CN118291518A - OsFE5 gene and application of recombinant vector or protein thereof in plant breeding for regulating starch synthesis - Google Patents

Abstract

The invention discloses OsFE gene and application of recombinant vector or protein thereof in plant breeding for regulating starch synthesis. The invention also discloses a method for cultivating transgenic plants with normal starch synthesis. The protein can influence the synthesis of starch in plant endosperm, and the encoding gene of the protein is introduced into plants with abnormal starch synthesis, so that transgenic plants with normal starch synthesis can be cultivated. The protein and the coding gene thereof can be applied to plant genetic improvement.

Description

OsFE5 gene and application of recombinant vector or protein thereof in plant breeding for regulating starch synthesis

Technical Field

The invention belongs to the application field of the technical field of agricultural science, and particularly relates to OsFE gene and application of a recombinant vector or protein thereof in plant breeding for regulating and controlling starch synthesis.

Background

Rice is one of the important food crops. The main component of rice is starch, which directly determines grain yield and rice quality. Therefore, the research on molecular mechanisms of rice starch synthesis and the excavation of related genes have extremely important significance for guaranteeing national grain safety and improving rice quality.

Research has shown that starch synthesis not only requires the action of enzymes involved in starch synthesis, but also requires a large number of other regulatory factors to function. For example, transcription factors OsNAC20 and OsNAC26 influence starch synthesis by regulating the expression of related genes, cell wall invertase gene GIF1 controls the unloading of sucrose in early stage of starch synthesis, amyloplast development related regulatory factors SSG4, SSG6 and FLO7 participate in starch synthesis by influencing composite starch granule formation, mitochondrial function related regulatory factor OsNDUFA and a plurality of PPR protein genes (OsNPPR 1, FLO10 and FLO 18) regulate rice starch synthesis by maintaining normal energy supply of mitochondria.

Screening rice endosperm starch mutants (waxy, pink, shrunken, dark, etc.) is an important method for mining new starch synthesis key genes. With the rapid development of molecular biology, the functions of a plurality of starch synthesis key genes are analyzed, but a starch synthesis regulation network is still unclear, and more new regulation factors need to be cloned.

Disclosure of Invention

The invention aims to: the technical problem to be solved by the invention is to provide OsFE gene, expression cassette, recombinant vector, recombinant bacterium or application of protein in plant breeding for regulating starch synthesis.

The technical scheme is as follows: in order to solve the technical problems, the invention provides an application of OsFE genes in plant breeding for regulating starch synthesis, and the nucleotide sequence of the OsFE genes is shown as SEQ ID NO.1 or SEQ ID NO. 2. SEQ ID NO.1 of the sequence Listing consists of 6530 nucleotides.

The invention also comprises an application of the recombinant expression vector, the expression cassette, the transgenic cell line or the recombinant bacterium containing OsFE genes in plant breeding for regulating and controlling starch synthesis, wherein the nucleotide sequence of the OsFE genes is shown as SEQ ID NO.1 or SEQ ID NO. 2.

Wherein the recombinant expression vector is a plant expression vector, and preferably, the plant expression vector comprises a binary agrobacterium vector.

The invention also comprises application of OsFE protein in plant breeding for regulating starch synthesis, and the amino acid sequence of OsFE protein is shown as SEQ ID NO. 3. SEQ ID NO.3 of the sequence Listing consists of 620 amino acids.

The invention also discloses a method for cultivating transgenic plants with normal starch synthesis, which comprises the step of introducing OsFE wild type genes into plants with abnormal starch synthesis to obtain transgenic plants with normal starch synthesis, wherein the nucleotide sequence of the OsFE wild type genes is shown as SEQ ID NO.1 or SEQ ID NO. 2.

Wherein the method comprises introducing a recombinant vector containing OsFE wild-type gene into a plant having abnormal starch synthesis.

The recombinant overexpression vector of the invention can be a recombinant plasmid obtained by inserting the gene (OsFE) into a recombination site of a double restriction enzyme cutting vector pCAMBIA1390 by using restriction enzymes KpnI and BamHI. pCAMBIA1390 containing OsFE was designated pCAMBIA 1390-OsFE.

The invention also comprises the application of the transgenic plant tissue or transgenic plant containing OsFE genes or tissue culture or protoplast generated by renewable cells of the transgenic plant in regulating and controlling starch synthesis of plants, wherein the nucleotide sequence of the OsFE genes is shown as SEQ ID NO.1 or SEQ ID NO. 2.

Plants of the invention include, but are not limited to, rice.

