CN117778542A - Primer group and kit for detecting HPA genotyping and application - Google Patents
Primer group and kit for detecting HPA genotyping and application Download PDFInfo
- Publication number
- CN117778542A CN117778542A CN202311160129.4A CN202311160129A CN117778542A CN 117778542 A CN117778542 A CN 117778542A CN 202311160129 A CN202311160129 A CN 202311160129A CN 117778542 A CN117778542 A CN 117778542A
- Authority
- CN
- China
- Prior art keywords
- seq
- genotyping
- hpa
- detecting
- kit
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
- 238000003205 genotyping method Methods 0.000 title claims abstract description 46
- 238000001514 detection method Methods 0.000 claims abstract description 36
- 238000006243 chemical reaction Methods 0.000 claims abstract description 20
- 238000000034 method Methods 0.000 claims abstract description 17
- 239000003153 chemical reaction reagent Substances 0.000 claims abstract description 4
- 239000000523 sample Substances 0.000 claims description 26
- 238000007789 sealing Methods 0.000 claims description 14
- 239000007788 liquid Substances 0.000 claims description 9
- 239000000047 product Substances 0.000 claims description 9
- 238000003908 quality control method Methods 0.000 claims description 9
- 239000012295 chemical reaction liquid Substances 0.000 claims description 8
- 108090000623 proteins and genes Proteins 0.000 claims description 8
- 239000007853 buffer solution Substances 0.000 claims description 5
- 239000000872 buffer Substances 0.000 claims description 4
- 108090000790 Enzymes Proteins 0.000 claims description 3
- 102000004190 Enzymes Human genes 0.000 claims description 3
- 239000011248 coating agent Substances 0.000 claims description 2
- 238000000576 coating method Methods 0.000 claims description 2
- 239000011265 semifinished product Substances 0.000 claims description 2
- 230000003321 amplification Effects 0.000 abstract description 13
- 238000003199 nucleic acid amplification method Methods 0.000 abstract description 13
- 102100024025 Heparanase Human genes 0.000 abstract description 8
- 101001047819 Homo sapiens Heparanase Proteins 0.000 abstract description 8
- 108700028369 Alleles Proteins 0.000 abstract description 4
- 230000000961 alloantigen Effects 0.000 abstract description 4
- 230000007547 defect Effects 0.000 abstract description 4
- 238000005516 engineering process Methods 0.000 abstract description 4
- 230000002860 competitive effect Effects 0.000 abstract description 3
- 230000008569 process Effects 0.000 abstract description 3
- 230000000694 effects Effects 0.000 abstract 1
- 239000000427 antigen Substances 0.000 description 15
- 108091007433 antigens Proteins 0.000 description 15
- 102000036639 antigens Human genes 0.000 description 15
- 108020004414 DNA Proteins 0.000 description 9
- 239000008280 blood Substances 0.000 description 6
- 210000004369 blood Anatomy 0.000 description 6
- 238000002360 preparation method Methods 0.000 description 6
- 238000005119 centrifugation Methods 0.000 description 5
- 239000007850 fluorescent dye Substances 0.000 description 5
- 238000012163 sequencing technique Methods 0.000 description 5
- 238000012408 PCR amplification Methods 0.000 description 4
- 238000004458 analytical method Methods 0.000 description 4
- 238000013461 design Methods 0.000 description 4
- 239000000203 mixture Substances 0.000 description 4
- 238000001802 infusion Methods 0.000 description 3
- 238000002493 microarray Methods 0.000 description 3
- 238000002156 mixing Methods 0.000 description 3
- 102100037917 CD109 antigen Human genes 0.000 description 2
- -1 GPIbα Proteins 0.000 description 2
- 101150069909 HPA gene Proteins 0.000 description 2
- 101000738399 Homo sapiens CD109 antigen Proteins 0.000 description 2
- 102100025305 Integrin alpha-2 Human genes 0.000 description 2
- 102100025306 Integrin alpha-IIb Human genes 0.000 description 2
- 108091028043 Nucleic acid sequence Proteins 0.000 description 2
- 102100036851 Platelet glycoprotein IX Human genes 0.000 description 2
- 208000003441 Transfusion reaction Diseases 0.000 description 2
- 238000000137 annealing Methods 0.000 description 2
- 238000010586 diagram Methods 0.000 description 2
- 230000002068 genetic effect Effects 0.000 description 2
- 238000004949 mass spectrometry Methods 0.000 description 2
- 239000002773 nucleotide Substances 0.000 description 2
- 125000003729 nucleotide group Chemical group 0.000 description 2
- 239000000243 solution Substances 0.000 description 2
- 239000000758 substrate Substances 0.000 description 2
- 101150066375 35 gene Proteins 0.000 description 1
- 206010067484 Adverse reaction Diseases 0.000 description 1
- 108010048623 Collagen Receptors Proteins 0.000 description 1
- 206010071602 Genetic polymorphism Diseases 0.000 description 1
- 102000003886 Glycoproteins Human genes 0.000 description 1
- 108090000288 Glycoproteins Proteins 0.000 description 1
- 101001078133 Homo sapiens Integrin alpha-2 Proteins 0.000 description 1
- 101001078143 Homo sapiens Integrin alpha-IIb Proteins 0.000 description 1
- 101001015004 Homo sapiens Integrin beta-3 Proteins 0.000 description 1
- 101001071312 Homo sapiens Platelet glycoprotein IX Proteins 0.000 description 1
- 101001070790 Homo sapiens Platelet glycoprotein Ib alpha chain Proteins 0.000 description 1
- 101001070786 Homo sapiens Platelet glycoprotein Ib beta chain Proteins 0.000 description 1
- 206010061218 Inflammation Diseases 0.000 description 1
- 101710149643 Integrin alpha-IIb Proteins 0.000 description 1
- 102100032999 Integrin beta-3 Human genes 0.000 description 1
- 108010020950 Integrin beta3 Proteins 0.000 description 1
- 102000015795 Platelet Membrane Glycoproteins Human genes 0.000 description 1
- 108010010336 Platelet Membrane Glycoproteins Proteins 0.000 description 1
- 101710191888 Platelet glycoprotein IX Proteins 0.000 description 1
- 102100034173 Platelet glycoprotein Ib alpha chain Human genes 0.000 description 1
- 102100034168 Platelet glycoprotein Ib beta chain Human genes 0.000 description 1
- 206010052779 Transplant rejections Diseases 0.000 description 1
- 230000006838 adverse reaction Effects 0.000 description 1
- 238000007844 allele-specific PCR Methods 0.000 description 1
- 208000037927 alloimmune thrombocytopaenia Diseases 0.000 description 1
- 125000003275 alpha amino acid group Chemical group 0.000 description 1
- 238000003556 assay Methods 0.000 description 1
- 230000009286 beneficial effect Effects 0.000 description 1
- 210000004204 blood vessel Anatomy 0.000 description 1
- 210000001185 bone marrow Anatomy 0.000 description 1
- 210000004027 cell Anatomy 0.000 description 1
- 230000008859 change Effects 0.000 description 1
- 210000000349 chromosome Anatomy 0.000 description 1
- 230000015271 coagulation Effects 0.000 description 1
- 238000005345 coagulation Methods 0.000 description 1
- 210000000805 cytoplasm Anatomy 0.000 description 1
- 238000012217 deletion Methods 0.000 description 1
- 230000037430 deletion Effects 0.000 description 1
- 238000001962 electrophoresis Methods 0.000 description 1
- 239000012634 fragment Substances 0.000 description 1
- 230000023597 hemostasis Effects 0.000 description 1
- 230000004054 inflammatory process Effects 0.000 description 1
- 210000003593 megakaryocyte Anatomy 0.000 description 1
- 238000012986 modification Methods 0.000 description 1
- 230000004048 modification Effects 0.000 description 1
- 230000035772 mutation Effects 0.000 description 1
- 108020004707 nucleic acids Proteins 0.000 description 1
- 150000007523 nucleic acids Chemical class 0.000 description 1
- 102000039446 nucleic acids Human genes 0.000 description 1
- 238000005457 optimization Methods 0.000 description 1
- 230000010355 oscillation Effects 0.000 description 1
- 238000012545 processing Methods 0.000 description 1
- 239000000376 reactant Substances 0.000 description 1
- 230000008439 repair process Effects 0.000 description 1
- 238000011160 research Methods 0.000 description 1
- 238000012216 screening Methods 0.000 description 1
- 239000000126 substance Substances 0.000 description 1
- 238000006467 substitution reaction Methods 0.000 description 1
- 208000011580 syndromic disease Diseases 0.000 description 1
- 238000012360 testing method Methods 0.000 description 1
- 238000005382 thermal cycling Methods 0.000 description 1
- 238000012546 transfer Methods 0.000 description 1
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a primer group and a kit for detecting HPA genotyping, wherein the primer group comprises 35 groups, and a kit containing a chip and an amplification reagent combination of the primer group is also provided. The application of the invention has the following technical effects: the invention adopts the micro-fluidic chip combined with competitive allele specific amplification technology to carry out genotyping qualitative detection on human platelet alloantigen (Human Platelet Alloantigens, HPAs) HPA 1-35, and compared with the existing detection technology, the invention can realize multi-site simultaneous detection, the volume of a PCR reaction system required by each site is only 1.15 mu L, and the DNA template is only 5-10 ng, thereby overcoming the defects of complex operation, complicated process and the like of the existing detection method, and having wide application prospect and clinical reference value.
Description
Technical Field
The invention relates to the technical field of biology, in particular to a primer group for detecting HPA genotyping, a kit and application thereof.
Background
Platelets are small masses of cytoplasm which fall off megakaryocytes in bone marrow, and have the main functions of coagulation, hemostasis, repair of damaged blood vessels, and play an important role in inflammatory reactions. The surface of platelets has complex blood group antigens, which are classified into two major classes of nonspecific antigens and specific antigens. Platelet specific antigen generally refers to human platelet alloantigen (Human Platelet Alloantigens, HPAs), and in the clinical platelet infusion process, the incompatible platelet of the infused HPA can cause the body of a blood receiver to produce platelet alloantibodies, and cause transfusion adverse reactions such as alloimmune thrombocytopenia syndrome (NAITP), post-transfusion purpura (PTP), ineffective platelet infusion (PTR), transplant rejection and the like, so that the platelet infusion of individuals with the same HPA type is ensured, complications related to transfusion are prevented, and the platelet specific antigen has important significance for clinical transfusion safety. Up to now, a total of 41 HPA antigens were found, and these 41 HPA antigens were divided into 35 systems (or quasisystems) according to PNC naming principles.
Human platelet-specific antigen (HPA), is autosomal bi-allele co-dominant inheritance with alleles located at 7 genetic loci on chromosome 3, 5, 6, 17 and 22, respectively, namely 7 genes ITGB3, GP1BA, ITGA2B, ITGA2, GP1BB, GP9 and CD109. The 7 genes above encode 7 platelet membrane Glycoproteins (Glycoproteins GP): GPIIIa, GPIbα, GPIIb, GPIa, GPIbβ, GPIX and CD109. Of 35 HPA antigen systems, 34 have single nucleotide polymorphism (Single Nucleotide Polymorphism, SNP) caused single amino acid substitution at corresponding position, thus resulting in GP antigen structural form change, genetic polymorphism of HPA; still another 1 (HPA-14 bw antigen) is due to the deletion of AAG three bases at positions 1909 to 1911 of the base sequence.
At present, no commercial kit for detecting HPA genotyping is searched in the domestic market, and various methods for HPA genotyping at the scientific research level exist, and the main methods at present are a specific sequence primer PCR method (PCR-SSP), a fluorescent probe/dye PCR method, a sequencing method (PCR-SSP), a microarray chip method, a flight mass spectrometry method and the like. The PCR-SSP method needs multi-tube amplification and multi-band electrophoresis, and risks of typing errors caused by easy confusion of interpretation exist. The fluorescent probe/dye PCR method requires multi-tube amplification. The PCR-SBT typing method, the microarray chip method and the flight mass spectrometry have the biggest defects that the operation process is very complicated, and expensive instrument and equipment resources are required. Therefore, it is necessary to develop a method or product for detecting multi-site simultaneous detection and automatic interpretation results, which is simple, rapid and low-cost to operate, so as to meet market and clinical demands.
Disclosure of Invention
(one) solving the technical problems
The existing detection method has the defects of complicated operation, high quality requirement of operators, large detection workload at the same time at multiple sites, complex analysis of detection results, lower cost performance and the like, and the invention provides a primer group, a kit and application for detecting HPA genotyping aiming at the defects of the prior art.
The first object of the present invention is to provide 35 sets of primers for detecting HPA genotyping; a second object is to provide a kit for detecting HPA genotyping; a third object is to provide the use of a primer set or kit for detecting HPA genotyping.
(II) technical scheme
In order to achieve the above purpose, the present invention provides the following technical solutions: a primer group for detecting HPA genotyping, wherein the sequence numbers of the 35 primer groups are shown in the table 1 in claim 1.
The primers related by the invention can be amplified simultaneously under the same PCR amplification condition through a series of optimized designs, so that the detection efficiency is greatly increased.
Further, the nucleotide sequences of SEQ ID Nos 1 to 105 of 35 primer sets for HPA1 to 35 genotyping are shown in Table 2:
TABLE 2 primer nucleotide sequences
Preferably, the primer group for detecting the genotyping of HPA 1-35 is characterized in that each primer group consists of two primers designed based on the difference of gene sequences and one common pair primer.
Preferably, the primer group for detecting the genotyping of HPA 1-35 is characterized in that the sequence listing numbers SEQ ID No.1, SEQ ID No.4, SEQ ID No.7, SEQ ID No.10, SEQ ID No.13, SEQ ID No.16, SEQ ID No.19, SEQ ID No.22, SEQ ID No.25, SEQ ID No.28, SEQ ID No.31, SEQ ID No.34, SEQ ID No.37, SEQ ID No.40, SEQ ID No.43, SEQ ID No.46, SEQ ID No.49, SEQ ID No.52, SEQ ID No.55, SEQ ID No.58, SEQ ID No.61, SEQ ID No.64, SEQ ID No.67, SEQ ID No.70, SEQ ID No.73, SEQ ID No.76, SEQ ID No.79, SEQ ID No.82, SEQ ID No.85, SEQ ID No.88, SEQ ID No.91, SEQ ID No.94, SEQ ID No.97, SEQ ID No.103, and SEQ ID No.62 carry a tag sequence; the sequence listing numbers SEQ ID No.2, SEQ ID No.5, SEQ ID No.8, SEQ ID No.11, SEQ ID No.14, SEQ ID No.17, SEQ ID No.20, SEQ ID No.23, SEQ ID No.26, SEQ ID No.29, SEQ ID No.32, SEQ ID No.35, SEQ ID No.38, SEQ ID No.41, SEQ ID No.44, SEQ ID No.47, SEQ ID No.50, SEQ ID No.53, SEQ ID No.56, SEQ ID No.59, SEQ ID No.62, SEQ ID No.65, SEQ ID No.68, SEQ ID No.71, SEQ ID No.74, SEQ ID No.77, SEQ ID No.80, SEQ ID No.83, SEQ ID No.86, SEQ ID No.89, SEQ ID No.92, SEQ ID No.95, SEQ ID No.98, SEQ ID No.101, SEQ ID No.104 carry a universal tag sequence GAAGGTCGGAGTCAACGGATT.
Preferably, the primer set comprises 35 sets of primers for detecting the genotyping of HPA 1-35 according to claim 1.
Preferably, the kit for detecting HPA genotyping comprises at least 35 chip reaction wells and 2 positioning wells, wherein each chip reaction well is coated with a set of primers in a primer set for detecting HPA genotyping according to any one of claims 1 to 3.
Preferably, the preparation method of the kit for detecting HPA 1-35 genotyping comprises the following steps:
(1) Selecting 35 site specific primer groups of HPA 1-35 genotyping to prepare Kong Weibiao, and respectively coating 35 groups of primers into a chip reaction hole according to Kong Weibiao to prepare a chip semi-finished product;
(2) Preparing PCR reaction liquid mainly comprising probes, enzymes, dNTPs and the like;
(3) Preparing a certain amount of sealing films, quality control products and PCR buffer solution;
(4) And assembling the semi-finished chip, the PCR reaction liquid, the sealing film, the quality control product and the PCR buffer liquid according to the detection times to form the kit for detecting HPA genotyping.
Preferably, the primer group for detecting HPA 1-35 genotyping and/or the kit for detecting HPA 1-35 genotyping as described in any one of claims 4-5 are applied to population HPA gene frequency screening.
The beneficial effects of the invention are as follows:
(1) 35 groups of primers are designed aiming at mutation conditions of 35 SNP loci of 35 antigen system related genes respectively, and the established detection method can effectively realize HPA 1-35 genotyping;
(2) The kit primer containing the primer group has similar annealing temperature after optimized design, can be amplified simultaneously under the same PCR amplification condition, greatly increases the detection efficiency, and can realize multi-site simultaneous detection; meanwhile, the kit adopts a microfluidic chip technology, and each detection index is arranged in an independent reaction tank, so that the required sample size is small, the experimental cost is saved, and the product requirements of detecting HPA 1-35 genotyping, and the kit is simple and quick to operate, low in cost, capable of simultaneously detecting multiple sites and capable of automatically judging and reading results are met.
(3) The primer group and the kit for detecting HPA genotyping can be effectively used for assisting in clinically identifying human platelet specific antigens on a gene detection level.
(4) The human genome DNA is taken as a template, and the genotype of 35 SNP loci related to an HPA 1-35 antigen system is detected by adopting a microfluidic chip combined with competitive allele specific amplification technology, so that each detection index can be placed in a separate reaction tank for detection; in each reaction tank, a site-specific primer with a general Tag sequence and a fluorescent probe amplify and fluorescently label fragments of related sites, and after the reaction is finished, information of 35 related sites of the HPA gene is obtained by reading fluorescent signals.
Drawings
FIG. 1 is a graph of 35-site detection information and corresponding fluorescence expression.
Fig. 2 is a block diagram of a chip substrate.
FIGS. 3 to 9 are diagrams showing the results of genotyping test of HPA1 to 35 and the fluorescent representation of the corresponding chips.
FIGS. 10, 11 and 12 are sequencing charts showing the results of chip detection for HPA1 to 35 gene typing, and the sequencing results are 100% identical to the chip detection results.
Detailed Description
Example 1 primer design
Platelets are autosomal double-allele co-dominant inheritance, and according to human platelet specific antigen HPA 1-35 allele reference sequences published by national center for biotechnology information (NCBI Gene Bank), primer design and optimization are carried out, so that the combined information of genetic loci of corresponding areas of HPA 1-35 genotyping can be detected simultaneously, and the simultaneous amplification under the same PCR amplification conditions can be realized at similar annealing temperatures.
Example 2 preparation of the kit
Based on the embodiment 1, the embodiment 2 selects 35 primer groups for preparing the kit for HPA 1-35 genotyping, and the kit mainly comprises semi-finished chips, PCR reaction liquid, sealing film, quality control product and PCR buffer liquid.
Through carrying out fluorescent signal detection on the PCR product, the sample can be subjected to genotyping according to fluorescent signal grouping, and the purposes of rapid, accurate and high-flux accurate genotyping and multi-site simultaneous detection are realized (the attached figure 1 of the specification).
A kit for SNP typing based on the principle of competitive allele-specific PCR, wherein the PCR reaction is completed on a microfluidic chip substrate (figure 2 of the specification), and the preparation method comprises the following steps:
(1) 35 site specific primer groups of HPA 1-35 genotyping are selected to prepare Kong Weibiao, 35 groups of primers are respectively coated into chip reaction holes according to Kong Weibiao to prepare semi-finished chips, the specification of each chip is 2 persons/sheet, each chip is provided with a positioning hole, internal reference quality control, negative quality control and positive quality control, and the corresponding detection indexes of the chip reaction tanks are shown in Table 3 in detail.
TABLE 3 chip reaction cell correspondence detection index
(2) The PCR reaction liquid is prepared mainly comprising probes, enzymes and dNTPs, and is provided with a certain amount of sealing films, quality control substances and PCR buffer solution, and the kit is assembled according to the detection times.
Example 3 related Gene detection
Based on the kit prepared in example 2, genotyping assays were performed on HPA 1-35 on 300 samples:
1. sample collection:
collecting blood of 300 blood donors without blood relationship, extracting genome DNA (the sample applicable to the kit is human genome DNA extracted from whole blood), and the detected genome DNA is required to meet the requirement that the concentration is not lower than 10 ng/. Mu.L;
2. the operation steps are as follows:
2.1 preparation of amplification System
Liquid component split charging is carried out between reagent split charging, PCR reaction liquid and PCR buffer solution are taken out, the mixture is placed at room temperature until the mixture is completely melted, vortex oscillation and uniform mixing are carried out, instantaneous centrifugation is carried out to the bottom of a tube, 200 mu L EP tubes with corresponding quantity are prepared in a clean workbench, and each tube is split charged with the PCR reaction liquid and the PCR buffer solution, and marking is carried out;
transferring the packaged reagent to a sample preparation area, taking out sample DNA from the temperature of minus 20 ℃, placing at room temperature until the sample DNA is completely melted, carrying out vortex vibration and mixing, carrying out instantaneous centrifugation to the bottom of a tube, taking out the sample DNA in a clean workbench, adding the sample DNA into a correspondingly marked centrifuge tube, carrying out vortex vibration and mixing, carrying out instantaneous centrifugation to the bottom of the tube for later use, wherein the total volume of each human PCR reaction is 80 mu L, and the composition of each human sample PCR reaction system is shown in Table 4.
TABLE 4 reaction System
| Sequence number | Reactant composition | Volume (mu L) |
| 1 | PCR reaction solution | 40 |
| 2 | PCR buffer | 20 |
| 3 | DNA template | 20 |
| 4 | Total volume (mu L) | 80 |
2.2 chip sample addition
In the sample preparation area, the chip is taken out in advance to be restored to room temperature, and the chip package is opened in a biosafety cabinet or a clean workbench and the sample adding operation is carried out.
When the sample is added, the chip is horizontally placed, the unfilled corner faces downwards left, 38 mu L of the prepared PCR amplification system is sucked by a liquid transfer device, liquid is vertically pumped into the chip from a sample hole on the right side of the chip, the sample addition is immediately stopped when the liquid reaches a sample outlet on the left side through a sample inlet channel, then the residual liquid in the sample inlet and outlet is wiped by dust-free paper, and finally the sample inlet and outlet is sealed by a sealing film (shown in figure 3).
2.3 centrifugal heat sealing of chips
And (3) opening a power supply of the centrifugal heat-sealing integrated machine, opening a centrifugal bin gate, putting the chip unfilled corner into a rotor towards the upper right, balancing, covering the centrifugal bin gate, and centrifuging by using a centrifugal key. And taking out the chip after the centrifugation is finished, observing whether the reaction tank is full of sample adding liquid, and if bubbles still exist, repeating the centrifugation until the bubbles disappear.
And inserting the unfilled corner of the chip into a heat-sealing tray towards the upper left for heat sealing, wherein at most 4 chips are heat-sealed at each time. When the chip is correctly inserted, the corresponding chip position on the display interface turns yellow, the bin gate is closed, and the heat sealing key is lightened when the temperature is stable, and the heat sealing key is clicked to heat seal. And taking out the chip after the interface displays that the heat sealing is finished and the tray is taken out of the bin.
2.4 chip amplification
The above chip was placed in a chip amplification apparatus with the chip film facing downward and the unfilled corner facing upward and left for amplification, and the amplification reaction was performed according to the thermal cycling procedure in Table 5.
TABLE 5 nucleic acid amplification reaction procedure
3. Chip scanning and result interpretation
In the amplification product analysis region, signal reading and result interpretation were performed using a microarray chip scanner Luxscan10K/D and HPA1 to 35 genotyping detection analysis system.
The computer, the scanner and the analysis software are sequentially turned on, the laser-on button of the software is clicked, and the preheating is carried out for 10min. Clicking the 'out-of-bin' button to stably place the unfilled corner of the chip into the chip bin towards the upper right, clicking the 'in-bin' button to send the chip into the scanner. And (3) inputting information such as sample numbers to be detected, chip numbers and the like in a sample information area of a detection interface, clicking on 'start scanning', automatically processing and analyzing fluorescent data by software after detection is completed, and displaying detection results of all detection indexes in a 'detection result' area.
4. Detection results and genotyping results
According to the HPA 1-35 genotyping detection analysis system, the genotypes of 300 samples are known by scanning, signal reading and result interpretation, and in addition, the 300 samples are subjected to gene sequencing detection, and after the chip result is compared with the sequencing result, the result coincidence rate is 100%.
The preferred embodiments of the invention disclosed above are intended only to assist in the explanation of the invention. The preferred embodiments are not exhaustive or to limit the invention to the precise form disclosed. Obviously, many modifications and variations are possible in light of the above teaching. The embodiments were chosen and described in order to best explain the principles of the invention and the practical application, to thereby enable others skilled in the art to best understand and utilize the invention. The invention is limited only by the claims and the full scope and equivalents thereof.
/>
/>
/>
/>
/>
/>
/>
/>
/>
/>
/>
/>
/>
/>
/>
/>
/>
/>
/>
/>
/>
/>
/>
/>
/>
/>
Claims (6)
1. The primer group for detecting HPA genotyping is characterized in that sequence numbers of the 35 groups of primers are shown in table 1:
TABLE 1 sequence Listing number corresponding to 35 primers of HPA genotyping
2. The primer set for detecting HPA genotyping according to claim 1, wherein each of the primers consists of two primers designed based on the difference in gene sequence and a common pair primer.
3. A primer set for detecting genotyping of HPA according to any one of claims 1 to 2, wherein said sequence listing is SEQ ID No.1, SEQ ID No.4, SEQ ID No.7, SEQ ID No.10, SEQ ID No.13, SEQ ID No.16, SEQ ID No.19, SEQ ID No.22, SEQ ID No.25, SEQ ID No.28, SEQ ID No.31, SEQ ID No.34, SEQ ID No.37, SEQ ID No.40, SEQ ID No.43, SEQ ID No.46, SEQ ID No.49, SEQ ID No.52, SEQ ID No.55, SEQ ID No.58, SEQ ID No.61, SEQ ID No.64, SEQ ID No.67, SEQ ID No.70, SEQ ID No.73, SEQ ID No.76, SEQ ID No.79, SEQ ID No.82, SEQ ID No.85, SEQ ID No.88, SEQ ID No.91, SEQ ID No.94, SEQ ID No.103, SEQ ID No.97, SEQ ID No.100, and a universal tag carrying sequence of No. GAAGGTGACCAAGTTCATGCT; the sequence listing numbers SEQ ID No.2, SEQ ID No.5, SEQ ID No.8, SEQ ID No.11, SEQ ID No.14, SEQ ID No.17, SEQ ID No.20, SEQ ID No.23, SEQ ID No.26, SEQ ID No.29, SEQ ID No.32, SEQ ID No.35, SEQ ID No.38, SEQ ID No.41, SEQ ID No.44, SEQ ID No.47, SEQ ID No.50, SEQ ID No.53, SEQ ID No.56, SEQ ID No.59, SEQ ID No.62, SEQ ID No.65, SEQ ID No.68, SEQ ID No.71, SEQ ID No.74, SEQ ID No.77, SEQ ID No.80, SEQ ID No.83, SEQ ID No.86, SEQ ID No.89, SEQ ID No.92, SEQ ID No.95, SEQ ID No.98, SEQ ID No.101, SEQ ID No.104 carry a universal tag sequence GAAGGTCGGAGTCAACGGATT.
4. A kit for detecting HPA genotyping, comprising at least 35 wells and 2 wells, wherein each well is coated with a set of primers of the primer set for detecting HPA genotyping of any one of claims 1-3.
5. A method for preparing a kit for detecting HPA genotyping according to claim 4, comprising the steps of:
(1) Selecting 35 site specific primer groups of HPA 1-35 genotyping to prepare Kong Weibiao, and respectively coating 35 groups of primers into a chip reaction hole according to Kong Weibiao to prepare a chip semi-finished product;
(2) Preparing PCR reaction liquid mainly comprising probes, enzymes, dNTPs and the like;
(3) Preparing a certain amount of sealing films, quality control products and PCR buffer solution;
(4) And assembling the semi-finished chip, the PCR reaction liquid, the sealing film, the quality control product and the PCR buffer liquid according to the detection times to form the kit for detecting HPA genotyping.
6. A reagent for detecting HPA genotyping, comprising the primer set according to claims 1 to 3 and/or the kit according to any one of claims 4 to 5.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202311160129.4A CN117778542A (en) | 2023-09-11 | 2023-09-11 | Primer group and kit for detecting HPA genotyping and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202311160129.4A CN117778542A (en) | 2023-09-11 | 2023-09-11 | Primer group and kit for detecting HPA genotyping and application |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN117778542A true CN117778542A (en) | 2024-03-29 |
Family
ID=90393188
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202311160129.4A Pending CN117778542A (en) | 2023-09-11 | 2023-09-11 | Primer group and kit for detecting HPA genotyping and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN117778542A (en) |
-
2023
- 2023-09-11 CN CN202311160129.4A patent/CN117778542A/en active Pending
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Hahn* et al. | Current applications of single-cell PCR | |
| CN1145704C (en) | Mesoscale polynucleotide amplification device | |
| CN107435069A (en) | A kind of quick determination method of cell line CRISPR/Cas9 gene knockouts | |
| Quirino et al. | Methods for blood group antigens detection: cost-effectiveness analysis of phenotyping and genotyping | |
| Latini et al. | A new strategy to identify rare blood donors: single polymerase chain reaction multiplex SNaPshot reaction for detection of 16 blood group alleles | |
| CN114134236B (en) | Application of reagent for detecting SNP molecular markers in goat RBP4 genotyping and/or goat molecular marker assisted breeding | |
| Hopp et al. | High‐throughput red blood cell antigen genotyping using a nanofluidic real‐time polymerase chain reaction platform | |
| Finning et al. | Evaluation of red blood cell and platelet antigen genotyping platforms (ID CORE XT/ID HPA XT) in routine clinical practice | |
| CN109486963A (en) | A kind of mankind KIR Genotyping detection primer group and application | |
| CN114507724A (en) | Primer group and kit for detecting human erythrocyte Rh blood group genotyping and application | |
| CN117587117A (en) | Primer group, kit and application for detecting Leber hereditary optic neuropathy | |
| McBean et al. | Blood group genotyping: the power and limitations of the Hemo ID Panel and MassARRAY platform | |
| CN110982895B (en) | Primer group and kit for detecting human erythrocyte ABO blood type genotyping and application | |
| US20090130666A1 (en) | Cytometric system including nucleic acid sequence amplification, and method | |
| US10889860B2 (en) | Compositions and methods for single G-level HLA typing | |
| CN111394434B (en) | CHO host cell DNA residue detection kit adopting TaqMan probe method and application thereof | |
| KR20170124728A (en) | Reagent for detecting cross contamination of PDX-model related with human and mouse, the kit comprising the same, and the method for the cross contamination detection | |
| CN117778542A (en) | Primer group and kit for detecting HPA genotyping and application | |
| CN111235261B (en) | Kit for detecting human platelet-specific antigen HPA 1-29 genotyping | |
| Bonet Bub et al. | ID CORE XT as a tool for molecular red blood cell typing | |
| CN101851673B (en) | Method for detecting tagged single-nucleotide polymorphic loci of six immunity-related genes of human | |
| CN112592965B (en) | E.coli host DNA residue detection kit adopting TaqMan probe method | |
| Reid et al. | Molecular approaches to blood group identification | |
| Hodges et al. | T-cell receptor molecular diagnosis of T-cell lymphoma | |
| CN103215356A (en) | Assay kit for detecting human leukocyte antigen-B (HLA-B)*57:01 and HLA complex P5 (HCP5) alleles |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |