CN117625553A

CN117625553A - Method for knocking out TIGIT gene of NK cell, TIGIT gene knocked-out NK cell and application

Info

Publication number: CN117625553A
Application number: CN202311651899.9A
Authority: CN
Inventors: 卢社莲; 唐立春; 李营营; 全壮
Original assignee: Beijing Dingcheng Taiyuan Biotechnology Co ltd
Current assignee: Beijing Dingcheng Taiyuan Biotechnology Co ltd
Priority date: 2023-12-05
Filing date: 2023-12-05
Publication date: 2024-03-01

Abstract

The invention relates to the field of gene editing, in particular to a method for efficiently knocking out a TIGIT gene of NK cells, the TIGIT knocked-out expressed NK cells obtained by the method, an immunotherapy product containing the NK cells, application of the NK cells in preparation of preparations for tumor treatment and the like. Compared with the NK cells without the TIGIT gene, the NK cells with the TIGIT knockout expression have stronger recognition and killing activity on tumor cells, so that the NK cells can be developed into safe and effective anti-tumor biological agents, and a novel biological agent is provided for adoptive immunotherapy of tumors and viral infectious diseases.

Description

Method for knocking out TIGIT gene of NK cell, TIGIT gene knocked-out NK cell and application

Technical Field

The invention belongs to the field of gene editing, and particularly relates to a method for knocking out a TIGIT gene of an NK cell, the TIGIT gene knocked out NK cell and application thereof, in particular to a method for efficiently knocking out the TIGIT gene of the NK cell, the TIGIT knocked out NK cell obtained by the method, an immune therapeutic product containing the NK cell, application in preparation of a preparation for tumor therapy and the like.

Background

Natural Killer (NK) cells are an important component of the human natural immune system, which are differentiated from hematopoietic stem cells, and which recognize and attack foreign pathogens and tumor cells in the body as the first line of defense, and are an important component of the natural immune system. Meanwhile, NK cells and B cells and T cells of an acquired immune system are members of lymphocyte families, and IFN gamma released after the NK cells and the T cells are activated can induce the expression of MHC molecules on the cell surface and amplify antigen presenting action, so that the NK cells can serve as a bridge to connect two major systems of innate immunity and acquired immunity.

NK cell surface does not express specific antigen recognition receptor, is not limited by MHC molecules, and can directly kill tumor cells without pre-sensitization in a variety of ways including: 1. releasing perforin and granzyme to cause tumor cell lysis; 2. releasing TNF to act on TNF receptor on the surface of tumor cells, causing apoptosis; NK cell surface ligands (FasL or TRAIL) bind to tumor cell surface receptors (Fas or TRAILR) and induce apoptosis; fc receptors on nk cell surfaces (CD 16, fcRIII gamma) bind antibodies and exert antibody-dependent cellular cytotoxicity (ADCC).

Natural Killer (NK) cells can therefore play an important role in the defense against diseases including the first line of malignancy. In contrast to cells of the acquired immune system (e.g., T cells), NK cells initiate cytotoxic activity without prior stimulation or sensitization, thereby providing an immediate natural response. NK cells have the advantage of killing tumors by both direct lysis and secretion of cytokines, which kill tumors through both perforin and FAS ligands. NK cells can produce TNF-, IFN-and IL-1, and these cytokines play a very important role in NK cell anti-cancer responses and in mobilizing T lymphocytes. Since NK cells have a rapid killing effect and a wide range of target cells, it is suggested that NK cells can be used for treating malignant tumors. Studies have demonstrated that adoptive transfer of activated, expanded autologous or allogeneic NK cells in vitro is effective in the treatment of a variety of leukemias and solid tumors.

NK cells can be identified by the deletion of cell surface TCRs and related CD3 molecules, as well as expression of CD 56. NK cells circulate mainly in blood, accounting for about 5 to 10% of Peripheral Blood Mononuclear Cells (PBMC), and are also present in lymphoid tissues such as bone marrow and spleen.

In tumor treatment, NK cells with a tumor killing function are prepared in vitro, and then the NK cells are returned to a patient, so that the tumor cells are killed in the patient, and the treatment effect is achieved. Therefore, the NK cells with sufficient quantity, strong killing property and stable quality are obtained, and are key to realizing clinical application of NK cell tumor treatment. However, since NK cells derived from peripheral blood are difficult to be amplified in large amounts in vitro and there is a technical difficulty in separating and purifying NK cells from peripheral blood, for example, it is difficult to avoid contamination from T lymphocytes, a large number of uniform NK cells cannot be obtained and the clinically required standard is reached, and thus this is also an obstacle that NK cells cannot be widely used in clinic; in addition, in some cases of tumor patients, NK cell mediated antitumor response is weak, which may be related to factors such as poor NK cell killing ability, poor in vivo viability or limited migration to tumor sites.

TIGIT (T cell immunoreceptor with immunoglobulin and ITIM domains) is one of NK cell inhibition targets, and researches show that if the NK cell TIGIT target is blocked, the NK cell can be prevented from being exhausted, and the anti-tumor activity of the NK cell is enhanced. In the aspect of NK cells, research also shows that depletion type NK cells can greatly express TIGIT instead of PD-1, whether TIGIT genes are knocked out in mice or TIGIT/PVR signal channels are blocked by antibodies, the anti-tumor activity of NK cells can be enhanced, and the survival time of tumor-bearing mice can be prolonged. Although anti-TIGIT antibodies exhibit desirable therapeutic effects in animal level studies, there are few clinical trials involving TIGIT antibodies. In a recent randomized, double-blind clinical trial, in which patients with PD-L1 positive non-small cell lung cancer were first-line treated with anti-TIGIT antibodies in combination with atilizumab, the Objective Remission Rate (ORR) of anti-TIGIT antibodies in combination with atilizumab was found to be only 37%, which was only 16% improvement over placebo + ati Li Zhushan antibody group, it was found that the clinical efficacy of current anti-TIGIT antibodies was still very limited, which may be related to the difficulty of the antibodies reaching tumor sites or insufficient antibodies reaching tumor sites to completely block TIGIT/PVR signaling pathways, thus this limitation largely restricted the development and application of immune checkpoint blocking therapies for TIGIT as a target.

The gene editing technology is an important technical means for researching functional genome, and four-generation gene editing technology including meganuclease, zinc finger nuclease, transcription activator-like effector nuclease, CRISPR and the like has been developed at present, wherein the CRISPR system is widely applied due to high efficiency and low cost. CRISPR/Cas12a is a novel nuclease system derived from prokaryotes, which consists of two elements, namely guide sequence sgRNA and nuclease Cas12a, and gene knockout has been successfully achieved in a plurality of cells derived from a plurality of species by using the CRISPR/Cas12a system so far, but no related report on TIGIT gene knockout in NK cells has been seen.

Therefore, searching NK cells with strong activity and establishing a culture system for in vitro large-scale allogeneic use is a problem that the NK cell adoptive immunotherapy tumor can be applied to clinic and needs to be solved. The establishment of the large-scale continuous culture and preparation process of NK cells, which is easy to operate, controllable in quality, high in yield, high in product activity and low in cost, can solve the bottleneck problem faced by the cellular immunotherapy technology, and can lead the cellular therapy products to be produced in a batched, large-scale, uniform and flow way like medicines.

Disclosure of Invention

In view of the problems existing in the prior art, the invention aims to provide a method for efficiently knocking out the TIGIT gene of NK cells and the TIGIT knocked-out NK cells obtained by the method, so as to improve the recognition and killing activity of NK cells on tumor cells, enable the NK cells to develop into safe and effective anti-tumor biological preparations, and provide new biological preparations for adoptive immunotherapy of tumors and viral infectious diseases.

The invention provides a method for knocking out TIGIT genes of NK cells, which comprises a method for therapeutic purposes and non-therapeutic purposes, wherein a CRISPR/Cas12a gene editing system is utilized to introduce a complex of sgRNA and Cas12a protein into amplified and cultured NK cells in an electroporation transfection mode, and the sequence of the sgRNA is at least one selected from the group consisting of sequences shown as SEQ ID No.1, SEQ ID No.2 or SEQ ID No.3.

The present invention provides NK cells in which TIGIT gene is knocked out and/or expression thereof is inhibited.

In some embodiments, expression of the TIGIT gene is knocked out by CRISPR/Cas12a technology.

In some embodiments, the NK cell is one in which the target site is TIGIT gene after knockdown with an RNP complex comprising Cas12a protein and an sgRNA whose sequence is at least one selected from the group consisting of the sequences set forth in SEQ ID No.1, SEQ ID No.2, and SEQ ID No.3.

In some embodiments, the RNP complex has a molar ratio of sgRNA to Cas12a protein of about 1 (1-3).

The invention also provides a gene editing method of the NK cell, which is to knock out a target site of the NK cell by using a CRISPR/Cas12a system, wherein the target site is a TIGIT gene, and the gene editing method comprises a treatment purpose and a non-treatment purpose.

In some embodiments, the CRISPR/Cas12a system comprises an RNP complex comprising a Cas12a protein and an sgRNA.

In some embodiments, the molar ratio of Cas12a protein to sgRNA in the RNP complex is 1 (1-3).

In some embodiments, the sequence of the sgRNA is selected from at least one of the group consisting of the sequences set forth in SEQ ID No.1, SEQ ID No.2, and SEQ ID No.3.

The invention also provides a preparation method of NK cells, which is characterized by comprising the following steps: obtaining an RNP complex; transfecting the RNP complex into NK cells by electroporation; sorting to obtain target cells; the preparation method comprises the situations of therapeutic purpose and non-therapeutic purpose.

In some embodiments, the RNP complex comprises a Cas12a protein and an sgRNA whose sequence is at least one selected from the group consisting of the sequences set forth in SEQ ID No.1, SEQ ID No.2, and SEQ ID No.3.

The present invention also provides an immunotherapeutic product comprising NK cells, comprising NK cells in which the TIGIT gene of the present invention is knocked out or the expression of which is suppressed.

The invention also provides the use of the NK cells of the invention or the immunotherapeutic products of the invention for the preparation of a formulation for the treatment of tumors.

The invention also provides a method of inhibiting tumor cell proliferation comprising contacting a tumor cell with one or more NK cells of the invention, an immunotherapeutic product of the invention and/or a biologic of the invention for tumor treatment.

The invention also provides the use of said NK cells and/or said immunotherapeutic product in the manufacture of a kit for inhibiting tumor cell proliferation, said kit comprising an NK cell as described in any of the preceding embodiments, an immunotherapeutic product as described in any of the preceding embodiments and/or a biologic as described in any of the preceding embodiments for tumor therapy.

ADVANTAGEOUS EFFECTS OF INVENTION

The NK cell TIGIT gene knockout method and the NK cell gene editing method provided by the invention have high-efficiency knockout efficiency, and the obtained NK cell with the TIGIT gene knockout has improved recognition and killing activity for tumor cells, so that a high-efficiency TIGIT gene knockout target is provided in the NK cell TIGIT gene knockout method provided by the invention.

Drawings

Fig. 1: TIGIT gene and knockout site schematic;

fig. 2: gene knockout efficiency of CrRNA1 site;

fig. 3: gene knockout efficiency of CrRNA2 site;

fig. 4: gene knockout efficiency of CrRNA3 site;

fig. 5: NK cell and NKTIGIT by flow cytometry ^-/- Results graph of TIGIT validation in cells;

fig. 6: NK cells and NK cells after TIGIT knockout (NKTIGIT) ^-/- ) Killing efficiency comparison against tumor target cells H358.

Detailed Description

Definition of the definition

Unless stated to the contrary, the terms used in the present invention have the following meanings.

In the claims and/or the specification of the present invention, the words "a" or "an" or "the" may mean "one" but may also mean "one or more", "at least one", and "one or more".

As used in the claims and specification, the words "comprise," "have," "include" or "contain" mean including or open-ended, and do not exclude additional, unrecited elements or method steps.

Throughout this application, the term "about" means: one value includes the standard deviation of the error of the device or method used to determine the value. The numerical ranges and parameters set forth herein are approximations that may vary depending upon the particular application. Any numerical value, however, inherently contains certain standard deviations found in their respective testing methods or apparatus. Accordingly, unless expressly stated otherwise, it is to be understood that all ranges, amounts, values and percentages used herein are modified by "about". As used herein, "about" generally means that the actual value is within plus or minus 10%, 5%, 1% or 0.5% of a particular value or range.

The term "natural killing" as used in the context of the present inventionInjury (NK) cells "are in the form of CD3 ^- /CD56 ⁺ The lymphocyte subgroup which is the main immunophenotype characteristic, does not express T cell receptor and B cell receptor, is an important component in natural immunocytes of human body, belongs to lymphocyte family members, is differentiated from hematopoietic stem cells, and is used as a first defense line of the organism to identify and attack external pathogens and tumor cells in the body.

The term "SNK cell (stimulated natural killer cells)" refers to natural killer cells which are induced to expand, are in an activated state and have a strong killing function on various tumor target cells through in vitro culture.

The term "CRISPR" is an important technology in gene editing technology because its targeting mechanism is by binding of specific RNA sequences to the site of the genome where editing is required by complementary actions and is therefore highly specific. CRISPR enables simultaneous multi-gene editing by using RNA clusters. Double strand breaks (double strand break, DSB) in cells can be repaired by non-homologous end joining (non-homologous end joining, NHEJ) with less frequent occurrence and eventually with nucleic acid insertion or deletion of small fragments where the gene is sheared, resulting in frameshifting of the gene and thus loss of function of the gene of interest.

In some embodiments, the invention provides an NK cell wherein the NK cells have been gene knocked out such that they lack or exhibit reduced expression of the NK inhibitory molecule. In some alternatives, the NK cells are gene knocked out such that they modulate or inhibit the expression of the NK inhibitory molecule. For example, in some alternatives, modified NK cells provided herein include cells comprising NK cells that have been gene knocked out to express one or more NK inhibitory molecules at lower levels than NK cells that have not been modified relative to the level of expression of the NK inhibitory molecules (such cells are referred to herein as "unmodified cells", even though these cells may have been modified relative to naturally occurring cells in aspects other than NK inhibitory molecule expression). The unmodified cell against which the level of NK inhibitory molecules is compared may be, for example, a naturally occurring NK cell or an NK cell obtained using a method as described herein instead of a naturally occurring NK cell. In some embodiments, the NK inhibitory molecule expressed at a modulated, reduced, or zero level is TIGIT.

In some embodiments, TIGIT expression in NK cells has been knocked out. In some embodiments, TIGIT expression in NK cells is knocked out by gene editing techniques, such as by using CRISPR or CRISPR-associated techniques. In some embodiments, the knockout of TIGIT expression in NK cells results in higher anti-tumor activity as compared to NK cells in which TIGIT is not knocked out (which may be naturally occurring NK cells or non-naturally occurring NK cells that have been gene knocked out to reduce or eliminate TIGIT expression). In specific embodiments, the tumor cells are solid tumor cells and/or non-solid tumor cells. In particular alternatives, the tumor cell is selected from one or more of a non-small cell lung cancer cell, a lung adenocarcinoma cell, a squamous cell carcinoma cell, a liver cancer cell, a Multiple Myeloma (MM) cell, an Acute Myelogenous Leukemia (AML) cell, a breast cancer cell, a pancreatic cancer cell, an ovarian cancer cell, a gastric cancer cell, a brain glioma cell, a head and neck cancer cell, a sarcoma cell, a ductal cancer cell, a leukemia cell, an acute T-cell leukemia cell, a chronic myelogenous lymphoma cell, a Chronic Myelogenous Leukemia (CML) cell, a colon adenocarcinoma cell, a histiocytic lymphoma cell, a colorectal cancer cell, a colorectal adenocarcinoma cell, and a retinoblastoma cell. In a particular alternative, the tumor cells are, for example, H358 cells. In a particular alternative, the tumor cell is a U266 cell. In a particular alternative, the tumor cells are ARH77 cells. In a particular alternative, the tumor cell is an Acute Myelogenous Leukemia (AML) cell. In a particular alternative, the tumor cell is an HL60 cell. In a specific alternative, the tumor cells are KG1 cells.

The present invention describes methods of knocking out TIGIT genes from NK cells. In some embodiments, the method of knocking out TIGIT genes of NK cells employs a CRISPR/Cas12a gene editing system. In some embodiments, the method of knocking out TIGIT gene of NK cells is to introduce a complex of sgRNA and Cas12a protein into amplified cultured NK cells by electroporation transfection. In the context of the present invention, the complex of sgRNA and Cas12a protein is also referred to as RNP complex.

The term "RNP complex (ribonucleoprotein complex)" means ribonucleoprotein, which is a nucleoprotein comprising RNA, is a complex capable of binding nucleic acids and proteins together. Ribonucleoproteins include ribosomes, telomerase, and micronuclear RNPs (snrnps). In the present invention, the RNP complex is a complex comprising Cas12a protein and sgRNA.

In some embodiments, the sequence of the sgrnas of the present invention is selected from at least one of the group consisting of the sequences set forth in SEQ ID No.1, SEQ ID No.2, and SEQ ID No.3. In a specific alternative, the sgRNA has a sequence selected from the group consisting of SEQ ID No.1, SEQ ID No.2, and SEQ ID No.3. In other specific alternatives, the sequence of the sgRNA is selected from any two of the group consisting of SEQ ID No.1, SEQ ID No.2, and SEQ ID No.3. In some specific alternatives, the sequence of the sgrnas is SEQ ID No.1 and SEQ ID No.2. In some specific alternatives, the sequence of the sgrnas is SEQ ID No.1 and SEQ ID No.3. In some specific alternatives, the sequence of the sgrnas is SEQ ID No.2 and SEQ ID No.3.

In some embodiments, the molar ratio of the sgRNA to the Cas12a protein in the RNP complex is about 1 (1-3). In particular alternatives, the molar ratio of the sgRNA to the Cas12a protein in the RNP complex is any ratio from about 1:1 to about 1:3, any ratio in this interval falling within the scope of the invention. For example, in some specific alternatives, the molar ratio of the sgRNA to the Cas12a protein in the RNP complex is about 1:1.1, about 1:1.2, about 1:1.3, about 1:1.4, about 1:1.5, about 1:1.6, about 1:1.7, about 1:1.8, about 1:1.9, about 1:2, about 1:2.1, about 1:2.2, about 1:2.3, about 1:2.4, about 1:2.5, about 1:2.6, about 1:2.7, about 1:2.8, about 1:2.9, about 1:3. In some specific alternatives, the molar ratio of the sgRNA to the Cas12a protein in the RNP complex is about 1:1, about 1:2, or about 1:3.

In the context of the present invention, "method of knocking out TIGIT gene of NK cells" has the same meaning as "gene editing method of NK cells". The description of "method of knocking out TIGIT gene of NK cells" also applies to "gene editing method of NK cells".

The invention also provides a preparation method of NK cells, comprising the steps of obtaining an RNP complex; transfecting the RNP complex into NK cells by electroporation; sorting to obtain target cells; the preparation method comprises the situations of therapeutic purpose and non-therapeutic purpose.

In the context of the present invention, the term "target cell" means an NK cell whose gene expression is suppressed by gene knockout. In some embodiments, the knockout NK cell refers to an NK cell that knocks out TIGIT gene or an NK cell in which expression of TIGIT gene is inhibited. In a particular alternative, the knockout NK cell refers to an NK cell that knocks out the TIGIT gene using the CRISPR/Cas12a system. In other specific alternatives, the knockout NK cells are those that employ the CRISPR/Cas12a system such that expression of TIGIT genes is inhibited. Thus, in some embodiments, "target cell" refers to an NK cell from which TIGIT gene was knocked out or an NK cell from which expression of TIGIT gene was inhibited as described above. In some embodiments, NK cells that use the CRISPR/Cas12a system to knock out the TIGIT gene or NK cells that use the CRISPR/Cas12a system such that expression of the TIGIT gene is inhibited.

In the context of the present invention, "gene expression is knocked out" has a biologically similar meaning to "gene knocked out", "gene expression is inhibited". In some embodiments, "expression of a gene is knocked out" includes various situations where "gene knockdown" and/or "gene expression is inhibited". In particular embodiments, the knockdown of TIGIT gene expression includes TIGIT gene knockdown and/or various situations in which TIGIT gene expression is inhibited. In particular alternatives, TIGIT gene knockout and/or inhibition of its expression is achieved by a CRISPR/Cas12a gene editing system.

The present invention also provides an immunotherapeutic product comprising NK cells comprising the TIGIT gene knockout or the NK cells whose expression is suppressed as described in the present invention. In some embodiments, the present invention provides NK cell-containing immunotherapeutic products obtained by the CRISPR/Cas12a technique such that the expression of TIGIT gene of NK cells is knocked out.

The invention also provides the application of the NK cells with the knocked-out TIGIT gene expression and/or the immunotherapeutic products containing the NK cells in preparing biological agents for tumor therapy.

The invention also provides a method of inhibiting tumor cell proliferation comprising contacting a tumor cell with one or more knockout NK cells prepared as described herein, an immunotherapeutic product comprising said NK cells, and/or a biologic for tumor treatment. In some embodiments, the contacting is performed in vitro. In some embodiments, the contacting is performed in vivo. In some embodiments, the contacting is performed in a human individual. In some embodiments, the human individual is selected or identified as an individual in need of cancer treatment. In some embodiments, the method comprises administering the NK cells to the selected or identified individual. In some embodiments, the tumor cell is a multiple myeloma cell. In some embodiments, the tumor cell is a solid tumor cell and/or a non-solid tumor cell. In particular alternatives, the tumor cell is selected from one or more of a non-small cell lung cancer cell, a lung adenocarcinoma cell, a squamous cell carcinoma cell, a liver cancer cell, a Multiple Myeloma (MM) cell, an Acute Myelogenous Leukemia (AML) cell, a breast cancer cell, a head and neck cancer cell, a sarcoma cell, a ductal carcinoma cell, a leukemia cell, an acute T-cell leukemia cell, a chronic myelogenous lymphoma cell, a Chronic Myelogenous Leukemia (CML) cell, a colon adenocarcinoma cell, a tissue cell lymphoma cell, a colorectal cancer cell, a colorectal adenocarcinoma cell, a pancreatic tumor cell, a renal tumor cell, and a retinoblastoma cell.

Examples

Other objects, features and advantages of the present invention will become apparent from the following detailed description. It should be understood, however, that the detailed description and the specific examples, while indicating specific embodiments of the invention, are given by way of illustration only, since various changes and modifications within the spirit and scope of the invention will become apparent to those skilled in the art from this detailed description.

The experimental techniques and experimental methods used in this example are conventional techniques unless otherwise specified, or according to conditions, operating methods, etc. suggested by the manufacturer. Materials, reagents and the like used in the examples are all available from a regular commercial source unless otherwise specified.

Example 1: TIGIT gene knockout target screening and synthesis

The human TIGIT (T cell immumoreceptor with IG and ITAM domains) gene is located on chromosome 3 (PUBMED ID: 201633), the TIGIT gene comprises 4 exons, in this example, 3 sites are selected on exon 2, crRNA1, crRNA2 and CrRNA3 in FIG. 1, respectively, and the corresponding gene sequences are SEQ ID No.1, SEQ ID No.2 and SEQ ID No.3, respectively.

SEQ ID No.1：TAATTTCTACTCTTGTAGATTATTGTGCCTGTCATCATTCC

SEQ ID No.2：TAATTTCTACTCTTGTAGATTGCAGAGAAAGGTGGCTCTAT

SEQ ID No.3：TAATTTCTACTCTTGTAGATTAGGACCTCCAGGAAGATTCT

The sgrnas were obtained by synthesis at each of the 3 sites.

Example 2: preparation of RNP Complex

The above 3-site sgrnas obtained in example 1 were respectively co-incubated with CRISPR Cas12a protein to obtain the corresponding RNP complexes.

The gene knockout efficiencies of the three sites of CrRNA1, crRNA2, crRNA3 were 75%,90% and 48.4%, respectively (fig. 2, fig. 3 and fig. 4). Wherein the second site has the highest gene knockout efficiency in NK cells, so the second site is selected as the optimal knockout site of NK cells.

Example 3: electrotransformation process

3.1 electric transfer preparation work

Cletrix 20. Mu.L of electric shock tube, opti-MEM I (51985091, gibco) electrotransport buffer equilibrated to room temperature;

placing the complete culture medium in a 12-hole plate, placing in a 37 ℃ cell incubator for more than 30min, and waiting for temperature balance;

TIGIT crRNA (10 nmol, SEQ ID No.4: TAATTTCTACTCTTGTAGATTGCAGAGAAAGGTGGCTCTAT (IDT chemical synthesis) was dissolved in 100. Mu.L of IDTE buffer (pH 7.5,11-01-02, IDT) to prepare a 100. Mu.M stock solution, which was stored at-20℃and dissolved on ice for use.

3.2 RNP incubation

1) 1.5mL EP tube (plastic centrifuge tube) without ribozyme was taken and the mixture shown in Table 1 was prepared at room temperature:

TABLE 1

2) Incubate for 15min at room temperature while preparing NK cells.

3.3NK cell preparation and electric shock

1) Cell count, 1X 10 ⁶ Cells were pooled into 1.5mL EP tubes (plastic centrifuge tubes);

2) Centrifuging at 400 Xg for 5min, and collecting NK cell precipitate;

3) Cell pellet was resuspended using 1mL PBS;

4) Centrifuging at 400 Xg for 5min, and collecting NK cell precipitate;

5) Carefully discard the supernatant, after transient centrifugation using a centrifuge, carefully pipette the supernatant as much as possible without disrupting cell pellet;

6) 15. Mu.L of Opti-MEM I was pipetted using a 20. Mu.L pipette and the resuspended cell pellet was gently blown;

7) Adding the RNP complex obtained in example 2 into the cell pellet, and gently blowing and sucking to mix uniformly;

8) Carefully transfer the above mixture to a 20 μl electric shock tube to avoid air bubbles;

9) Setting the electric shock program to 470V,20ms for electric shock;

10 After the electric shock is finished, standing for 1min at room temperature, and gently sucking the whole cell mixture to be transferred into the balanced complete culture medium in the step 2.1;

11 Placing into a cell culture box at 37 ℃ for culturing for 48 hours.

Example 4: gene knockout efficiency detection

4.1 genomic DNA extraction

The procedure was as described for the DNA extraction kit DP304-03 from Tiangen.

1) After culturing the cells obtained in example 3 for 48 hours, cell counting was performed to obtain 5X 10 cells ⁵ Cells were pooled into 1.5mL EP tubes while cells without electrotransfer RNP were harvested as controls;

2) Centrifuging at 3000rpm for 5min, and collecting cell precipitate;

3) Cell pellet was resuspended using 200 μl GA buffer;

4) Adding 20 mu L of proteinase K, blowing and sucking, and mixing;

5) Adding 200 mu L of GB buffer solution, and uniformly mixing by vortex oscillation;

6) Incubating at 70 ℃ for 10min, and uniformly mixing for 1 time by vortex vibration in the middle;

7) 200 mu L of absolute ethyl alcohol is added, and vortex oscillation is carried out for 15s;

8) Transferring the mixture obtained in the step 7) to an adsorption column CB3, centrifuging at 12000rpm for 30s, discarding the waste liquid, and placing the adsorption column CB3 back into a collecting pipe;

9) Adding 500 mu L GD buffer solution (absolute ethyl alcohol is added in advance) into the adsorption column CB3, centrifuging at 12000rpm for 30s, discarding the waste liquid, and placing the adsorption column CB3 into a collecting pipe;

10 600. Mu.L PW rinse solution (absolute ethanol has been added in advance) is added into the adsorption column, the solution is centrifuged at 12000rpm for 30s, the waste liquid is discarded, and the adsorption column CB3 is put back into the collection tube;

11 Repeating the washing once;

12 Placing the adsorption column into a collecting pipe, centrifuging at 12000rpm for 2min, and discarding the waste liquid. Placing the adsorption column CB3 at room temperature to thoroughly dry the residual rinse liquid in the adsorption material;

13 Transferring the adsorption column CB3 into a clean 1.5mL EP pipe, suspending and dripping 100 mu L TE eluent into the middle position of the adsorption film, standing for 3min at room temperature, centrifuging at 12000rpm for 2min, and discarding the adsorption column;

14 The extracted genome DNA is preserved at-20 deg.c for further use.

4.2 target Gene amplification

1) PCR amplification primers were synthesized by Biotechnology (Shanghai) Co., ltd:

forward primer: ATGGAGAGGAGCGTCTCTTG (SEQ ID No. 5)

Reverse primer: CATATGACCTCATCAACTGGTCT (SEQ ID No. 6)

2) PCR amplification (according to the instructions of Toyobo KOD FX Neo kit, code No. KFX-201), PCR reaction system and reaction procedure are shown in Table 2 and Table 3, respectively.

TABLE 2 PCR reaction System

TABLE 3 PCR reaction procedure

4.3 TIGIT gene knockout efficiency detection

1) The PCR product was sent to the biological engineering (Shanghai) Co., ltd, and Sanger sequencing was performed with forward primers;

2) Gene knockout efficiency was analyzed using the online software http:// shinyapps.

4.4 cell phenotype assay

Detection of NK cells and NKTIGIT using flow cytometry ^-/- Expression of TIGIT in cells, NK phenotypes were analyzed. The method comprises the following specific steps:

a) NK cells and NKTIGIT are taken ^-/- The cells were centrifuged at 1000rpm for 5min and the supernatant was discarded, washed once with 10mL PBS and the wash was discarded.

b) NK cells and NK TIGIT ^-/- Cells were resuspended in 6mL of PBS, each of which was dispensed into 5 flow tubes, 1mL of each tube was centrifuged at 1000rpm for 5min, and the supernatant was discarded, and then each tube of cells was resuspended in 50. Mu.L of PBS.

c) Adding antibody for incubation: each group of cells was incubated for 30min at room temperature in 2 tubes, which were control group with isotype control antibody and single-stained tube with 5. Mu.L TIGIT flow antibody.

d) After antibody incubation, each tube was washed with 2mL of PBS, 1000rpm,5min centrifuged to discard the supernatant, and then resuspended in 1mL of PBS, respectively, and detected using a flow cytometer.

As can be seen from fig. 5, the TIGIT expression rate in the NK cell surface is 79.6%, and after TIGIT (CrRNA 2 site) in the NK cell genome is knocked out by CRISPR Cas12a, TIGT expression on the NK cell surface is detected, and the flow detection result shows that the expression level is significantly reduced.

4.5 cell killing assay

NK cells and NK ^TIGIT-/- The cell is used for respectively detecting the killing efficiency of lung cancer cells NCI-H358, and the specific operation steps are as follows:

a) Taking different target cells, gently scraping the cells with a cell scraper, washing with 10mL of PBS, collecting in a centrifuge tube, centrifuging at 1000rpm for 5min, discarding supernatant, re-suspending with 10mL of RPMI-1640+2% FBS, sampling, counting, and adjusting the cell density to 8×10 according to the cell number ⁴ cells/ml；

b) Inoculating target cells: inoculating the target cells with the adjusted density into 96-well cell culture plates by a row gun respectively, wherein each well contains 50 mu L of RPMI-1640+2% FBS, and simultaneously, a control group without target cells is arranged;

c) Taking cultured NK cells and NK ^TIGIT-/- Cells were resuspended in 30mL PBS, sampled and counted, washed by centrifugation, and the supernatant was discarded, and the cell density was adjusted to 3.2X10 according to the result of the counting by using RPMI-1640+2% FBS ⁶ cells/mL, then serially diluted in a gradient of 1.6X10 ⁶ cells/mL、0.8×10 ⁶ cells/mL、0.4×10 ⁶ cells/mL、0.2×10 ⁶ cells/mL、0.1×10 ⁶ Six densities of cells/mL;

d) Inoculation of NK and NK ^TIGIT-/- And (3) cells: sequentially adding diluted SNKs with different densities into corresponding 96-well plates containing target cells, wherein the SNKs are 50 mu L/well, so that the effective target ratios are respectively 20:1, 10:1, 5:1, 2.5:1 and 1.25:1, and simultaneously setting a target cell high concentration group and a target cell low concentration group (respectively abbreviated as a T high group and a T low group), and respectively adding 50 mu LRPMI-1640+2% FBS;

e) After cell inoculation is finished, the cell is placed at 37 ℃ and CO ₂ Co-culturing in an incubator for 4 hours;

f) After 4h of cell CO-culture, 10 mu L of cell lysate is added into each hole of the Tgao group, and the mixture is placed at 37 ℃ and CO ₂ The incubator is fully cracked for 1h;

g) After cell lysis, the cells were removed, 100 μ L Working Solution was added to each well, and protected from light at room temperature for 30min;

h) After 50. Mu.L Stop Solution was added to each well, the absorbance at 490nm was measured immediately with a microplate reader, and the cell killing efficiency was calculated according to the formula.

NK cells and NK cells after TIGIT knockout (NK) ^TIGIT-/- ) The killing efficiency against tumor target cells H358 was significantly different (fig. 6). The effective target ratio is 1.25:1, NK ^TIGIT-/- The killing efficiency of the cells to the tumor target cells H358 is 39.67 percent, which is obviously higher than that of NK cells (20.49 percent); the effective target ratio is 2.5:1, NK cells and NK ^TIGIT-/- The killing efficiency of the cells against H358 was 34.54% and 58.26%, respectively. It can be seen that NK cell killing against tumor cells was enhanced after NK cell knockout TIGIT expression.

According to the embodiment, the sgRNA can realize high-efficiency knockout of the TIGIT gene in the NK cell, wherein the knockout efficiency of the sgRNA shown in SEQ ID NO.2 on the TIGIT gene of the NK cell can reach more than 90%; and the killing capacity of the chimeric antigen receptor NK cells obtained by adopting the NK cell TIGIT gene knockout method of the invention to tumor cells is obviously improved.

The above examples of the present invention are only examples for clearly illustrating the present invention, and are not limiting of the embodiments of the present invention. Other variations or modifications of the above teachings will be apparent to those of ordinary skill in the art. It is not necessary here nor is it exhaustive of all embodiments. Any modification, equivalent replacement, improvement, etc. which come within the spirit and principles of the invention are desired to be protected by the following claims.

Claims

1. An NK cell, wherein the NK cell is an NK cell in which TIGIT gene has been knocked out and/or whose expression has been inhibited.

2. The NK cell of claim 1, wherein expression of the TIGIT gene is knocked out by CRISPR/Cas12a technology.

3. The NK cell according to claim 1 or 2, wherein the NK cell is an NK cell in which the expression of the target site, which is TIGIT gene, has been knocked out with an RNP complex comprising Cas12a protein and an sgRNA having a sequence selected from at least one of the sequences shown by SEQ ID No.1, SEQ ID No.2 or SEQ ID No.3.

4. The NK cell gene editing method according to claim 1 or 2, wherein the target site of NK cells, which is TIGIT gene, is knocked out with CRISPR/Cas12a system, which is a non-therapeutic purpose.

5. The method of claim 4, wherein the CRISPR/Cas12a system comprises an RNP complex comprising a Cas12a protein and an sgRNA.

6. The method according to claim 5, wherein the sgRNA has a sequence selected from at least one of the group consisting of the sequences shown in SEQ ID No.1, SEQ ID No.2 and SEQ ID No.3.

7. A method of preparing the NK cell of claim 1 or 2, comprising: obtaining an RNP complex; transfecting the RNP complex into NK cells by electroporation; sorting to obtain target cells.

8. The method of claim 7, wherein the RNP complex comprises Cas12a protein and sgRNA, the sequence of which is at least one selected from the group consisting of the sequences set forth in SEQ ID No.1, SEQ ID No.2, and SEQ ID No.3.

9. An immunotherapeutic product comprising NK cells, characterized in that it comprises NK cells as claimed in claim 1 or 2.

10. Use of an immunotherapeutic product according to claim 9 in the manufacture of a kit for inhibiting tumour cell proliferation, the kit comprising an immunotherapeutic product according to claim 9.