The beneficial effects are that: compared with the prior art, the invention has the following advantages: the invention discovers, locates and clones a new gene OsFE of plant starch synthesis related protein for the first time. The plant starch synthesis related protein of the invention affects the starch synthesis process of plants. Inhibition of expression of the protein-encoding gene can lead to a disruption of starch synthesis in plant seeds, thereby allowing for the cultivation of transgenic plants with endosperm variation and transgenic plants with reduced starch content in the plant. The coding gene of the protein is introduced into plants with reduced starch content, so that plants with normal starch content can be cultivated. The protein and the coding gene thereof can be applied to plant genetic improvement.

Drawings

FIG. 1 shows endosperm phenotypes of wild type Nipponbare and mutant fe 5.

FIG. 2 shows the scanning electron microscope observation of wild type Japanese sunny and mutant fe5 endosperm.

FIG. 3 shows the measurement of total starch content in wild type Japanese sunny and mutant fe5 endosperm.

FIG. 4 shows the measurement of total starch content in wild type Japanese sunny and mutant fe5 endosperm.

Fig. 5 is a fine positioning schematic.

FIG. 6 shows the T ₁ seed phenotype of the pCAMBIA1390-OsFE transgenic plants.

Detailed Description

Embodiments of the present invention will be described in detail below with reference to examples, but it will be understood by those skilled in the art that the following examples are only for illustrating the present invention and should not be construed as limiting the scope of the present invention. The specific conditions are not noted in the examples and are carried out according to conventional conditions or conditions recommended by the manufacturer. The reagents or apparatus used were conventional products commercially available without the manufacturer's attention.

Example 1 discovery of Rice starch Synthesis-related sites and genes encoding the same

1. Starch content analysis and genetic analysis of rice starch mutant fe5

From the library of Japanese sun-irradiation mutagenesis mutants, one endosperm-flour mutant was selected and designated fe5. The fe5 endosperm was found to appear pink and opaque compared to the wild type by stereoscopy (fig. 1). Scanning electron microscopy (FIG. 2) revealed that the wild-type endosperm cross-section starch particles were closely aligned and of uniform size, whereas the mutant fe5 endosperm cross-section starch particles were loosely aligned and of non-uniform size. Physicochemical analysis showed that the mutant endosperm had very significantly reduced total starch and amylose content compared to the wild type (figures 3 and 4).

1. Localization of mutant genes

F ₁ is hybridized with indica rice variety 9311 to obtain F ₂ seed. The extreme individuals with opaque phenotype are selected from F ₂ for linkage analysis, and the target genes are determined on the 6 th chromosome long arm of the rice through 10 extreme individuals. Then, the mutant gene was located between the molecular markers P133 and P135 at a physical distance of about 233kb by fine localization using 795 extreme individuals. (FIG. 5).

The method for SSR marker analysis is as follows:

(1) Extracting the total DNA of the selected single plant by using a CTAB method

Cutting small amount of leaf of mutant fe5, indica rice variety 9311, nippon Temminck and F ₂ seeds respectively, placing in 2.0mL centrifuge tube, and adding small steel balls for grinding; adding 300 mu L of CTAB into a centrifuge tube, and treating for 30min in a 65 ℃ oven; adding 300 μl of chloroform into the centrifuge tube, mixing, and centrifuging at 12000x rpn min; sucking 200 μl of supernatant into 1.5mL centrifuge tube, adding 400 μl of alcohol, treating with negative 20deg.C refrigerator for 30min, centrifuging 12000x rpn for 5min, pouring supernatant, and air drying overnight; add 100. Mu.L ddH ₂ O for solubilization.

(2) The DNA extracted as described above was diluted to about 20 ng/. Mu.L and subjected to PCR amplification as a template

PCR reaction System (10. Mu.L): 1. Mu.L of DNA (20 ng/. Mu.L), 1. Mu.L of upstream primer (2 pmol/. Mu.L), 1. Mu.L of downstream primer (2 pmol/. Mu.L), 7.5. Mu.L of PCR mix, and 4.5. Mu.L of ddH ₂ O, 15. Mu.L in total.

PCR reaction procedure: denaturation at 94.0℃for 5min; denaturation at 94.0 ℃ for 30s, annealing at 55 ℃ for 30s, extension at 72 ℃ for 1min, and total circulation for 35 times; extending at 72 ℃ for 7min; preserving at 10 ℃. The PCR reaction was performed in a Bio-Rad T100 PCR instrument.

(3) PCR product detection of SSR markers

The amplified products were analyzed by 8% non-denaturing polyacrylamide gel electrophoresis. The molecular weight of the amplified product was compared with that of a 50bp DNA LADDER control, and silver staining was performed.

The primer development process is as follows:

(1) SSR marker development

The sequence of the localization interval was downloaded at the NCBI website, SSR primers were designed using PRIMER PREMIER 5.0.0 software and synthesized by the south kyo bioengineering company, inc. The SSR pair primers designed by self are mixed in equal proportion, the polymorphism between Japanese sunny and 9311 is detected, and the polymorphism is used as a molecular marker for fine localization. The molecular markers used for fine localization are shown in Table 1.

TABLE 1 molecular markers for Fine localization

2. Acquisition of starch Synthesis-related Gene

Through sequencing within a 233kb interval, the OsFE gene of the mutant fe5 is found to have 5 base deletion mutation, namely 153 th to 157 th base deletion of a coding region of the wild type OsFE gene, the nucleotide sequence of the OsFE mutant gene is shown as SEQ ID NO.10, and the amino acid sequence of the OsFE mutant protein in the wild type OsFE5 protein is shown as SEQ ID NO. 11. Primers were designed based on the sequences published on the network as follows:

primer1：5'GTGATCTGACCGCCGGCGAC 3'(SEQ ID NO.4)；

primer2：5'CAACTCGCTTCGAATATCTG 3'(SEQ ID NO.5)。

PCR amplification was performed using primer1 and primer2 as primers and Japanese developing endosperm cDNA as a template to obtain the target gene. The PCR amplification system is as follows: 3.4. Mu.L of cDNA, 3. Mu.L of upstream primer (2 pmol/. Mu.L), 3. Mu.L of downstream primer (2 pmol/. Mu.L), 5. Mu.L of dNTP, 15. Mu.L of KOD buffer and 0.6. Mu.L of KOD enzyme (1.0U/. Mu.L). Amplification reactions were performed on a Bio-Rad T100 PCR instrument: 94 ℃ for 3min;94℃30sec,60℃1.5min,72℃10min,33 cycles; and at 72℃for 5min. The PCR product was recovered and purified, and then was connected to pEASY-Blunt (full gold biosciences Co., ltd.) to transform E.coli Trans10 competent cells (full gold biosciences Co., ltd.), and positive clones were selected and sequenced.

The sequence determination result shows that the fragment obtained by PCR reaction has the nucleotide sequence shown as SEQ ID NO.2, and encodes a protein consisting of 230 amino acid residues (see SEQ ID NO.3 of the sequence table). The protein shown in SEQ ID NO.3 is named FE5, and the encoding gene of the protein shown in SEQ ID NO.3 is named OsFE.

Example 2 acquisition and identification of transgenic plants

1. Recombinant expression vector construction

The cDNA of endosperm in Japanese sunny development is used as a template, the OsFE gene is obtained by PCR amplification, and the PCR primer sequence is as follows:

primer3：

5'TTACTTCTGCACTAGGTACCATGTCGTACGATCGCGTCAC 3'(SEQ ID NO.6)；

primer4：

5'GAATTCCCGGGGATCCTCACCTAGCTTCATCTTCTA 3'(SEQ ID NO.7)。

The primers are positioned at the 5 'and 3' ends of the gene shown in SEQ ID NO.2, and the PCR product is recovered and purified. The PCR product was cloned into vector pCAMBIA1390 (FIG. 5) using ClonExpress IIOne Step Cloning Kit recombinant kit (Northenan Biotechnology Co., ltd.). Recombination reaction system (10 μl): 2.0. Mu.L of PCR product, 6.0. Mu.L of pCAMBIA1390, 1.0. Mu.L of 5 XCE II buffer, exnase II. Mu.L. After brief centrifugation, the mixture was subjected to a 37℃water bath for 15 minutes. Sequencing results show that the recombinant expression vector containing the gene shown in SEQ ID NO.1 is obtained, and pCAMBIA1390 containing OsFE is named pCAMBIA 1390-OsFE.

2. Acquisition of recombinant Agrobacterium

The recombinant strain is obtained by transforming the Agrobacterium EHA105 strain with pCAMBIA1390-OsFE by freeze thawing transformation. The method specifically comprises the following steps: adding 1-2 mu L of the transformed plasmid into agrobacterium EHA105, and quick-freezing in liquid nitrogen for 5min; then placing in a water bath kettle at 37 ℃ for heat shock for 5min; adding 1mL of LB culture solution, and placing in a shaking table at 28 ℃ for 3-4h; coating the bacterial liquid on an LB culture medium, and placing the LB plate in a 28 ℃ incubator for culturing for 2-3 days.

