheep interleukin-6 antibody, antibody pair and application thereof
CN119684448B (en) Monoclonal antibody against Ki-67 protein and application thereof
CN118255883B (en) Monoclonal antibodies, antibody pairs and kits targeting human cone opsin-like protein 1 and their applications
CN120904333A (en) Monoclonal antibody against human NKp30 protein and application thereof
CN120081940A (en) Rabbit antibody against mouse neural cell adhesion molecule 1 and its application
CN120842405A (en) Monoclonal antibodies against human LAMP-2A protein and their applications in immunoassays

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant