CN117778626A - Triple real-time fluorescent RT-PCR detection method and kit for porcine reproductive and respiratory syndrome virus - Google Patents
Triple real-time fluorescent RT-PCR detection method and kit for porcine reproductive and respiratory syndrome virus Download PDFInfo
- Publication number
- CN117778626A CN117778626A CN202311820063.7A CN202311820063A CN117778626A CN 117778626 A CN117778626 A CN 117778626A CN 202311820063 A CN202311820063 A CN 202311820063A CN 117778626 A CN117778626 A CN 117778626A
- Authority
- CN
- China
- Prior art keywords
- prrsv
- probe
- primer
- time fluorescent
- nadc34
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
- 241001135989 Porcine reproductive and respiratory syndrome virus Species 0.000 title claims abstract description 102
- 238000001514 detection method Methods 0.000 title claims abstract description 38
- 238000003757 reverse transcription PCR Methods 0.000 title claims abstract description 32
- 239000000523 sample Substances 0.000 claims abstract description 88
- 238000000034 method Methods 0.000 claims abstract description 23
- 230000001717 pathogenic effect Effects 0.000 claims abstract description 9
- 230000003321 amplification Effects 0.000 claims description 16
- 238000003199 nucleic acid amplification method Methods 0.000 claims description 16
- 238000006243 chemical reaction Methods 0.000 claims description 14
- 125000006853 reporter group Chemical group 0.000 claims description 8
- 238000000137 annealing Methods 0.000 claims description 4
- 108090000790 Enzymes Proteins 0.000 claims description 3
- 102000004190 Enzymes Human genes 0.000 claims description 3
- 238000004925 denaturation Methods 0.000 claims description 3
- 230000036425 denaturation Effects 0.000 claims description 3
- 238000010791 quenching Methods 0.000 claims description 3
- 230000000171 quenching effect Effects 0.000 claims description 3
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Substances O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 claims description 3
- 238000012257 pre-denaturation Methods 0.000 claims description 2
- 230000035945 sensitivity Effects 0.000 abstract description 9
- 241000710777 Classical swine fever virus Species 0.000 abstract description 7
- 241001135549 Porcine epidemic diarrhea virus Species 0.000 abstract description 7
- 241000702670 Rotavirus Species 0.000 abstract description 7
- 241000701093 Suid alphaherpesvirus 1 Species 0.000 abstract description 7
- 241000711484 Transmissible gastroenteritis virus Species 0.000 abstract description 7
- 238000013461 design Methods 0.000 abstract description 5
- 241001673669 Porcine circovirus 2 Species 0.000 abstract description 4
- 241000700605 Viruses Species 0.000 abstract description 4
- 238000005457 optimization Methods 0.000 abstract description 4
- 108090000623 proteins and genes Proteins 0.000 description 9
- 238000003753 real-time PCR Methods 0.000 description 9
- 108020004707 nucleic acids Proteins 0.000 description 6
- 150000007523 nucleic acids Chemical class 0.000 description 6
- 102000039446 nucleic acids Human genes 0.000 description 6
- 239000012634 fragment Substances 0.000 description 5
- 230000007918 pathogenicity Effects 0.000 description 5
- 239000013612 plasmid Substances 0.000 description 5
- 238000012163 sequencing technique Methods 0.000 description 5
- 238000012360 testing method Methods 0.000 description 5
- 238000002474 experimental method Methods 0.000 description 4
- 239000000203 mixture Substances 0.000 description 4
- 208000005342 Porcine Reproductive and Respiratory Syndrome Diseases 0.000 description 3
- 241000282898 Sus scrofa Species 0.000 description 3
- 208000037265 diseases, disorders, signs and symptoms Diseases 0.000 description 3
- 239000013641 positive control Substances 0.000 description 3
- 230000002265 prevention Effects 0.000 description 3
- 208000035473 Communicable disease Diseases 0.000 description 2
- 101710144128 Non-structural protein 2 Proteins 0.000 description 2
- 238000011161 development Methods 0.000 description 2
- 201000010099 disease Diseases 0.000 description 2
- 208000015181 infectious disease Diseases 0.000 description 2
- 238000012986 modification Methods 0.000 description 2
- 230000004048 modification Effects 0.000 description 2
- 230000035772 mutation Effects 0.000 description 2
- 239000013642 negative control Substances 0.000 description 2
- 238000005215 recombination Methods 0.000 description 2
- 230000006798 recombination Effects 0.000 description 2
- 101000621943 Acholeplasma phage L2 Probable integrase/recombinase Proteins 0.000 description 1
- 101000618348 Allochromatium vinosum (strain ATCC 17899 / DSM 180 / NBRC 103801 / NCIMB 10441 / D) Uncharacterized protein Alvin_0065 Proteins 0.000 description 1
- 101000781117 Autographa californica nuclear polyhedrosis virus Uncharacterized 12.4 kDa protein in CTL-LEF2 intergenic region Proteins 0.000 description 1
- 101000708323 Azospirillum brasilense Uncharacterized 28.8 kDa protein in nifR3-like 5'region Proteins 0.000 description 1
- 101000770311 Azotobacter chroococcum mcd 1 Uncharacterized 19.8 kDa protein in nifW 5'region Proteins 0.000 description 1
