Detailed Description
In order to make the objects, technical solutions and advantages of the present invention more apparent, the present invention will be described in further detail with reference to the following examples. The examples described herein are intended to illustrate the invention only and are not intended to limit the invention.
Various modifications to the precise description of the invention will be readily apparent to those skilled in the art from the information contained herein without departing from the spirit or scope of the appended claims. It is to be understood that the scope of the invention is not limited to the defined processes, properties or components, as these embodiments, as well as other descriptions, are merely illustrative of specific aspects of the invention. Indeed, various modifications of the embodiments of the invention which are obvious to those skilled in the art or related fields are intended to be within the scope of the following claims.
For a better understanding of the present invention, and not to limit its scope, all numbers expressing quantities, percentages and other values used in the present invention are to be understood as being modified in all instances by the term "about". Accordingly, unless indicated otherwise, the numerical parameters set forth in the specification and attached claims are approximations that may vary depending upon the desired properties sought to be obtained. Each numerical parameter should at least be construed in light of the number of reported significant digits and by applying ordinary rounding techniques.
In addition, it is noted that unless otherwise defined, in the context of the present invention, scientific and technical terms used should have meanings commonly understood by one of ordinary skill in the art.
The terms "comprising," "including," "having," and the like are intended to be non-limiting, as other steps and other ingredients not affecting the result may be added. The term "and/or" should be taken to refer to a specific disclosure of each of the two specified features or components with or without the other. For example, "a and/or B" is considered to include the following: (i) A, (ii) B, and (iii) A and B. The terms "first," "second," and the like, are used for distinguishing between similar objects and not necessarily for describing a particular sequential or chronological order, it being understood that such uses may be interchanged where appropriate.
The terms "rabbit monoclonal antibody", "rabbit antibody" and "rabbit monoclonal antibody" and the like have the same meaning and refer to antibodies that specifically bind murine (Mouse) interleukin-2 unless otherwise specified. The modifier "rabbit" means that the Complementarity Determining Regions (CDRs) of the antibody are derived from a rabbit immunoglobulin sequence. The terms "murine interleukin-2", "Mouse IL2", "Mouse interleukin-2", and the like have the same meaning.
An antibody is an immunoglobulin molecule capable of specifically binding to an antigen or epitope of interest through at least one antigen recognition site located in the variable region of the immunoglobulin molecule. In the present invention, the term "antibody" is to be interpreted in the broadest sense and includes different antibody structures, including but not limited to so-called full length antibodies, antibody fragments, and genetic or chemical modifications thereof, as long as they exhibit the desired antigen binding activity.
A typical antibody molecule (full length antibody) consists of two identical light chains (L) and two identical heavy chains (H). Light chains can be divided into two types, kappa and lambda chains, respectively; heavy chains can be categorized into five, μ, δ, γ, α and ε chains, respectively, and antibodies are defined as IgM, igD, igG, igA and IgE, respectively. The amino acid sequences of the heavy and light chains near the N-terminus vary greatly, the other portions of the amino acid sequences are relatively constant, the region of the light and heavy chains near the N-terminus, where the amino acid sequences vary greatly, is referred to as the variable region (V), and the region near the C-terminus, where the amino acid sequences are relatively stable, is referred to as the constant region (C). Heavy chain variable regions (VH) and light chain variable regions (VL) are typically the most variable parts of antibodies and contain antigen recognition sites. The VH and VL regions can be further subdivided into hypervariable regions (hypervariable region, HVR) also known as Complementarity Determining Regions (CDRs) which are circular structures, and Framework Regions (FR) where the heavy and light chain CDRs are held closely together and cooperate with one another by the FR regions to form surfaces complementary to the three-dimensional structure of the antigen or epitope of interest, determining the specificity of the antibody, and are the sites for antibody recognition and binding to the antigen. The FR region is the more conserved part of VH and VL, which are generally in the β -sheet configuration, joined by three CDRs forming a connecting loop. Each VH and VL is typically composed of three CDRs and four FRs arranged from amino-terminus to carboxy-terminus in the following order: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4.
CDRs and FR can be identified according to Kabat definition, chothia definition, a combination of both Kabat definition and Chothia definition, abM definition, contact definition, IMGT unique number definition and/or conformational definition, or any CDR determination method known in the art. As used herein, is defined by the Kabat numbering system.
The light chain constant region (CL) and the heavy chain constant region (CH) are not directly involved in binding of an antibody to an antigen, but they exhibit different effector functions, such as participation in antibody-dependent cytotoxicity of an antibody. CL lengths of different classes of igs (κ or λ) are substantially identical, but CH lengths of different classes of igs are different, e.g. IgG, igA and IgD include CH1, CH2 and CH3, while IgM and IgE include CH1, CH2, CH3 and CH4. The amino acid sequences of the antibody heavy and light chain constant regions are well known in the art.
Full length antibodies are the most complete antibody molecular structure, having a typical Y-type molecular structure, and thus, "full length antibodies", "complete antibodies" and "Y-type antibodies" are used interchangeably in the context of the present invention.
An antibody fragment is one or more portions or fragments of a full length antibody that substantially retains the same biological function or activity as the full length form, in particular, an antibody fragment comprises at least the same CDR regions, more preferably the same variable regions, as the full length antibody, thereby retaining intact antigen recognition and binding sites capable of binding to the same antigen (e.g., IL-2), and in particular to the same epitope, as the full length antibody. In typical examples, the antibody fragments include: fab, F (ab) 2、Fab'、F(ab')2、Fv、(Fv)2、scFv、sc(Fv)2, which may be obtained by techniques conventional in the art.
(I) Fab: antigen binding fragments (Fab) monovalent fragments consisting of the complete light chain (variable and constant regions) and part of the heavy chain (variable and first constant regions) are obtained by proteolytic cleavage of full length antibodies to give Fab, F (ab ') 2, fab' fragments and the like. For example, igG can be degraded into two Fab fragments and one Fc fragment by papain; igG can be degraded into a F (ab ') 2 fragment and a pFC' fragment by pepsin. The F (ab ') 2 fragment was further reduced to form two Fab' fragments. Because the Fab has an antigen binding region and a partial constant region, the Fab not only has the antibody-antigen affinity like scFv, excellent tissue penetrating power and the like, but also has a more stable structure.
(Ii) F (ab) 2: comprising a bivalent fragment consisting of two Fab's linked by a disulfide bridge in the hinge region.
(Iii) Fv: the variable fragment (Fv) is located at the N-terminus of the antibody Fab fragment, contains only the variable region, and consists of one variable region of one light chain and one heavy chain, is a dimer of one VH and one VL that are non-covalently bound (VH-VL dimer), and the 3 CDRs of each variable region interact to form an antigen-binding site on the surface of the VH-VL dimer, with the ability to recognize and bind antigen, although with less avidity than the whole antibody.
(Iv) (Fv) 2: consists of two Fv fragments covalently linked together.
(V) scFv: the Single chain antibody (scFv) is an Fv fragment consisting of a Single polypeptide chain, which is formed by joining a heavy chain variable region (VH) and a light chain variable region (VL) via a flexible linker (linker, typically consisting of 10 to 25 amino acids), which retains the binding specificity of the original antibody to an antigen, and the linker in the present invention is not particularly limited as long as it does not interfere with the expression of the antibody variable regions joined at both ends thereof. Compared with full-length antibodies, scFv has the characteristic of small molecular weight, thus having higher penetrability and lower immune side reaction.
(Vi) The sc (Fv) 2 fragment is formed by connecting two heavy chain variable regions and two light chain variable regions by a linker or the like.
In some embodiments, the full length sequence of an antibody or antibody fragment of the invention may comprise Complementarity Determining Regions (CDRs) and Framework Regions (FRs) from a rabbit immunoglobulin sequence. In other embodiments, the antibodies may comprise amino acid residues encoded by non-rabbit immunoglobulin sequences, e.g., murine antibodies, chimeric antibodies, etc. to reduce body rejection while maintaining the desired specificity, affinity. The term "chimeric antibody" refers to an antibody in which a portion is derived from a particular source or species, while the remainder is derived from a different source or species. The term "murine antibody" is a chimeric antibody in which the CDR regions of a non-murine antibody, such as a rabbit antibody, and the FR regions derived from a mouse, in some cases the variable regions of a non-murine antibody bind to the constant regions of a murine antibody, e.g., a mouse rabbit chimeric antibody; in other cases, the CDR regions of a non-murine antibody bind to the FR regions and constant regions derived from a murine antibody sequence by grafting the CDR regions of a non-murine antibody onto a murine antibody Framework (FR) sequence derived from a single or multiple other murine antibody variable region framework sequences. In the present invention, the CDR regions in the chimeric or murine antibody are derived from rabbit-derived CDR regions.
The terms "monoclonal antibody" or "mab" and the like are used interchangeably and refer to a homogeneous population of antibodies, i.e., the individual antibodies comprising the population are identical except for small amounts of mutations and/or post-translational modifications (e.g., isomerization, amidation) that may occur naturally. "monoclonal antibodies" are highly specific, exhibiting a single binding specificity and affinity for the same or substantially the same epitope on an antigen. The modifier "monoclonal" indicates the antibody is obtained from a substantially homogeneous population of antibodies and is not to be construed as limiting the source or manner of preparation of the antibody. The antibodies can be prepared by a variety of methods including, but not limited to, hybridoma methods, phage display methods, yeast display methods, recombinant DNA methods, single cell screening, or single cell sequencing methods.
The term "specific binding" is a term well known in the art that exhibits "specific binding," "specific binding," or is referred to as "preferential binding" if a molecule reacts more frequently, more rapidly, longer in duration, and/or with greater affinity to a particular antigen or epitope of interest than to other antigens or epitopes of interest, and does not necessarily require (although may include) exclusive binding.
In order that the above-recited objects, features and advantages of the present invention will become more readily apparent, a more particular description of the invention briefly described above will be rendered by reference to specific embodiments thereof which are illustrated in the appended drawings.
The present invention provides an antibody for detecting murine interleukin-2, said antibody being selected from the group consisting of a first antibody or a second antibody, said first antibody and said second antibody each comprising a light chain variable region and a heavy chain variable region, said light chain variable region and said heavy chain variable region each comprising 3 Complementarity Determining Regions (CDRs) designated CDR1, CDR2 and CDR3, respectively; wherein: the amino acid sequences of CDR1, CDR2 and CDR3 on the light chain variable region of the first antibody are respectively shown as SEQ ID NO.3, SEQ ID NO.4 and SEQ ID NO.5, and the amino acid sequences of CDR1, CDR2 and CDR3 on the heavy chain variable region are respectively shown as SEQ ID NO.8, SEQ ID NO.9 and SEQ ID NO. 10; the amino acid sequences of CDR1, CDR2 and CDR3 on the light chain variable region of the second antibody are shown as SEQ ID NO.13, SEQ ID NO.14 and SEQ ID NO.15 respectively, and the amino acid sequences of CDR1, CDR2 and CDR3 on the heavy chain variable region are shown as SEQ ID NO.18, SEQ ID NO.19 and SEQ ID NO.20 respectively.
The antibody containing the CDR sequence provided by the invention has the capability of specifically recognizing and binding the murine interleukin-2, and has the advantages of good binding activity, high affinity to the murine interleukin-2, wherein the affinity constant K D of the first antibody is 7.31 multiplied by 10 - 10 M, the affinity constant K D of the second antibody is 1.48 multiplied by 10 -9 M, high affinity, high sensitivity, high specificity, good accuracy and the like, and the antibody is used for immunodetection of the murine interleukin-2. In addition, the two antibodies provided by the invention can recognize different epitopes on the surface of the murine interleukin-2 protein, can be used for developing a double antibody sandwich method enzyme-linked immunosorbent assay (ELISA) detection system, has good detection specificity and extremely high detection sensitivity, takes a first antibody as a capture antibody and a second antibody as a detection antibody as an example, carries out quantitative detection on the IL-2 with different concentrations, has the detection limit as low as 54.85pg/mL, provides a feasible and reliable method for accurately and efficiently detecting the trace level of the murine IL-2 protein in a sample, and has wide market prospect and good economic and social benefits.
Alternatively, the light chain variable region and the heavy chain variable region each comprise 4 Framework Regions (FR), 4 FR and 3 CDRs sequentially staggered to form the variable region. The amino acid sequence of the light chain variable region (VL) of the first antibody is shown as SEQ ID NO.2, and the amino acid sequence of the heavy chain variable region (VH) is shown as SEQ ID NO. 7. The amino acid sequence of the light chain variable region (VL) of the second antibody is shown as SEQ ID NO.12, and the amino acid sequence of the heavy chain variable region (VH) is shown as SEQ ID NO. 17.
Optionally, the first antibody and the second antibody further comprise a light chain constant region and a heavy chain constant region, wherein CL and VL constitute a light chain and CH and VH constitute a heavy chain in each antibody. The constant regions of antibodies are typically obtained by public interrogation, such as: the rabbit source IGG GAMMA C REIGN was searched for CH and the rabbit source IGG KAPPA C REIGN was searched for CL via IMGT online database (www.imgt.org). Specifically, the amino acid sequence of the light chain (FL chain) of the first antibody is shown as SEQ ID NO.1, and the amino acid sequence of the heavy chain (FH chain) is shown as SEQ ID NO. 6. The amino acid sequence of the light chain (FL chain) of the second antibody is shown as SEQ ID NO.11, and the amino acid sequence of the heavy chain (FH chain) is shown as SEQ ID NO. 16. Wherein the light chain constant region of the first antibody and the second antibody is a kappa chain and the heavy chain constant region is of the IgG1 type.
Optionally, the first antibody and/or the second antibody is a full length antibody or is an antigen binding region of the full length antibody; the antigen binding region is selected from the group consisting of Fab, F (ab) 2、Fab'、F(ab')2、Fv、(Fv)2, scFv, or sc (Fv) 2.
Yet another embodiment of the invention provides a nucleic acid molecule encoding a first antibody and/or a second antibody as described above, a recombinant vector or a host cell comprising said nucleic acid molecule.
The nucleic acid molecule may be in the form of DNA (e.g., cDNA or genomic DNA or synthetic DNA) or RNA (e.g., mRNA or synthetic RNA). The DNA may be single-stranded or double-stranded, or may be a coding strand or a non-coding strand.
The sequence of the nucleic acid molecule is deduced by conventional means such as codon encoding rules according to the amino acid sequence of the antibody. The full-length sequence of the nucleic acid molecule or a fragment thereof can be obtained by PCR amplification, recombinant methods or artificial synthesis. The obtained nucleic acid molecules are inserted into an expression vector, then host cells are transfected, and the transfected host cells are cultured under specific conditions, so that the antibody of the invention can be expressed and obtained.
The original vector from which the recombinant vector is constructed is a variety of vectors conventional in the art, as long as it is capable of harboring the nucleic acid molecule. Typical vectors include plasmids, viral vectors, phages, cosmids and minichromosomes. Plasmids are the most common form of vector, and thus, in the context of the present invention, vectors are used interchangeably with plasmids. The vector may be a cloning vector (i.e., for transferring the nucleic acid molecule into a host and for mass propagation in a host cell) or an expression vector (i.e., comprising the necessary genetic elements to allow expression of the nucleic acid molecule inserted into the vector in a host cell). The nucleic acid molecules of the invention may be inserted into a suitable vector to form a cloning vector or an expression vector carrying the nucleic acid molecule. This is a well known technique and will not be described in detail here.
Nucleic acid molecules encoding the heavy and light chains of the antibodies of the invention may be constructed separately on two vectors, which may be introduced into the same or different host cells. When the heavy and light chains are expressed in different host cells, each chain may be isolated from the host cell in which it is expressed and the isolated heavy and light chains mixed and incubated under appropriate conditions to form the antibody. In other embodiments, the nucleic acid molecules encoding the heavy and light chains of the rabbit antibodies of the invention may also be cloned into a vector, each nucleic acid sequence being linked downstream of a suitable promoter; for example, each nucleic acid sequence encoding a heavy chain and a light chain may be operably linked to a different promoter, or the nucleic acid sequences encoding the heavy chain and the light chain may be operably linked to a single promoter such that both the heavy chain and the light chain are expressed from the same promoter. The choice of expression vector/promoter depends on the type of host cell used to produce the antibody.
Transfection or transformation of the recombinant vector into a host cell according to the present invention is carried out using conventional techniques. When the host is a prokaryote such as E.coli, competent cells capable of absorbing DNA are obtained after the exponential growth phase and treated with CaCl 2 or MgCl 2; or by microinjection, electroporation, or liposome encapsulation. When the host is eukaryotic, the following DNA transfection methods may be used: calcium phosphate coprecipitation, microinjection, electroporation, liposome packaging, and the like.
The host cell may be a prokaryotic or eukaryotic cell. Representative examples are: coli, streptomycete, salmonella typhimurium, yeast, drosophila S2 or Sf9 cells, mammalian CHO, COS7, 293 series cells, and the like. After obtaining the host cell transfected or transformed with the recombinant vector as described above, the antibody can be expressed by culturing under appropriate conditions, and then isolated to obtain the purified antibody.
Preferably, the recombinant vector is a mammalian expression vector pBR322 and the host cell is a human kidney epithelial cell (293F cell).
Another embodiment of the present invention provides an antibody pair for detecting murine interleukin-2, consisting of a first antibody and a second antibody as described above.
The double-antibody sandwich ELISA detection system for developing the mouse IL-2 protein, which is provided by the invention, has the advantages of high specificity, high sensitivity, good reliability and the like, is favorable for realizing high-efficiency and accurate detection of the mouse IL-2 level, has a wide detection linear range and is widely applicable to fields.
In yet another embodiment, the invention provides an antibody or antibody pair for detecting murine interleukin-2 as described above for use in preparing a murine interleukin-2 detection reagent or kit.
The advantages of the antibody or antibody pair for detecting murine interleukin-2 in the preparation of the murine interleukin-2 detection reagent or kit are the same as those of the antibody or antibody pair for detecting murine interleukin-2 described above with respect to the prior art, and are not described in detail herein.
Based on the same inventive concept as described above, embodiments of the present invention also provide a detection reagent or kit for detecting murine interleukin-2, the detection reagent or kit comprising the first antibody and/or the second antibody as described above.
It should be emphasized that the first antibody and the second antibody may be used individually, or may be used together, or may be used in pairs. In the detection, for example, when the first antibody and/or the second antibody are used separately or in combination, the first antibody and/or the second antibody are used as the primary antibody or the capture antibody, and the sample to be detected is contacted with the first antibody and/or the second antibody, followed by detection of the antibody. In some embodiments, the first antibody and/or the second antibody may be conjugated to a detectable label, and qualitative or quantitative detection of IL-2 may be achieved by analyzing the change in the identifiable signal produced by the detectable label. In other embodiments, the primary and/or secondary antibodies to murine IL-2 are not labeled (as primary antibodies or capture antibodies), and the detectable label is conjugated to a secondary antibody that binds to the primary antibody (as a detection antibody) or other molecule, e.g., if the anti-murine IL-2 antibody is a rabbit IgG antibody, the secondary antibody may be an anti-rabbit IgG antibody, thereby producing a change in the recognizable signal by the conjugation of the detectably labeled secondary antibody. When the antibodies are paired, one of the first antibody and the second antibody is used as a primary antibody or a capture antibody, and the other is used as a secondary antibody or a detection antibody.
The detection methods described above employ conventional immunological methods including, but not limited to: enzyme Immunoassay (EIA), enzyme-linked immunosorbent assay (ELISA), enzyme-linked immunospot, immunohistochemical (IHC), immunofluorescence (IF), immunoblotting (WB), flow Cytometry (FC), and the like. The test subjects include recombinantly expressed IL-2, naturally secreted or expressed IL-2 proteins. Detection samples include, but are not limited to, IL-2 protein in serum, plasma, urine, cell culture fluids, and the like.
Preferably, the detection reagent or kit comprises a first antibody as a capture antibody (or primary antibody) and a second antibody as a detection antibody (or secondary antibody), and the second antibody is modified with a detectable label.
Such detectable labels for producing identifiable signal changes include, but are not limited to: biotin, fluorescent dyes (e.g., umbelliferone, fluorescein isothiocyanate, rhodamine, dichlorotriazinylamine fluorescein, dansyl chloride), fluorescent proteins (e.g., isophthalocyanin, phycoerythrin, perCP, and phycocyanin), enzymes (e.g., alkaline phosphatase, acid phosphatase, beta-galactosidase, glucose oxidase, horseradish peroxidase, acetylcholinesterase, avidin), colloidal gold, colored magnetic beads, latex particles, radionuclides, detection antibodies, or combinations thereof.
Preferably, the detectable label is biotin.
The invention will be further illustrated with reference to specific examples. The experimental methods in which specific conditions are not specified in the following examples are generally conducted under conventional conditions, for example, those described in the molecular cloning Experimental guidelines (fourth edition) published in Cold spring harbor laboratory, or are generally conducted under conditions recommended by the manufacturer.
EXAMPLE 1 preparation of Rabbit-derived monoclonal antibodies
The antigen of the invention is a full-length extracellular region of high-quality recombinant MouseIL-2 (from ABclonal, accession number RP 01384) with biological activity, which is expressed by a mammalian expression system, and the protein sequence is shown in NCBI accession number: np_032392.1. The antibody preparation method is a monoclonal antibody development technology based on single B lymphocyte screening and culture, briefly, B lymphocytes are firstly sorted and cultured from rabbit spleen cells of immune antigens, RNA in the antigen-specific B lymphocytes is extracted, the RNA is reversely transcribed into cDNA, natural paired heavy chain variable region (VH) and light chain variable region (VL) genes encoding rabbit-derived antibodies are obtained through PCR amplification, finally the VH and VL genes are respectively loaded on an expression vector, host cells are co-transformed or transfected and cultured, and two high-specificity and high-affinity rabbit-derived antibodies 2A5 and 6A12 which recognize and bind to mouse IL-2 are obtained through separation, purification and screening. The Amino Acid (AA) sequences of antibodies 2A5 and 6A12 are shown in tables 1-2, respectively. For convenience of description, light chain CDR1-3 are denoted by LCDR1, LCDR2 and LCDR3, respectively, and heavy chain CDR1-3 are denoted by HCDR1, HCDR2 and HCDR3, respectively.
TABLE 1 sequence information for Rabbit monoclonal antibody 2A5 of this example
TABLE 2 sequence information for Rabbit monoclonal antibody 6A12 of this example
The preparation method of the rabbit source antibody 2A5 and the rabbit source antibody 6A12 specifically comprises the following steps:
1. Animal immunization: mouseIL-2 were used to immunize 2 New Zealand white rabbits; each white rabbit is immunized by 200 mug, the immunogen is mixed with the equivalent complete Freund adjuvant to prepare an emulsifying agent before the first immunization, and the emulsifying agent is subcutaneously injected into the abdomen and the back of the rabbit at multiple points; 100 mug of immunogen is mixed with the equivalent amount of incomplete Freund's adjuvant every 3 weeks after the primary immunization to prepare an emulsifier, and the emulsifier is subcutaneously injected into the abdomen and the back of a rabbit for two times of boosting; serum samples from rabbits were collected after three immunizations, their titers against IL-2 were determined by ELISA, rabbits with high serum titers were boosted by subcutaneous multipoint injection with 200. Mu.g of immunogen, animals were sacrificed three days later and spleens were taken.
