CN116355761A - Novel aerobic denitrification fungus method for treating low carbon nitrogen ratio micro-polluted water body - Google Patents

Abstract

The invention relates to the technical field of microbial screening, in particular to a novel method for treating aerobic denitrifying fungi of a low carbon nitrogen ratio micro-polluted water body, which comprises a fungus with aerobic denitrifying capability, and is characterized in that: the fungus is filamentous fungus, NCBI accession number is: OK560676, named: penicillium brasiliensis the fungus screening method is to obtain the fungus through water sample membrane enrichment and plate separation culture screening under the conditions of constant temperature dark culture with the pH value of 5.6 and the temperature of 30 ℃, wherein the fungus enrichment method comprises the following steps: using a vacuum suction filter to enrich fungi in 100mL of water body through a 0.22 mu m acetate fiber filter membrane, wherein the culture period is 3 days, the temperature is 30 ℃, and the fungus screening method is to obtain the water body through membrane enrichment and plate separation culture screening under the conditions of constant temperature dark culture with the pH value of 5.6 and the temperature of 30 ℃; the invention realizes good effect of removing the nitrate nitrogen, solves the problem of difficult screening of aerobic denitrifying fungi, and provides a screening and identifying method.

Description

Novel aerobic denitrification fungus method for treating low carbon nitrogen ratio micro-polluted water body

Technical Field

The invention relates to the technical field of microbial screening, in particular to a novel method for treating aerobic denitrifying fungi of a low carbon nitrogen ratio micro-polluted water body.

Background

The low carbon nitrogen ratio denitrification is an important field of water treatment, and the biological denitrification method is an efficient, green and low-cost denitrification mode. Microbial denitrification in the traditional sense is performed by denitrification under anaerobic conditions by bacteria. This allows denitrification to be performed under aerobic conditions as the aerobic denitrification strains are separated in large amounts, and also provides the possibility for simultaneous nitrification-denitrification processes. The nitrification-denitrification process reduces the treatment cost and has higher removal efficiency than the conventional nitrification-denitrification process.

At present, research is mainly focused on aerobic denitrifying microorganisms which mainly take bacteria as main materials, and reports on aerobic denitrifying fungi are rare. In addition, compared with aerobic denitrifying bacteria, the aerobic denitrifying bacteria have stronger adaptability and tolerance, especially in severe environments. Therefore, the fungus with the aerobic denitrification capability is screened out to provide new insight for removing nitrate from the water body in the low carbon nitrogen ratio environment, and has important significance for the actual treatment of the landscape water body.

Based on the method, the invention designs a novel aerobic denitrification fungus method for treating the slightly polluted water body with low carbon nitrogen ratio so as to solve the problems.

Disclosure of Invention

In order to achieve the above purpose, the present invention provides the following technical solutions:

a novel method for treating aerobic denitrification fungi of a low carbon nitrogen ratio micro-polluted water body comprises a fungus with aerobic denitrification capability, and is characterized in that: the fungus is filamentous fungus, NCBI accession number is: OK560676, named: penicillium brasiliensis.

The new aerobic denitrifying fungus method for treating the micro-polluted water body with the low carbon nitrogen ratio specifically comprises the following steps:

s1, fungus screening method is that under the condition of constant temperature dark culture with pH value of 5.6 and 30 ℃, water sample enrichment and plate separation culture screening are carried out to obtain the fungus;

wherein, the fungus enrichment method comprises the following steps: using a vacuum suction filter to enrich fungi in 100mL of water body through a 0.22 mu m acetate fiber filter membrane, attaching the enriched filter membrane to a fungi solid flat plate, wherein the culture period is 3 days, and the temperature is 30 ℃;

s2, preparing a denitrification culture medium: the method comprises dissolving 4.130g of C6H12O6, 0.108g of KNO3, 0.1g of MgSO4, 1.5g of KH2PO4, 5.0g of NaHPO4.7H2O and 2mL of trace element solution with ultrapure water at 25deg.C, metering the volume with 1000mL volumetric flask, transferring the solution to 1000mL conical flask, adjusting pH to 7.2, and sterilizing at 121deg.C for 30 min;

s3, preparing a microelement solution: adding 4.4mg ZnSO4, 144mg EDTA-2Na, 10.2mg MnCl2.4H2O, 11mg CaCl2, 10mg FeSO4.7H2O, 3.2mg CuSO4.5H2O, 2.2mg (NH 4) 6Mo7O 24.4H2O and 3.2mg CoCl2.6H2O into a 1000mL volumetric flask, keeping the volumetric flask constant to 1L, and refrigerating at 4 ℃;

s4, enrichment culture preparation: 5g peptone, 10g C6H12O6, 1g KH2PO4, 0.5g MgSO4, 0.025g C20H2Cl4I4Na2O5, 0.002g C6H4Cl2N2O2, 0.1g C11H12Cl2N2O5, 15g agar and ultrapure water are added into a 1000mL volumetric flask to carry out constant volume, the pH value is adjusted to 5.6 after the solution is transferred into a 1000mL conical flask, and the solution is sterilized at the high temperature of 121 ℃ for 30 minutes;

s5, fungus separation and purification method: the method comprises the steps of carrying out flame sterilization and cooling on an inoculating loop, dipping a fungus community attached to a filter membrane, carrying out plate separation culture by a cross streaking method, and culturing in a temperature box at 30 ℃ for 2-5 days after streaking is finished, wherein if mixed bacteria appear, streaking is needed to be repeated for a plurality of times;

s6, detecting total nitrogen, nitrate nitrogen, nitrite nitrogen and ammonia nitrogen in a denitrification culture medium, wherein the total nitrogen detection method is an alkaline potassium persulfate ultraviolet spectrophotometry, the nitrate nitrogen detection method is an ultraviolet spectrophotometry, the nitrite nitrogen detection method is an N- (1-naphthyl) -ethylenediamine spectrophotometry, and the ammonia nitrogen detection method is a Nashi reagent spectrophotometry, the method adopts an ITS identification method, the identification method adopts an amplification program of PCR, the method comprises the steps of pre-denaturation at 94 ℃ for 5min, deformation at 94 ℃ for 45S, annealing at 55 ℃ for 45S, extension at 72 ℃ for 1min and 30 cycles, repair extension at 72 ℃ for 10min and termination of reaction at 4 ℃, and the PCR amplification system in the identification method comprises 0.5 mu L of Template (20-50 ng/. Mu.L) of genomic DNA, 2.5 mu L of 10 XBuffer (containing Mg < 2+ >), 1 mu L of dNTP (2.5 mM each), 0.5 mu L of polymerase, positive and negative polymer (10 uM) and 0.5 mu L of distilled water, wherein the PCR amplification system comprises the following primer sequences:

ITS1：TCCGTAGGTGAACCTGCGG

ITS4：TCCTCCGCTTATTGATATGC

s7, analyzing a fungus PCR amplification result, specifically performing comparison of the obtained sequencing data with a GenBank database, referring to a fungus identification manual, obtaining the species of the strain and drawing a phylogenetic tree

S8, performing flame sterilization and cooling on the separated and purified fungi by using an inoculating loop, picking fungus colonies, adding the fungus colonies into a denitrification liquid culture medium containing 150mL, placing the culture medium into an oscillation incubator at the rotating speed of 120rpm for 3 days at the temperature of 30 ℃, and measuring the total nitrogen, nitrate nitrogen, nitrite nitrogen and ammonia nitrogen content in the denitrification culture medium.

Compared with the prior art, the invention has the beneficial effects that:

the fungus strain has good denitrification capability. Meanwhile, the strain is subjected to the denitrification treatment of landscape raw water, the total nitrogen removal rate in the natural water is as high as 80%, the method is simple and effective to remove nitrogen pollution in the natural water, provides a new insight for removing nitrate in the water with low carbon nitrogen ratio, solves the screening difficulty of aerobic denitrifying fungi, and provides a screening and identifying method.

Drawings

In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings that are needed for the description of the embodiments will be briefly described below, and it is obvious that the drawings in the following description are only some embodiments of the present invention, and that other drawings may be obtained according to these drawings without inventive effort for a person skilled in the art.

FIG. 1 is a schematic diagram of a fungal sequence listing of the present invention;

FIG. 2 is a comparative schematic diagram of strains according to the present invention;

FIG. 3 is a schematic diagram showing nitrate removal by the Penicillium strain of the present invention with glucose as substrate;

FIG. 4 is a schematic diagram showing the rapid growth and total organic carbon removal of the Penicillium strain of the present invention with glucose as a substrate;

FIG. 5 is a schematic diagram showing a denitrification experiment performed on park landscape raw water by using the Penicillium strain of the present invention.

Detailed Description

The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings in the embodiments of the present invention, and it is apparent that the described embodiments are only some embodiments of the present invention, but not all embodiments, and all other embodiments obtained by those skilled in the art without making creative efforts based on the embodiments of the present invention are included in the protection scope of the present invention.

In order that the invention may be readily understood, a more complete description of the invention will be rendered by reference to the appended drawings. Several embodiments of the invention are presented in the figures. This invention may, however, be embodied in many different forms and should not be construed as limited to the embodiments set forth herein. Rather, these embodiments are provided so that this disclosure will be thorough and complete.

It will be understood that when an element is referred to as being "mounted" on another element, it can be directly on the other element or intervening elements may also be present. When an element is referred to as being "connected" to another element, it can be directly connected to the other element or intervening elements may also be present. The terms "vertical," "horizontal," "left," "right," and the like are used herein for illustrative purposes only.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The terminology used herein in the description of the invention is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. The term "and/or" as used herein includes any and all combinations of one or more of the associated listed items.

Referring to fig. 1-5, the present invention provides a technical solution:

a novel method for treating aerobic denitrification fungi of a low carbon nitrogen ratio micro-polluted water body comprises a fungus with aerobic denitrification capability, and is characterized in that: the fungus is filamentous fungus, NCBI accession number is: OK560676, named: penicillium brasiliensis.

A method of screening for aerobic denitrifying fungi comprising the steps of:

step 1: preparation of enriched culturable fungal medium: the culture medium comprises 5g of peptone, 10g of glucose, 1g of dipotassium hydrogen phosphate, 0.5g of magnesium sulfate, 0.025g of rose bengal, 0.002g of ammonium chloride, 0.1g of chloramphenicol and 15g of agar per liter. Mixing the above materials into 1000mL volumetric flask, adding ultrapure water to desired volume, pouring into 1L sterile conical flask, adjusting pH to 5.6+ -0.2, sterilizing the culture medium in high pressure steam sterilizing pot at 121deg.C for 30min, and cooling to 55deg.C to obtain solid plate.

Step 2: enrichment culture: 100mL of water sample of the water source reservoir is filtered by a 0.22-mu m polyester fiber membrane, the filter membrane is taken down by sterile forceps after filtration is completed and is attached to a fungus solid flat plate, under the condition that no bubble is ensured on the attached membrane, the oxygen of a constant temperature incubator is ensured to be sufficient, the flat plate is placed in the constant temperature incubator at 30 ℃ in an inverted mode for 3 to 5 days until the colony size is uniform and can be picked up.

Step 3: and (3) picking up the greenish villiated thallus of the culture medium in the step (2), scribing and separating again on the culture medium prepared in the step (1), ensuring that the oxygen of the constant temperature incubator is sufficient, putting the flat plate upside down, and growing in the constant temperature incubator at 30 ℃ for three to five days. The above steps are repeated until the fungi on the solid plate have clear turquoise strains, consistent appearance and size and no other fungi and bacteria are associated.

Based on the scheme, the preparation of the aerobic denitrification culture medium is carried out: the culture medium comprises 0.413 g of glucose, 0.108g of potassium nitrate, 0.1g of magnesium sulfate, 1.5g of dipotassium hydrogen phosphate, 5.0g of sodium hydrogen phosphate heptahydrate and 2ml of trace element solution per liter, wherein the trace element solution is prepared by: zinc sulfate 4.4mg, disodium ethylenediamine tetraacetate 144mg, manganese chloride tetrahydrate 10.2mg, calcium chloride 11mg, ferrous sulfate heptahydrate 10mg, copper sulfate pentahydrate 3.2mg, ammonium molybdate 2.2mg, cobalt chloride hexahydrate 3.2 mg;

step 4: the identification method of the aerobic denitrifying fungus comprises the identification of the aerobic denitrifying fungus capability and growth, the identification of the obligate aerobic and the identification of molecular biology;

step A: aerobic denitrification fungus capability and growth identification

Preparing the aerobic denitrification culture medium in the step 3, sterilizing the culture medium together with a 250mL conical flask, and adding 150mL of the culture medium into the 250mL conical flask after the sterilization is finished. After picking the fungal colonies on the plate with the inoculating loop, they were added to a 250mL Erlenmeyer flask. The above flask was placed in a shaking incubator at a rotation speed of 120rpm and a temperature of 30 ℃.10 mL of bacterial liquid is taken every 3 hours to be used for measuring the change of nitrate nitrogen, nitrite nitrogen, ammonia nitrogen, total nitrogen and soluble total organic carbon. The remaining bacterial liquid was used to determine the growth characteristics of the strain, and the specific procedure was to measure the absorbance of the bacterial liquid at a wavelength of 600nm to represent the cell density. If the removal rate of nitrate and ammonium salt of the strain is higher than 85% within 48 hours, the strain to be detected has aerobic denitrification capability;

and (B) step (B): and (3) specificity aerobic identification:

inoculating the aerobic denitrifying fungus identified in the step A to a denitrifying liquid culture medium, transferring the denitrifying fungus to an anaerobic bottle after the denitrifying fungus reaches a stable period, and flushing nitrogen for sealing; after the strain is placed in a constant temperature incubator at 30 ℃ for 7 days, if no obvious growth sign exists, the strain is strictly aerobic denitrifying fungus.

Step C: fungal molecular biology identification:

b, extracting DNA and carrying out PCR amplification sequencing on the fungi separated and purified in the step B; the method comprises the following specific steps: extracting the DNA of fungi according to the specification by using an Ezup column type fungus genome DNA extraction kit, performing PCR amplification on the extracted DNA, and selecting the transcription region spacing regions 1 and 2 in the fungus primer, wherein the PCR length is about 600 bp. The specific sequence is as follows:

ITS1：TCCGTAGGTGAACCTGCGG

ITS4：TCCTCCGCTTATTGATATGC

the PCR amplification system was 0.5. Mu.L of Template (20-50 ng/. Mu.L of genomic DNA), 2.5. Mu.L of 10 XBuffer (containing Mg2+), 1. Mu.L of dNTP (each 2.5 mM), 0.5. Mu.L of polymerase, 0.5. Mu.L of forward and reverse polymers (10. Mu.M), and 9.5. Mu.L of distilled water was added. The PCR cycle conditions were: pre-denaturation at 94 ℃ for 5min, deformation at 94 ℃ for 45s, annealing at 55 ℃ for 45s, extension at 72 ℃ for 1min, 30 cycles, repair extension at 72 ℃ for 10min, and termination reaction at 4 ℃.

Electrophoresis gel was performed on the amplified fragment, and electrophoresis was performed at a voltage of 150V for 20min at a current of 100mA under 1% agarose. The PCR product electrophoresed bands cut the desired bands of fungal DNA.

Cloning sequencing of fungi requires ligation and preparation of competent cells. The specific steps are as follows

18-T Vector ligation kit procedure. The preparation of competent cells selects the calcium chloride method, and the specific operation is as follows: a single colony was picked from a fresh plate incubated at 37℃for 16 hours and transferred to a 1L flask containing 100mL of LB medium. The culture was vigorously shaken at 37℃for 3 hours (rotary shaker, 300 rpm). Bacteria were transferred under sterile conditions to a sterile, single-use, 50mL polypropylene tube pre-chilled with ice, and placed on ice for 10min, and the culture was allowed to cool to 0 ℃. After the culture temperature reached 4℃and centrifugation at 4000rpm for 10min, the cells were recovered. The culture broth was decanted and the tube was inverted for 1min to drain out the last traces of culture broth remaining. Precooling with 10mL of iceEach pellet was resuspended in 0.1mol/L CaCl2 and placed on an ice bath. After centrifugation at 4000rpm for 10min at 4℃the cells were recovered. The culture broth was decanted and the tube was inverted for 1 minute to drain out the last traces of culture broth remaining. Each cell pellet was resuspended with 2mL of 0.1mol/L CaCl2 (20% glycerol) pre-chilled with ice per 50mL of initial culture. Finally, the cells were divided into small portions (100. Mu.L/branch) and frozen at-70 ℃.

The competent cell ligation product was transformed by taking 100. Mu.L of competent cells, placing them on ice, and gently suspending the cells after complete thawing. Subsequently, 10. Mu.L of the ligation mixture was added and gently mixed. Placed on ice for 30 minutes. Heat shock is carried out for 90s in a water bath at the temperature of 42 ℃ and the mixture is placed on ice for 15 to 20min. 400. Mu.L of LB medium was added thereto, and the mixture was cultured at 37℃and 200 to 250rpm with shaking for 1 hour. mu.L of the culture broth was pipetted with a gun head and plated onto ampicillin plates previously coated with 20. Mu.L of 100mM IPTG and 100. Mu.L of 20mg/ml X-gal. Finally, the plate was left to stand forward at 37℃for 1 hour to absorb excess liquid, and then incubated upside down overnight.

The DNA fragments were subjected to blue-white screening. The specific operation is as follows: when the foreign DNA fragment was inserted into pUC57, the recombinant clone appeared white on the X-gal/IPTG plate, but not the recombinant clone, because the presence of the nucleic acid sequence of the foreign DNA altered the encoding of the LacZ gene, thereby affecting the activity of the β -galactosidase α -fragment, and therefore white colonies grown on the IPTG/X-gal plate were selected as sequencing targets.

Plasmids from the sequenced subjects were extracted and sequenced. The method comprises the following specific steps: amplification with M13+ primers (specific system as in step C). M13+/-primer sequencing was then performed.

The length of the fungus strain sequence is 487bp; uploading the sequencing result to NCBI to obtain accession number, accession number is OK560676, performing Blast on other sequences in GenBank, using some fungi which are common to the obtained result and database as phylogenetic tree, aligning the sequences by MEGA 5.0 software and selecting maximum likelihood estimation method for analysis, wherein the result is shown in figure 1, and the result shows that the fungi to be tested has 97% similarity with Penicillium brasilianum CBS (NR 111499.1), so the identified strain is penicillium brazilian.

Based on the scheme, the bacterial liquid and the sterile glycerin in the ratio of 1:1 in the stable period of the aerobic denitrifying fungus are taken and stored at the temperature of 50m centrifuge tube to 20 ℃. If the nitrification-aerobic denitrification experiment of the water body with the low carbon nitrogen ratio is carried out, the frozen bacterial liquid needs to be activated and cultured under the conditions of 30 ℃ and 120rpm of denitrification culture medium for use.

Identification of denitrification performance of aerobic denitrification fungi:

after the penicillium liquid stored in the step C is activated, the phosphate buffer solution is used for adjusting the cell density value OD600 to 0.3, 3mL of the bacterial liquid is added into the denitrification culture medium, the nitrate concentration in the denitrification culture medium is 15mg/L, and the total organic carbon concentration is 150mg/L. The culture was carried out at a rotation speed of 120rpm and a temperature of 30℃for 48 hours. The results of nitrate and other forms of nitrogen changes are shown in figure 2. The results of the growth characteristics of the Penicillium strain and the removal characteristics of the total organic carbon are shown in FIG. 4.

In FIG. 3, the effect of the Penicillium strain on nitrate removal was evident with glucose as substrate, and the nitrate concentration was reduced from 15mg/L to 8.32mg/L within 12 hours. After 48 hours, the nitrate is reduced to 1.62mg/L, and the nitrate removal rate reaches 89.20 percent. There was a slight nitrite accumulation around 15 hours, but it disappeared soon.

In fig. 4, the penicillium strain grows rapidly with glucose as substrate and is evident for total organic carbon removal. Within 21 hours, the OD600 of the Penicillium strain increased from 0 to a maximum of 0.310. After 48 hours, the removal rate of the penicillium strain on the total organic carbon is as high as 90%.

In FIG. 5, the penicillium strain is used for carrying out a denitrification experiment on park landscape raw water, the nitrate concentration in the raw water is 4.08mg/L, the ammonia nitrogen is 1.11mg/L, the nitrite nitrogen is 0.13mg/L, the soluble organic carbon is 24.2mg/L, after 0.2g of the commercial biodegradable plastic bag is added, the denitrification experiment is carried out for 7 days, the nitrate removal rate is more than 80%, and the ammonia nitrogen and the nitrite nitrogen are completely removed in the 2 nd day, so that the penicillium strain has a remarkable denitrification effect on the actual landscape raw water.

Although embodiments of the present invention have been shown and described, it will be understood by those skilled in the art that various changes, modifications, substitutions and alterations can be made therein without departing from the principles and spirit of the invention, the scope of which is defined in the appended claims and their equivalents.

Claims (2)

1. An aerobic denitrification fungus for treating a micro-polluted water body with low carbon nitrogen ratio, which comprises a fungus with aerobic denitrification capability, and is biologically characterized in that: the fungus is filamentous fungus, NCBI accession number is: OK560676, named: penicillium brasiliensis.

2. The novel aerobic denitrification fungus method for treating a micro-polluted water body with a low carbon nitrogen ratio according to claim 1, which comprises the following steps:

s1, fungus screening method is that under the condition of constant temperature dark culture with pH value of 5.6 and 30 ℃, water sample enrichment and plate separation culture screening are carried out to obtain the fungus;

wherein, the fungus enrichment method comprises the following steps: using a vacuum suction filter to enrich fungi in 100mL of water body through a 0.22 mu m acetate fiber filter membrane, attaching the enriched filter membrane to a fungi solid flat plate, wherein the culture period is 3 days, and the temperature is 30 ℃;

s2, preparing a denitrification culture medium: the method comprises dissolving 4.130g of C6H12O6, 0.108g of KNO3, 0.1g of MgSO4, 1.5g of KH2PO4, 5.0g of NaHPO4.7H2O and 2mL of trace element solution with ultrapure water at 25deg.C, metering the volume with 1000mL volumetric flask, transferring the solution to 1000mL conical flask, adjusting pH to 7.2, and sterilizing at 121deg.C for 30 min;

s3, preparing a microelement solution: adding 4.4mg ZnSO4, 144mg EDTA-2Na, 10.2mg MnCl2.4H2O, 11mg CaCl2, 10mg FeSO4.7H2O, 3.2mg CuSO4.5H2O, 2.2mg (NH 4) 6Mo7O 24.4H2O and 3.2mg CoCl2.6H2O into a 1000mL volumetric flask, keeping the volumetric flask constant to 1L, and refrigerating at 4 ℃;

s4, enrichment culture preparation: 5g peptone, 10g C6H12O6, 1g KH2PO4, 0.5g MgSO4, 0.025g C20H2Cl4I4Na2O5, 0.002g C6H4Cl2N2O2, 0.1g C11H12Cl2N2O5, 15g agar and ultrapure water are added into a 1000mL volumetric flask to carry out constant volume, the pH value is adjusted to 5.6 after the solution is transferred into a 1000mL conical flask, and the solution is sterilized at the high temperature of 121 ℃ for 30 minutes;

s5, fungus separation and purification method: the method comprises the steps of carrying out flame sterilization and cooling on an inoculating loop, dipping a fungus community attached to a filter membrane, carrying out plate separation culture by a cross streaking method, and culturing in a temperature box at 30 ℃ for 2-5 days after streaking is finished, wherein if mixed bacteria appear, streaking is needed to be repeated for a plurality of times;

s6, detecting total nitrogen, nitrate nitrogen, nitrite nitrogen and ammonia nitrogen in a denitrification culture medium, wherein the total nitrogen detection method is an alkaline potassium persulfate ultraviolet spectrophotometry, the nitrate nitrogen detection method is an ultraviolet spectrophotometry, the nitrite nitrogen detection method is an N- (1-naphthyl) -ethylenediamine spectrophotometry, and the ammonia nitrogen detection method is a Nashi reagent spectrophotometry, the method adopts an ITS identification method, the identification method adopts an amplification program of PCR, the method comprises the steps of pre-denaturation at 94 ℃ for 5min, deformation at 94 ℃ for 45S, annealing at 55 ℃ for 45S, extension at 72 ℃ for 1min and 30 cycles, repair extension at 72 ℃ for 10min and termination of reaction at 4 ℃, and the PCR amplification system in the identification method comprises 0.5 mu L of Template (20-50 ng/. Mu.L) of genomic DNA, 2.5 mu L of 10 XBuffer (containing Mg < 2+ >), 1 mu L of dNTP (2.5 mM each), 0.5 mu L of polymerase, positive and negative polymer (10 uM) and 0.5 mu L of distilled water, wherein the PCR amplification system comprises the following primer sequences:

ITS1：TCCGTAGGTGAACCTGCGG

ITS4：TCCTCCGCTTATTGATATGC

s7, analyzing a fungus PCR amplification result, specifically performing comparison of the obtained sequencing data with a GenBank database, referring to a fungus identification manual, obtaining the species of the strain and drawing a phylogenetic tree

S8, performing flame sterilization and cooling on the separated and purified fungi by using an inoculating loop, picking fungus colonies, adding the fungus colonies into a denitrification liquid culture medium containing 150mL, placing the culture medium into an oscillation incubator at the rotating speed of 120rpm for 3 days at the temperature of 30 ℃, and measuring the total nitrogen, nitrate nitrogen, nitrite nitrogen and ammonia nitrogen content in the denitrification culture medium.

Images