- 101000748761 Bacillus subtilis (strain 168) Uncharacterized MFS-type transporter YcxA Proteins 0.000 description 1
- 101000765620 Bacillus subtilis (strain 168) Uncharacterized protein YlxP Proteins 0.000 description 1
- 101000916134 Bacillus subtilis (strain 168) Uncharacterized protein YqxJ Proteins 0.000 description 1
- 101000754349 Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251) UPF0065 protein BP0148 Proteins 0.000 description 1
- 101000827633 Caldicellulosiruptor sp. (strain Rt8B.4) Uncharacterized 23.9 kDa protein in xynA 3'region Proteins 0.000 description 1
- 101000947628 Claviceps purpurea Uncharacterized 11.8 kDa protein Proteins 0.000 description 1
- 101000686796 Clostridium perfringens Replication protein Proteins 0.000 description 1
- 208000003322 Coinfection Diseases 0.000 description 1
- 101000788129 Escherichia coli Uncharacterized protein in sul1 3'region Proteins 0.000 description 1
- 101000788370 Escherichia phage P2 Uncharacterized 12.9 kDa protein in GpA 3'region Proteins 0.000 description 1
- 206010017472 Fumbling Diseases 0.000 description 1
- 101000787096 Geobacillus stearothermophilus Uncharacterized protein in gldA 3'region Proteins 0.000 description 1
- 101000976889 Haemophilus phage HP1 (strain HP1c1) Uncharacterized 19.2 kDa protein in cox-rep intergenic region Proteins 0.000 description 1
- 101000827627 Klebsiella pneumoniae Putative low molecular weight protein-tyrosine-phosphatase Proteins 0.000 description 1
- 101001130841 Middle East respiratory syndrome-related coronavirus (isolate United Kingdom/H123990006/2012) Non-structural protein ORF5 Proteins 0.000 description 1
- 101000974028 Rhizobium leguminosarum bv. viciae (strain 3841) Putative cystathionine beta-lyase Proteins 0.000 description 1
- 101000756519 Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003) Uncharacterized protein RCAP_rcc00048 Proteins 0.000 description 1
- 101000948219 Rhodococcus erythropolis Uncharacterized 11.5 kDa protein in thcD 3'region Proteins 0.000 description 1
- 101000936711 Streptococcus gordonii Accessory secretory protein Asp4 Proteins 0.000 description 1
- 101000929863 Streptomyces cinnamonensis Monensin polyketide synthase putative ketoacyl reductase Proteins 0.000 description 1
- 101000788468 Streptomyces coelicolor Uncharacterized protein in mprR 3'region Proteins 0.000 description 1
- 101000845085 Streptomyces violaceoruber Granaticin polyketide synthase putative ketoacyl reductase 1 Proteins 0.000 description 1
- 101000711771 Thiocystis violacea Uncharacterized 76.5 kDa protein in phbC 3'region Proteins 0.000 description 1
- 101000711318 Vibrio alginolyticus Uncharacterized 11.6 kDa protein in scrR 3'region Proteins 0.000 description 1
- 238000004458 analytical method Methods 0.000 description 1
- 230000009286 beneficial effect Effects 0.000 description 1
- 239000003153 chemical reaction reagent Substances 0.000 description 1
- 238000010586 diagram Methods 0.000 description 1
- 238000003748 differential diagnosis Methods 0.000 description 1
- 238000010790 dilution Methods 0.000 description 1
- 239000012895 dilution Substances 0.000 description 1
- 208000035475 disorder Diseases 0.000 description 1
- 241001493065 dsRNA viruses Species 0.000 description 1
- 230000000694 effects Effects 0.000 description 1
- 238000000605 extraction Methods 0.000 description 1
- 238000002156 mixing Methods 0.000 description 1
- 238000002360 preparation method Methods 0.000 description 1
- 230000001850 reproductive effect Effects 0.000 description 1
- 208000023504 respiratory system disease Diseases 0.000 description 1
- 238000011896 sensitive detection Methods 0.000 description 1
- 210000002966 serum Anatomy 0.000 description 1
- 239000000243 solution Substances 0.000 description 1
- 238000006467 substitution reaction Methods 0.000 description 1
- 208000024891 symptom Diseases 0.000 description 1
- 230000001360 synchronised effect Effects 0.000 description 1
- 230000002194 synthesizing effect Effects 0.000 description 1
- 238000012795 verification Methods 0.000 description 1
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a triple real-time fluorescent RT-PCR detection method and a kit for porcine reproductive and respiratory syndrome virus, belonging to the technical field of virus PCR detection. The invention designs and synthesizes specific primers and probes aiming at highly pathogenic variant strains, NADC-like 30 strains and NADC-like 34 strains of porcine reproductive and respiratory syndrome virus, and establishes a triple real-time fluorescent RT-PCR detection method through condition optimization. The method can identify the strain, but the detection results of porcine epidemic diarrhea virus, transmissible gastroenteritis virus, swine fever virus, rotavirus, porcine circovirus type 2 and porcine pseudorabies virus are all negative, which shows that the specificity is very good; the method has good linear relation within the range of 1E8-1 copies/. Mu.L, and has the lowest sensitivity of 1 copies/. Mu.L detectable and high sensitivity; the method has the advantages that the repetition coefficient in the batch and between batches is less than 2%, and the repeatability is good.
Description
Technical Field
The invention belongs to the technical field of virus PCR detection, and particularly relates to a triple real-time fluorescent RT-PCR detection method and a kit for porcine reproductive and respiratory syndrome virus.
Background
The porcine reproductive and respiratory syndrome (Porcine reproductive andrespiratory syndrome, PRRS) is a highly contagious, high mortality infectious disease which is caused by porcine reproductive and respiratory syndrome virus (Porcine reproductive and respiratory syndrome virus, PRRSV) and takes sow reproductive disorders and neonatal piglet respiratory diseases as main symptoms, and causes great loss to the pig industry, thus becoming one of important infectious diseases which seriously threatens the development of the pig industry in China. PRRSV belongs to a single-stranded RNA virus, is extremely susceptible to mutation and recombination, is a wide variety of domestic PRRSV species and is largely divided into two major categories: european and American, each genotype is in turn divided into multiple genotypes. At present, epidemic strains in China mainly adopt American strains, and a certain proportion of European strains exist. PRRSV was first isolated in 1996 in China and named CH-1a; a new PRRSV characterized by high morbidity and mortality, designated highly pathogenic PRRSV (HP-PRRSV), appeared in 2006; in 2013, china first discovers a NADC30 PRRSV-like strain (NADC 30-like PRRSV), and the strain spreads rapidly to become one of the main popular strains in China at present; in 2018, china reports a first-class NADC34 PRRSV strain (NADC 34-like PRRSV), and in recent years, the NADC34-like PRRSV is continuously expanded in the popular range of China, and has evolved into a dominant strain in local areas. At present, NADC30-like PRRSV, NADC34-like PRRSV and HP-PRRSV become main epidemic strains in China, a large number of recombination phenomena exist, the PRRSV has a plurality of new and complex epidemic strains due to the high mutation characteristic, and mixed infection cases of multiple strains exist, so that serious challenges are brought to the prevention and control of the disease.
At present, the identification and detection method of each variant strain of the porcine reproductive and respiratory syndrome virus is mainly based on sequencing of ORF5 or NSP2 genes, and the analysis is carried out by constructing a evolutionary tree, but the detection and detection method is complex in implementation operation, high in technical requirement and long in time, and is not beneficial to rapid detection and epidemic situation control of the virus in large-scale epidemic disease. At present, a patent and a detection method for detecting the triple of the highly pathogenic variant strain, the NADC30-like strain and the NADC34-like strain of the porcine reproductive and respiratory syndrome virus can not be identified at the same time.
Therefore, the establishment of a rapid, accurate and sensitive detection method for the highly pathogenic variant strain, the NADC30-like strain and the NADC34-like strain of the porcine reproductive and respiratory syndrome virus has important significance for the differential diagnosis, prevention and control of the porcine reproductive and respiratory syndrome virus.
Disclosure of Invention
In order to solve the technical problems, the invention designs and synthesizes specific primers and probes aiming at the high pathogenicity variant strain, the NADC30-like strain and the NADC34-like strain of the porcine reproductive and respiratory syndrome virus, and establishes a triple real-time fluorescence RT-PCR detection method of the high pathogenicity variant strain, the NADC30-like strain and the NADC34-like strain of the porcine reproductive and respiratory syndrome virus by optimizing fluorescent quantitative reaction conditions. The method can specifically identify the highly pathogenic variant strain, the NADC30-like strain and the NADC34-like strain of the porcine reproductive and respiratory syndrome virus, and has negative detection results on the Porcine Epidemic Diarrhea Virus (PEDV), the transmissible gastroenteritis virus (TGEV), the Classical Swine Fever Virus (CSFV), the Rotavirus (RV), the porcine circovirus type 2 (PCV 2) and the porcine pseudorabies virus (PRV), namely the TaqMan fluorescent quantitative PCR detection method established by the invention has good specificity; the invention has good linear relation in the range of 1E8-1 copies/. Mu.L, and has the lowest sensitivity of 1 copies/. Mu.L detectable and high sensitivity; the invention has the advantages of less than 2% of repetition coefficient in batch and between batches and good repeatability.