2. B lymphocytes in spleen were isolated and B lymphocyte sorting was performed: b lymphocytes in spleen are separated by adopting a conventional method, antigen-specific B lymphocytes are obtained by separation, and related methods are disclosed in patent ' a method for efficiently separating single antigen-specific B lymphocytes from spleen cells ' (publication No. CN110016462A, publication No. 2019-07-16) ', and patent ' an in vitro B lymphocyte culture system and application (publication No. CN111518765A, publication No. 2020-08-11) '.
3. Cloning of the genes encoding the rabbit monoclonal antibodies: positive clones were identified by antigen coated ELISA of the cultured B lymphocyte supernatants. Positive clone cells were collected and lysed, and RNA was extracted and reverse transcribed into cDNA according to the Quick-RNA TM MicroPrep kit instructions (available from ZYMO, cat. No. R1051). Wherein, reverse transcription system includes: oligo (dT) 12-18primer (Life) 1 μ L, dNTPs (10 mM) 1 μ L, RNA1 μL; after 65℃for 5min in a PCR apparatus, 5X FSBuffer (from ABconal) 4. Mu. L, DTT (100 mM) 1. Mu. L, RNaseOUT (40U/. Mu.L) 1. Mu. L, ABScript II RT (200U/. Mu.L from ABconal) 1. Mu.L was added to the above product, and after mixing, the reaction was carried out at 42℃for 1h,85℃for 5min to obtain cDNA. The cDNA is used as a template, a natural paired rabbit monoclonal antibody light chain variable region (VL) and heavy chain variable region (VH) are amplified from the cDNA of the corresponding positive clone by adopting a PCR method, and sequencing is carried out, and is completed by Jin Kairui biotechnology limited company. The PCR reaction system comprises: 4. Mu.L of cDNA, 1. Mu.L of forward primer (10 mM), 1. Mu.L of reverse primer (10 mM), 12.5. Mu.L of 2X GloriaHiFi (from ABclonal, cat. RK 20717) and 6.5. Mu.LH 2 O; the PCR amplification procedure included: the reaction mixture was subjected to preliminary denaturation at 98℃for 30s, followed by 40 cycles at 98℃for 10s,64℃for 30s, and 72℃for 30s, and finally kept at 72℃for 5min, and the resulting reaction mixture was kept at 4 ℃. Primer sequences (5 '-3') for amplifying VL and VH genes are shown below, and F and R represent forward and reverse primers, respectively:
VL-F: TGAATTCGAGCTCGGTACCCATGGACACGAGGGCCCCCAC (see SEQ ID NO. 21);
VL-R: CACACACACGATGGTGACTGTTCCAGTTGCCACCTGATCAG (see SEQ ID NO. 22);
VH-F: TGAATTCGAGCTCGGTACCCATGGAGACTGGGCTGCGCTG (see SEQ ID NO. 23);
VH-R: GTAGCCTTTGACCAGGCAGCCCAGGGTCACCGTGGAGCTG (see SEQ ID NO. 24).
4. Production and purification of rabbit monoclonal antibodies: for large-scale production of anti-murine IL-2 antibodies, mammalian expression vectors pBR322 (pBR 322 OSLIC Hc) carrying light chain constant region (CL) and heavy chain constant region (CH) genes are treated with XbaI and NheI restriction endonucleases, respectively, and after the VL and VH genes comprising signal peptides amplified by the PCR are purified, homologous recombination is adopted to construct the expression vectors into the expression vectors, so that the light chain gene and heavy chain gene expression vectors are obtained, and the successful construction of the expression vectors is verified by sequencing. The expression patterns of the vectors used are shown in FIG. 1, pBR322 origin and f1 origin are replication promoters, AMPCILLIN is a resistance gene, CMVpromoter is a transcription promoter, SV40 PAterminator is a tailing signal, LIGHT CHAIN constant is the nucleic acid sequence of the light chain constant region (left panel), and HEAVY CHAIN constant is the nucleic acid sequence of the heavy chain constant region (right panel). CL, CH genes CL is obtained by searching IMGT online database (www.imgt.org), searching rabbit source IGG GAMMA C REIGN for CH, searching rabbit source IGG KAPPA C REIGN.
