CN116254272A

CN116254272A - Application of gene OsPIN10b in plant root elongation

Info

Publication number: CN116254272A
Application number: CN202210852947.XA
Authority: CN
Inventors: 孙虎威; 赵全志; 王博博
Original assignee: Henan Agricultural University
Current assignee: Henan Agricultural University
Priority date: 2020-12-11
Filing date: 2020-12-11
Publication date: 2023-06-13
Also published as: CN112430604B; CN112430604A

Abstract

The present application is a divisional application of 202011444476.6. The invention relates to the field of plant growth and development molecular biology, in particular to application of a gene OsPIN10b in plant root elongation, wherein the gene OsPIN10b has a nucleotide sequence shown as SEQ ID NO. 1, and the gene OsPIN10b is applied in regulation and control of plant root length traits. According to the invention, the transgenic vector is constructed by cloning the gene OsPIN10b, so that the over-expression and knockout transgenic material is obtained, the phenotype character of the transgenic material is measured, and the obvious change of the root morphology in different materials is obtained, and compared with the knockout transgenic material and wild type material, the over-expression material shows the characters of root length increase and the like, so that the OsPIN10b gene plays an important regulation and control function in the rice root elongation development process.

Description

Application of gene OsPIN10b in plant root elongation

The present patent application is a divisional application. The original application number is 202011444476.6, the application date is 12 months 11 days in 2020, and the invention name is: genetic engineering application of gene OsPIN10 b.

Technical Field

The invention relates to the field of plant growth and development molecular biology, in particular to application of a gene OsPIN10b in plant root elongation.

Background

Auxins are the only phytohormones with definite polar transport properties and need to rely on auxin input and output vectors to assist in cell entry and exit. AUX family proteins belong to the input vector affecting the transport of auxins into the cell, while PIN family proteins belong to the auxin output vector responsible for transporting auxins from the cell to the outside (Rutschow et al, 2014; zhou et al, 2018), and the concentration gradients of auxins formed by their polar transport can affect many physiological processes of plants, including root growth and tropism (Woodward et al, 2005;Vanneste et al, 2009). The polar transport of auxins in plant tissues is largely due to highly regulated, polar-localized PIN family proteins (Friml et al, 2002). In arabidopsis, the PIN family genes are cloned into a total of 8 genes (Benkova et al, 2003); homologous genes for 12 PINs were predicted in rice (Wang et al, 2009); there are also 12 PIN homologous genes reported in maize (forstan et al 2012); homologous genes are also found in plants such as soybean, wild cherry and poplar (Zazimalova et al, 2007). The polar auxin transport transporter PIN1 is involved in basal transport of plant shoot apex auxin and in apical transport of roots (Blilou et al 2005), and therefore upregulation of PIN1 transcription and protein level expression may promote transport of shoot apex auxin to the root tip, which may be one of the causes of elevated root auxin. Pin3 and PIN7, which are located in the columella cells, have the function of transporting auxin laterally and maintaining the concentration gradient of auxin in this region (Petrek et al 2009;Ganguly et al, 2010), while PIN4, which is expressed in the stationary center of the root tip and in the cells below, has the function of maintaining the level of auxin in this region and its concentration gradient, and is involved in the regulation of meristem development of the root tip (Friml et al 2002). Therefore, the PIN family genes play a very important role in regulating and controlling the growth and development process of rice. Gene functions of the PIN family in rice are to be further discovered.

Disclosure of Invention

The rice OsPIN10b is homologous to PIN1 in Arabidopsis thaliana, codes 592 amino acid and has a molecular weight of 62.93124KD. Through cloning to the OsPIN10b gene and connecting an over-expression vector, the transgenic strain research shows that the root system development, the leaf angle, the leaf length and the plant height are obviously changed, which is shown by the characters of increasing the length of the root system, obviously reducing the number of lateral roots, increasing the angle of the root system, increasing the leaf angle, shortening the leaf length, reducing the plant height and the like, and the important regulation and control functions of the OsPIN10b gene in the growth and development processes of the root system, the leaf angle and the plant height of rice are shown.

The first aspect of the present invention provides the following technical solutions:

the gene OsPIN10b has a nucleotide sequence shown in SEQ ID NO. 1, and the gene OsPIN10b is applied to regulating at least one of plant root system development, leaf development and plant height.

Further, the root development includes any one or more of root length, root angle, and lateral root number;

the leaf development includes either or both of leaf angle and leaf length.

According to the invention, through cloning gene OsPIN10b, constructing a transgenic vector, obtaining an over-expression and knockout transgenic material, and performing phenotypic character measurement on the transgenic material, obtaining obvious changes of root morphology in different materials. Compared with the knockout transgenic material and the wild rice material, on one hand, the over-expression material shows the characters of increasing the length and angle of the root system, obviously reducing the number of lateral roots and the like, which proves that the OsPIN10b gene plays an important regulation and control function in the growth and development process of the root system of the rice; on the other hand, the leaf angle and the leaf length of the over-expression material are obviously changed, and compared with the knocked-out transgenic material and the wild rice material, the over-expression material is characterized in that the leaf angle is increased and the leaf length is shortened, so that the OsPIN10b gene plays an important regulation and control function in the growth and development process of rice leaves; in the third aspect, the plant height also has obvious phenotype change, and compared with the transgenic material knocked out and the wild rice material, the plant height of the over-expression material is obviously reduced, which proves that the OsPIN10b gene plays an important role in the growth and development process of the rice plant height.

In addition, the tissue localization of the OsPIN10b gene was examined using transgenic materials, and found that the OsPIN10b gene was expressed in germinated seeds, pericycle of roots, root-stem junctions, vascular bundles, veins, young spikes, anthers, and grouted seeds, respectively.

Further, over-expression of the gene OsPIN10b promotes root elongation, reduces lateral root number, increases root angle, increases leaf angle, shortens leaf length and reduces plant height.

The gene OsPIN10b has obvious effect on plant root system development, which indicates that the gene OsPIN10b is closely related to plant root system development, in particular to the length of the longest seed root, the angle of the longest seed root and the quantity of lateral roots. Therefore, in practical application, the purpose of changing the length and angle of plant root systems and the quantity of lateral roots can be achieved by over-expressing the gene OsPIN10 b.

The gene OsPIN10b has obvious effects on plant leaf angle and leaf length development, which indicates that the gene OsPIN10b is closely related to plant leaf angle and leaf length development. Therefore, in practical application, the aim of changing the leaf angle and the leaf length of the plant can be achieved by over-expressing the gene OsPIN10 b.

The gene OsPIN10b has obvious effect on plant height development, namely, the gene OsPIN10b is closely related to plant height development. Therefore, in practical application, the aim of changing the plant height can be achieved by over-expressing the gene OsPIN10 b.

In the invention, the genetic engineering application of the gene OsPIN10b can be that the gene OsPIN10b is used as a molecular marker for plant root system development, leaf angle, leaf length and plant height development, namely, the conditions of plant root system development, leaf angle, leaf length and plant height are relatively described by detecting whether the plant has the expression of the gene OsPIN10b, so that good technical support is provided for plant breeding.

In the present invention, the plants include monocotyledonous plants and dicotyledonous plants;

the monocotyledonous plants comprise rice, corn and wheat;

the dicotyledonous plants include soybean, cotton, tobacco.

The second aspect of the invention provides a method for detecting plant root system development, leaf angle, leaf length and plant height performance, which detects the gene OsPIN10b expression condition of a sample to be detected to judge the root system development, leaf angle, leaf length and plant height performance;

the root system development comprises root system length and angle and lateral root number.

Namely judging the conditions of the root length and angle, the lateral root number, the leaf included angle, the leaf length and the plant height of the target plant through the expression condition of the gene OsPIN10b of the sample to be detected.

The detection of whether the sample to be detected contains the gene OsPIN10b can be carried out in various modes, for example, whether the sample to be detected contains the gene OsPIN10b per se can be directly detected, products generated by the gene OsPIN10b can be detected, the products comprise direct products, indirect products, secondary products and the like, and the products can be genes, proteins, certain compounds and the like.

The gene OsPIN10b can be directly detected, and can be detected by a specific primer pair of the gene OsPIN10b or by a probe or chip designed for the gene OsPIN10 b. Further, the sample to be detected is detected through a primer pair or a probe or a chip of the gene OsPIN10 b.

The primer pair or the probe or the chip for the gene OsPIN10b is designed according to a conventional method.

Further, the nucleic acid sequences of the primer pairs are shown as SEQ ID NO.2 and SEQ ID NO. 3.

However, the mode of detecting the gene OsPIN10b is not limited to this, and any mode which can be realized in molecular biology is within the scope of the invention.

Similarly, detection of the product produced by gene OsPIN10b can also be carried out by various means, such as various ELISA detection kits and the like.

Further, the sample to be tested comprises material suitable for tissue culture of sexually reproducing, asexually reproducing or regenerable cells.

These samples to be tested may be materials suitable for sexual reproduction, such as selected from pollen, ovaries, ovules, embryo sacs, etc.;

materials suitable for asexual reproduction may for example be selected from roots, stems, cuttings, protoplasts, etc.;

suitable materials for tissue culture of regenerable cells may be selected from leaves, pollen, meristematic cells, roots, root tips, seeds, embryos, cotyledons, hypocotyls, stems, and the like, for example.

Specifically, the sample to be detected includes any one of the following materials: leaves, roots, stems, radicle, embryo, seeds.

Wherein the plant comprises a monocot and a dicot; such as monocots including rice, maize, wheat; dicotyledonous plants include soybean, cotton, tobacco.

The third aspect of the invention also provides application of the gene OsPIN10b in research on genetic diversity of plant populations.

Compared with the prior art, the invention has the beneficial effects that at least the following aspects are included:

(1) Through systematic research, the invention provides the biological function of the gene OsPIN10b for the first time.

(2) According to the invention, through constructing an over-expression material and a knockout material of the OsPIN10b gene, researches show that the over-expression of the OsPIN10b gene has obvious influence on root length and angle, lateral root number, leaf included angle, leaf length and plant height.

(3) The OsPIN10b gene provided by the invention can be applied to aspects of plant root system development, leaf included angle, leaf length and plant height performance, and related plants comprise rice, corn, wheat, soybean, cotton, tobacco and the like.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below.

FIG. 1 is a graph showing the detection result of the molecule of the OsPIN10b gene overexpression material in the embodiment 1 of the invention;

FIG. 2 is a schematic diagram showing the detection of molecules of the OsPIN10b gene knockout material in example 2 of the present invention;

FIG. 3 is a root phenotype diagram of a transgenic material and a wild-type material according to an embodiment of the present invention;

FIG. 4 is a bar graph of root length statistics for transgenic material and wild type material in an embodiment of the present invention;

FIG. 5 is a statistical bar graph of the number of adventitious roots of a transgenic material and a wild-type material in an embodiment of the invention;

FIG. 6 is a bar graph of plant height statistics for transgenic material and wild type material in an embodiment of the invention;

FIG. 7 is a bar graph of root angle measurements of transgenic material and wild type material in an embodiment of the invention;

FIG. 8 is a root phenotype diagram of a transgenic material and a wild-type material according to an embodiment of the present invention;

FIG. 9 is a histogram of statistics of lateral root numbers of transgenic material and wild-type material in an embodiment of the present invention;

FIG. 10 is a histogram of statistics of lateral root count per unit length of transgenic material and wild type material in an embodiment of the invention;

FIG. 11 is a phenotype diagram of the mature period of transgenic material and wild type material according to an embodiment of the present invention;

FIG. 12 is a bar graph of mature plant height of transgenic material and wild type material according to an embodiment of the present invention;

FIG. 13 is a chart of the four-week-old leaf angle phenotype of transgenic material and wild-type material according to an embodiment of the present invention;

FIG. 14 is a column diagram of leaf angles at the four sides of a transgenic material and a wild-type material in an embodiment of the present invention;

FIG. 15 is a chart showing the four-week-old leaf length phenotype of transgenic material and wild-type material according to an embodiment of the present invention;

FIG. 16 is a long column diagram of four-week-old leaves of transgenic material and wild-type material according to an embodiment of the present invention.

Detailed Description

Embodiments of the present invention will be described in detail below with reference to examples, but it will be understood by those skilled in the art that the following examples are only for illustrating the present invention and should not be construed as limiting the scope of the present invention. The specific conditions are not noted in the examples and are carried out according to conventional conditions or conditions recommended by the manufacturer. The reagents or apparatus used were conventional products commercially available without the manufacturer's attention.

Example 1

Obtaining a transgenic plant comprising the steps of:

1) Extraction of Total RNA

Sterilizing the seeds of Nippon Temminck with NaClO with the mass concentration of 30%, accelerating germination, culturing to obtain rice plants with consistent size when two leaves are one-heart, removing endosperm, transplanting into IRRI nutrient solution of 1/2 International Rice institute with pH of 5.5, changing to IRRI full nutrient solution of International Rice institute when four leaves are one-heart (Mao D R.the methods of plant nutrition research.Beijing: beijing Agricultural University Press, 1994), culturing for one week, rapidly placing the roots and leaves in liquid nitrogen for freezing preservation, weighing about 0.1g of sample, grinding with liquid nitrogen, fully adding 1.5mL of centrifuge tube, rapidly adding 1mL of Trizol reagent, adding 0.2mL of chloroform, centrifuging, absorbing supernatant, adding 0.5mL of isopropanol, centrifuging, discarding supernatant, adding 70% ethanol, washing precipitate, dissolving RNA in DEPC water (volume ratio is 1 per mill), detecting RNA mass by agarose gel electrophoresis with the mass ratio of 1.0%, and detecting the concentration and purity of the total RNA by a spectrophotometer. And after the product is qualified, entering the next step.

2) Total cDNA Synthesis

Mu.g of each RNA sample was added to 50. Mu. Mol.L ^-1 OligodT 18 was supplemented with 10. Mu.L of 1%DEPC water, placed on ice for 5min in a water bath at 70℃and then sequentially added with 0.5. Mu.L of RNase inhibitor and 5xRT buffer 5. Mu.L of 10mM dNTPs 2.5. Mu.L of M-MLV reverse transcriptase 1. Mu.L, and 25. Mu.L of 1%DEPC water, after 60min in a water bath at 42℃in a water bath at 70℃for 10min, the reaction was terminated (OligodT 18 was synthesized by Nanjing gold St, and the reverse transcription kit was purchased from Fermas, canada).

3) Full-length cDNA acquisition of OsPIN10b Gene

Using the total cDNA of rice japan obtained above as a template, PCR primers were designed, the PCR product of which contained the complete OsPIN10b reading frame (from the start codon ATG to TAG), the primer sequences were:

OsPIN10b-F:5’-ATGATATCGTGGCACGAGC-3’；

OsPIN10b-R:5’-TCATAGTAGCCCAAGAATAAT-3’

the PCR procedure was as follows: pre-denaturation at 95℃for 3min, denaturation at 95℃for 30s, annealing at 56℃for 45s at 72℃for 2min and renaturation for 35 cycles, and extension at 72℃for 7min, the amplified PCR product was detected by 1% agarose gel electrophoresis and had a size of 1776bp fragment. Separating the target PCR product by agarose electrophoresis, cutting and recovering, connecting the recovered fragment with a P-easy block carrier, adding 5 mu L of the total volume of an enzyme-linked system (comprising 1 mu L of the carrier and 4 mu L of the PCR purified product), mixing uniformly after sample addition, centrifuging and throwing to the bottom of a tube, and standing at 28 ℃ for 15min;

transferring the enzyme-linked system into DH5 alpha competent cells of Escherichia coli by heat shock at 42 ℃, adding 500-700 mu L of LB liquid medium without antibiotics, shaking for 1h, centrifuging at low speed, enriching thallus, and coating on a medium containing kana 100 mu g.mL ^-1 After growing for 12-14 h on LB solid medium, picking positive colony for DNA sequencing, osPIN10b geneThe Open Reading Frame (ORF) of OsPIN10b with accession number AK240660 is 1776bp in full length; the correct sequencing bacterial liquid is added with equal volume of 50% glycerol and stored at-70 ℃ for later use, and the P vector containing the open reading frame of OsPIN10b is named as pOsPIN10binP.

4) Construction of the overexpression vector pUbi-OsPIN10b

Based on the cDNA sequence of the rice auxin transporter gene OsPIN10b, PCR primers were designed, the PCR product contained the complete OsPIN10b gene reading frame (from the initiation codon ATG to the termination codon TAG), and restriction endonuclease sites KpnI and SpeI were introduced on the upstream and downstream primers, respectively, with the primer sequences:

overOsPIN10b-F：5’-gaGGTACC ATGATATCGTGGCACGAGC-3’KpnI

overOsPIN10b-R：5’-atACTAGT TCATAGTAGCCCAAGAATAAT-3’SpeI

using the pOsPIN10binP plasmid obtained above as a template, the PCR procedure was as follows: pre-denaturation at 95℃for 3min, denaturation at 95℃for 30s, annealing at 56℃for 45s, renaturation at 72℃for 2min, and extension at 72℃for 7min after 35 cycles, the amplified PCR product was detected by 1% agarose gel electrophoresis, and the PCR product was approximately 1800bp in size. Separating the target PCR product by agarose electrophoresis, then cutting and recovering, carrying out enzyme cutting and recovering on the recovered product by using restriction enzymes KpnI and SpeI, simultaneously, carrying out double enzyme cutting on a plant over-expression vector pTCK303 plasmid by using KpnI and SpeI, then respectively recovering the enzyme-cut PCR fragment and the vector, and carrying out dephosphorylation on the vector and then recovering again; after recovery, the linearized vector was ligated with the digested PCR fragment by T4 ligase overnight at 16℃and transformed into E.coli DH5a competent cells, which were plated on a plasmid containing 50. Mu.g.mL kanamycin ^-1 After growing for 12 hours on LB solid medium, picking up positive colony, extracting plasmid, carrying out DNA sequencing on the bacterial liquid after the fragment size is verified to be correct by KpnI and SpeI enzyme digestion, adding equal volume of 50% glycerol into the bacterial liquid containing correct clone for sequencing, and preserving at-70 ℃, wherein the plasmid for extracting positive clone is named pUbi-OsPIN10b;

finally, pUbi-OsPIN10b plasmid is transformed into competent cells of agrobacterium tumefaciens EHA105 by an electric shock method and is smeared on the competent cells containing 50 mug.mL of kanamycin and streptomycin ^-1 YEP fixation of (C)After growing on a body culture medium for 48 hours, selecting positive colonies, extracting plasmids, and after double enzyme digestion verification of KpnI and SpeI, adding equal volume of 50% glycerol into bacterial liquid to store at-70 ℃ for transgenic standby;

5) Obtaining transgenic plants

To avoid plant cytoplasmic gene mutations generated by the transgenic process, we performed different batches of transgenic experiments. The agrobacterium transformed with pUbi-OsPIN10b plasmid obtained in 2018, 7-2018, 10-2018, 12-2019 infects rice callus, co-cultures for 3 days, and obtains T0 generation transgenic plants of different years and different batches through selective culture, differentiation, rooting and seedling hardening of the resistant callus. To avoid plant trait changes due to cytoplasmic chimerism caused by non-genomic insertion, we performed two amplifications on all transgenic material, resulting in a stably inherited T2 generation and physiological assays on stably inherited T2 generation material.

The transgenic plants were prepared specifically as follows:

5.1 Agrobacterium-mediated transformation of rice

Inducing callus: peeling rice seeds (14 grains) in triangular flask, soaking in 70% ethanol for 1min (submerging seeds), pouring 70% ethanol, washing with sterilized water for 5-6 times, soaking in 30% sodium hypochlorite for 30min, and washing with sterilized water for 5-6 times until clear. The seeds were pulled onto sterilized filter paper with forceps, blotted, and finally placed on induction medium and incubated in an illumination incubator at 32℃for 5d.

Preparation of agrobacterium: agrobacterium EHA105 strain harboring the corresponding vector was streaked on AB medium (50 mg/L Kan) and dark cultured at 28℃for 3 days. Agrobacterium colonies were scraped off with a sterile spoon and suspended in AAM medium (containing As) with an OD600 of about 0.1.

Infection of callus and co-culture: the rice callus is picked from the secondary culture medium and put into a centrifuge tube, and the quantity of the callus is smaller than that of a conical part of a 50ml centrifuge tube (the callus with light yellow, round and tough property is selected). Taking 1ml of the cultured bacterial liquid in a 1.5ml centrifuge tube, centrifuging at 4 ℃ and 5000rpm for l min, and removing the supernatant. With a composition of 200 mumo1·L ^-1 30ml of acetosyringone (As) infected bacteria liquid was used to pour the collected bacteria suspension into selected callus and infect for 5min. Pouring out the liquid, taking out the callus, and draining on a sterile culture dish containing absorbent paper for 30-40min. The calli were placed on co-culture medium (9 cm sterile filter paper on top of it) and incubated at 25℃for 3 days in the dark.

Washing bacteria and antibiotic screening culture: the callus was removed from the co-culture medium and rinsed 5 times with sterile water, with each shaking for 5min. Then using 500 mg.L ^-1 The carbenicillin (car) is soaked in sterile water for 40-60min. Finally, the mixture is placed on sterile filter paper and drained for 2 hours. The first round of screening, namely transferring the dried callus into a medium containing 400 mg.L ^-1 Carbenicillin (car) and 50 mg.L ^-1 Performing first selection on hygromycin (Hyg) selection medium, and culturing at 32 ℃ under illumination for two weeks;

in the second round of screening, the calli with vigorous growth are transferred to a differentiation medium containing 50mg/L hygromycin B and 250mg/L carboxybenzyl to induce differentiation, and the illumination is continued for about two weeks at 28 ℃.

Induced differentiation and rooting of resistant calli: and (3) transferring the yellow-fresh resistant callus into a differentiation tank filled with a differentiation medium, placing the callus into a constant-temperature culture room, waiting for differentiation into seedlings (about 30d, the culture condition of the tissue culture room is 24-30 ℃ and the light/8 h is dark), and placing the seedlings into a rooting medium for strengthening the seedlings when the seedlings grow to about 5 cm.

Exercise and transplanting of transgenic seedlings: and (3) picking out test tubes with intact seedling roots and stems and leaves (the seedlings grow to the top of the test tubes, timely uncovering the cover, opening a sealing film, adding a proper amount of sterile water (preventing the growth of culture medium), hardening the seedlings for about 3-7 d, washing agar, transplanting to a greenhouse for water culture or soil culture growth and detection.

5.2 Hygromycin for rapidly detecting transgenic seedlings to obtain T0 generation plants

Fresh green leaves (with cuts at both ends) of about 1cm long are cut and collected, and placed on hygromycin (80 mg.L) ^-1 ) Culturing at 30deg.C for 16/8 hr (light/dark) for 48 hr to obtain positive plant and negative young plantThe leaves of the seedlings are necrotized in blocks (Zheng. Establishment of a highly efficient transgenic system for rice and application thereof. 2008). And obtaining 60 positive T0 plants by hygromycin screening. Planting the over-expression material in a greenhouse of Henan agricultural university in 2019 for 4 months to 11 months to obtain the T0 generation seeds.

5.3 Molecular characterization of OsPIN10b over-expressed lines

The T0 generation seed sprouting to obtain T1 generation transgenic seedling, respectively taking Sword She Chouqu RNA in the tillering initial stage of transgenic material OX-OsPIN0b and wild type material Japanese sunny, carrying out quantitative PCR by reverse transcription, and obtaining stable genetic OX-12, OX-19 and OX-20 transgenic strains as shown in figure 1.

Example 2

Obtaining a gene OsPIN10b knockout plant:

1) Selecting a target:

two target sites were designed at the first exon of the gene based on NCBI OsPIN10b gene sequence

Target 1: gaggacgccccaccaccgcacgg

Target 2: gccggagtaagggccgtacatgg

2) Construction of intermediate vectors

2.1 intermediate vector primer Synthesis

KOOsPIN10b-Y1 primer:

KOOsPIN10b--Y1+:cagtGGTCTCatgcagaggacgccccaccaccgca

KOOsPIN10b--Y1-:cagtGGTCTCaaaactgcggtggtggggcgtcctc

KOOsPIN10B- -B1 primer:

KOOsPIN10b--B1+:cagtGGTCTCatgcagccggagtaagggccgtaca

KOOsPIN10b--:cagtGGTCTCaaaactgtacggcccttactccggc

and (3) primer denaturation and annealing to obtain gRNA fragments, wherein a PCR reaction system is as follows: the forward and reverse primers were each 5. Mu.l, and 40. Mu.l of water was added to make up to 40. Mu.l. The PCR reaction procedure was as follows: denaturation at 95℃for 10min, annealing at 55℃for 10min and cooling at 14℃for 5min.

2.2 construction of intermediate vectors by enzyme-cutting ligation

The KOOsPIN10b-Y1 cleavage ligation system is as follows: gRNA fragment: 2 μl of no-load 1 (pBWA (V) hu-cas9 yl): 1.5 μl ECO31I:0.5 mu l T4-ligase:0.5 mu l T4-buffer:1 mu l H O:4.5 μl

The KOOsPIN 10B-B1 cleavage ligation system is as follows: gRNA fragment: 2 μl no-load 2 (pBWD (LB) DNAi): 1.5 μl ECO31I:0.5 mu l T4-ligase:0.5 mu l T4-buffer:1 mu l H ₂ O：4.5μl

The prepared system is placed in a 37 ℃ incubator for reaction for 2 hours.

The ligation system was transformed into E.coli DH 5. Alpha. Competent cells, positive colonies were picked up and plasmids were extracted for DNA sequencing. The plasmids with correct sequencing were designated KOOsPIN10b Y1-1 KOOsPIN10 B1-1, respectively.

3) Construction of double-target cleavage ligation

The plasmid with correct sequence is used for double-target enzyme digestion connection, and the enzyme digestion connection system is as follows: KOOsPIN10b Y1-1 (plasmid): 1 μl KOOsPIN10b B1-1 (plasmid): 1.5 μl LguI:0.5 mu l T4-ligase:0.5 mu l T4-buffer:1 mu l H ₂ O: 5.5. Mu.l of the prepared system was placed in an incubator at 37℃for 2 hours, and after transformation, the system was subjected to bacterial examination. The bacterial detection system is as follows: mix 10ul pyl-R (forward sense primer): 1. Mu.l Pbw2- (reverse sense primer): 1. Mu. l H ₂ 0:8 μl of the primer sequence is shown as pyl-R accggtaaggcgcgccgtagt Pbw 2.2-: gcgattaagttgggtaacgccaggg, picking up the stripe fungus with the fungus detection size of about 1000bp, extracting plasmid, enzyme cutting, verifying and sequencing. The correct plasmid is named as Pyl-HU-OsPIN10b, agrobacterium is transformed, and positive agrobacterium is infected with rice callus to obtain the gene knockout material of the OsPIN10 b. The transformation procedure is as in example one.

4) Identification of Gene knockout Material

Taking transgenic material and wild type material Japanese seedling stage leaf, extracting DNA, designing forward and reverse primers according to two ends of target site (target 1gaggacgccccaccaccgcacgg; target 2 gccggagtaagggccgtacatgg), KO-OsPIN10b-F: CAACACACTAATCGCACGCT

KO-OsPIN10b-R:ACGAGCTGATCGAGTAGATCTC

And (3) carrying out sanger generation sequencing on the PCR amplification product, and comparing the sequencing result with the sequencing result of the Japanese sunny amplification product to determine whether the gene knockout is successful.

The detection results are shown in FIG. 2.

In order to avoid the change of plant traits caused by cytoplasmic chimerism caused by non-genome insertion, two propagation processes are performed on all obtained T0 generation transgenic knockout plants to obtain stably inherited T2 generation, and physiological measurement is performed on stably inherited T2 generation materials.

Test examples

1. The T2 generation transgenic material and the wild material are germinated for 1 day at 28 ℃ after Japanese disinfection, then are irradiated for 16 hours, are dark for 8 hours, are cultured for five days at 28 ℃, and then are used for counting the root phenotype of the seedling stage by a root system scanner. Eight replicates per line. The results are shown in FIGS. 3-6.

As can be seen from FIGS. 3-5, the T2 generation OsPIN10b gene overexpression material (OX-12, OX-19, OX-20) showed no significant change in the number of adventitious roots as compared with the wild type (Japanese sunny), and the longest seed root length was significantly increased. As can be seen from FIGS. 3 and 6, the short-term cultured T2-generation OsPIN10b gene overexpression material (OX-12, OX-19, OX-20) showed no significant change in plant height as compared with the wild type (Japanese sun).

The angle of the longest seed root from the vertical was measured using a protractor for the longest seed root in fig. 3, and the result is shown in fig. 7. As can be seen from FIG. 7, the root angles of the over-expressed materials (OX-12, OX-19, OX-20) were significantly greater than that of the wild type (Japanese sun) and knockout materials (KO-42, KO-31, KO-42). The OsPIN10b gene has obvious influence on the angle of seed roots.

2. The longest seed root in the above materials was peeled off and further examined.

The results are shown in FIGS. 8-10.

The number of lateral roots in the longest seed root per sample is shown in fig. 9. As can be seen from FIGS. 8 and 9, the OsPIN10b overexpressing material (OX-12, OX-19, OX-20) has significantly reduced lateral root numbers compared to the wild-type (Japanese sunny) and knocked-out materials (KO-42, KO-31, KO-42).

The number of side roots per unit length was calculated, and the result is shown in fig. 10. The number of lateral roots per unit length of the longest seed root length of OsPIN10b over-expressed material (OX-12, OX-19, OX-20) is significantly smaller than that of wild type (Nippon) and knockout material (KO-42, KO-31, KO-42), wherein knockout material (KO-42, KO-31, KO-42) is increased over wild type.

The above shows that the OsPIN10b gene has a significant effect on the number of lateral roots.

In the present invention, the seed root develops from the radicle, the adventitious root originates from the rhizome junction (stem base), and the lateral root originates from a specific pericycle cell.

3. Statistical analysis of agronomic traits in rice maturity

After 35 days of flowers, statistical analysis is carried out on T2 generation OsPIN10b transgenes planted in the field and the plant height of the over-expressed materials, and the plant height of the overground part is measured by using a metric ruler, and eight repeats of each plant line are carried out.

The results are shown in FIGS. 11-12.

FIG. 12 shows that OsPIN10b overexpressing material (OX-12, OX-19, OX-20) showed a significant decrease in plant height compared to wild-type (Japanese sunny) and knockout material (KO-22, KO-31, KO-42).

4. Analysis of overexpression and knock-out Material leaf Angle

The T2 generation transgenic material and the wild type material were germinated at 28 ℃ for 1 day after Japanese disinfection, then were irradiated for 16 hours, darkened for 8 hours, and cultured at 28 ℃ for four weeks, and the angle of the second fully developed leaf from the top was measured by using a protractor, and eight replicates per strain. The results show, as shown in FIGS. 13 and 14, that OsPIN10b overexpressing material (OX-12, OX-19, OX-20) had significantly increased leaf angle compared to wild-type (Japanese sunny) and knockout material (KO-22, KO-31, KO-42).

5. Analysis of overexpression and knockdown Material Sword She Shechang

The T2 generation transgenic material and the wild type material were germinated at 28 ℃ for 1 day after Japanese disinfection, then were irradiated for 16 hours, darkened for 8 hours, and cultured at 28 ℃ for four weeks, and the leaf length was completely developed from the first piece by measuring with a ruler, eight replicates per strain. As a result, as shown in FIGS. 15 to 16, the leaf length of OsPIN10b overexpressing material (OX-12, OX-19, OX-20) was significantly shorter than that of wild-type (Japanese sunny) and knockout material (KO-22, KO-31, KO-42).

Taken together, it is known that the OsPIN10b gene has obvious effects on root development, plant height, leaf angle, leaf length and leaf length.

In the present invention, the reagents and solutions involved are as follows:

1. induction medium

The pH was 5.8 and autoclaved at 115℃for 20min.

2. Co-culture medium

The pH was 5.2 and autoclaved at 115℃for 20min.

3. Selection Medium

/>

The pH was 5.8 and autoclaved at 115℃for 20min.

4. Differentiation medium

The pH was 5.8 and autoclaved at 115℃for 20min.

5. Rooting culture medium

/>

The pH was 5.8 and autoclaved at 115℃for 20min.

6. AAM culture solution

The pH was 5.2 and autoclaved at 115℃for 20min.

7. AB medium

/>

pH7.2, and autoclaving at 115℃for 20min.

8. The mother liquor formula of the culture medium comprises the following components:

N ₆ macroelement (20X)

The above reagents are dissolved one by one, then distilled water is used for constant volume at room temperature, the preparation person and the preparation date are marked, and the mixture is preserved at 4 ℃.

N ₆ Microelement (1000X)

The above reagents were dissolved at room temperature and fixed in distilled water to volume, and the formulation person and formulation date were well-established and stored at 4 ℃.

N ₆ Organic matter (100X)

Distilled water is added for volume fixing, the preparation person and the preparation date are well marked, and the storage is kept at 4 ℃ for no more than 1 month.

MS major element (20X)

MS trace element (1000X)

MS organic matter (100X)

/>

Wherein, iron salt (100X): 3.73g of disodium ethylene diammonium tetraacetate (Na ₂ EDTA·2H ₂ O) and 2.78g FeSO ₄ ·7H ₂ O was dissolved separately, mixed and used. Distilled water is fixed to 1000ml, the distilled water is subjected to warm bath for 2 hours at 70 ℃, and after cooling, the preparation and the preparation date are marked, and the distilled water is preserved at 4 ℃.

50mg/ml Inositol (Myo-Inositol): 5g inositol was fixed to 100ml distilled water, and stored at 4℃with the standard concentration, the person who prepared, and the date of preparation.

5mg/ml copper sulfate (CuSO) ₄ ·5H ₂ O)：0.5g CuSO ₄ ·5H ₂ O was fixed to 100ml, and the standard concentration, formulation person and formulation date were stored at 4 ℃.

5mg/ml cobalt chloride (CoCl) ₂ ·6H ₂ O)：0.5g CoCl ₂ ·6H ₂ O was fixed to 100ml, and the standard concentration, formulation person and formulation date were stored at 4 ℃.

2,4-D (1 mg/ml): 100mg of 2,4-D is placed in a 100ml beaker, 20ml of water is added firstly, then 3ml of 1N KOH is added, after complete dissolution, water is added to a volume of 100ml, the concentration, the preparation person and the preparation date are standard, and the mixture is stored at 4 ℃.

KT (1 mg/ml): 100mg of Kinetin (KT for short) is placed in a 100ml beaker, 20ml of water is added firstly, then 5ml of 1N HCl is added, water is added to a volume of 100ml after complete dissolution, the concentration, the preparation person and the preparation date are marked, and the packaging is carried out at the temperature of minus 20 ℃.

NAA (1 mg/ml): 100mg NAA was placed in a 100ml beaker, 20ml water was added first, then 3ml 1N KOH was added, after complete dissolution, water was added to a constant volume of 100ml, the concentration, formulation and formulation date were calibrated, and stored at 4 ℃.

1N KOH:5.6g KOH was dissolved in 100ml water and the concentration, formulator and formulation date were indicated and stored at room temperature.

1N NaOH:4g NaOH was dissolved in 100ml water and stored at room temperature with the indicated concentration, formulator and date of formulation.

1N HCl:12.5ml of concentrated hydrochloric acid is added with water to a volume of 100ml, the concentration, the preparation person and the preparation date are marked, and the mixture is stored at room temperature.

Kan (50 mg/ml) Kanamycin (Kan for short), 50mg/ml, filtering, sterilizing, and storing at-20deg.C.

Rif (50 mg/ml): rif (Rif) was prepared as a 50mg/ml stock solution in DMSO, and stored at-20℃at the standard concentration, the manufacturer, and the date of preparation.

Cb (500 mg/ml): 1g of Carbenicillin (Carbenicillin) in an ultra clean bench was dissolved in 2ml of sterilized water, and the solution was filtered and sterilized, and stored at-20℃with the concentration, the date of preparation and the date of preparation being well-established.

AS (100 mM): 0.196g AS was dissolved in10 ml DMSO and divided into 1ml vials, and stored at-20℃with the indicated concentrations, formulator and formulation date.

The abbreviations written in English for the medium used in the present invention are as follows: cb (carbanicillin, carbenicillin); NAA (Napthalene acetic acid, naphthylacetic acid); 2,4-D (2, 4-Dichlorophenoxyacetic acid,2, 4-dichlorophenoxyacetic acid); AS (acetosyringone); CH (Casein Enzymatic Hydrolysate, hydrolyzed casein); l-pro (L-proline); L-Glu (L-glutamine); MES (2- (N-Morpholino) EthaneSulfonic Acid); n6 (N6 macroelement solution); b5 (B5 microelement composition solution).

While particular embodiments of the present invention have been illustrated and described, it will be appreciated that various other changes and modifications can be made without departing from the spirit and scope of the invention. It is therefore intended to cover in the appended claims all such changes and modifications that are within the scope of this invention.

Claims

1. The application of the gene OsPIN10b in plant root elongation, wherein the gene OsPIN10b has a nucleotide sequence shown in SEQ ID NO. 1, and the application of the gene OsPIN10b in regulation and control of plant root length characters.

2. The use according to claim 1, wherein overexpression of the gene OsPIN10b promotes root elongation.

3. The use according to claim 1 or 2, wherein the plant is rice.