3. Acquisition of transgenic plants

The pCAMBIA1390-OsFE strain is transformed into rice starch synthesis abnormal mutant fe5, and the specific method is as follows:

(1) Culturing pCAMBIA1390-OsFE strain at 28deg.C for 16 hr, collecting thallus, and diluting to concentration of OD600 ≡0.5 in N6 liquid culture medium (Sigma Co., C1416) to obtain bacterial liquid;

(2) Mixing and infecting the fe5 rice mature embryo embryogenic callus cultured for one month with the bacterial liquid in the step (1) for 30min, sucking the bacterial liquid by filter paper, transferring into a co-culture medium (N6 solid co-culture medium, sigma company), and co-culturing for 3 days at 24 ℃;

(3) Inoculating the callus of the step (2) on N6 solid screening medium containing 100mg/L hygromycin for the first time (16 days);

(4) Selecting healthy calli, transferring the healthy calli into an N6 solid screening culture medium containing 100mg/L hygromycin for second screening, and carrying out secondary transfer every 15 days;

(5) Selecting healthy calli, transferring the healthy calli into an N6 solid screening culture medium containing 50mg/L hygromycin for third screening, and carrying out secondary once every 15 days;

(6) Selecting the resistant callus, transferring the resistant callus into a differentiation medium for differentiation; and obtaining T ₀ -generation positive plants differentiated into seedlings.

4. Identification of transgenic plants

1. PCR molecular characterization

In the invention, hygromycin marks are used for identifying transgenic plants. Extracting genome DNA from the T ₀ generation plant obtained in the step three, and amplifying by using the genome DNA as a template and using a Primer5 and a Primer6 as primers.

PCR reaction system for label analysis: genomic DNA (20 ng/. Mu.L) of T ₀ -generation transgenic plants 2. Mu.L, primer5 (10 pmoL/. Mu.L) 2. Mu.L, primer6 (10 pmol/. Mu.L) 2. Mu.L, PCR mix 7.5. Mu.L, ddH ₂ O1.5. Mu.L, and total volume 15. Mu.L.

Amplification reactions were performed on a Bio-Rad T100 PCR instrument: 94 ℃ for 3min;94℃30sec,55℃1min,72℃2.5min,33 cycles; and at 72℃for 5min.

Primer5：5'ACGCACAATCCCACTATCCT 3'(SEQ ID NO.8)；

Primer6：5'ACAGCCATCGGTCCAGAC 3'(SEQ ID NO.9)；

And (3) performing gel running analysis on the PCR product by agarose gel electrophoresis to determine the transgenic positive plants.

2. Phenotypic identification

T ₀ generation is transformed into pCAMBIA1390-OsFE5 positive plants, mutant fe5 and Nipponbare are planted on a rice breeding base respectively. After seed harvest, the seed of the pCAMBIA1390-OsFE plants was found to resume the transparent phenotype (fig. 6, where L1, L2, L3 are three different transgenic lines). Thus demonstrating that the mutant phenotype in fe5 is caused by the mutation in OsFE. pCAMBIA1390-OsFE can restore starch synthesis of the fe5 strain to normal levels.

Claims (10)

1. The application of the OsFE5 gene in plant breeding for regulating starch synthesis is characterized in that the nucleotide sequence of the OsFE gene is shown as SEQ ID NO.1 or SEQ ID NO. 2.
2. 2. The application of the recombinant expression vector, the expression cassette, the transgenic cell line or the recombinant bacterium containing OsFE genes in plant breeding for regulating and controlling starch synthesis is characterized in that the nucleotide sequence of the OsFE genes is shown as SEQ ID NO.1 or SEQ ID NO. 2.
3. 3. Use according to claim 2, wherein the recombinant expression vector is a plant expression vector, preferably comprising a binary agrobacterium vector.
4. The application of the OsFE5 protein in plant breeding for regulating starch synthesis is characterized in that the amino acid sequence of the OsFE protein is shown as SEQ ID NO. 3.
5. 5. A method for cultivating a transgenic plant with normal starch synthesis, which is characterized in that the method comprises introducing OsFE wild type gene into a plant with abnormal starch synthesis to obtain a transgenic plant with normal starch synthesis, wherein the nucleotide sequence of OsFE wild type gene is shown as SEQ ID NO.1 or SEQ ID NO. 2.
6. 6. The method for growing a transgenic plant with normal starch synthesis according to claim 5, comprising introducing a recombinant vector containing OsFE wild type gene into a plant with abnormal starch synthesis.
7. 7. The method for growing transgenic plants with normal starch synthesis according to claim 6, wherein the recombinant vector is pCAMBIA 1390-OsFE.
8. 8. Use of a transgenic plant tissue or transgenic plant containing OsFE gene or a tissue culture or protoplast produced by regenerable cells of said transgenic plant for regulating starch synthesis in a plant, wherein the nucleotide sequence of said OsFE gene is shown in SEQ ID No.1 or SEQ ID No. 2.
9. 9. The use according to claim 1-4, claim 8, wherein the plant comprises rice.
10. 10. The method of any one of claims 5-7, wherein the plant comprises rice.