The signal peptide of this example may be expressed by using an antibody commonly used in the art, such as a rabbit monoclonal antibody against Human interferon alpha 2 and its use (publication No. CN116063487A, publication No. 2023-05-05) and a light chain variable region upstream of a signal peptide "MDTRAPTQLLGLLLLWLPGATF" or "MDTRAPTQLLGLLLLWLPGARC" and a heavy chain variable region upstream of a signal peptide "METGLRWLLLVAVLKGVQC" of a high affinity Human IL-5 rabbit monoclonal antibody and its use (publication No. CN115819578A, publication No. 2023-03-21).
The expression vector containing the light chain (FL) gene and the heavy chain (FH) gene, which are verified to be correct by sequencing, is transfected into 293F cells together, and the culture is carried out for 72 to 96 hours after transfection, so that the rabbit-derived monoclonal antibody containing the recombinant recognition mouse IL-2 in the culture supernatant is obtained. The antibody of interest was purified from the culture supernatant using a proteona affinity gel resin (purchased from heaven and earth, cat No. SA 023100). The purity of the antibody 2A5 was more than 95% and the concentration of the antibody 6A12 was 2.44mg/mL, as determined by electrophoresis on a 12% SDS-PAGE gel. The purified antibody is packaged and stored at a low temperature of-20 ℃ for standby.
EXAMPLE 2 Performance test of Rabbit monoclonal antibodies 2A5 and 6A12 to recognize IL-2 antigen
1) The above obtained antibodies 2A5 and 6A12 against murine IL-2 were precisely assayed for affinity for the Mouse IL-2 protein using a Probe Life company Gator biomolecular interaction Analyzer, the concentration of antibody 2A5 was 1. Mu.g/mL and the concentration of antibody 6A12 was 4. Mu.g/mL; antibodies were immobilized on protein A probes, respectively, and then binding was performed with recombinant Mouse IL-2 protein at two concentrations of 75nM and 150nM, respectively, against antibody 2A5 and antibody 6A12, to obtain affinity curves.
FIGS. 2-3 show affinity curves for antibodies 2A5 and 6A12 binding to murine IL-2, respectively, wherein the ordinate indicates the change in conjugate thickness after probe binding to antibody and protein, and the abscissa indicates the binding time, and the dark gray curve is a real-time binding numerical curve and the light gray curve is a fitted average curve. The affinity constants calculated by curve fitting are shown in table 3, wherein dissociation coefficient K off is used for characterizing the constant of the dissociation speed of an antibody and an antigen, binding coefficient K on is used for characterizing the constant of the binding speed of an antibody and a target thereof, and affinity constant K D is the ratio of K off/Kon, representing the equilibrium dissociation constant between an antibody and an antigen thereof. The results indicated that the affinity constants K D of the antibodies 2A5 and 6A12 with the murine IL-2 protein were 7.31X10 -10 M and 1.48X10 -9 M, respectively, demonstrating high affinity and good specificity.
TABLE 3 determination of affinity-related parameters for Rabbit monoclonal antibodies
| Antibodies to |
Koff(1/s) |
Kon(1/Ms) |
KD(M) |
| 2A5 |
1.01×10-3 |
1.38×106 |
7.31×10-10 |
| 6A12 |
6.69×10-4 |
4.52×105 |
1.48×10-9 |
2) Identification of antigen recognition epitopes: the epitope of MouseIL-2 protein was identified using Gator biomolecular interaction analyzer from ProbeLife company, wherein HFC (Anti-HIgGFC, available from Gator, cat. No. 160003) was used as the material, 3. Mu.g/mL was used, and the concentrations of the antibodies 2A5 and 6A12 to be tested were 3. Mu.g/mL.
FIG. 4 shows the case where 2A5 and 6A12 recognize an epitope of murine IL-2, wherein the ordinate indicates the thickness variation of the conjugate after binding of the probe to the antibody and protein, and the abscissa indicates the binding time. From the figure, the probe after being solidified MouseIL-2 can be continuously combined with the antibody 6A12 after being combined with the antibody 2A5, and the fact that 2A5 and 6A12 are combined with different parts of the MouseIL-2 protein surface is confirmed, and the two parts recognize different epitopes and do not interfere with each other. Thus, antibodies 2A5 and 6A12 can be used as paired antibodies for dual antibody sandwich ELISA.
Example 3 establishment of a double antibody sandwich ELISA System based on antibodies 2A5 and 6A12 and sensitivity test thereof
The method comprises the following steps of establishing a double-antibody sandwich method enzyme-linked immunosorbent assay (ELISA) system by taking 2A5 as a capture antibody and 6A12 as a detection antibody: 1) Coating the capture antibody 2A5: diluting antibody 2A5 to 2 mug/mL with 1 XPBS, mixing uniformly by a vortex instrument, adding into a 96-well micro-pore plate at 100 mug/well, covering a cover plate film, and placing in a refrigerator at 4 ℃ for incubation for 16-20h; 2) Washing the plate: after the incubation is completed, the liquid in the holes is discarded, the plate is washed once by 1 XPBST, 350 mu L of sample is added, the liquid in the holes is discarded after standing for 40s, and the liquid in the holes is dried on the flat paper; 3) Closing: adding E013 blocking solution (containing 2% BSA, 5% sucrose, 0.05% Tween and 0.1% proclin300, pH7.2 in 1×PBS) into the plate holes at 200 μl/hole, covering with cover plate film, blocking at 37deg.C for 2 hr, discarding blocking solution after blocking, drying the ELISA plate, oven drying at 37deg.C for 0.5-2 hr, and taking out; 4) Adding antigen protein IL-2: murine IL-2 protein was diluted in gradient with E013 blocking solution, dilution concentration: 4000. 2000, 1000, 500, 250, 125, 62.5 and 0pg/mL, then adding different concentrations into an ELISA plate at 100 mu L/hole in sequence, covering a cover plate film, and incubating for 2 hours at 37 ℃; 5) Washing the plate: after the incubation is completed, the liquid in the holes is discarded, the plate is washed three times by 1 XPBST, 300 mu L of sample is added, the liquid in the holes is discarded after standing for 40s, and the liquid in the holes is dried on the flat paper; 6) Detection antibody 6a12: diluting the biotin-labeled rabbit monoclonal antibody 6A12 (6A 12-biotin) to 0.083 mug/mL, sequentially adding 100 mug/hole into an ELISA plate, covering a cover plate film, and incubating at 37 ℃ for 1h; The 6A12-biotin processing method comprises the following steps: preparing antibody 6A12 into a solution with the concentration of 1mg/mL, and preparing NHS-LC-biotin into a solution with the concentration of 60mg/mL by using DMSO; 200. Mu.L of 1mg/mL antibody 6A12 solution was taken and 10. Mu.L of 60mg/mL NHS-LC-biotin solution was added; after mixing, the mixture was left at room temperature for 30min, and then 50. Mu.g of 500mM Tris solution (pH 9.0) was added to stop the reaction; finally adding a large amount of 1 XPBS buffer solution with pH of 7.4, centrifuging by using a centrifugal column with the exclusion limit of 30KD, and removing redundant biotin molecules and balancing a buffer solution system; 7) Washing the plate: after the incubation is completed, the liquid in the holes is discarded, the plate is washed three times by 1 XPBST, 300 mu L of sample is added, the liquid in the holes is discarded after standing for 40s, and the liquid in the holes is dried on the flat paper; 8) Adding SA-HRP: 100 xSA-HRP (horseradish peroxidase labeled streptavidin, available from Wuhan Sanying biotechnology Co., ltd., product No. SA 00001-0) concentrate is diluted 100 times, and added into an ELISA plate sequentially at 100 μl/hole, covered with a cover plate film, and incubated at 37deg.C for 0.5 hr; 9) Washing the plate: after the incubation is completed, the liquid in the holes is discarded, the plate is washed three times by 1 XPBST, 300 mu L of sample is added, the liquid in the holes is discarded after standing for 40s, and the liquid in the holes is dried on the flat paper; 10 Adding TMB color development liquid: adding 3,3', 5' -tetramethyl benzidine (TMB) color development liquid into an ELISA plate at a concentration of 100 mu L/hole, covering a cover plate film, and incubating at 37 ℃ for 15min;11 Reading: after the incubation was completed, the microplate was removed, 50. Mu.L of stop solution (1 mol/L hydrochloric acid) was added to each well, and immediately reading was performed with an microplate reader. The calibration value Y1 (y1=od 450nm-OD630nm) of absorbance was plotted on the abscissa with murine IL-2 protein concentration as the ordinate, and a standard curve was obtained using Logistic curve four-parameter fitting. The lowest murine IL-2 concentration, with an average absorbance greater than the average absorbance of the triplicate blank control, was the sensitivity of the double antibody sandwich ELISA system. The results are shown in FIG. 5 and Table 4.
TABLE 4 sensitivity test data for the establishment of double antibody sandwich ELISA systems based on antibodies 2A5 and 6A12
The results show that the double-antibody sandwich ELISA detection of the murine IL-2 protein based on the antibodies 2A5 and 6A12 has good linearity in the protein concentration range of 0-2000pg/mL, the sensitivity reaches 54.85pg/mL, and the high-sensitivity and high-reliability detection of trace IL-2 protein in a sample to be detected can be realized.
The foregoing description of the preferred embodiments of the invention is not intended to be limiting, but rather is intended to cover all modifications, equivalents, and alternatives falling within the spirit and principles of the invention.