In order to achieve the above purpose, the present invention adopts the following technical scheme:
the invention provides a triple real-time fluorescent RT-PCR primer probe set based on HP-PRRSV, NADC30-like PRRSV and NADC34-like PRRSV, which comprises an HP-PRRSV primer pair probe set, a NADC30-like PRRSV primer pair probe set and a NADC34-like PRRSV primer pair probe set; wherein the HP-PRRSV primer pair probe set comprises a primer pair with a sequence shown as SEQ ID NO. 4-SEQ ID NO.5 and a probe with a sequence shown as SEQ ID NO. 6; the NADC30-like PRRSV primer pair probe set comprises a primer pair with a sequence shown as SEQ ID NO. 7-SEQ ID NO.8 and a probe with a sequence shown as SEQ ID NO. 9; the NADC34-like PRRSV primer pair probe set comprises a primer pair with a sequence shown as SEQ ID NO. 10-SEQ ID NO.11 and a probe with a sequence shown as SEQ ID NO. 12.
Furthermore, the 5 'end of each probe in the triple real-time fluorescent RT-PCR primer probe set is respectively modified with a fluorescent reporter group, and the 3' end is respectively marked with a fluorescent quenching group.
Further, the fluorescent reporter group modified on the HP-PRRSV probe is FAM, the fluorescent reporter group modified on the NADC30-like PRRSV probe is VIC, and the fluorescent reporter group modified on the NADC34-like PRRSV probe is CY5; the fluorescence quenching groups marked on the three probes are MGB.
The invention also provides a kit for detecting and/or identifying HP-PRRSV, NADC30-like PRRSV and NADC34-like PRRSV, which comprises the triple real-time fluorescent RT-PCR primer probe group.
The invention also provides a triple real-time fluorescent RT-PCR detection method, wherein the triple real-time fluorescent RT-PCR primer probe set or the kit is used.
Furthermore, in the triple real-time fluorescent RT-PCR detection method, the primer and probe dosages of the HP-PRRSV, NADC30-like PRRSV and NADC34-like PRRSV are all 0.3-0.5 mu L.
Furthermore, the triple real-time fluorescent RT-PCR amplification reaction system comprises: 2 x One Step U + Mix 12.5. Mu.L, one Step U+enzyme Mix 2. Mu.L, HP-PRRSV forward primer 0.3. Mu.L, HP-PRRSV reverse primer 0.3. Mu.L, HP-PRRSV probe 0.3. Mu.L; NADC30-like PRRSV forward primer 0.5. Mu.L, NADC30-like PRRSV reverse primer 0.5. Mu.L, NADC30-like PRRSV probe 0.5. Mu.L; NADC34-like PRRSV forward primer 0.5. Mu.L, NADC34-like PRRSV reverse primer 0.5. Mu.L, NADC34-like PRRSV probe 0.5. Mu.L; 1.6. Mu.L of sterile nuclease-free water.
Further, the amplification reaction conditions of the triple real-time fluorescent RT-PCR are as follows: the sample was subjected to 40 cycles of pre-denaturation at 95℃for 20s, denaturation at 95℃for 5s and annealing at 60℃for 20 s.
The invention also provides an application of the triple real-time fluorescent RT-PCR primer probe set, the kit or the triple real-time fluorescent RT-PCR detection method in detection and/or identification of highly pathogenic variant strains, NADC30-like strains and NADC34-like strains of porcine reproductive and respiratory syndrome viruses.
Compared with the prior art, the invention has the following technical effects:
(1) According to the invention, through analyzing and comparing the genome sequences of the porcine reproductive and respiratory syndrome virus high pathogenicity variant strain, the NADC30-like strain and the NADC34-like strain, a primer probe capable of distinguishing and diagnosing the porcine reproductive and respiratory syndrome virus high pathogenicity variant strain, the NADC30-like strain and the NADC34-like strain is finally designed and screened.
(2) The triple fluorescence quantitative experiment of the invention is to amplify 3 target genes simultaneously in the same reaction tube for quantitative experiment, so that the amplification of one target gene tends to affect the amplification of the other two target genes, and the amplification efficiency is synchronous by the design optimization of the primer probes and the optimization of the reaction conditions instead of simply mixing all the primer probes and templates in the same reaction tube. According to the invention, through design optimization of the primers and the probes, proper primer probe sequences are found to distinguish the high pathogenicity variant strain, the NADC30-like strain and the NADC34-like strain of the porcine reproductive and respiratory syndrome virus, the amplification efficiency is close, the process is difficult, the result is not easy to control, multiple experiments are required, and meanwhile, the ratio of the primers to the probes is adjusted, and the reaction conditions are optimized, so that the amplification efficiency and the sensitivity of three target genes in a sample are consistent.
(3) Compared with the prior art, the method can identify the type of infection of the porcine reproductive and respiratory syndrome virus variant strain in the sample after one detection operation, has the advantages of high sensitivity, strong specificity and good repeatability, and provides technical support for prevention and control of porcine reproductive and respiratory syndrome virus in a pig farm.
(4) The invention can specifically identify the highly pathogenic variant, NADC30-like and NADC34-like of the porcine reproductive and respiratory syndrome virus, and has negative detection results on Porcine Epidemic Diarrhea Virus (PEDV), transmissible gastroenteritis virus (TGEV), classical Swine Fever Virus (CSFV), rotavirus (RV), porcine circovirus type 2 (PCV 2) and porcine pseudorabies virus (PRV); the invention has good linear relation in the range of 1E8-1 copies/. Mu.L, and the sensitivity is the lowest and can detect 1 copies/. Mu.L; the present invention has a repetition factor of less than 2% both within and between batches.
Drawings
FIG. 1 is a graph showing the amplification curves and standard curves of the HP-PRRSV subtype detected in example 3 of the present invention using the method of the present invention, wherein: plasmid standard copy numbers are 1E8,1E7,1E6,1E5,1E4,1E3,1E2,1E1,1 copies/. Mu.L in sequence from left to right;
FIG. 2 is a graph showing amplification curves and standard plots of NADC30-like PRRSV subtypes detected in example 3 of the present invention using the method of the present invention, wherein: plasmid standard copy numbers are 1E8,1E7,1E6,1E5,1E4,1E3,1E2,1E1,1 copies/. Mu.L in sequence from left to right;
FIG. 3 is a graph showing amplification curves and standard plots of NADC34-like PRRSV subtypes detected in example 3 of the present invention using the method of the present invention, wherein: plasmid standard copy numbers are 1E8,1E7,1E6,1E5,1E4,1E3,1E2,1E1,1 copies/. Mu.L in sequence from left to right;
FIG. 4 is a diagram showing the specificity of the method for detecting triple fluorescence quantitative RT-PCR using the present invention in example 4, wherein: representing NADC30-like PRRSV positive fragment, NADC34-like PRRSV positive fragment and HP-PRRSV positive fragment from top to bottom;
FIG. 5 shows the results of the detection of clinical samples using the method of the present invention and the PCR sequencing method of example 6 of the present invention, respectively.
Detailed Description
The following examples are illustrative of the invention and are not intended to limit the scope of the invention. Modifications and substitutions to methods, procedures, or conditions of the present invention without departing from the spirit and nature of the invention are intended to be within the scope of the present invention. The reagents, kits and instruments used in the following examples are commercially available, and the methods used in the examples are consistent with the methods conventionally used unless otherwise specified.
The technical scheme of the invention is further elaborated in the following in conjunction with examples.
Example 1 development of detection methods and kits
(1) Designing and synthesizing a primer:
by downloading and comparing the NSP2 genes of HP-PRRSV, NADC30-like and NADC34-like PRRSV in GenBank, selecting a proper region and designing three pairs of specific primers and probes capable of identifying the HP-PRRSV, NADC30-like and NADC34-like PRRSV by using Primer Express 3.0.1 software, the primers and probes are synthesized by the biological engineering Co.
HP-PRRSV target gene sequence (SEQ ID NO. 1):
ACACCTATGAGTGAGCCCGTACTTGTGCCCGCGTCGCGACGTGTCCCCAAGCTGATGAC
ACCTTTGAGTGGGTCGGCACCAGTTCCTGCACCGCGTAGAACTGTGACAACAACGCTG
ACGCACCAGGATGAGCCTCTGGATTTGTCTGCGTCCTCACAGACGGAATATGAGGCTTT
CCCCCTAGCACCATCGCAGAACATGGGCATCCTGGAGGCGGGGGGGCAAGAAGTTGAGGAAGTCCTGAGTGAAATCTCGGA；
NADC30-like PRRSV target gene sequence (SEQ ID NO. 2):
AACTTCCCTTACTGCTGGGAAGATCTGGCCGGTGGTCCCTTCCGTTCCCCAGTCCTGCCT
GAGTCAGTGGCACGTTCGAATGAACCTGTGCCTGTCCCTGCACCGCGCAGGACTGTGTC
CCGACTGAAGCCGTCACCGATAGTGTCAACCCCTGTGCCCGCACCACGATGTGGGCTTCAGCAGGTGGAAGGAATGAACTTGGCGGTAGGGA；
NADC34-like PRRSV target gene sequence (SEQ ID NO. 3):
GTGATGGACGCCTCATTAAATTGGAATGTTGTGTTCCCTGGAGTTGAGGCGGGAGTTCA
CCTAACCGAGTTGCCCCCGGCCAACCAGTGTCGCGCTCCCACTTCTATCGCGACTCAAG
GGCTTTTTGAGGACGGCCCGGCCCCACCGCCACCTCTTACACCAAGGGTTCAGCCTCAA
AAAACAAAGTCCGTCAGAAGCTTGCCAGATTGCAAGCCCGTCCCTGCTCCGCGCAGGAGAATTAGATCTGTCTGTAG。
(2) Preparing a recombinant plasmid standard:
the fragments of HP-PRRSV, NADC30-like, NADC34-like PRRSV target gene were synthesized by the Biotechnology Co., ltd and ligated into pUC57 vector.
(3) TaqMan fluorescent quantitative PCR primer probe dosage fumbling:
HP-PRRSV primer and probe are used in an amount of 0.3-0.5 mu L, NADC30-like PRRSV primer and probe are used in an amount of 0.3-0.5 mu L, NADC34-like PRRSV primer and probe are used in an amount of 0.3-0.5 mu L, and the optimal combination is selected.
(4) The primers and probes used in the amplification are respectively:
HP-PRRSV forward primer: ACGTGYCCCCAAGCTGATG (SEQ ID NO. 4)
HP-PRRSV reverse primer: TCTGTGARGACRCAGACAAATC (SEQ ID NO. 5)
HP-PRRSV probe: FAM-CTGTGACAACAACGCTGA-MGB (SEQ ID NO. 6)
NADC30-like PRRSV forward primer: AGTCAGTGGCACGTTCGAATG (SEQ ID NO. 7)
NADC30-like PRRSV reverse primer: CTGYTGAARCCCACRTCGT (SEQ ID NO. 8)
NADC30-like PRRSV probe: VIC-TGCCTGTCCCHGCAC-MGB (SEQ ID NO. 9)
NADC34-like PRRSV forward primer: CCCACTTCTATCGCGACTCAA (SEQ ID NO. 10)
NADC34-like PRRSV reverse primer: TGAGGCTGAACCCTTGGTGTA (SEQ ID NO. 11)
NADC34-like PRRSV probe: CY5-TTTTTGAGGACGGCCCGG-MGB (SEQ ID NO. 12)
The working concentration of the primer probe is 10 mu mol/L, and the optimal dosage of the HP-PRRSV primer probe is 0.3 mu L; the optimal dosage of the NADC30-like PRRSV primer probe is 0.5 mu L; the optimal amount of NADC34-like PRRSV primer probe was 0.5. Mu.L.
Amplification reaction system: 2 x One Step U + Mix 12.5. Mu.L, one Step U+enzyme Mix 2. Mu.L, HP-PRRSV forward primer 0.3. Mu.L, HP-PRRSV reverse primer 0.3. Mu.L, HP-PRRSV probe 0.3. Mu.L; NADC30-like PRRSV forward primer 0.5. Mu.L, NADC30-like PRRSV reverse primer 0.5. Mu.L, NADC30-like PRRSV probe 0.5. Mu.L; NADC34-like PRRSV forward primer 0.5. Mu.L, NADC34-like PRRSV reverse primer 0.5. Mu.L, NADC34-like PRRSV probe 0.5. Mu.L sterile nuclease-free water 1.6. Mu.L.
Adding 5 mu L of sample RNA to be detected into a reaction system with the total amount of 25 mu L, reversely transcribing a PCR tube with the reaction system at 52 ℃ for 5min, pre-denaturing for 20s at 95 ℃, denaturing for 5s at 95 ℃ and annealing for 20s at 60 ℃, wherein the total period of denaturation and annealing is 40 cycles.
(5) And (3) result detection:
and reading corresponding Ct values by using a fluorescence quantitative PCR instrument from the provided software, and judging whether the sample to be detected is positive or negative. The test establishment conditions are shown in table 1.
Table 1 conditions for establishment of test
Note that: positive control had a significant exponential increase, with a typical sigmoid curve.
The sample detection result judging standard is as follows:
the sample FAM channel Ct is less than or equal to 40, has obvious exponential growth, and is judged to be positive, which indicates that HP-PRRSV nucleic acid is detected in the sample;
the Ct of the VIC/HEX channel of the sample is less than or equal to 40, the Ct of the sample has obvious exponential growth, and the sample is judged to be positive, which indicates that NADC30-like PRRSV nucleic acid is detected in the sample;
the Ct of the sample CY5 channel is less than or equal to 40, has obvious exponential growth, and is judged to be positive, which indicates that NADC34-like PRRSV nucleic acid is detected in the sample;
and the sample detection result has no Ct value or Ct value is more than 40, and the result is judged as negative, which indicates that HP-PRRSV, NADC30-like PRRSV and NADC34-like PRRSV nucleic acid are not detected in the sample.
Example 2 preparation of fluorescent quantitative Standard
Fragments of HP-PRRSV, NADC30-like PRRSV, NADC34-like PRRSV target genes were synthesized by the Biotechnology Co., ltd, ligated into pUC57 vector, and provided with sequencing reports.
Example 3 sensitivity test
Using the optimized reaction conditions, 10-fold gradient dilution (1E 8-1 copies/. Mu.L) of the standard (1E 8) of known concentration was performed, and fluorescence quantitative PCR was performed as a template to verify sensitivity, and the results are shown in FIGS. 1 to 3.
The results show that: the detection lower limit of the triple real-time fluorescent quantitative PCR on the HP-PRRSV, NADC30-like PRRSV and NADC34-like PRRSV subtypes is 1 copies/. Mu.L.
Example 4 specificity test
Nucleic acid extraction kit is used for extracting nucleic acid of Porcine Epidemic Diarrhea Virus (PEDV), transmissible gastroenteritis virus (TGEV), swine fever virus (CSFV), rotavirus (RV), porcine circovirus type 2 (PCV 2) and porcine pseudorabies virus (PRV) as templates for fluorescence quantitative PCR reaction, and negative and positive control is set at the same time, and specificity experiment is carried out, and the result is shown in figure 4.
The results show that: only positive control showed a clear amplification curve, and no amplification curve was found for other porcine-derived virus and negative control. Therefore, the TaqMan fluorescent quantitative PCR detection method established by the invention has good specificity.
Example 5 repeatability test
The method was verified for in-group reproducibility by repeating 6 times on the same day using plasmids of known concentrations (1E 5 copies/. Mu.L, 1E3 copies/. Mu.L, 1E1 copies/. Mu.L) as templates; the method was run 3 times at different times to verify the inter-group repeatability. The results are shown in Table 2.
TABLE 2 fluorescent quantitative PCR method reproducibility
As can be seen from table 2: the variation coefficients of the inside and the between groups are between 0.15% and 1.12%, which are less than 2%, so that the TaqMan fluorescence quantitative PCR detection method established by the invention has good repeatability.
Example 6 clinical sample detection results
The invention is used for simultaneously detecting 6 clinical samples, including serum and tissues, according to a triple real-time fluorescent RT-PCR detection method and a kit for a highly pathogenic variant strain, a NADC30-like strain and a NADC34-like strain of porcine reproductive and respiratory syndrome virus, and the detection is carried out by using PCR sequencing, and the result is shown in figure 5.
The results show that: the method established by the invention is completely consistent with verification of the sequencing result, and is accurate and reliable.
The above embodiments are only illustrative of the preferred embodiments of the present invention and are not intended to limit the scope of the present invention, and various modifications and improvements made by those skilled in the art to the technical solutions of the present invention should fall within the protection scope defined by the claims of the present invention without departing from the design spirit of the present invention.
Claims (9)
1. The triple real-time fluorescent RT-PCR primer probe set based on HP-PRRSV, NADC30-like PRRSV and NADC34-like PRRSV is characterized by comprising an HP-PRRSV primer pair probe set, a NADC30-like PRRSV primer pair probe set and a NADC34-like PRRSV primer pair probe set; wherein,
the HP-PRRSV primer pair probe set comprises a primer pair with a sequence shown as SEQ ID NO. 4-SEQ ID NO.5 and a probe with a sequence shown as SEQ ID NO. 6;
the NADC30-like PRRSV primer pair probe set comprises a primer pair with a sequence shown as SEQ ID NO. 7-SEQ ID NO.8 and a probe with a sequence shown as SEQ ID NO. 9;
the NADC34-like PRRSV primer pair probe set comprises a primer pair with a sequence shown as SEQ ID NO. 10-SEQ ID NO.11 and a probe with a sequence shown as SEQ ID NO. 12.
2. The triple real-time fluorescent RT-PCR primer probe set according to claim 1, wherein each probe in the triple real-time fluorescent RT-PCR primer probe set is respectively modified with a fluorescent reporter group at the 5 'end and a fluorescent quencher group at the 3' end.
3. The triple real-time fluorescent RT-PCR primer set of claim 2, wherein the fluorescent reporter group modified on the HP-PRRSV probe is FAM, the fluorescent reporter group modified on the NADC30-like PRRSV probe is VIC, and the fluorescent reporter group modified on the NADC34-like PRRSV probe is CY5; the fluorescence quenching groups marked on the three probes are MGB.
4. A kit for detecting and/or identifying HP-PRRSV, NADC30-like PRRSV, NADC34-like PRRSV, characterized in that the kit comprises a triple real-time fluorescent RT-PCR primer set according to any one of claims 1-3.
5. A triple real-time fluorescent RT-PCR detection method, wherein the triple real-time fluorescent RT-PCR detection method uses the triple real-time fluorescent RT-PCR primer probe set according to any one of claims 1 to 3 or the kit according to claim 4.
6. The method according to claim 5, wherein the amount of the primer and probe used in the method is 0.3-0.5. Mu.L.
7. According to claimThe triple real-time fluorescent RT-PCR detection method of claim 6, wherein the amplification reaction system of the triple real-time fluorescent RT-PCR is as follows: 2 x One Step U + Mix 12.5. Mu.L, one Step U+enzyme Mix 2. Mu.L, HP-PRRSV forward primer 0.3. Mu.L, HP-PRRSV reverse primer 0.3. Mu.L, HP-PRRSV probe 0.3. Mu.L; NADC30-like PRRSV forward primer 0.5. Mu.L, NADC30-like PRRSV reverse primer 0.5. Mu.L, NADC30-like PRRSV probe 0.5. Mu.L; NADC34-like PRRSV forward primer 0.5. Mu.L, NADC34-like PRRSV reverse primer 0.5. Mu.L, NADC34-like PRRSV probe 0.5. Mu.L; 1.6. Mu.L of sterile nuclease-free water.
8. The method for detecting the triple real-time fluorescent RT-PCR according to claim 7, wherein the amplification reaction conditions of the triple real-time fluorescent RT-PCR are as follows: the sample was subjected to 40 cycles of pre-denaturation at 95℃for 20s, denaturation at 95℃for 5s and annealing at 60℃for 20 s.
9. The use of a triple real-time fluorescent RT-PCR primer set according to any one of claims 1 to 3, a kit according to claim 4 or a triple real-time fluorescent RT-PCR detection method according to any one of claims 5 to 8 for detection and/or identification of highly pathogenic variants, NADC30-like, NADC34-like of porcine reproductive and respiratory syndrome virus.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202311820063.7A CN117778626A (en) | 2023-12-27 | 2023-12-27 | Triple real-time fluorescent RT-PCR detection method and kit for porcine reproductive and respiratory syndrome virus |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202311820063.7A CN117778626A (en) | 2023-12-27 | 2023-12-27 | Triple real-time fluorescent RT-PCR detection method and kit for porcine reproductive and respiratory syndrome virus |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN117778626A true CN117778626A (en) | 2024-03-29 |
Family
ID=90384817
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202311820063.7A Pending CN117778626A (en) | 2023-12-27 | 2023-12-27 | Triple real-time fluorescent RT-PCR detection method and kit for porcine reproductive and respiratory syndrome virus |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN117778626A (en) |
-
2023
- 2023-12-27 CN CN202311820063.7A patent/CN117778626A/en active Pending
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111500791B (en) | Triple FQ-PCR detection method for porcine epidemic diarrhea virus, porcine delta coronavirus and porcine acute diarrhea syndrome coronavirus | |
| CN110760620A (en) | Classical swine fever virus and African classical swine fever virus dual-fluorescence PCR detection reagent, kit and detection method | |
| CN113502352B (en) | EMA-ddPCR primer and probe for detecting infectious ASFV and application | |
| CN113774168A (en) | 2019 novel coronavirus, Deltay and lambda variant strain typing nucleic acid detection kit and detection method thereof | |
| CN113462820A (en) | Multiplex RT-PCR primer probe set for real-time fluorescent quantitative detection of four porcine diarrhea viruses, kit and detection method thereof | |
| CN115976285A (en) | Quadruple fluorescent quantitative PCR detection kit for detecting African swine fever | |
| CN105907890A (en) | Primers, probe and method for rapidly distinguishing HP-PRRS (High pathogenic porcine reproductive and respiratory syndrome) vaccine strain GDr180 from HP-PRRS wild strain | |
| CN113913559B (en) | Reagent for fluorescence quantitative detection of PRRSV and detection method for PRRSV typing | |
| CN114350848B (en) | Dual fluorescent probe primer combination for identifying African swine fever type I strain and type II strain, kit and application thereof | |
| CN116904667B (en) | Primer group, probe, kit and method for detecting wild strain and vaccine strain of porcine epidemic diarrhea virus | |
| CN116004920B (en) | Fluorescence PCR detection method and kit for four different lineages of strains of porcine reproductive and respiratory syndrome | |
| CN116162734B (en) | Specific primer, probe and kit for rapidly detecting African swine fever wild strain and gene deletion strain | |
| CN112280899A (en) | Porcine astrovirus type 2 TaqMan fluorescent quantitative PCR kit and application thereof | |
| CN112029908A (en) | Detection kit for porcine coronavirus and acute diarrhea syndrome coronavirus | |
| CN116555495A (en) | Primer probe combination, kit and method for identifying and detecting African swine fever I177L gene deletion strain | |
| CN113801966B (en) | Fluorescent quantitative PCR method and kit for detecting novel coronavirus subgenomic | |
| CN116024387A (en) | Quadruple fluorescence PCR detection kit for porcine viral diarrhea pathogen and application thereof | |
| CN117778626A (en) | Triple real-time fluorescent RT-PCR detection method and kit for porcine reproductive and respiratory syndrome virus | |
| CN114540546A (en) | Primer probe set, kit and detection method for PRRSV and CSFV double fluorescence quantitative PCR detection | |
| CN114438265A (en) | Nucleic acid composition, kit and detection method for simultaneously detecting porcine delta coronavirus, reovirus and porcine kobuvirus | |
| CN115976273B (en) | Dual fluorescence PCR detection kit for identifying African swine fever virus genes type I and type II | |
| CN116144836B (en) | Quadruple fluorescent quantitative RT-PCR (reverse transcription-polymerase chain reaction) detection primer set for PRRSV (porcine reproductive and respiratory syndrome virus) and detection method | |
| CN118127229B (en) | Real-time fluorescence quantitative PCR primer probe set and kit for detecting temporary porcine fever virus and application of kit | |
| CN114292961B (en) | Real-time fluorescent RT-PCR detection primer and probe set for identifying NADC-30-like strain | |
| CN116814862B (en) | Identification and detection of African swine fever gene type I virulent virus, type I attenuated virus and type II virus |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |