CN118027160A - Preparation method of recombinant Aeromonas hydrophila Hcp protein - Google Patents

Abstract

The invention provides a preparation method of recombinant aeromonas hydrophila Hcp protein, which belongs to the technical field of biology, and comprises the following steps: step 1: designing and synthesizing a primer; step 2: amplifying the Hcp gene; step 3: construction of prokaryotic expression plasmid pET-32 a-Hcp; step 4: performing induction expression and expression condition optimization of recombinant Hcp protein; step 5: identification and purification of the expression form of the recombinant Hcp protein. The Hcp protein belongs to hydrophilic protein, the hydrophobicity of amino acid 117 is strongest, the value is 1.433, and the hydrophilicity of amino acid 55 is strongest, the value is-1.911. The protein fat coefficient was 73.66, the instability coefficient was 32.03, and the protein was stable. The Hcp protein was analyzed for hydrophilicity and hydrophobicity using ProtScale, with amino acid scores less than 0 indicating hydrophilicity and scores greater than 0 indicating hydrophobicity. Analysis shows that most amino acids of the Hcp protein are located in the hydrophilic region, are hydrophilic proteins, and are consistent with the physicochemical analysis result of the proteins.

Description

Preparation method of recombinant aeromonas hydrophila Hcp protein

Technical Field

The invention relates to the technical field of biology, in particular to a preparation method of recombinant aeromonas hydrophila Hcp protein.

Background

Aeromonas hydrophila (Aeromonas hydrophila, AH) is gram-negative bacteria belonging to the genus Aeromonas of the family Vibrionaceae, is a conditional pathogenic bacteria commonly existing in various water bodies, soil and environments, is one of normal flora species in a culture water environment, can cause various diseases of fishes, animals and people, and can induce fish infection septicemia. Bringing great economic loss to the aquaculture industry at home and abroad. At present, the AH infection is mainly inhibited by antibiotics in the aquaculture industry, and the abuse of antibiotics not only can cause AH to generate drug resistance, but also can influence the ecological environment and the food safety quality, thereby causing food quality safety problems and ecological safety problems. Aquatic organisms in aquaculture are susceptible to attack by AH and disease. The individual shrimps are smaller, the treatment is not practical one by one, and the shrimp groups are difficult to treat in the water body. Therefore, it is important to control the continuous outbreak of this bacterium in the population and aquaculture.

The pathogenic mechanisms of AH are complex, and disease in the host is usually dependent on interactions between the secretory system and virulence factors. The type IV secretion system (Type VI secretion system, T6 SS) is one of the secretion systems of AH, consisting of 13 proteins, responsible for the transport of part of effector proteins outside the cell. The hemolysin co-regulated protein (Hcp) is one of the protein components of T6SS, and Hcp protein can form a tube-like hexamer to assist T6SS in secreting virulence related proteins. Hcp proteins play an important role in the T6SS system, both as structural proteins that help form the injection device secretion proteins and as effector proteins that can be secreted extracellularly to enhance virulence. The existing haemolysin cotodulatory protein is difficult to obtain, so that a preparation method of recombinant aeromonas hydrophila Hcp protein needs to be designed.

Disclosure of Invention

The invention aims to provide a preparation method of recombinant aeromonas hydrophila Hcp protein, which solves the technical problem that the existing aeromonas hydrophila Hcp protein is difficult to obtain.

In order to achieve the above purpose, the technical scheme adopted by the invention is as follows:

a method for preparing recombinant aeromonas hydrophila Hcp protein, said method comprising the steps of:

step 1: designing and synthesizing a primer;

step 2: amplifying the Hcp gene;

Step 3: construction of prokaryotic expression plasmid pET-32 a-Hcp;

Step 4: optimizing the induction expression and expression conditions of the recombinant Hcp protein;

step 5: identification and purification of the expression form of the recombinant Hcp protein.

Further, the specific process of the step 1 is as follows:

designing an Hcp gene specific primer according to the sequence of the Hcp gene, wherein restriction enzyme cutting sites are EcoR I and Xho I respectively;

Hcp-F：5'--3'：CCGGAATTCATGCCAACTCCATGTTATAT；

Hcp-R：5'--3'：CGGCTCGAGTTACGCCTCGATCGGAGCAC。

further, the specific process of the step 2 is as follows:

PCR amplification is carried out by taking DNA of AH-SC-3 as a template and Hcp-F/R as a primer pair, and the PCR product is subjected to gel recovery according to the operation instruction of a gel recovery kit.

Further, the specific process of the step 3 is as follows:

And (3) carrying out double enzyme digestion on a glue recovery product of the target gene Hcp and a pET-32a (+) vector, then carrying out glue recovery again, connecting the two fragments according to a T4 ligase specification, converting the connecting product into DH5 alpha competent cells according to a DH5 alpha competent cell using specification, extracting plasmids according to a plasmid extraction kit operating specification after single colony propagation in the next day, carrying out enzyme digestion identification and sequencing on the obtained plasmids, and naming the plasmids as pET-32a-Hcp.

Further, the specific process of step4 is as follows:

pET-32a-Hcp is transformed into BL21 competent cells according to the specification, the BL21 competent cells are coated on an ampicillin-resistant LA plate, the LA plate is cultured for 12 hours in a constant temperature incubator at 37 ℃, single colony is selected for culturing at 37 ℃ and at 150rpm, part of bacterial liquid is taken for PCR identification, positive clones which are identified correctly are subjected to enrichment culture, optimal induction conditions are determined by adding different doses of IPTG and changing induction time after the logarithmic growth phase is reached, supernatant is discarded after 8-000 rpm 3min of bacterial liquid is collected, 40 mu L of PBS is added for resuspension precipitation and mixing with 10 mu L of 5X Loading Buffer, and SDS-PAGE electrophoresis is carried out after 10min of boiling water bath.

Further, the specific process of step 5 is as follows:

performing ultrasonic lysis on the expressed bacterial liquid, separating supernatant and precipitate at 4 000rpm for 10min, dissolving the precipitate in Inclusion Body Elutio Buffer, mixing 40 mu L of supernatant and precipitate solution with 10 mu L of 5× Loading Buffer, performing SDS-PAGE electrophoresis after 10min in boiling water, determining expression form, inducing, and purifying protein according to the method in the purification kit.

Due to the adoption of the technical scheme, the invention has the following beneficial effects:

The Hcp protein belongs to hydrophilic protein, the hydrophobicity of amino acid No. 117 is strongest, the value is 1.433, and the hydrophilicity of amino acid No. 55 is strongest, the value is-1.911. The protein fat coefficient was 73.66, the instability coefficient was 32.03, and the protein was stable. The Hcp protein was analyzed for hydrophilicity and hydrophobicity using ProtScale, with amino acid scores less than 0 indicating hydrophilicity and scores greater than 0 indicating hydrophobicity. Analysis shows that most amino acids of the Hcp protein are located in hydrophilic areas, are hydrophilic proteins, and are consistent with the physicochemical analysis result of the proteins, and the proteins mainly comprise random curls, extension chains, alpha-helices and beta-corners. Hcp acts as an export carrier and chaperone for effector proteins and may be attached by covalent extension of these components or by non-covalent interactions. Therefore, the Hcp protein can also be used as a marker for normal production of T6SS function

Drawings

FIG. 1 is a diagram showing the results of double digestion of the recombinant plasmid pET-32a-Hcp of the invention;

FIG. 2 is an optimized view of the conditions for inducible expression of the pET-32a-Hcp recombinant protein of the invention;

FIG. 3 is a graph showing the results of expression and purification of the pET-32a-Hcp recombinant protein of the invention;

FIG. 4 is a graph of the hydrophilic-hydrophobic analysis of the Hcp protein of the invention;

FIG. 5 is a graph showing the prediction of the Hcp protein signal peptide of the invention;

FIG. 6 is a predicted view of the Hcp protein transmembrane domain of the invention;

FIG. 7 is a map of the phosphorylation site prediction of the Hcp protein of the invention;

FIG. 8 is a diagram of the Hcp protein conserved domain of the invention;

FIG. 9 is a predicted graph of the secondary structure of the Hcp protein of the invention;

FIG. 10 is a predicted map of the tertiary structure of the Hcp protein of the invention.

Detailed Description

In order to make the objects, technical solutions and advantages of the present invention more apparent, the present invention will be further described in detail below by referring to the accompanying drawings and by illustrating preferred embodiments. It should be noted, however, that many of the details set forth in the description are merely provided to provide a thorough understanding of one or more aspects of the invention, and that these aspects of the invention may be practiced without these specific details.

A method for preparing recombinant aeromonas hydrophila Hcp protein, said method comprising the steps of:

1 materials and methods

Step 1: strain and vector

The AH-SC-3 strain was isolated, identified and deposited by the China center for type culture Collection (M2023860); pET-32a (+) vector was purchased from Biotechnology (Shanghai) Inc., DH 5. Alpha. BL21 (DE 3) competent cells were purchased from Shanghai high-feather Biotechnology Inc.

Step 2: main reagent and instrument

Restriction enzymes EcoR I and Xho I, T4 DNA LIGASE were purchased from Bao Ri doctor materials technology (Beijing) Co., ltd; plasmid miniprep kit was purchased from OMEGA company; his tag protein purification kit, goat anti-rabbit IgG (H+L) HRP antibody was purchased from Kangshen Biotechnology Co., ltd; pre-stained protein markers were purchased from GenStar.

Step 3: primer design and Synthesis

The Hcp gene specific primer is designed according to the sequence of the Hcp gene, and restriction enzyme cutting sites are EcoR I and Xho I respectively. Hcp-F:5'- -3': CCGGAATTCATGCCAACTCCATGTTATAT; hcp-R:5'- -3': CGGCTCGAGTTACGCCTCGATCGGAGCAC A

Step 4: amplification of Hcp Gene

PCR amplification is carried out by taking DNA of AH-SC-3 as a template and Hcp-F/R as a primer pair, and the PCR product is subjected to gel recovery according to the operation instruction of a gel recovery kit.

Step 5: construction of prokaryotic expression plasmid pET-32a-Hcp

And (3) carrying out double enzyme digestion on a glue recovery product of the target gene Hcp and the pET-32a (+) vector, then carrying out glue recovery again, connecting the two fragments according to a T4 ligase specification, and converting the connection product into DH5 alpha competent cells according to a DH5 alpha competent cell using specification. The plasmid was extracted according to the instructions of the plasmid extraction kit after single colony propagation on the next day. The obtained plasmid was subjected to enzyme digestion, identified and sequenced, and designated pET-32a-Hcp.

Step 6: inducible expression of recombinant Hcp protein and optimization of expression conditions

PET-32a-Hcp was transformed into BL21 competent cells according to the instructions and plated on ampicillin-resistant LA plates and incubated in a incubator at 37℃for 12h. Single colony culture is selected and cultured for 6 hours at 37 ℃ and at 150rpm, partial bacterial liquid is taken for PCR identification, and positive clones with correct identification are subjected to enrichment culture. Optimal induction conditions were determined by adding different doses of IPTG after the logarithmic growth phase was reached and varying the induction time. The supernatant was collected at 8,000 rpm for 3min, the pellet was resuspended in 40. Mu.L of PBS and mixed with 10. Mu.L of 5X Loading Buffer, and after 10min in boiling water, SDS-PAGE was performed.

Step 7: identification and purification of recombinant Hcp protein expression forms

Performing ultrasonic lysis on the expressed bacterial liquid, separating supernatant and precipitate from the lysate at 4 000rpm for 10min, and dissolving the precipitate in Inclusion Body Elutio Buffer. 40. Mu.L of the supernatant and the pellet solution were mixed with 10. Mu.L of 5X Loading Buffer, and subjected to SDS-PAGE after 10min in boiling water. A number of inductions were performed after the expression pattern was determined. The protein was purified according to the method in the purification kit.

Amplification of the Hcp gene and construction of a prokaryotic expression vector, and gel electrophoresis results show that the amplification result is obtained to obtain a 519bp target fragment (see figure 1A). The result of gel electrophoresis showed that the pET-32a-Hcp double cleavage gave a fragment of about 519bp in size and a fragment of 5.9kbp, which was consistent with the expectations (see FIG. 1B). The homology of the sequencing result with the reference sequence is 100%. See fig. 1A: hcp gene amplification results. M: DNA molecular weight standard (DL 2 000); 1: hcp gene PCR amplification products; see fig. 1B; double enzyme digestion identification of pET-32a-Hcp recombinant plasmid; m: DNA molecular weight standard (DL 10 000); 1: the pET-32a-Hcp recombinant plasmid enzyme cutting product.

The conditions for Hcp expression of the recombinant protein were optimized, and the result showed that the expressed target protein was about 37ku, which is consistent with the expected size (see fig. 2A, B). The protein expression level was increased when the induction final concentration was increased (see FIG. 2A), whereas the protein expression level was not significantly increased when the induction time was increased (see FIG. 2B). Fig. 2A: fumbling results for optimal IPTG induction concentration of pET-32a-Hcp protein: protein molecular mass standard.1: pET-32a (+) empty vector; 2: pET-32a-Hcp was not induced; 3-7: the final concentration of IPTG was 0.2mmol/L, 0.4mmol/L, 0.6mmol/L, 0.8mmol/L and 1.0mmol/L, respectively, of the induced recombinant AH Hcp protein. Fig. 2B: fumbling results for the optimal induction time of pET-32a-Hcp protein: protein molecular mass standard.1: pET-32a (+) empty vector; 2: pET-32a-Hcp was not induced; 3-7: the induction time is respectively 2h, 4h, 6h, 8h and 10h of induced recombinant AH Hcp protein.

Identification and purification of the expression form of the recombinant protein Hcp, and SDS gel electrophoresis results show that the recombinant protein Hcp exists in the supernatant and the sediment (see figure 3), and the expression amount in the supernatant is higher as shown in the figure. The size of the purified protein was consistent with the expected. In fig. 3, M: protein molecular mass standard; 1: pET-32a (+) empty vector; 2: pET-32a-Hcp induction; 3: pET-32a-Hcp was not induced; 4: inducing the supernatant after crushing by pET-32 a-Hcp; 5: pET-32a-Hcp is induced to be crushed and then deposited; 6: purifying the expression of pET-32 a-Hcp.

The Hcp protein has basic physicochemical properties, the Hcp protein consists of 172 amino acids, and the most amino acids are valine (Val) and threonine (Thr), which account for 8.7 percent. The molecular formula of the protein is C ₈₄₆H₁₃₀₄N₂₂₄O₂₅₉S₈, the relative molecular mass is 19013.49, and the theoretical isoelectric point is 5.24. The total number of positive charge residues carried by the protein is 138, and the total number of negative charge residues is 20. The total average hydrophilicity (GRAVY) of the protein is-0.273, which belongs to hydrophilic protein, the hydrophobicity of amino acid No. 117 is strongest, the value is 1.433, and the hydrophilicity of amino acid No. 55 is strongest, the value is-1.911. The protein fat coefficient was 73.66, the instability coefficient was 32.03, and the protein was stable. The Hcp protein was analyzed for hydrophilicity and hydrophobicity using ProtScale, with amino acid scores less than 0 indicating hydrophilicity and scores greater than 0 indicating hydrophobicity. Analysis showed that most of the amino acids of Hcp protein were located in the hydrophilic region, which was hydrophilic protein, consistent with the results of physicochemical analysis of the protein, as shown in fig. 4.

Signal peptide and transmembrane domain predictions of Hcp protein, signalP5.0 analysis (FIGS. 5-6) showed that Hcp protein has no signal cleavage site, and that Hcp protein is presumed to contain no signal peptide, belonging to a non-secreted protein. The TMHMM2.0 prediction (FIG. 8) shows that the probability of the protein in the transmembrane region (transmembrane) and the intramembrane region (inside) is very low, and the probability in the extracellular region (outside) is close to 1, indicating that the Hcp protein has no transmembrane domain and is located entirely in the extracellular region.

Phosphorylation site and conserved domain of Hcp protein the phosphorylation site of Hcp protein was predicted using netphos3.1, and when the threshold was 0.5, the protein was predicted to have a total of 30 phosphorylation sites (fig. 7), including 11 serine (Serine), 15 threonine (Threonine) and 4 Tyrosine (Tyrosine). The Hcp protein was predicted to contain a conserved domain (fig. 8), belonging to the Hcp1 family of T6SS secretion systems, the outer membrane channel protein family, using NCBI's CD-search tool. As shown in fig. 9, the third red on the left is serine phosphorylation site; the first red on the left is threonine phosphorylation site; the second blue on the left is the tyrosine phosphorylation site; the purple line is a broad value.

The secondary and tertiary structures of Hcp proteins were predicted using SPOMA software and consisted of mainly Random coil (Random coil), extended strand (Extended strand), 25.00%, alpha-helix (Alpha helix), 19.19%, beta-turn (Beta turn), 4.07% (fig. 9). By using the three-level structure MODEL (fig. 10) of SWISS-MODEL prediction, the global MODEL quality estimation (global MODEL quality estimation, GMQE) value obtained by prediction is 0.95, and the gmqe value can simply evaluate the quality of the prediction MODEL, and the closer the value is to 1, the better the modeling quality is, and the reliable the prediction result is.

The foregoing is merely a preferred embodiment of the present invention and it should be noted that modifications and adaptations to those skilled in the art may be made without departing from the principles of the present invention, which are intended to be comprehended within the scope of the present invention.

Claims (6)

1. The preparation method of the recombinant aeromonas hydrophila Hcp protein is characterized by comprising the following steps: the method comprises the following steps:

step 1: designing and synthesizing a primer;

step 2: amplifying the Hcp gene;

Step 3: construction of prokaryotic expression plasmid pET-32 a-Hcp;

step 4: performing induction expression and expression condition optimization of recombinant Hcp protein;

step 5: identification and purification of the expression form of the recombinant Hcp protein.

2. The method for producing a recombinant aeromonas hydrophila Hcp protein according to claim 1, wherein: the specific process of the step 1 is as follows:

designing an Hcp gene specific primer according to the sequence of the Hcp gene, wherein restriction enzyme cutting sites are EcoR I and Xho I respectively;

Hcp-F：5'--3'：CCGGAATTCATGCCAACTCCATGTTATAT；

Hcp-R：5'--3'：CGGCTCGAGTTACGCCTCGATCGGAGCAC。

3. the method for producing a recombinant aeromonas hydrophila Hcp protein according to claim 1, wherein: the specific process of the step 2 is as follows:

PCR amplification is carried out by taking DNA of AH-SC-3 as a template and Hcp-F/R as a primer pair, and the PCR product is subjected to gel recovery according to the operation instruction of a gel recovery kit.

4. The method for producing a recombinant aeromonas hydrophila Hcp protein according to claim 1, wherein: the specific process of the step 3 is as follows:

And (3) carrying out double enzyme digestion on a glue recovery product of the target gene Hcp and a pET-32a (+) vector, then carrying out glue recovery again, connecting the two fragments according to a T4 ligase specification, converting the connecting product into DH5 alpha competent cells according to a DH5 alpha competent cell using specification, extracting plasmids according to a plasmid extraction kit operating specification after single colony propagation in the next day, carrying out enzyme digestion identification and sequencing on the obtained plasmids, and naming the plasmids as pET-32a-Hcp.

5. The method for producing a recombinant aeromonas hydrophila Hcp protein according to claim 1, wherein: the specific process of the step 4 is as follows:

pET-32a-Hcp is transformed into BL21 competent cells according to the specification, the BL21 competent cells are coated on an ampicillin-resistant LA plate, the LA plate is cultured for 12 hours in a constant temperature incubator at 37 ℃, single colony is selected for culturing at 37 ℃ and at 150rpm, part of bacterial liquid is taken for PCR identification, positive clones which are identified correctly are subjected to enrichment culture, optimal induction conditions are determined by adding different doses of IPTG and changing induction time after the logarithmic growth phase is reached, supernatant is discarded after 8-000 rpm 3min of bacterial liquid is collected, 40 mu L of PBS is added for resuspension precipitation and mixing with 10 mu L of 5X Loading Buffer, and SDS-PAGE electrophoresis is carried out after 10min of boiling water bath.

6. The method for producing a recombinant aeromonas hydrophila Hcp protein according to claim 1, wherein: the specific process of the step 5 is as follows:

performing ultrasonic lysis on the expressed bacterial liquid, separating supernatant and precipitate at 4 000rpm for 10min, dissolving the precipitate in Inclusion Body Elutio Buffer, mixing 40 mu L of supernatant and precipitate solution with 10 mu L of 5× Loading Buffer, performing SDS-PAGE electrophoresis after 10min in boiling water, determining expression form, inducing, and purifying protein according to the method in the purification kit.