CN117070432A

CN117070432A - Recombinant lactobacillus for fusion expression of swine dendritic cell targeting peptide and PEDV neutralizing epitope and application thereof

Info

Publication number: CN117070432A
Application number: CN202310884511.3A
Authority: CN
Inventors: 王丽; 王晓娜; 姜艳萍; 李一经; 夏天
Original assignee: Northeast Agricultural University
Current assignee: Northeast Agricultural University
Priority date: 2023-07-18
Filing date: 2023-07-18
Publication date: 2023-11-17

Abstract

The invention discloses recombinant lactobacillus for fusion expression of pig-derived dendritic cell targeting peptide and PEDV neutralizing epitope and application thereof. The recombinant lactobacillus contains plasmid for fusion expression of porcine dendritic cell targeting peptide KC1 and Porcine Epidemic Diarrhea Virus (PEDV) neutralizing epitope COE, wherein the amino acid sequence of the porcine dendritic cell targeting peptide KC1 is shown as SEQ ID NO. 1. The invention starts from the characteristic that the specific targeting dendritic cells of the immunogenic antigen by the probiotics lactobacillus can induce strong immune response of the antigen, and develops a recombinant lactobacillus vaccine for fusion expression of antigen epitope COE neutralized by porcine dendritic cell targeting peptide KC1 and PEDV. The invention provides important material basis and technical means for research of the targeting vaccine, and has important significance for development and development of novel targeting vaccine of pigs.

Description

Recombinant lactobacillus for fusion expression of swine dendritic cell targeting peptide and PEDV neutralizing epitope and application thereof

Technical Field

The invention relates to a recombinant lactobacillus and application thereof, in particular to a recombinant lactobacillus for fusion expression of pig-derived dendritic cell targeting peptide and PEDV neutralizing epitope and application thereof in preparation of vaccines. The invention belongs to the field of biotechnology.

Background

Most infections occur after the antigen crosses numerous protective mucosal barriers of the body, for example diarrhea is the passage of pathogens across the gastrointestinal mucosa causing the infection. The mucosal barrier, which is immunologically significant, will be an effective strategy for preventing contact infections between microorganisms and hosts. Mucosal surface vaccination can successfully induce mucosal antibodies (IgA) and cell-mediated immune responses, while producing systemic antibody responses (IgG).

The current effective strategy of mucosal immunity vaccines is to target the specificity of an immunogenic antigen to antigen presenting cells by probiotics so as to induce strong immune response of the antigen, so that the antigen presenting cells are specifically activated, and immune cells are used for directional induction of humoral immunity and cellular immunity. The phage display linear 12 peptide library is used for research, the human peripheral blood DCs targeting peptide is obtained through screening, and the targeting peptide and antigen are fused and expressed in a lactobacillus delivery carrier, so that a good immune effect is obtained. In addition, the phage ring 7 peptide library is used for screening out mouse bone marrow-derived DC targeting peptide, and the mouse bone marrow-derived DC targeting peptide is coupled with antigen to prepare chitosan nanoparticle vaccine, so that the immune efficiency is remarkably improved. However, there are few studies on swine dendritic cell targeting peptides, and related recombinant lactobacillus oral vaccines of swine dendritic cell targeting peptides are involved.

Because of the increasing impact of variant or virulence-enhancing strains, the efficacy of existing vaccine products is increasingly being influenced, new product development focus is on how to improve vaccine efficacy, such as increasing the strength of protective immune responses, early generation of immunity or prolonged immune phase, etc., however, currently licensed methods of use of vaccines typically employ subcutaneous or intramuscular injection, the immune response generated is usually limited to systemic humoral immune (e.g. antibody-producing) pathogens or toxins, has limited cellular immunity (e.g. T cell mediation), and only few mucosal immunoprotection occurs, although oral vaccines have many immunological and practical advantages, a variety of physicochemical and biological barriers hinder antigen delivery of gastrointestinal tract vaccines, only a limited number of oral vaccines are available, and thus lactic acid bacteria targeted oral vaccines are becoming the focus of research for new vaccines. Although existing humanized DC targeting peptides can bind to DCs of multiple species sources to varying degrees, there is currently no targeted prophylactic regimen for recombinant lactobacillus oral vaccines related to porcine dendritic cell targeting peptides.

Disclosure of Invention

The invention aims to provide recombinant lactobacillus for fusion expression of pig-derived dendritic cell targeting peptide KC1 and PEDV neutralizing epitope COE, a construction method thereof and application thereof in vaccine preparation.

In order to achieve the above purpose, the invention adopts the following technical means:

the invention carries out separation culture on pig DCs, obtains pig mononuclear DCs with higher purity through morphological, phenotypic and functional identification, constructs pig DCs targeting peptide KC1 fusion antigen recombinant lactobacillus reuteri (pPG-KC 1-COE/L.reuteri), and verifies the binding effect of the pig DCs and the pig mononuclear DCs through experiments such as a scanning electron microscope, a flow cytometry and Q-PCR. Furthermore, the recombinant lactobacillus oral immunization piglet animal experiment proves that the KC1 fusion antigen recombinant lactobacillus reuteri can induce the piglet to generate remarkable cellular immunity and humoral immunity.

Based on the research, the invention provides a recombinant lactobacillus for fusion expression of a pig-derived dendritic cell targeting peptide KC1 and a PEDV neutralizing epitope COE, which is characterized in that the recombinant lactobacillus contains plasmids for fusion expression of the pig-derived dendritic cell targeting peptide KC1 and a pig epidemic diarrhea virus (Porcine Epidemic Diarrhea virus, PEDV) neutralizing epitope COE, wherein the amino acid sequence of the pig-derived dendritic cell targeting peptide KC1 is shown as SEQ ID NO. 1.

Preferably, the amino acid sequence of the fusion protein of the pig-derived dendritic cell targeting peptide KC1 and PEDV neutralizing epitope COE is shown as SEQ ID NO. 2.

Preferably, the nucleotide sequence of the fusion protein for encoding the pig-derived dendritic cell targeting peptide KC1 and PEDV neutralizing epitope COE is shown as SEQ ID NO. 3.

Preferably, the plasmid is a pPG-T7g10-PPT plasmid for fusion expression of a swine dendritic cell targeting peptide KC1 and a porcine epidemic diarrhea virus neutralizing epitope COE.

Furthermore, the invention also provides a method for constructing the recombinant lactobacillus, which comprises the following steps:

(1) Designing and synthesizing a primer sequence of a KC1 gene of the following pig dendritic cell targeting peptide, wherein a KC1-COE-F primer is introduced into a Sac I enzyme cutting site, a HindIII enzyme cutting site, a KC1 polypeptide fragment, a Linker sequence and a COE fragment, and a KC1-COE-R primer is introduced into an Apa I enzyme cutting site, an Xho I enzyme cutting site, a Flag tag sequence and a COE fragment; 5' -CGAGCTCATGCCCAAGCTTAAGTGTTGTTATCCGAATCCGCTC KC1-COE-F: GAGGAAGCCGCAGCCAAAGAGGCTGCAGCCAAGGTTACTTTGC

CATCATT-3’

KC1-COE-R：5’-GGGCCCCTTATCGTCGTCATCCTTGTAATCGTCCGTGACACCT

TCAAGTGGTTTAGGCGTGCCAGT-3’

(3) Amplifying KC1-COE gene fragments containing Fla g tag sequences by using a primer KC1-COE-F/R by taking plasmids containing COE coding sequences as templates, and recovering PCR products obtained after amplification, and preserving at-20 ℃ for later use;

(3) The gel recovery product KC1-COE is connected with a pEASY-Blunt vector, and the connection product is added into a competent cell of escherichia coli DH5 alpha to obtain a recombinant plasmid containing KC1-COE, which is named pEASY-Blunt-KC1-CO E;

(4) The recombinant plasmid pEASY-Blunt-KC1-COE and the expression vector pPG-T7g10-PPT are subjected to double enzyme digestion by SacI and Apa I, and KC1-COE gene fragments and vector fragments are respectively recovered; connecting the recovered gene fragment KC1-COE with a pPG-T7g10-PPT vector, thermally converting the connection product into escherichia coli DH5 alpha, extracting a recombinant plasmid and naming the recombinant plasmid as the pPG-KC1-COE;

(5) Sterile procedure Single colonies on the thermal conversion plates were picked and inoculated to a strain containing 100. Mu.g/mL Cm ⁺ Culturing in a shaking incubator at 37 ℃ for 12 hours in 5ml LB liquid medium, extracting recombinant plasmid pP G-KC1-COE by using a small plasmid kit, determining the sequence of the inserted sequence, and sequencing the result to show that the inserted sequence in the recombinant plasmid is correct, thus indicating that the construction of the recombinant plasmid pPG-KC1-COE is completed;

(6) Construction and identification of pPG-KC1-COE/L.reuteri

And (3) electrically converting the recombinant plasmid pPG-KC1-COE into competent cells of lactobacillus reuteri, and screening positive clones to obtain recombinant lactobacillus which fusion expresses the pig-derived dendritic cell targeting peptide KC1 and PEDV and neutralizes the epitope COE.

Furthermore, the invention also provides application of the recombinant lactobacillus in preparing medicines for preventing or treating porcine epidemic diarrhea virus infection.

Wherein, preferably, the medicine is a vaccine.

Compared with the prior art, the invention has the beneficial effects that:

the invention starts from the characteristic that the specific targeting dendritic cells of the immunogenic antigen by the probiotics lactobacillus can induce strong immune response of the antigen, and develops a recombinant lactobacillus vaccine for fusion expression of the porcine dendritic cell targeting peptide KC1 and Porcine Epidemic Diarrhea Virus (PEDV) neutralizing antigen epitope COE. The invention provides important material basis and technical means for research of the targeting vaccine, and has important significance for development and development of novel targeting vaccine of pigs.

Drawings

FIG. 1 shows the results of microscopic observation (100 μm) of swine mononuclear cell-derived dendritic cells;

wherein A: microscopic observation of the cell culture day 5; B. microscopic observation after 1 day of stimulation with LPS;

FIG. 2 shows the expression profile (50 μm) of the molecular phenotype of IFA detected porcine Mo-DCs;

FIG. 3 shows the detection of MHC-II and CD172a, the molecular phenotype of swine single-core derived DCs;

FIG. 4 is a graph showing the detection of phagocytic capacity of porcine Mo-DCs;

FIG. 5 shows the results of the fourth round of post-screen sequencing alignment and repeated sequences;

FIG. 6 is a fluorescence microscope showing the effect of fluorescent peptides on binding to DCs;

FIG. 7 is a flow chart of the results of an analysis of the affinity of FITC-labeled peptides with porcine DCs;

FIG. 8 is a view of the binding sites of fluorescent peptides to DCs by laser confocal observation;

FIG. 9 is an experimental result of KC peptide competition binding DCs using alanine mutation;

wherein A: KC three-dimensional structure diagram; B. c, D: percentage of inhibition binding calculated from the detected fluorescence intensity;

FIG. 10 is a fluorescence microscope showing the effect of fluorescent peptides on binding to DCs;

FIG. 11 is a flow chart of the results of an analysis of the affinity of FITC-labeled peptides with porcine DCs;

FIG. 12 is a view of the binding sites of fluorescent peptides to DCs by confocal laser light;

FIG. 13 shows the result of PCR amplification of 6 aa-COE;

note that: m: DL 2000DNAMarker;1:6aa-COE PCR product; 2: water control;

FIG. 14 shows the PCR identification of recombinant plasmid pPG-6 aa-COE;

note that: m: DL 2000DNAMarker;1 and 2: pPG-6aa-COE PCR product; 3: water control;

FIG. 15 shows the results of double cleavage assay of recombinant plasmid pPG-KC 1-COE;

note that: m: DL 8000DNAMarker;1: double enzyme cutting of Sac I/Apa I;

FIG. 16 shows the PCR identification of recombinant Lactobacillus plasmid pPG-KC 1-COE/L.reuteri;

note that: m: DL 2000DNAMarker;1: pPG-6aa-COE/L.reuteri plasmid; 2: water control;

FIG. 17 is an identification of recombinant Lactobacillus expressing a foreign protein;

wherein A: analyzing and determining the expression of the exogenous protein by Western Blot; b: analysis and determination of foreign protein expression by IFA:

FIG. 18 is a view of the capture of swine mononuclear source DCs to recombinant Lactobacillus by scanning electron microscopy;

FIG. 19 is a graph showing the detection of the ability of recombinant Lactobacillus to target porcine mononuclear-source DCs;

wherein A: determining the capture effect of the swine mononuclear source DCs on the DCs targeting peptide KC1 fusion antigen through flow cytometry; b: detecting the capturing effect of the pig mononuclear source DCs on the DCs targeting peptide KC1 fusion antigen by using a plate counting method;

FIG. 20 shows the expression of surface molecules and cytokines of swine mononucleosis DCs;

FIG. 21 is a graph showing the ability of recombinant lactic acid bacteria to stimulate porcine mononuclear DCs to mediate T cell proliferation;

FIG. 22 detection of anti-PEDV-specific IgG and SIgA induced by oral immunization of pigs with recombinant lactic acid bacteria.

Detailed Description

The invention will be further described with reference to specific embodiments, and advantages and features of the invention will become apparent from the description. The embodiments are merely exemplary and do not limit the scope of the invention in any way. It will be understood by those skilled in the art that various changes and substitutions of details and forms of the technical solution of the present invention may be made without departing from the spirit and scope of the present invention, but these changes and substitutions fall within the scope of the present invention.

Example 1 isolated culture and identification of porcine mononuclear-derived dendritic cells

1. Isolated culture of swine mononuclear-derived dendritic cells

The anterior vena cava is aseptically collected for 5-8 weeks old piglet blood, heparin sodium anticoagulation tube is adopted, and the venous blood is diluted by sterile PBS and double antibody in a ratio of 1:1. A sterile centrifuge tube is selected, normal-temperature Histopaque-1077 lymphocyte separation liquid is firstly added into each tube along the tube wall, then equal-amount diluted blood is slowly added into the tube wall, an obvious boundary line between the separation liquid and the blood is ensured, and the centrifugation is carried out for 25min at 2500 rpm. Slowly taking out the centrifuge tube, slowly sucking the middle white mist mononuclear cell layer by a pipetting gun, subpackaging into a sterile centrifuge tube, centrifuging at 1800rpm for 10min, discarding the supernatant,the cell pellet was resuspended by adding red blood cell lysate to each tube, lysed for 5min at room temperature, centrifuged at 1800rpm for 8min, and the supernatant discarded. Cell pellet was resuspended by adding sterile PBS per tube, centrifuged at 1800rpm for 8min, and the supernatant discarded. Peripheral Blood Mononuclear Cells (PBMCs) were obtained. The cell pellet was resuspended in 2X 10 with pre-prepared RPMI-1640 complete medium ⁶ The cells were inoculated into six-well plates at a density of/mL, shaken well and then placed at 37℃in 5% CO ₂ And (5) standing and culturing in a constant temperature incubator. After 6h incubation, observation was carried out by light microscopy, at which time the adherent cells were monocytes. Non-adherent cells were slowly aspirated along the walls of the wells with a pipette, and 2mL of RPMI-1640 complete medium was slowly added, and rpGM-CSF and rpIL-4 were added to each well at a concentration of 20ng/mL, 37℃and 5% CO ₂ Culturing in a constant temperature incubator, and changing liquid at intervals of 1d by half the operation, and inducing into immature swine MoDCs after culturing for 5 d. After 5d induction culture of swine MoDCs, mature DCs were obtained after stimulation with LPS at a final mass concentration of 200 ng/mL.

2. Morphology observation of swine mononuclear source DCs

During cell culture, the cultured DCs were observed for morphological changes using an optical inverted microscope, and the results are shown in fig. 1. The observation result shows that the mononuclear cells obtained by just separation are round in shape, small in volume and fully suspended in the culture solution; after 1d of culture, cells suspended in the culture liquid started to grow on the wall, and a small number of cell colonies appeared. After 2d of culture, the cell volume starts to become larger, and the number of cell colonies increases; after 4d of culture, the cell volume in the culture solution is in a state of different sizes, part of the cell surface is in radial irregular dendrites, the morphology is different, and the cell is in a semi-adherent state; after 5d culture, most cells are in the form of protrusions on the peripheral surface, cells are irregular and in a semi-suspended state, and at this time, the cells show the morphological characteristics of typical immature DCs. After the LPS was added to the cells and the induction was continued for 1d, the surface protrusions of the cells were more apparent.

3. Fluorescent microscope for detecting phenotype of swine mononuclear source DCs

The culture solution of mononuclear source DCs in the six-hole plate is sucked out slowly, so that the cells are prevented from falling off the hole plate, 0.01M PBS is slowly added along the wall of the hole plate, washing is repeated twice, and RPMI-1640 basic culture solution is added. PE-mouse anti-porcine CD172a and FITC-mouse anti-porcine MHC-II antibody were added sequentially to six well plates and incubated for 30min at room temperature in the absence of light. The antibody was slowly aspirated with a pipette and fixed with 6% formaldehyde for 5min. The non-specifically bound fluorescent antibody was removed by washing twice with 0.01M PBS, DAPI incubated at room temperature for 10min, washed twice with 0.01MPBS, observed with a fluorescence microscope and photographed. As a result, it was found that 5d monocytes induced with rPGM-CSF and rPIL-4 expressed CD172a and MHC-II molecular phenotypes by fluorescence microscopy, as shown in FIG. 2.

4. Flow cytometry for detecting purity of swine mononuclear source dendritic cells

Sterile 0.01M PBS was added to the cell well plates of the immature and mature mononuclear-derived DCs, respectively, and the cells were blown up from the well plates and suspended in PBS, after which centrifugation at 2000rpm for 5min, the supernatant was discarded by repeated washing, and the immature and mature mononuclear-derived DCs were each equally distributed in 1.5mL EP tubes. PE-mouse anti-porcine CD172a and FITC-mouse anti-porcine MHC-II antibodies were added to immature and mature mononuclear-derived DCs, respectively, and only 0.01M PBS was added as a negative control to the final 1-tube. After the addition was completed, the mixture was resuspended, incubated with tinfoil at room temperature for 30min in the dark, and centrifuged at 2000rpm for 5min. Cells were washed 3 times with 0.01M PBS to remove non-specific fluorescent antibodies. After centrifugation and removal of the supernatant, cells were resuspended by adding 500. Mu. L0.01M PBS to each tube, and examined by flow cytometry to ensure at least 1X 10 cells per tube prior to shipment ⁵ And each.

Flow cytometry was performed to examine the expression of the surface molecules (CD 172a and MHC-II) of the induced cell DCs. Cells induced by pGM-CSF and pIL-4 were incubated with CD172a and MHC-II monoclonal antibodies, and MoDCs without incubated fluorescent antibodies were used as negative controls. Flow cytometry results showed that CD172a and MHC-II molecule expression levels could reach 92.5% and 69.5%, indicating that PGM-CSF and PIL-4 could induce differentiation of PBMCs into immature mononuclear-derived DCs. After the immature mononuclear source DCs are stimulated to mature by LPS, the expression level of the surface DCs surface molecules CD172a and MHC-II can reach 98.1% and 78.3%, and the result is shown in figure 3.

5. Detection of phagocytic function of swine mononuclear source DCs

Adding 0.01M PBS to the cultured unformed cellsCentrifuging at 2000rpm for 5min in mature mononuclear source DCs, discarding supernatant, repeatedly washing for 3 times, and adjusting cell concentration to 2×10 ⁵ Setting 5 gradients, respectively, connecting three replicates of each gradient to 96-well plate, adding 100 μl of 0.1% neutral red into each well, adding 0.01M PBS into one group as negative control, placing at 37deg.C, and 5% CO ₂ Culturing in an incubator for 60min, 90min, 120min and 150min, discarding the rest neutral red which is not phagocytized after incubation, repeatedly washing twice by using 0.01M PBS (pre-heating), adding 100 mu L of 1% SDS lysate into each well, incubating the lysed cells at room temperature for 2h, and reading the OD540 value on an enzyme-labeled instrument, wherein the OD value is proportional to the phagocytic function of the cells.

To further determine whether PBMCs successfully differentiated into mononuclear-derived DCs after induction by the inducer, the present study utilized neutral red to examine the phagocytic capacity of immature and mature mononuclear-derived DCs based on their greater processing uptake and phagocytic capacity to antigen, while the processing uptake and phagocytic capacity of mature mononuclear-derived DCs gradually decreased this major biological activity. The results are shown in FIG. 4, and the immature mononuclear-source DCs have obviously increased phagocytosis of neutral red with the time, and can reach the maximum at 120 min; however, the increase and change of phagocytic capacity of the mature mononuclear source DCs induced by LPS with time are not obvious, and the phagocytic capacity of the mature mononuclear source DCs slightly decreases. The results show that the experiment successfully separates the high-purity pig mononuclear source DCs.

EXAMPLE 2 phage display 12 peptide library differential screening of porcine dendritic cell targeting peptides

1. Screening of targeting peptides

The screening process is divided into four rounds, and is specifically as follows:

first round: will be 2X 10 ¹¹ The pfu of the PhD-12 library was added to porcine mononuclear-derived DCs (5X 10) ⁵ /mL) and after incubation at 4 ℃ for 30min, centrifugation at 2000rpm for 3min, the cell pellet was resuspended in PBS containing 1% Bovine Serum Albumin (BSA) and 0.05% tween 20, and washing was repeated 3 times; 1mL of buffer (0.2 mol/L glycine-hydrochloric acid, pH=2.2, 1mg/mL bovine serum albumin) was added, and after mixing gently at room temperature for 10min, 50. Mu.L Tris-HCl (pH 9.1) was added for neutralization; centrifuging The supernatant is the phage eluent combined with the surface of the membrane, the eluent and E.coli ER2738 culture solution (A600 nm approximately equal to 0.5) are vigorously shaken in a conical flask for 4.5 hours, and a polyethylene glycol NaCl secondary precipitation method is adopted to prepare phage amplification liquid.

2 nd-4 th round of screening, the first round of amplification solution was added to 5X 10 ⁵ Incubation in mLPBMC (negative selection cells) at 4deg.C for 30min, centrifugation at 2000rpm for 3min, transferring supernatant to porcine mononuclear source DCs, and repeating the first round of steps; the incubation time was shortened to 20min for round 3 and 10min for round 4. Phage titer was determined from each round of screening eluate and amplification solution using LB isopropyl-thio- β -D-galactoside (IPTG) 5-bromo-4-chloro-3-indole- β -thiogalactoside (Xgal) Tet plate culture; after round 4 biological elimination, 204 plaques were randomly picked, and M13 phage single-stranded DNA was extracted with the kit and sequenced.

The number of screening rounds, the input amount and the recovery amount are shown in Table 1, after non-specific binding phage are rinsed off in each screening round, phage bound to the surface are eluted and amplified, four rounds of panning are continuously carried out, the recovery rate rises in the second round, and the recovery rate is stable after the incubation time is reduced in the third round and the fourth round. In the fourth round of plaque sequencing results, 161 total phages displaying HS (HSLRHDYGYPGH), KC (KCCYPNMAAFA) and SF (SFLTNFVQPHAS) short peptides were repeatedly appeared after four rounds of panning, indicating that they may be peptide sequences with better affinity for swine single-core DCs, as shown in fig. 5.

TABLE 1 screening round number, input amount and recovery amount

2. Synthesis of polypeptides

Peptides HS (HSLRHDYGYPGH), KC (KCCYPNMAAFA) and SF (SFLTNFVQPHAS), etc., repeated in the fourth round of screening were selected and synthesized using Fmoc for HPLC purification (purity > 95%) and mass spectrometry (completed by genescript corporation) with the specific sequences shown in Table 2. The fluorescent peptide powder is dissolved in PBS in advance and stored at-20 ℃ for standby.

TABLE 2 polypeptide sequences

3. Detection of short peptide affinity

3.1 fluorescent microscope to observe the binding effect of fluorescent peptide and swine mononuclear source DCs

After washing twice with PBS, the single-core-derived DCs on day 6 of culture (cell number of about 10 ⁵ Per mL), 50 μg of FITC-labeled 12 peptides HS, KC and SF were added to each well, and the wells were allowed to stand at room temperature for 30min, rinsed three times with pbs, and the fluorescent peptide binding effect was observed with a fluorescent microscope. The result is shown in FIG. 6, the fluorescence intensity of KC short peptide combined with cells is higher than that of HS short peptide, which shows that KC fluorescent peptide can be combined with DCs cells well.

3.2 flow cytometry to detect affinity of peptides to swine mononuclear-derived DCs

25. Mu.g of FITC-labeled 12 peptides HS, KC and SF were added to DCs on day 6 of culture, respectively (cell mass about 10) ⁶ Per mL), centrifugation at 1800r/min, washing the pellet twice with PBS, resuspending the cells with 500 μl PBS, detecting fluorescent signals by flow cytometry, and repeating each sample three times. The detection result is shown in fig. 7, and under the same condition, the fluorescence signal intensity of KC and SF short peptides is obviously higher than that of HS short peptides, which indicates that the KC and SF short peptides can be better combined with swine dendritic cells in a specific way.

3.3 laser confocal observation of the binding of fluorescent peptide to porcine small intestine DCs

Taking frozen slices of small intestines of pigs, and standing at room temperature for 10min. Blocking with 5% goat serum at room temperature for 30min, adding 400 μLMHC-II-FITC, CD172a-PE, and incubating at 37deg.C for 30min. Sections were washed 3 times with 0.01M PBS to remove non-specific fluorescence. To the sections 50. Mu.g of FITC-labeled 12 peptides HS, KC and SF, respectively, were added and incubated at 4℃for 30min in the absence of light. Sections were washed 2 times with 0.01M PBS to remove non-specific fluorescence. DAPI 100. Mu.L was added to each slice, and incubated at room temperature for 10min in the dark. Sections were washed 2 times with 0.01M PBS to remove non-specific fluorescence. The results of laser confocal observation and slicing are shown in fig. 8, and KC short peptide can be well combined with DCs in the small intestine of pigs.

3.4 Effect of alanine mutations on binding of polypeptides to porcine mononuclear-derived DCs

After washing twice with PBS, the single-core-derived DCs on day 6 of culture (cell number of about 10 ⁴ Per mL), 5. Mu.g/mL, 10. Mu.g/mL, 20. Mu.g/mL, 40. Mu.g/mL KC and amino acid mutated 12 peptide were added to the mononuclear-source DCs on day 6 of culture, incubated at 37℃for 1h, PBS rinsed three times, biotin-labeled KC and mononuclear-source DCs incubated at 37℃for 1h, PBS rinsed three times, HRP-streptavidin added, incubated at 37℃for 1h, PBS rinsed three times, 100. Mu.L/well TMB added for 10min, and 2M H added ₂ SO ₄ Terminating the reaction, and detecting OD by using an enzyme-labeled instrument ₄₅₀ Absorbance. FIG. 9 (B) shows the percent inhibition of peptide binding at various concentrations of competing peptides, the reference KC peptide effectively competes with biotinylated KC peptide for pig mononucleosis DCs, losing this ability to inhibit binding after substitution of amino acids 1,4,5 and 6 with alanine. It was demonstrated that amino acids 1,4,5 and 6 are less likely to bind KC to the targeting protein on the surface of swine mononuclear-derived DCs. The results in FIG. 9 (A, C) show that the double mutant KC still has binding inhibition ability after the 2,3 amino acids are disubstituted by alanine, but the short peptide significantly reduces the binding inhibition ability after the 2,3 amino acids are deleted, which indicates that a certain space is required between the 1,4 amino acids when KC binds to the targeting protein on the surface of swine mononuclear source DCs. The results of FIG. 9 (D, E) show that not only KC1 (KCCYPN, shown by SEQ ID NO. 1) does not lose inhibition binding ability but also binding ability is higher than KC after deletion of the last six amino acids of KC.

3.5 fluorescent microscope to observe the binding effect of fluorescent peptide and pig mononuclear source DCs

After washing twice with PBS, the single-core-derived DCs on day 6 of culture (cell number of about 10 ⁵ Per mL), 50 μg of FITC-labeled 12 peptides HS, KC and SF and hexapeptides KC1 and KC2 were added to each well, respectively, and the wells were allowed to act at room temperature for 30min, rinsed three times with pbs, and fluorescent peptide binding was observed with a fluorescent microscope. Results As shown in FIG. 10, the fluorescence intensities of KC1 and KC2 short peptides indicate that KC1 fluorescent peptide can be well combined with DCs cells.

3.6 flow cytometry to detect affinity of peptides to swine mononuclear-derived DCs

Mu.g of FITC-labeled 12 peptide KC and hexapeptides KC1 and KC2 were added to DCs on day 6 of culture, respectively (cell amount about 10) ⁶ Per mL), centrifugation at 1800r/min, washing the pellet twice with PBS, resuspending the cells with 500 μl PBS, detecting fluorescent signals by flow cytometry, and repeating each sample three times. The detection result is shown in fig. 11, and under the same condition, the fluorescence signal intensity of the KC1 short peptide is obviously higher than that of KC and KC2 short peptide, which indicates that the KC1 short peptide can be better specifically combined with the swine dendritic cells.

3.7 laser confocal observation of the binding condition of the fluorescent peptide and the pig small intestine DCs

Taking frozen slices of small intestines of pigs, and standing at room temperature for 10min. Blocking with 5% goat serum at room temperature for 30min, adding 400 μLMHC-II-FITC, CD172a-PE, and incubating at 37deg.C for 30min. Sections were washed 3 times with 0.01M PBS to remove non-specific fluorescence. To the sections, 50. Mu.g of FITC-labeled 12 peptide KC and hexapeptides KC1, KC2 were added, respectively, and incubated at 4℃for 30min in the absence of light. Sections were washed 2 times with 0.01M PBS to remove non-specific fluorescence. DAPI 100. Mu.L was added to each slice, and incubated at room temperature for 10min in the dark. Sections were washed 2 times with 0.01M PBS to remove non-specific fluorescence. The results of laser confocal observation and slicing are shown in fig. 12, and the KC1 short peptide can be well combined with DCs in the small intestine of pigs.

EXAMPLE 3 construction of recombinant Lactobacillus reuteri for fusion expression of porcine dendritic cell targeting peptide KC1 and Porcine Epidemic Diarrhea Virus (PEDV) neutralizing epitope COE

1. Primer synthesis

The following porcine dendritic cell targeting peptide KC1 gene primer sequences (see Table 3) were designed using Oligo 6 software, using the dendritic cell targeting peptide KC1 sequence (KCCYPN) selected according to example 2, and the primers were synthesized by Jilin Kumei Biotechnology Co.

TABLE 3 primer sequences

Note that: the underlined part is the introduced cleavage site, the bolded part is the coding sequence of dendritic cell targeting peptide KC1 (KCCYPN), the bolded italic part is the Flag tag sequence, and the bolded italic underlined part is the rigid Linker sequence.

The following real-time fluorescent quantitative primer sequences (see Table 4) were designed using Oligo 6 software based on the published sequences in GenBank, and primers were synthesized by Jilin Kyoto Biotechnology Co.

TABLE 4 primer sequences

Construction of 2-expression pig DCs targeting peptide KC1 fusion antigen recombinant lactobacillus reuteri

2.1PCR amplification of the Gene of interest

The KC1-COE gene fragment containing the Flag tag sequence was amplified using the primers KC1-COE-F/R in Table 3 (KC 1-COE-F primer introduced into Sac I cleavage site, hind III cleavage site, KC1 polypeptide fragment, linker sequence and COE fragment, KC1-COE-R primer introduced into Apa I cleavage site, xho I cleavage site, flag tag sequence and COE fragment) using the pMD-19T-COE plasmid (Oral recombinant Lactobacillus vaccine targeting the int estinal microfold cells and dendritic cells for delivering the core neutralizing epitope of porcine epidemic diarrhea virus. Microb Cell face. 2018;17:20.Published online2018Feb 9.doi:10.1186/s 12934-018-0861-7) as a template. The PCR procedure was: the reaction system is shown in Table 5 at 95℃for 5 min- [98℃for 10 s- & gt 55℃for 45 s- & gt 68℃for 30s ]. Times.30 cycles- & gt 68℃for 10 min. And (3) performing agarose gel electrophoresis analysis on the amplified PCR product. The results are shown in FIG. 13, where the nucleic acid bands were of the expected size, the sequencing result was 521bp in size, and the nucleotide sequence was identical to the expected design (sequencing result not shown).

And uniformly mixing a PCR product of the KC1-COE gene with a Loading Buffer, performing agarose gel electrophoresis, cutting off a target fragment under an ultraviolet lamp after the completion of the agarose gel electrophoresis, recovering the target fragment by using a common agarose gel DNA recovery kit purchased from TIANGEN company, and preserving at-20 ℃ for later use.

TABLE 5 PCR System for amplifying KC1-COE Gene

Construction and identification of 2.2pPG-KC1-COE recombinant lactic acid bacteria vector

The gel recovery product KC1-COE was ligated with pEASY-Blunt vector, placed in a 25℃linker, and ligated with 10 min. The ligation product was added to E.coli DH 5. Alpha. Competent cells, gently flicked, mixed well and ice-bathed for 30min. Heat shock is carried out for 30s in a water bath at the temperature of 42 ℃, and then the water bath is immediately placed on ice for 2min; 800. Mu.L of LB medium was added thereto, and the mixture was cultured in a shaking incubator at 200rpm and 37℃for 1 hour. 200. Mu.L of the mixture was spread on a plate and cultured in an incubator at 37℃for 12 hours. Single colonies on the transformation plates were picked up and inoculated into 5ml LB liquid medium containing 100. Mu.g/mLAMP, cultured in a shaking incubator at 37℃for 12h, and the recombinant plasmid pEASY-Blunt-KC1-COE was extracted with the miniplasmid kit. And carrying out PCR and double enzyme digestion identification on the obtained recombinant plasmid. The result of PCR amplification gel electrophoresis shows that about 500bp nucleic acid electrophoresis band is obtained by amplification, the nucleic acid fragment is connected with a carrier and sequenced, the determination result shows that the amplified fragment size is 521bp, and the nucleic acid sequence and the size are consistent with the expected design. The recombinant plasmids identified correctly by sequencing were named pEASY-Blunt-KC1-COE, respectively.

The recombinant plasmids pEASY-Blunt-KC1-COE and the expression vector pPG-T7g 10-PtT are digested with SacI and ApaI, and KC1-COE gene fragment and vector fragment are recovered respectively. The recovered gene fragmentKC1-COE and pPG-T7g10-PPT carrier are connected according to the molar mass ratio of 3:1, the connection product is thermally transformed into escherichia coli DH5 alpha, and the recombinant plasmid is extracted and named as pPG-KC1-COE; sterile procedure Single colonies on the thermal conversion plates were picked and inoculated to a strain containing 100. Mu.g/mL Cm ⁺ In 5ml LB liquid medium, cultured in a shaking incubator at 37℃for 12 hours, and the recombinant plasmid pPG-KC1-COE was extracted with a miniplasmid kit. Recombinant plasmids were identified by PCR (see FIG. 14) and double digestion (see FIG. 15). The result of PCR amplification gel electrophoresis shows that about 500bp nucleic acid electrophoresis band is obtained by amplification, the nucleic acid fragment is consistent with the expected result, the nucleic acid fragment is connected with a carrier for sequence determination, the determination result shows that the amplified fragment size is 521bp, and the nucleic acid sequence and the size are consistent with the expected design; after double enzyme digestion, the constructed lactobacillus recombinant plasmid p PG-KC1-COE shows that enzyme digestion products respectively have bands of about 5000bp and more than 500bp, and enzyme digestion results are consistent with expected results. Sequencing the inserted sequence of the recombinant plasmid pPG-KC1-COE, wherein the sequencing result shows that the inserted sequence in the recombinant plasmid is correct, and the construction of the recombinant plasmid pPG-KC1-COE is completed.

Construction and identification of 2.3pPG-KC1-COE/L.reuteri

Lactobacillus reuteri was streaked on MRS plates and incubated overnight at 37 ℃. Single colonies were picked from the plates and inoculated into 3 mM RS liquid medium and incubated at 37℃overnight. Inoculating the bacterial liquid into 200 mM MS liquid culture medium (containing 2% glycine) at a ratio of 1:100, and standing at 37deg.C for culturing to OD ₆₀₀ 200mL of bacterial liquid is subpackaged into 4 sterile 50mL centrifuge tubes, ice bath is carried out for 30min, centrifugation is carried out at 3500rpm/min at 4 ℃ for 10min, and bacterial precipitate is collected. Washing the precipitate with pre-cooled EPWB for 2 times, centrifuging at 3500r/min for 10min, and collecting bacterial precipitate. Washing the precipitate with pre-cooled EPB for 2 times, centrifuging at 3500r/min for 10min, and collecting bacterial precipitate. The pellet was suspended with 2mL of pre-chilled EPB, dispensed into 2mL EP tubes, 200. Mu.L/tube, and stored at-80℃for further use.

The recombinant plasmid pPG-KC1-COE was gently mixed with competent cells, ice-bathed for 10min, and then added to a pre-chilled sterile electric beaker. And (3) performing electric conversion, wherein parameters are as follows: voltage 2200V, shock time 4ms. Rapid 1mL MRS recovery after shock is overThe culture medium was gently mixed and incubated in an ice bath for 10min at 37℃for 5h. Centrifuging at 3500r/min for 5min, collecting appropriate amount of bacterial liquid, and coating on the substrate containing Cm of 5 μg/mL ⁺ On MRS agar plates, stationary culture was performed at 37℃for 36 hours, and positive clones were selected.

Sterile procedure Single colonies on MRS electrotransformation plates were randomly picked and inoculated at a concentration of 10. Mu.g/mL Cm ⁺ Is cultured at 37℃overnight in the MR S liquid medium. 2ml of the bacterial liquid is taken out from the sterile operating table and centrifuged for 3min at 5000r/min in a 2ml EP tube. The supernatant was discarded, the pellet was suspended in 1ml of sterile water, centrifuged at 5000r/min for 3min and washed 3 times. The cells were suspended with 1ml lysozyme, centrifuged at 5000r/min for 3min in a 37℃water bath for 2h, the supernatant was discarded, the pellet was suspended with sterile water, centrifuged at 5000r/min for 3min, and washed 2 times. Recombinant lactobacillus plasmids were extracted with a miniplasmid kit, designated pPG-KC1-COE/L. The KC1-COE gene fragment was amplified by PCR, and the PCR product was subjected to nucleic acid electrophoresis to obtain a band of about 500bp in size (see FIG. 16), which was in accordance with the intended design. Sequencing analysis is carried out on the recombinant lactobacillus plasmid with the correct PCR identification, the nucleotide size and the sequence of the recombinant lactobacillus plasmid are consistent with those of the expected recombinant lactobacillus plasmid, and the result shows that the construction of the recombinant lactobacillus pPG-KC1-COE/L.reuteri is completed. Wherein, the amino acid sequence of the fusion protein of the pig-derived dendritic cell targeting peptide KC1 and PEDV neutralizing epitope COE is shown as SEQ ID NO. 2. The nucleotide sequence of the fusion protein for encoding the pig-derived dendritic cell targeting peptide KC1 and PEDV neutralizing epitope COE is shown as SEQ ID NO. 3.

2.4 identification of recombinant Lactobacillus expressing exogenous proteins

Expression of the foreign protein was analyzed and determined by WesternBlot: recombinant lactobacillus pPG-COE/L.reuteri, pPG-KC1-COE/L.reuteri and Vector/L.reuteri are subjected to stationary culture at 37 ℃ until the OD600 nm is about 1, 4ml of bacterial liquid is taken for centrifugation, supernatant is removed, bacterial cells are washed 3 times by deionized water, bacterial cell precipitate is subjected to lysozyme action, after water bath at 37 ℃ for 1h, supernatant is removed by centrifugation, water washing is carried out 3 times, bacterial cell precipitate is suspended by 2ml of 1XPBS, and then an equal amount of loading buffer solution 2 XSDS is added for boiling for 15min. SDS-PAGE, transfer and Western Blot: the filter paper with 6 layers, the albumin glue, the PVDF film with 0.22 mu m and the filter paper with 6 layers are sequentially clamped by a wet transfer clamp, and the transfer conditions of the wet transfer are 100V and 2h. Blocking 5% skim milk at 4deg.C overnight, washing with PBST for 3 times, diluting the primary antibody of the mouse anti-Flag label monoclonal antibody with primary antibody (1:5000), and incubating at 37deg.C for 2 hr; washing 3 times, HRP-labeled goat anti-mouse IgG antibody was diluted with 5% skim milk at 1xPBS as secondary antibody, 1: 4000-fold dilution, 1h incubation at room temperature, 3 wash-out with PBST followed by ECL color development. Western Blot detection shows that the molecular weight of the pPG-COE protein is about 66kDa, the molecular weight of the pPG-KC1-COE protein is about 68kDa, and no target band is seen in recombinant lactobacillus Vector/L.reuteri transferred into empty Vector (see FIG. 17A). The result shows that the target protein of the DCs targeting peptide KC fusion antigen can be expressed in lactobacillus and can be recognized by Flag tag antibody.

Analysis and determination of foreign protein expression by IFA: taking lactobacillus Vector/L.reuteri of the electric transformation empty Vector as a negative control, respectively taking recombinant lactobacillus pPG-COE/L.reuteri, pPG-KC-COE/L.reuteri and V ector/L.reuteri bacterial solutions, centrifuging for 5min at 5000r/min respectively, washing bacterial sediment for 3 times by using sterile 1xPBS, and discarding the supernatant. In the construction process of the recombinant plasmid, 3' segments of the COE and KC1-COE genes have Flag tag sequences, so that the murine anti-Flag tag monoclonal antibody diluted by 1xPBS is used as a primary antibody, and the dilution is 1:1000 The culture was allowed to act in a shaking incubator at 37℃for 2 hours, centrifuged at 5000r/min for 5 minutes, the bacterial pellet was washed 3 times with sterile 1xPBS, and the supernatant was discarded. The procedure was performed in the dark, using FITC-labeled goat anti-mouse IgG antibody diluted with 1xPBS as secondary antibody, the dilution was 1:250 The bacteria precipitate is washed 3 times by aseptic 1xPBS under the action of a shaking incubator at 37 ℃ for 30min and centrifugation at 5000r/min for 5min, and the supernatant is discarded. Finally, the bacterial precipitate is suspended by 500 mu L of sterile water, a proper amount of smear is taken, naturally dried in a dark place and observed under a fluorescence microscope. The results of fluorescence microscopy showed that both pPG-COE/L.reuteri and pPG-KC1-CO E/L.reuteri exhibited significant green fluorescence, whereas the Vector/L.reuteri surface showed no fluorescent signal (see FIG. 17B). The result shows that the target protein of the DCs targeting peptide KC fusion antigen can be expressed in lactobacillus and can be recognized by Flag tag antibody.

Analysis of 3 recombinant lactobacillus targeting pig mononuclear source DCs binding ability

3.1 scanning electron microscope observation of the conditions of capturing recombinant lactobacillus by pig mononuclear source DCs

Inspection of pig mononuclei by using scanning electron microscopeCapturing of DCs targeting sequence fusion antigens by source DCs. The main experimental method comprises the following steps: inducing and culturing immature swine single-core DCs in six-hole plates paved with climbing plates, culturing for 5d, and culturing recombinant lactobacillus pPG-KC1-COE/L.reuteri, pPG-COE/L.reuteri and Vector/L.reuteri and immature DCs (cell number: bacterial number=1:1) at 37 ℃ and 5% CO ₂ Culturing for 120min, and washing with PBS for 1 time to remove non-adhered recombinant lactobacillus. 2% glutaraldehyde was added as a fixative to the cell well plate and incubated for 3h at 4℃for fixation (the amount of fixative added was over the position of the slide). The mixture was carefully rinsed 3 times with 0.1mol of phosphate buffer at pH 7.2 for 10min each time, and dehydrated once each 10min each time with 50%,70%,90% ethanol and 2 times each time with 100% ethanol for 10min each time. The displacement was performed using 100% ethanol: and (3) treating the mixed solution of tert-butanol=1:1 for 15min, and replacing pure tert-butanol for 2 times, wherein the first time is to replace the climbing sheet directly in the pore plate, the second time is to take the climbing sheet out of the pore plate and put the climbing sheet into a small box for replacement, and finally the small box with the climbing sheet is put into a refrigerator at 20 ℃ for freezing for 30min. And (3) after freezing, drying the surface of the climbing sheet in a dryer for about 4 hours, wherein the cell-bearing surface of the climbing sheet faces upwards during microscopic examination, and adhering the climbing sheet to a scanning electron microscope sample stage by using a conductive adhesive tape, wherein the surface of the climbing sheet is required to be coated with a layer of 100-150 angstrom metal film by using an ion sputtering coating instrument for microscopic examination. As shown in FIG. 18, both pPG-KC1-COE/L.reuteri and pPG-COE/L.reuteri can be captured by DCs, and pPG-KC1-COE/L.reuteri is captured by swine single core DCs more than pPG-COE/L.reuteri. However, few effects were observed by Vector/L.reuteri alone, which were captured by swine-derived mononuclear-source DCs.

3.2 detection of Capture ability of porcine Mono-Nuclear DCs for DCs targeting peptide KC1 fusion antigen

The capture effect of porcine mononuclear-source DCs on the DCs targeting peptide KC1 fusion antigen was determined by flow cytometry. The main experimental method comprises the following steps: fluorescent dye CFSE stock was prepared with sterile PBS at 1:800 to be diluted into working fluid. The cultured recombinant lactic acid bacteria pPG-KC1-COE/L.reuteri, COE/L.reuteri and Vector/L.reuteri were centrifuged at 5000r/min for 5min. Discard supernatant, use PBSThe cells were suspended in 500. Mu.L, and the recombinant Lactobacillus was labeled with the same amount of CFSE working solution and incubated at 4℃for 30min in the absence of light. The supernatant was centrifuged off and washed 2 times with 500. Mu.L of PBS to remove nonspecific fluorescence, and labeling was detected by flow cytometry. Recombinant lactobacillus pPG-KC1-COE/L.reuteri, COE/L.reuteri and Vector/L.reuteri successfully labeled with CFSE and immature swine single-core source DCs were treated with 5% CO at 37 ℃C ₂ Incubate in incubator for 30min. Immature swine mononuclear source DCs after incubation of recombinant lactobacillus are gently blown, and cells are collected in an EP tube by centrifugation at 1200r/min for 8 min. The supernatant was discarded and washed 2 times with PBS to remove nonspecific binding. Cells were resuspended in 500. Mu.L of PBS per tube and examined on a flow cytometer with the use of DCs without recombinant Lactobacillus as cell controls. The results showed that the positive rate of swine single-core source DCs added to the recombinant lactobacillus group was 91.6% and 74.6%, respectively (see FIG. 19A), and that the pPG-KC1-COE/L.reuteri group was significantly higher than the CO E/L.reuteri group, which demonstrated that the DCs targeting peptide KC1 could enhance the recognition and capture efficiency of swine single-core source DCs to recombinant lactic acid bacteria.

Detecting the capture amount of the target antigen by using a plate counting method, and mixing recombinant lactobacillus pPG-KC1-COE/L.reuter i, COE/L.reuter and Vector/L.reuter according to the following ratio of 1:100 proportion is inoculated into MRS culture medium, cultured in a 37 ℃ incubator, washed 2 times with sterile PBS, and finally suspended by RPMI-1640 basal culture solution. Combining the suspended recombinant lactobacillus with immature swine mononuclear-derived DCs at 37 ℃ with 5% CO ₂ Incubators were incubated for 30min, washed 2 times with sterile PBS, and recombinant lactobacilli not bound to immature DCs were removed. Cells were collected in EP tubes by centrifugation at 3500rpm for 5min, suspended in 100. Mu.L of sterile PBS, plated, incubated in an incubator at 37℃and the PCR method was used to identify the KC1-COE gene in recombinant plasmid pG-KC1-COE/L.reuteri, the COE gene in recombinant plasmid COE/L.reuteri and a portion of the Vector gene in recombinant plasmid Vector/L.reuteri, respectively, and colony counts were performed for three replicates per recombinant lactic acid bacterium group. The results showed that the number of colonies of immature swine single-core source DCs incubated with pPG-KC1-COE/L.reuteri was significantly greater than in the other groups (see 19B). The experiment is consistent with the results of scanning electron microscope observation and flow cytometry.

3.3 Effect of DCs targeting peptide KC1 fusion antigen on expression of surface molecules and cytokines of swine-derived mononuclear-derived DCs

After 5d induction culture of DCs, recombinant Lactobacillus pPG-KC1-COE/L.reuteri, vector/L.reuteri and LPS were incubated with immature swine mononuclear-derived DCs for 12h, and DCs without recombinant Lactobacillus were used as cell controls. The cells were collected in EP tubes by centrifugation at 3500r/min for 5min after washing 2 times with PBS to remove recombinant lactobacilli not bound to immature DCs, and RNA was extracted using the total RNA extraction kit. Adding oligo DT into the obtained total RNA system, mixing thoroughly, water-bathing at 75deg.C for 10min, ice-bathing for 5min, and adding reverse transcription system to carry out reverse transcription. Fully and uniformly mixing, carrying out water bath at 42 ℃ for 3h, water bath at 70 ℃ for 10min, and ice bath for 5min to obtain cDNA.

Taking the obtained cDNA as a template, taking unintegrated DCs of recombinant lactobacillus as a control group, taking beta-ac tin as an internal reference gene, setting 3 parallel samples, carrying out real-time fluorescence quantitative PCR detection on cell surface molecules, setting negative control for each gene, carrying out a reaction program of 95 ℃ for 10min, entering a circulation program, carrying out circulation at 95 ℃ for 15s,60 ℃ for 1min,40 times, and adopting relative quantification of 2 ^—ΔΔCT The relative expression level of the cytokine is calculated.

Recombinant lactobacillus pPG-KC1-COE/L.reuteri, CO E/L.reuteri, vector/L.reuteri and LPS expressing fusion antigens of different DCs targeting sequences are respectively incubated with immature swine mononuclear source DCs, the LPS incubation group is used as a positive control group, qRT-PCR is used for detecting the expression quantity of surface molecules (CD 40, CD80 and CD 86), tol-like receptors (TLR-2, TLR-4, TLR-6 and TLR-9) and cytokines (IL-10, IL-12 and IFN-gamma) of the DCs, and the results show that the recombinant lactobacillus pPG-KC1-COE/L.reuteri and COE/L.reuteri can promote the up-regulation of the expression level of the surface molecules of the DCs compared with the immature DCs without the recombinant lactobacillus (see figure 20).

3.4 Effect of DCs targeting peptide KC1 on the ability of recombinant lactic acid bacteria to stimulate porcine mononuclear-derived DCs to mediate T cell proliferation

Mononuclear cell layers were isolated from 10mL of the anterior vena cava blood of piglets and the collected cells were washed 3 times with basal 1640 culture solution. With pre-warmed complete RPMI-1640 mediumResuspension, cell count, and cell concentration adjustment of approximately 2×10 ⁶ mL ^-1 Thereby obtaining a reaction cell. The obtained immature pig mononuclear DCs and DCs which are stimulated to mature by LPS or pPG-KC1-COE/L.reuteri, COE/L.reuteri and Vector/L.reuteri are treated by mitomycin C with the final mass concentration of 25 mug/mL, placed in a 37 ℃ incubator to act for 1h, and then washed by basic RPMI-1640 culture solution for 3 times. Cell counts, cells were resuspended in complete RPMI-1640 medium as stimulated cells. Pig mononuclear DCs and T lymphocytes are cultured together, 100 mu LT lymphocytes are added into each 96-well plate, and the DCs subjected to different treatments are added into the stimulated cells and the reaction cells according to the ratio of 1:1,1:10 and 1:100 respectively to make marks. Negative control wells were set as DCs alone, T cells, and blank control wells were RPMI-1640 medium. 3 replicates per well with a final volume of 200 μl were placed at 37deg.C, 5% CO ₂ Culturing in an incubator is continued for 72 hours. CCK-8 was added to 96-well plates at 20. Mu.L per well and the OD450 values were read on a microplate reader. The stimulation index (stimulation index, SI) of allogeneic mixed lymphocytes is given by SI= (OD) _sample -OD _DCsonly )/(OD _Tcellsonly -OD _{DCsblankcontrol} ). Experimental results show that the recombinant lactobacillus pPG-KC 1-COE/L.re-use and COE/L.re-use can cause significant proliferation of T cells after the DCs are stimulated, and the recombinant lactobacillus pPG-KC 1-COE/L.re-use has stronger capacity than COE/L.re-use for mediating proliferation of the T cells when the DCs are stimulated (figure 21). From the above results, it can be seen that KC1 is advantageous for the ability of recombinant lactic acid bacteria to stimulate proliferation of swine mononuclear-derived DCs mediated T cells.

4 recombinant lactic acid bacteria oral immunization of pig-induced anti-PEDV specific IgG and SIgA assay

Culturing recombinant lactobacillus pPG-COE/L.reuteri and pPG-KC1-COE/L.reuteri to OD600 value of 1.0, counting viable bacteria, adjusting to the same OD600 value, centrifuging at 4000rpm, collecting thallus for 8min, washing with PBS solution for 1 time, and re-suspending thallus with PBS to obtain bacterial amount of 10 ¹⁰ CFU/ml. SPF piglets of one month of age are divided into three groups of 3 piglets each. Each pig of the first group was orally administered 5mL pPG-COE/L.reuteri (concentration 10) ¹⁰ CFU/ml); a second group of oral doses of pPG-KC1-COE/L.reuteri; the third group of PBS orally administered at the same dosage was used as a control. Each group was inoculated orally with recombinant bacteria 1 time a day for three consecutive days, i.e. days 1, 2 and 3.

The immunized pigs were subjected to vena cava blood collection at day 0, day 7, day 14, day 21, day 28, day 35, day 42 and day 47, blood was collected at 37℃for 1 hour, left standing overnight at 4℃and centrifuged at 4000r/min for 8min, and serum was isolated and stored at-40℃for further use. Serum antibody titers were detected by ELISA. Coating a 96-well micro-reaction plate with PEDV standard antigen, coating overnight, washing with PBST 3 times, adding 200 μl of sealing solution into each well, sealing at 37deg.C for 2h, and washing with PBST 3 times; adding diluted pig serum, reacting at 37deg.C for 1 hr, discarding, washing with PBST for 3 times, adding HRP-labeled mouse anti-pig IgG, reacting at 37deg.C for 30min, washing with PBST for 3 times, adding TMB A, B chromogenic solution, developing at 37deg.C in dark for 15min, adding stop solution, and measuring OD 490nm with enzyme marker instrument.

Immunized pigs were collected with nasal and anal swabs on days 0, 7, 14, 21, 28, 35, 42 and 47, respectively. The specific method comprises the following steps: the swab was rinsed with 200 μlpbs and stored at-40 ℃ for later use. Mucosal antibody levels were detected by ELISA: PEDV standard antigen is coated on a 96-well micro-reaction plate, the coating is carried out overnight, PBST is washed 3 times, 200 mu l of sealing liquid is added into each well, sealing is carried out at 37 ℃ for 2 hours, and PBST is washed 3 times; adding diluted nasal cavity and anus swab flushing liquid, reacting for 1h at 37 ℃, discarding liquid, washing for 3 times by PBST, adding HRP-labeled mouse anti-pig sIgA, reacting for 30min at 37 ℃, washing for 3 times by PBST, adding TMB A, B developing liquid, developing for 15min at 37 ℃ in a dark place, adding stop liquid, and measuring OD490 nm by an enzyme-labeling instrument.

Serum was collected at days 0, 7, 14, 21, 28, 35, 42 and 47 post-immunization, respectively, and ELISA detected anti-PEDV specific IgG levels in serum, as shown in FIG. 14, igG started to be produced at day 7 post-immunization, and IgG was higher in the pPG-KC1-COE/L.reuteri group than in the pPG-COE/L.reuteri group (p < 0.05) at day 21, and the targeted peptide group was not significantly different from the control peptide group on day 49 post-immunization.

Serum, nasal and anal swabs were collected at days 0, 7, 14, 21, 28, 35, 42 and 47 post-immunization, respectively, and ELISA detected serum, nasal and anal mucosa anti-PEDV specific sIgA levels as shown in FIG. 22, the sIgA of the pPG-KC1-COE/L.reuteri group was significantly higher at day 7 post-immunization than that of the pPG-COE/L.reuteri group (p < 0.001), and the difference between the targeting peptide group and the control peptide group was insignificant at day 49 post-immunization.

In conclusion, fusion expression of the porcine DC targeting peptide KC1 (KCCYPN) can enhance the recognition and ingestion capacity of porcine DCs on antigens and enhance the immune function of porcine DCs. Experiments prove that the recombinant lactobacillus reuteri oral immunization of pigs expressing the porcine DCs targeting peptide KC1 fusion antigen induces remarkable cellular immunity and humoral immunity, shows that KC1 has good targeting property and can be used as a good adjuvant of lactobacillus vaccine.

Claims

1. The recombinant lactobacillus for fusion expression of the pig-derived dendritic cell targeting peptide KC1 and PEDV neutralizing epitope COE is characterized by comprising plasmids for fusion expression of the pig-derived dendritic cell targeting peptide KC1 and pig epidemic diarrhea virus (PorcineEpidemicDiarrheavirus, PEDV) neutralizing epitope COE, wherein the amino acid sequence of the pig-derived dendritic cell targeting peptide KC1 is shown as SEQ ID NO. 1.

2. The lactobacillus set according to claim 1, wherein the amino acid sequence of the fusion protein of the pig-derived dendritic cell targeting peptide KC1 and PEDV neutralizing epitope COE is shown in SEQ ID NO. 2.

3. The lactobacillus set according to claim 1, wherein the nucleotide sequence of the fusion protein encoding the porcine dendritic cell targeting peptide KC1 and PEDV neutralizing epitope COE is shown in SEQ ID No. 3.

4. The lactobacillus set as claimed in claim 1 wherein the plasmid is a pPG-T7g10-PPT plasmid for fusion expression of a porcine dendritic cell targeting peptide KC1 and a porcine epidemic diarrhea virus neutralizing epitope COE.

5. A method of constructing the recombinant lactobacillus according to any of claims 1 to 4, comprising the steps of:

(1) Designing and synthesizing a primer sequence of a KC1 gene of the following pig dendritic cell targeting peptide, wherein a KC1-COE-F primer is introduced into a SacI enzyme cutting site, a HindIII enzyme cutting site, a KC1 polypeptide fragment, a Linker sequence and a COE fragment, and a KC1-COE-R primer is introduced into an ApaI enzyme cutting site, an XhoI enzyme cutting site, a Flag tag sequence and the COE fragment;

5’-CGAGCTCATGCCCAAGCTTAAGTGTTGTTATCCGAATCCGCTC KC1-COE-F：GAGGAAGCCGCAGCCAAAGAGGCTGCAGCCAAGGTTACTTTGCCATCATT-3’

KC1-COE-R：5’-GGGCCCCTTATCGTCGTCATCCTTGTAATCGTCCGTGACACCT

TCAAGTGGTTTAGGCGTGCCAGT-3’

(2) Amplifying KC1-COE gene fragments containing Fla g tag sequences by using a primer KC1-COE-F/R by taking plasmids containing COE coding sequences as templates, and recovering PCR products obtained after amplification, and preserving at-20 ℃ for later use;

(4) The recombinant plasmid pEASY-Blunt-KC1-COE and the expression vector pPG-T7g10-PPT are subjected to SacI and ApaI double digestion, and KC1-COE gene fragments and vector fragments are respectively recovered; connecting the recovered gene fragment KC1-COE with a pPG-T7g10-PPT vector, thermally converting the connection product into escherichia coli DH5 alpha, extracting a recombinant plasmid and naming the recombinant plasmid as the pPG-KC1-COE;

(5) Sterile procedure Single colonies on the thermal conversion plates were picked and inoculated at 100. Mu.g/mLCm ⁺ Culturing in a shaking incubator at 37 ℃ for 12 hours in a 5ml LB liquid medium, extracting recombinant plasmid pP G-KC1-COE by using a small plasmid kit, determining the sequence of the inserted sequence, and determining that the sequence inserted into the recombinant plasmid is correct by a sequencing result, wherein the construction of the recombinant plasmid pPG-KC1-COE is completed;

(6) Construction and identification of pPG-KC1-COE/L.reuteri

6. Use of the recombinant lactobacillus according to any of claims 1 to 4 for the manufacture of a medicament for the prevention or treatment of porcine epidemic diarrhea virus infection.

7. The use according to claim 6, wherein the medicament is a vaccine.