CN116162704A

CN116162704A - System for leukemia diagnosis and treatment

Info

Publication number: CN116162704A
Application number: CN202211095387.4A
Authority: CN
Inventors: 张超; 井多辉
Original assignee: Hangzhou Hema Biotechnology Co ltd
Current assignee: Hangzhou Hema Biotechnology Co ltd
Priority date: 2017-05-23
Filing date: 2017-05-23
Publication date: 2023-05-26
Also published as: CN108937848A; CN115927619A; CN108937848B; CN115927620A; CN115927621A; CN115927622A

Abstract

The present application relates to a system for conducting leukemia diagnosis and treatment, the system comprising: a modeling module for constructing a leukemia patient-specific humanized disease model and at least one detection module for detecting the presence and/or proportion of leukemia cells. The system has the characteristics of high specificity and the like, and can be used for personalized diagnosis and treatment of patients.

Description

System for leukemia diagnosis and treatment

Technical Field

The present application relates to a disease diagnosis and treatment system. In particular to a system for leukemia diagnosis and treatment. The system can predict the therapeutic effect of the drug on the patient according to the performance of the drug in the individual specific disease model, and track the therapeutic effect through personalized detection.

Background

Leukemia is a malignant proliferative disease of the hematopoietic system, generally referred to as a disease caused by massive proliferation and accumulation of leukemia cells. Due to the complexity of leukemia parting and prognosis processes, accurate diagnosis and corresponding treatment of leukemia are imperative in order to obtain better therapeutic effects.

There is a lot of evidence that standardized chemotherapy is ineffective for a large number of patients. Almost 100% of patients will first receive standardized chemotherapy after they are diagnosed with leukemia. Taking childhood leukemia as an example, a standard chemotherapy regimen involves the use of 8 chemotherapeutic agents in only the first stage, and the administration time of each agent is strictly prescribed, with a total course of treatment of up to 1 year. The success of chemotherapy is a prerequisite for other subsequent treatments, such as bone marrow transplantation. However, this standardized chemotherapy regimen is ineffective for at least about 25% of the leukemic children, with a mortality rate of up to 85% of this population. The most significant cause of this is the individual differences among patients. Whereas standardized treatment regimens provide the same treatment regimen for different patient individuals regardless of such individual differences. The result is necessarily: the effective medicine and the ineffective medicine in the combined chemotherapy cannot be distinguished; the invalid chemotherapeutic drugs cause great harm to the body of the patient; the mechanism responsible for resistance cannot be understood; for drug-resistant patients, a method of increasing the administration dosage and carrying out chemotherapy with higher intensity is clinically adopted, so that the injury to the patients is potentially increased; treatment regimens that reflect individual differences in patients cannot be provided.

On the other hand, detection of cancer cell residues (MRD, minimal Residual Disease) is very important for assessing the effect of treatment and predicting cancer recurrence. Internationally, typically bounded by one ten-thousandth, cancer cell residues exceeding one ten-thousandth mean a significant probability of cancer recurrence. Detecting cancer cells in advance means accurately grasping the condition and performing more timely treatment, thereby improving the probability of patient survival.

Currently, the main means for detecting cancer cell residues is by flow cytometry, i.e., cell level detection. The upper limit of the precision of cell level detection is only one ten thousandth, and the method is easily influenced by cell differentiation and clone selection, and has poor stability. In addition, this method cannot be applied rapidly, stably and efficiently in actual clinical detection, and has a great limitation.

Disclosure of Invention

The present application provides a system for conducting leukemia diagnostics. The system provided by the present application is capable of rapidly, reliably, and/or stably reflecting the presence and/or proportion of leukemia cells in a leukemia patient. Furthermore, the systems provided herein can provide reliable references for subsequent leukemia treatment regimens. The systems provided herein can be used for candidate drug screening. Furthermore, the system of the present application may be used to personalize diagnosis and treatment of a subject. For example, the systems and methods of the present application are capable of recommending specific drug candidates and treatment regimens for a subject by constructing a subject-specific humanized disease model and concomitant detection.

In one aspect, the present application provides a system for conducting leukemia diagnosis and treatment, the system comprising: a) A modeling module for constructing a subject-specific humanized disease model, the subject being a leukemia patient; b) At least one detection module for detecting the presence and/or proportion of leukemia cells in the subject. The modeling module may include: a1 A sample unit comprising a suspension of leukemia cells derived from the subject, the density of leukemia cells in the suspension being 2x10 ⁷ Ml to 5x10 ⁷ /ml; a2 A radiation unit comprising a radioactive treatment device for the radioactive treatment of a suitable immunodeficient mouse; a3 An inoculation unit for inoculating the leukemia cell suspension into the immunodeficient mice treated with the irradiation unit. The at least one detection module may include: b1 An amplification unit comprising a reagent capable of specifically amplifying a target gene to obtain a target-specific amplification product.

In certain embodiments, the system further comprises c) a drug candidate screening module. The drug candidate screening module may include a first drug candidate set and a second drug candidate set; wherein the first drug candidate group comprises one or more drugs selected from the group consisting of: vincristine, dexamethasone, levoasparaginase, topoisomerase inhibitor, purine nucleoside derivative, proteasome inhibitor, mTOR inhibitor, dasatinib, antibody drug, all-trans retinoic acid, DNA damage inducer, folic acid reductase inhibitor, deacetylase inhibitor, multi-receptor tyrosine kinase inhibitor, cytotoxic drug and vitamin a amide. The second drug candidate set may include one or more drugs selected from the group consisting of: protein kinase inhibitors, apoptosis modulators, DNA disintegrants, cell division inhibitors, MDM2 oncogene inhibitors, antibodies and other chemotherapeutic agents.

In certain embodiments, the modeling module in the system further comprises a 4) a separation unit comprising a monocyte separation liquid for centrifuging leukemia cells of the subject.

In certain embodiments, the modeling module in the system further comprises a 5) a T cell removal unit for removing T cells in a sample derived from a non-T cell leukemia subject, thereby obtaining the leukemia cell suspension.

In certain embodiments, the monocyte separation liquid is Ficoll and the centrifugation is density gradient centrifugation.

In certain embodiments, the leukemia cell suspension comprises RPMI cell culture medium.

In certain embodiments, the T cells that are removed are CD3 positive T cells. In certain embodiments, the T cell removal unit comprises magnetic beads comprising CD3 antibodies. In certain embodiments, the T cell removal unit further comprises a high magnetic field.

In certain embodiments, the leukemia is acute lymphoblastic leukemia and the immunodeficient mouse is an NSG mouse. In certain embodiments, the leukemia is acute myelogenous leukemia and the immunodeficient mouse is a MISTRG mouse.

In certain embodiments, the radiation treatment device is an X-ray radiation device and produces a radiation dose of 200cGy to 300cGy. In certain embodiments, the radiation treatment device is an X-ray radiation device and produces a radiation dose of 550cGy to 650cGy.

In certain embodiments, the radiation unit in the system is configured to subject the immunodeficient mice to the radiation treatment within 12-24 hours prior to a predetermined inoculation time.

In certain embodiments, the immunodeficient mice are 5-7 weeks old.

In certain embodiments, the modeling module in the system further comprises a 6) an infrared irradiation and heating unit for infrared lamp irradiation and heating of the immunodeficient mouse.

In certain embodiments, the modeling module in the system further comprises a 7) a monitoring unit for monitoring the growth of leukemia cells from the subject in the vaccinated immunodeficient mice. In certain embodiments, the monitoring unit comprises reagents and devices that detect the proportion of hucd45+, hucd19+, hucd3+, and/or hucd33+ cells in the peripheral blood of the mouse.

In certain embodiments, the modeling module in the system further comprises a 8) a spleen processing unit comprising a separation element by which the spleen of the mouse can be separated when the proportion of hucd45+, hucd19+, hucd3+, and/or hucd33+ cells in the vaccinated peripheral blood of the mouse is at least 50%, a disruption element by which the spleen of the isolated mouse is disrupted to obtain spleen cells, and a suspension element by which the spleen cells are prepared as the leukemia cell suspension.

In certain embodiments, the modeling module in the system further comprises a 9) liquid nitrogen for cryopreserving the leukemia cell suspension.

In certain embodiments, the candidate drug screening module further comprises a monitoring unit for monitoring the growth of leukemia cells from the subject in the vaccinated immunodeficient mice. In certain embodiments, the monitoring unit comprises reagents and means to detect the proportion of hucd45+, hucd19+, hucd3+, and/or hucd33+ cells in the peripheral blood of the mouse, the monitoring unit may be configured to suggest that a candidate drug may be administered to the mouse when the proportion reaches 1% -5%.

In certain embodiments, the monitoring unit comprises reagents and means for detecting the proportion of hucd45+, hucd19+, hucd3+, and/or hucd33+ cells in the peripheral blood of the mouse, and the monitoring unit may be configured to continuously monitor changes in the proportion of the hucd45+, hucd19+, hucd3+, and/or hucd33+ cells in the peripheral blood of the mouse after administration of the drug, and to indicate the efficacy of the candidate drug in response to the changes.

In certain embodiments, the monitoring unit is configured to: when the ratio of hucd45+, hucd19+, hucd3+, and/or hucd33+ cells in the peripheral blood cells of the mice is monitored to remain below 1% and maintained for at least 2 weeks after administration of the drug candidate, the drug candidate is indicated to be effective.

In certain embodiments, the first drug candidate group comprises one or more drugs selected from the group consisting of: vincristine, dexamethasone, levoasparaginase, topotecan, clofarabine, carfilzomib, temsirolimus, dasatinib, bortezomib, CD19 antibody, all-trans retinoic acid, doxorubicin, carbamate, SAHA, sunitinib, cyclophosphamide, and valphenamide.

In certain embodiments, the protein kinase inhibitor in the second drug candidate group comprises one or more drugs selected from the group consisting of: AZD8055, MLN0128, GSK690693, MK-2206, SAR245408, rapamycin, MLN0128, selumetinib, AZD6244, PCI-32765, ibrutinib, SGI-1776, dinaciclib, VS-4718, sorafenib, sunitinib and AZD1480.

In certain embodiments, the apoptosis modulator in the second candidate drug group comprises one or more drugs selected from the group consisting of: ABT-263 (naviteclmax), ABT-199 (venetoclax), LCL161 and birinaptant.

In certain embodiments, the DNA-degrading agent in the second drug candidate group comprises one or more drugs selected from the group consisting of: PR-104, cytarabine (CPX-351), daunorubicin (Vyxeos) and temozolomide.

In certain embodiments, the cell division inhibitor in the second drug candidate group comprises one or more drugs selected from the group consisting of: eribulin, ispinesib and alilerib.

In certain embodiments, the MDM2 class oncogene inhibitor in the second candidate drug group comprises one or more drugs selected from the group consisting of: MK-8242 (SCH 900242) and RG7112.

In certain embodiments, the antibody class drug in the second drug candidate group comprises one or more drugs selected from the group consisting of: SAR3419.

In certain embodiments, the other chemotherapeutic drug adjunctive in the second drug candidate group comprises one or more drugs selected from the group consisting of: alvershimycin, AT13387, PF-03084014, RO-4929097, MLN4924, PG11047, CX-5461, BMN-673, selinexor, bortezomib, curaxin and CBL0137.

In certain embodiments, vincristine is included in the first drug candidate group, and is adapted to be administered to the subject-specific humanized disease model according to the following requirements: is suitable for being administrated by intraperitoneal injection, and the dosage of each administration is 0.5mg/kg, once a week and continuously for 3-6 weeks.

In certain embodiments, wherein the first drug candidate group comprises a carbamate folate, and the carbamate folate is suitable for administration to the leukemia humanized disease model according to the following requirements: is suitable for being applied by intraperitoneal injection, and the application amount is 3-6mg/kg each time, is applied once every two weeks, and is continuously applied for 6-10 weeks.

In certain embodiments, dexamethasone is included in the first drug candidate group, and is adapted to be administered to the leukemia-humanized disease model according to the following requirements: is suitable for being applied by intraperitoneal injection, and the application amount is 10-20mg/kg each time, once daily and continuously for 3-6 weeks.

In certain embodiments, doxorubicin is included in the first drug candidate set, and is adapted to be administered to the leukemia humanized disease model according to the following requirements: is suitable for intravenous administration, each time at an amount of 0.5-3mg/kg, once a week for 3-6 weeks.

In certain embodiments, a levoasparaginase is included in the first candidate drug group and is adapted for administration to the leukemia humanized disease model according to the following requirements: is suitable for being applied by intraperitoneal injection, and the application amount is 500-2000KU/kg each time, once daily and continuously for 3-6 weeks.

In certain embodiments, topotecan is included in the first drug candidate set and is adapted for administration to the leukemia humanized disease model according to the following requirements: is suitable for being applied by intraperitoneal injection, the dosage of each application is 0.1-5mg/kg, the application is carried out once daily for 2-8 weeks, and the application is stopped for one week after two weeks of administration.

In certain embodiments, clofarabine is included in the first drug candidate group and is adapted for administration to the leukemia humanized disease model according to the following requirements: is suitable for being applied by intraperitoneal injection, and the application amount is 10-100mg/kg each time, once daily and continuously for 3-6 weeks.

In certain embodiments, carfilzomib is included in the first drug candidate group, and the carfilzomib is adapted for administration to the leukemia humanized disease model according to the following requirements: is suitable for intravenous injection, and each time is 0.1-10mg/kg, twice weekly for 3-6 weeks.

In certain embodiments, the first drug candidate group comprises temsirolimus therein, and the temsirolimus is adapted for administration to the leukemia humanized disease model according to the following requirements: is suitable for being administrated by intraperitoneal injection, and the administration amount is 5-50mg/kg each time, once daily and continuously for 1-3 weeks.

In certain embodiments, dasatinib is included in the first drug candidate group, and is adapted for administration to the leukemia humanized disease model according to the following requirements: suitable for administration by oral administration, each time at an amount of 5-50mg/kg, once daily and for 2-6 weeks.

In certain embodiments, bortezomib is included in the first drug candidate group, and is adapted for administration to the leukemia humanized disease model according to the following requirements: is suitable for being applied by intraperitoneal injection, and the application amount is 0.1-20mg/kg each time, and the application is carried out twice a week for 4-8 weeks.

In certain embodiments, SAR3419 is included in the first drug candidate set, and the SAR3419 is adapted for administration to the leukemia humanized disease model according to the following requirements: is suitable for being applied by intraperitoneal injection, and the application amount is 0.5-50mg/kg each time, once a week and continuously for 4-8 weeks.

In certain embodiments, all-trans retinoic acid is included in the first candidate drug group, and is adapted for administration to the leukemia humanized disease model according to the following requirements: is suitable for being applied by intraperitoneal injection, and the application amount is 0.5-10mg/kg each time, once a week and continuously for 2-6 weeks.

In certain embodiments, SAHA is included in the first drug candidate group and is adapted for administration to the leukemia humanized disease model according to the following requirements: is suitable for being applied by intraperitoneal injection, and the application amount is 100-500mg/kg each time, once daily and continuously for 3-6 weeks.

In certain embodiments, sunitinib is included in the first drug candidate group, and the sunitinib is adapted for administration to the leukemia humanized disease model according to the following requirements: suitable for administration by oral administration, each at a dose of 10-100mg/kg, once daily and for 2-6 weeks.

In certain embodiments, cyclophosphamide is included in the first drug candidate set, and is adapted for administration to the leukemia humanized disease model according to the following requirements: is suitable for being administrated by intraperitoneal injection, and the administration amount is 30-300mg/kg each time, once daily and continuously for 2-6 weeks.

In certain embodiments, the first candidate drug group comprises a vitamin a amide, and the vitamin a amide is suitable for administration to the leukemia humanized disease model according to the following requirements: is suitable for being applied by intraperitoneal injection, and the application amount is 20-200mg/kg each time, once daily and continuously for 2-6 weeks.

In certain embodiments, the leukemia comprises B-cell acute lymphoblastic leukemia and/or T-cell acute lymphoblastic leukemia.

In certain embodiments, the target gene comprises one or more genes selected from the group consisting of: igH, igK, T cell receptor A, T cell receptor D, T cell receptor B, T cell receptor G and Tal 1.

In certain embodiments, the target gene comprises an IgH gene rearrangement and the agent capable of specifically amplifying the target gene comprises one or more primer combinations selected from the group consisting of: 1) Forward primer: VH1/7, reverse primer: JH cos; 2) Forward primer: VH2, reverse primer: JH cos; 3) Forward primer: VH3, reverse primer: JH cos; 4) Forward primer: VH4, reverse primer: JH cos; 5) Forward primer: VH5, reverse primer: JH cos; 6) Forward primer: VH6, reverse primer: JH cos; 7) Forward primer: DH1, DH4, DH5 and DH7, reverse primers: JH cos; 8) Forward primer: DH2, reverse primer: JH cos; 9) Forward primer: DH3, reverse primer: JH cos; and 10) forward primer: DH6, reverse primer: JH con.

In certain embodiments, the primer JH ons comprises a sequence selected from the group consisting of seq id nos: SEQ ID NO. 19; and the sequence shown in SEQ ID No. 20. In certain embodiments, the primer VH1/7 comprises a sequence selected from the group consisting of: SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO. 3. In certain embodiments, the primer VH2 comprises a sequence selected from the group consisting of: SEQ ID No.4, SEQ ID No.5 and SEQ ID No. 6. In certain embodiments, the primer VH3 comprises a sequence selected from the group consisting of: SEQ ID NO.7, SEQ ID NO.8 and SEQ ID NO. 9. In certain embodiments, the primer VH4 comprises a sequence selected from the group consisting of: SEQ ID NO.10, SEQ ID NO.11 and SEQ ID NO. 12. In certain embodiments, the primer VH5 comprises a sequence selected from the group consisting of: SEQ ID NO.13, SEQ ID NO.14 and SEQ ID NO. 15. In certain embodiments, the primer VH6 comprises a sequence selected from the group consisting of: SEQ ID No.16, SEQ ID No.17 and SEQ ID No. 18. In certain embodiments, the primer DH1 comprises a sequence selected from the group consisting of: SEQ ID NO.21 and SEQ ID NO. 22. In certain embodiments, the primer DH2 comprises a sequence selected from the group consisting of: SEQ ID No.23 and SEQ ID No. 24. In certain embodiments, the primer DH3 comprises a sequence selected from the group consisting of: SEQ ID NO.25 and SEQ ID NO. 26. In certain embodiments, the primer DH4 comprises a sequence selected from the group consisting of: SEQ ID NO.27 and SEQ ID NO. 28. In certain embodiments, the primer DH5 comprises a sequence selected from the group consisting of: SEQ ID NO.29 and SEQ ID NO. 30. In certain embodiments, the primer DH6 comprises a sequence selected from the group consisting of: SEQ ID NO.31 and SEQ ID NO. 32. In certain embodiments, the primer DH7 comprises a sequence selected from the group consisting of: SEQ ID NO.33 and SEQ ID NO. 34.

In certain embodiments, the target gene comprises an IgK gene rearrangement and the agent capable of specifically amplifying the target gene comprises one or more primer combinations selected from the group consisting of: 1) Forward primer: vk1, reverse primer: kdel; 2) Forward primer: vk2, reverse primer: kdel; 3) Forward primer: vk3, reverse primer: kdel; and 4) forward primer: intron RSS, reverse primer: kdel.

In certain embodiments, the primer Vk1 comprises a sequence selected from the group consisting of: SEQ ID NO.35 and SEQ ID NO. 36. In certain embodiments, the primer Vk2 comprises a sequence selected from the group consisting of: SEQ ID NO.37 and SEQ ID NO. 38. In certain embodiments, the primer Vk3 comprises a sequence selected from the group consisting of: SEQ ID NO.39 and SEQ ID NO. 40. In certain embodiments, the primer Vk4 comprises a sequence selected from the group consisting of: SEQ ID NO.41 and SEQ ID NO. 42. In certain embodiments, the primer Intron RSS comprises a sequence selected from the group consisting of: SEQ ID NO.43 and SEQ ID NO. 44. In certain embodiments, the primer Kdel comprises a sequence selected from the group consisting of: SEQ ID NO.45 and SEQ ID NO. 46.

In certain embodiments, the leukemia comprises B-cell acute lymphoblastic leukemia, and the target gene comprises a gene rearrangement of the T-cell receptor region; the genes of the T cell receptor region include one or more selected from the group consisting of: t cell receptor A, T cell receptor D, T cell receptor B and T cell receptor G; and the agent capable of specifically amplifying the target gene comprises one or more primer combinations selected from the group consisting of: 1) Forward primer: vd2, reverse primer: dd3; 2) Forward primer: dd2, reverse primer: dd3; 3) Forward primer: vd2, reverse primer: ja29; 4) Forward primer: vd2, reverse primer: ja9, ja29, ja30, ja48, ja49, ja52, ja54, ja55, ja56, ja57, ja58, ja59 and Ja61; 5) Forward primer: vg1, reverse primer: jg1 and Jg2; 6) Forward primer: vg2, reverse primer: jg1 and Jg2; 7) Forward primer: vg4, reverse primer: jg1 and Jg2; 8) TCRB multiple primer combination A; 9) TCRB multi-primer combination B; and 10) TCRB multiple primer combination C.

In certain embodiments, the primer Vg1 comprises a sequence selected from the group consisting of: SEQ ID NO.47 and SEQ ID NO. 48. In certain embodiments, the primer Vg2 comprises a sequence selected from the group consisting of: SEQ ID NO.49 and SEQ ID NO. 50. In certain embodiments, the primer Vg4 comprises a sequence selected from the group consisting of: SEQ ID NO.53 and SEQ ID NO. 54. In certain embodiments, the primer Jg1 comprises a sequence selected from the group consisting of seq id nos: SEQ ID No.55 and SEQ ID No. 56. In certain embodiments, the primer Jg2 comprises a sequence selected from the group consisting of seq id nos: SEQ ID NO.57 and SEQ ID NO. 58. In certain embodiments, the primer Vd2 comprises a sequence selected from the group consisting of: SEQ ID NO.61 and SEQ ID NO. 62. In certain embodiments, the primer Dd2 comprises a sequence selected from the group consisting of: SEQ ID NO.65 and SEQ ID NO. 66. In certain embodiments, the primer Dd3 comprises a sequence selected from the group consisting of: SEQ ID NO.67 and SEQ ID NO. 68. In certain embodiments, the primer Ja9 comprises a sequence selected from the group consisting of: SEQ ID NO. 71. In certain embodiments, the primer Ja29 comprises a sequence selected from the group consisting of: SEQ ID NO. 72. In certain embodiments, the primer Ja30 comprises a sequence selected from the group consisting of: SEQ ID NO. 73. In certain embodiments, the primer Ja48 comprises a sequence selected from the group consisting of: SEQ ID NO. 74. In certain embodiments, the primer Ja49 comprises a sequence selected from the group consisting of: SEQ ID NO. 75. In certain embodiments, the primer Ja52 comprises a sequence selected from the group consisting of: SEQ ID NO. 76. In certain embodiments, the primer Ja54 comprises a sequence selected from the group consisting of: SEQ ID NO. 77. In certain embodiments, the primer Ja55 comprises a sequence selected from the group consisting of: SEQ ID NO. 78. In certain embodiments, the primer Ja56 comprises a sequence selected from the group consisting of: SEQ ID NO. 79. In certain embodiments, the primer Ja57 comprises a sequence selected from the group consisting of: SEQ ID NO. 80. In certain embodiments, the primer Ja58 comprises a sequence selected from the group consisting of: SEQ ID NO. 81. In certain embodiments, the primer Ja59 comprises a sequence selected from the group consisting of: SEQ ID NO. 82. In certain embodiments, the primer Ja61 comprises a sequence selected from the group consisting of: SEQ ID NO. 83.

In certain embodiments, the multi-primer combination a comprises one or more sequences selected from the group consisting of: SEQ ID No.86, SEQ ID No.87, SEQ ID No.88, SEQ ID No.89, SEQ ID No.90, SEQ ID No.91, SEQ ID No.92, SEQ ID No.93, SEQ ID No.94, SEQ ID No.95, SEQ ID No.96, SEQ ID No.97, SEQ ID No.98, SEQ ID No.99, SEQ ID No.100, SEQ ID No.101, SEQ ID No.102, SEQ ID No.103, SEQ ID No.104, SEQ ID No.105, SEQ ID No.106, SEQ ID No.107, SEQ ID No.108, SEQ ID No.111, SEQ ID No.112, SEQ ID No.113, SEQ ID No.114, SEQ ID No.115, SEQ ID No.116, SEQ ID No.118, SEQ ID No.122 and SEQ ID No. 123.

In certain embodiments, the multi-primer combination B comprises one or more sequences selected from the group consisting of: SEQ ID No.86, SEQ ID No.87, SEQ ID No.88, SEQ ID No.89, SEQ ID No.90, SEQ ID No.91, SEQ ID No.92, SEQ ID No.93, SEQ ID No.94, SEQ ID No.95, SEQ ID No.96, SEQ ID No.97, SEQ ID No.98, SEQ ID No.99, SEQ ID No.100, SEQ ID No.101, SEQ ID No.102, SEQ ID No.103, SEQ ID No.104, SEQ ID No.105, SEQ ID No.106, SEQ ID No.107, SEQ ID No.108, SEQ ID No.117, SEQ ID No.119, SEQ ID No.120 and SEQ ID No. 121.

In certain embodiments, the multi-primer combination C comprises one or more sequences selected from the group consisting of: SEQ ID No.109, SEQ ID No.110, SEQ ID No.111, SEQ ID No.112, SEQ ID No.113, SEQ ID No.114, SEQ ID No.115, SEQ ID No.116, SEQ ID No.117, SEQ ID No.118, SEQ ID No.119, SEQ ID No.120, SEQ ID No.121, SEQ ID No.122 and SEQ ID No. 123.

In certain embodiments, the leukemia comprises T-cell acute lymphoblastic leukemia, and the target gene comprises a gene rearrangement of the T-cell receptor region; the genes of the T cell receptor region include one or more selected from the group consisting of: t cell receptor A, T cell receptor D, T cell receptor B and T cell receptor G; and the agent capable of specifically amplifying the target gene comprises one or more primer combinations selected from the group consisting of: 1) Forward primer: vd1, reverse primer: jd1; 2) Forward primer: vd2, reverse primer: jd1; 3) Forward primer: vd3, reverse primer: jd1; 4) Forward primer: vd2, reverse primer: dd3; 5) Forward primer: dd2, reverse primer: dd3; 6) Forward primer: dd2, reverse primer: jd1; 7) Forward primer: vd2, reverse primer: ja29; 8) Forward primer: vd2, reverse primer: ja9, ja29, ja30, ja48, ja49, ja52, ja54, ja55, ja56, ja57, ja58, ja59 and Ja61; 9) Forward primer: vg1, reverse primer: jg1 and Jg2;10 Forward primer: vg2, reverse primer: jg1 and Jg2;11 Forward primer: vg3, reverse primer: jg1 and Jg2;12 Forward primer: vg4, reverse primer: jg1 and Jg2;13 Forward primer: sildb, reverse primer: taldb1;14 TCRB multi-primer combination a;15 TCRB multi-primer combination B; and 16) TCRB multiple primer combination C.

In certain embodiments, the primer Vg3 comprises a sequence selected from the group consisting of: SEQ ID NO.51 and SEQ ID NO. 52. In certain embodiments, the primer Vd3 comprises a sequence selected from the group consisting of: SEQ ID NO.63 and SEQ ID NO. 64. In certain embodiments, the primer Vg1 comprises a sequence selected from the group consisting of: SEQ ID NO.47 and SEQ ID NO. 48. In certain embodiments, the primer Vg2 comprises a sequence selected from the group consisting of: SEQ ID NO.49 and SEQ ID NO. 50. In certain embodiments, the primer Vg4 comprises a sequence selected from the group consisting of: SEQ ID NO.53 and SEQ ID NO. 54. In certain embodiments, the primer Jg1 comprises a sequence selected from the group consisting of seq id nos: SEQ ID No.55 and SEQ ID No. 56. In certain embodiments, the primer Jg2 comprises a sequence selected from the group consisting of seq id nos: SEQ ID NO.57 and SEQ ID NO. 58. In certain embodiments, the primer Vd2 comprises a sequence selected from the group consisting of: SEQ ID NO.61 and SEQ ID NO. 62. In certain embodiments, the primer Dd2 comprises a sequence selected from the group consisting of: SEQ ID NO.65 and SEQ ID NO. 66. In certain embodiments, the primer Dd3 comprises a sequence selected from the group consisting of: SEQ ID NO.67 and SEQ ID NO. 68. In certain embodiments, the primer Ja9 comprises a sequence selected from the group consisting of: SEQ ID NO. 71. In certain embodiments, the primer Ja29 comprises a sequence selected from the group consisting of: SEQ ID NO. 72. In certain embodiments, the primer Ja30 comprises a sequence selected from the group consisting of: SEQ ID NO. 73. In certain embodiments, the primer Ja48 comprises a sequence selected from the group consisting of: SEQ ID NO. 74. In certain embodiments, the primer Ja49 comprises a sequence selected from the group consisting of: SEQ ID NO. 75. In certain embodiments, the primer Ja52 comprises a sequence selected from the group consisting of: SEQ ID NO. 76. In certain embodiments, the primer Ja54 comprises a sequence selected from the group consisting of: SEQ ID NO. 77. In certain embodiments, the primer Ja55 comprises a sequence selected from the group consisting of: SEQ ID NO. 78. In certain embodiments, the primer Ja56 comprises a sequence selected from the group consisting of: SEQ ID NO. 79. In certain embodiments, the primer Ja57 comprises a sequence selected from the group consisting of: SEQ ID NO. 80. In certain embodiments, the primer Ja58 comprises a sequence selected from the group consisting of: SEQ ID NO. 81. In certain embodiments, the primer Ja59 comprises a sequence selected from the group consisting of: SEQ ID NO. 82. In certain embodiments, the primer Ja61 comprises a sequence selected from the group consisting of: SEQ ID NO. 83.

In certain embodiments, the primer Vd1 comprises a sequence selected from the group consisting of: SEQ ID NO.59 and SEQ ID NO. 60. In certain embodiments, the primer Jd1 comprises a sequence selected from the group consisting of seq id nos: SEQ ID NO.69 and SEQ ID NO. 70. In certain embodiments, the primer Sildb comprises a sequence selected from the group consisting of: SEQ ID NO. 84. In certain embodiments, the primer taddb 1 comprises a sequence selected from the group consisting of: SEQ ID NO. 85.

In certain embodiments, the leukemia is B-cell acute lymphoblastic leukemia. In certain embodiments, the leukemia is T-cell acute lymphoblastic leukemia.

In certain embodiments, the detection module in the system further comprises an identification unit comprising reagents and means for identifying the target-specific amplification product, thereby identifying a characteristic amplification product of the target-specific amplification product derived from leukemia cells of the subject.

In certain embodiments, the identification unit comprises reagents and devices necessary for gel electrophoresis separation of the target-specific amplification products.

In certain embodiments, the detection module in the system further comprises an analysis unit comprising reagents and means for analyzing the characteristic amplification product, thereby obtaining a characteristic gene sequence specific for leukemia cells of the subject.

In certain embodiments, the analysis unit comprises reagents and apparatus necessary for nucleic acid sequencing and sequence analysis of the characteristic amplification products.

In certain embodiments, the analysis unit comprises reagents and means required to identify conserved nucleic acid sequences and subject-specific nucleic acid sequences in the nucleic acid sequences of the characteristic amplification products, thereby obtaining a characteristic gene sequence specific for the subject leukemia cells.

In certain embodiments, the detection module in the system further comprises a recognition unit comprising reagents and devices capable of specifically recognizing and/or amplifying the characteristic gene sequence of the subject, thereby determining the presence and/or proportion of residual leukemia cells in the subject.

In certain embodiments, the recognition unit comprises an agent or device that specifically amplifies a gene sequence specific for a leukemia cell of the subject.

In certain embodiments, the recognition unit further comprises a probe that binds to a non-characteristic gene sequence and a reagent or device capable of amplifying the non-characteristic gene sequence.

In certain embodiments, the non-characteristic gene sequence comprises a nucleic acid sequence derived from one or more genes from the group consisting of: igH, igK, T cell receptor A, T cell receptor D, T cell receptor B, T cell receptor G and Tal 1.

In certain embodiments, the non-characteristic gene sequence comprises a nucleic acid sequence derived from IgH, and the agent or device capable of amplifying the non-characteristic gene sequence comprises a sequence selected from the group consisting of: sequences shown in SEQ ID No.124, SEQ ID No.125, SEQ ID No.126, SEQ ID No.127, SEQ ID No.128, SEQ ID No.129, SEQ ID No.130 and SEQ ID No. 131. In certain embodiments, the non-characteristic gene sequence comprises a nucleic acid sequence derived from IgH, and the probe that binds to the non-characteristic gene sequence comprises a sequence selected from the group consisting of: sequences shown in SEQ ID No.173, SEQ ID No.174, SEQ ID No.175, SEQ ID No.176, SEQ ID No.177, SEQ ID No.178, SEQ ID No.179 and SEQ ID No. 180. In certain embodiments, the non-characteristic gene sequence comprises a nucleic acid sequence derived from IgK, and the agent or device capable of amplifying the non-characteristic gene sequence comprises a sequence selected from the group consisting of: SEQ ID NO.132, SEQ ID NO.133, SEQ ID NO.134, SEQ ID NO.135, SEQ ID NO.136, SEQ ID NO.137, SEQ ID NO.138, SEQ ID NO.139, SEQ ID NO.140 and SEQ ID NO. 141. In certain embodiments, the non-characteristic gene sequence comprises a nucleic acid sequence derived from IgK, and the probe that binds to the non-characteristic gene sequence comprises a sequence selected from the group consisting of: sequences shown in SEQ ID No.181, SEQ ID No.182, SEQ ID No.183, SEQ ID No.184, SEQ ID No.185, SEQ ID No.186, SEQ ID No.187, SEQ ID No.188, SEQ ID No.189 and SEQ ID No. 190. In certain embodiments, the non-characteristic gene sequence comprises a nucleic acid sequence derived from T cell receptor G, and the agent or device capable of amplifying the non-characteristic gene sequence comprises a sequence selected from the group consisting of: sequences shown in SEQ ID No.142, SEQ ID No.143, SEQ ID No.144, SEQ ID No.145, SEQ ID No.146, SEQ ID No.147, SEQ ID No.148, SEQ ID No.149, SEQ ID No.150 and SEQ ID No. 151. In certain embodiments, the non-characteristic gene sequence comprises a nucleic acid sequence derived from T cell receptor G, and the probe that binds to the non-characteristic gene sequence comprises a sequence selected from the group consisting of: sequences shown in SEQ ID No.191, SEQ ID No.192, SEQ ID No.193, SEQ ID No.194, SEQ ID No.195, SEQ ID No.196, SEQ ID No.197, SEQ ID No.198, SEQ ID No.199 and SEQ ID No. 200. In certain embodiments, the non-characteristic gene sequence comprises a nucleic acid sequence derived from T cell receptor D and/or T cell receptor a, and the agent or device capable of amplifying the non-characteristic gene sequence comprises a sequence selected from the group consisting of: SEQ ID No.152, SEQ ID No.153, SEQ ID No.154, SEQ ID No.155, SEQ ID No.156 and SEQ ID No. 157. In certain embodiments, the non-characteristic gene sequence comprises a nucleic acid sequence derived from T cell receptor D and/or T cell receptor a, and the probe that binds to the non-characteristic gene sequence comprises a sequence selected from the group consisting of: the sequences shown in SEQ ID No.201, SEQ ID No.202, SEQ ID No.203, SEQ ID No.204, SEQ ID No.205 and SEQ ID No. 206. In certain embodiments, the non-characteristic gene sequence comprises a nucleic acid sequence derived from T cell receptor B, and the agent or device capable of amplifying the non-characteristic gene sequence comprises a sequence selected from the group consisting of: SEQ ID No.158, SEQ ID No.159, SEQ ID No.160, SEQ ID No.161, SEQ ID No.162, SEQ ID No.163, SEQ ID No.164, SEQ ID No.165, SEQ ID No.166, SEQ ID No.167, SEQ ID No.168, SEQ ID No.169 and SEQ ID No. 170. In certain embodiments, the non-characteristic gene sequence comprises a nucleic acid sequence derived from T cell receptor B, and the probe that binds to the non-characteristic gene sequence comprises a sequence selected from the group consisting of: SEQ ID No.207, SEQ ID No.208, SEQ ID No.209, SEQ ID No.210, SEQ ID No.211, SEQ ID No.212, SEQ ID No.213, SEQ ID No.214, SEQ ID No.215, SEQ ID No.216, SEQ ID No.217, SEQ ID No.218 and SEQ ID No. 219. In certain embodiments, the non-characteristic gene sequence comprises a nucleic acid sequence derived from Tal 1, and the agent or device capable of amplifying the non-characteristic gene sequence comprises a sequence selected from the group consisting of: SEQ ID NO.171 and SEQ ID NO. 172. In certain embodiments, the non-characteristic gene sequence comprises a nucleic acid sequence derived from Tal 1, and the probe that binds to the non-characteristic gene sequence comprises a sequence selected from the group consisting of: SEQ ID NO.220 and SEQ ID NO. 221.

In certain embodiments, the detection system comprises 2 or more detection modules, wherein at least one detection module is for detecting the presence and/or proportion of leukemia cells therein prior to the subject receiving the treatment, and wherein at least one detection module is for detecting the presence and/or proportion of leukemia cells therein after the subject receiving the treatment.

In certain embodiments, the detection module comprises a treatment prompting unit that prompts subsequent treatment regimens to be employed for the respective subject based on the detected presence and/or proportion of leukemia cells in the subject.

In certain embodiments, when the proportion of leukemia cells in the subject tested is 1/10 ⁴ In the following, the treatment prompting unit prompts success of the treatment and no additional treatment is required. In certain embodiments, when the proportion of leukemia cells in the subject tested is 1/10 ⁴ In the above cases, the treatment prompting unit prompts that the treatment is imperfect and other treatments are needed or the treatment intensity is improved. In certain embodiments, when the proportion of leukemia cells in the subject tested is 1/104 or more and 1/10 ³ In the following, the treatment prompting unit prompts that the subject can be subjected to bone marrow transplantation operation. In certain embodiments, when the proportion of leukemia cells in the subject tested is 1/10 ³ The above timeThe treatment prompting unit prompts that the bone marrow transplantation operation is not suitable for the subject, and the subject should be continuously treated with other treatments or the intensity of the treatments is improved.

In certain embodiments, the monitoring unit of the other therapy selected from the drug candidate screening module prompts the drug candidate to be effective, or a therapy and/or drug that is functionally and/or potently similar thereto.

Other aspects and advantages of the present disclosure will become readily apparent to those skilled in the art from the following detailed description. Only exemplary embodiments of the present disclosure are shown and described in the following detailed description. As those skilled in the art will recognize, the present disclosure enables one skilled in the art to make modifications to the disclosed embodiments without departing from the spirit and scope of the invention as described herein. Accordingly, the drawings and descriptions herein are to be regarded as illustrative in nature and not as restrictive.

Drawings

The specific features of the invention related to this application are set forth in the appended claims. The features and advantages of the invention that are related to the present application will be better understood by reference to the exemplary embodiments and the drawings that are described in detail below. The brief description of the drawings is as follows:

FIG. 1 shows a flow cytometer analysis schematic for analyzing a blood sample from a patient with leukemia.

FIG. 2 shows a schematic representation of flow cytometry analysis of T cell depleted leukemia cells.

FIG. 3 shows a schematic representation of flow cytometry analysis of T cells retained in a screening tube.

Figure 4 shows a hierarchical standard schematic for evaluating drug efficacy.

FIG. 5 shows the results of gene expression analysis on the disease model of the present application.

FIG. 6 is a schematic representation of the detection of leukemia cell residues in a subject.

FIG. 7 is a schematic diagram showing the results of specific gene expression in leukemia cells of a subject.

FIG. 8 is a schematic diagram showing the results of detecting patient-specific DNA sequences in leukemia cells of a subject.

FIG. 9 is a schematic representation of the results of detection of leukemia cells in a subject by qPCR reactions.

Fig. 10 is a schematic flow chart of the operation of the leukemia diagnosis and treatment system of the present application.

Fig. 11 is a schematic diagram showing the relationship between functional units in the leukemia diagnosis and treatment system of the present application.

Detailed Description

Further advantages and effects of the invention of the present application will become apparent to those skilled in the art from the disclosure of the present application, from the following description of specific embodiments.

In this application, the term "Leukemia" (Leukemia) generally refers to a disease caused by the massive proliferation, accumulation of Leukemia cells, usually starting in the bone marrow. The leukemia may include B-cell acute lymphoblastic leukemia and/or T-cell acute lymphoblastic leukemia.

In this application, the term "about" generally means ranging from 0.5% to 10% above or below the specified value, e.g., ranging from 0.5%, 1%, 1.5%, 2%, 2.5%, 3%, 3.5%, 4%, 4.5%, 5%, 5.5%, 6%, 6.5%, 7%, 7.5%, 8%, 8.5%, 9%, 9.5%, or 10% above or below the specified value.

Modeling module

In this application, the term "modeling module" generally refers to a functional unit for constructing a model of a specific humanized disease in a subject suffering from leukemia. For example, the modeling module can include a sample unit comprising a leukemia cell suspension derived from the subject, a radiation unit comprising a radiation treatment device, and an inoculation unit for inoculating the leukemia cell suspension to an immunodeficient mouse treated with the radiation unit.

For example, the modeling module may include a sample-carrying device that obtains a sample of a subject (e.g., a device that obtains a sample such as a lancet, a device that carries a sample such as a cuvette), a sample-processing device that processes a sample of a subject to obtain a leukemic cell suspension of a subject (e.g., a solution for suspending leukemic cells and a cuvette); a radioactive treatment device (e.g., an X-ray accelerator for radiotherapy) and an immunodeficient mouse (e.g., NSG mouse, MISTRG mouse) for performing a radioactive treatment on an appropriate immunodeficient mouse; an inoculation device (e.g., syringe, etc.) capable of inoculating a leukemia cell suspension into an immunodeficient mouse treated with the irradiation unit.

The modeling module may further comprise a separation unit capable of separating the subject sample. For example, the modeling module can include a reagent to separate cells (e.g., monocyte separation fluid), a device to separate cells (e.g., a centrifuge). The modeling module may further comprise a T cell removal unit that removes T cells in a sample derived from a non-T cell leukemia subject to obtain the leukemia cell suspension. For example, the modeling module can include a high magnetic field (e.g., a magnetic field strength of no less than about 0.05 tesla), a CD3 positive T cell screening agent (e.g., magnetic beads coated with a CD3 monoclonal antibody). The modeling module may also include an infrared illumination and heating unit that illuminates the individual with an infrared light source, for example, the modeling module may include an infrared light source (e.g., 175 watt infrared lamp). The modeling module may further comprise a monitoring unit that monitors the growth of leukemia cells from the subject in the vaccinated immunodeficient mice. For example, the modeling module can include monitoring huCD45 in the peripheral blood of the mice vaccinated with the injection ⁺ 、huCD19 ⁺ 、huCD3 ⁺ And/or huCD33 ⁺ A monitoring device (e.g., a flow cytometer) and a monitoring reagent (e.g., an anti-CD 45 antibody, an anti-CD 19 antibody, an anti-CD 3 antibody, and/or an anti-CD 33 antibody) for the proportion of cells. The modeling module may further include a spleen processing unit that processes the spleen of the disease model. For example, the modeling module may include a separation element (e.g., surgical scissors) for separating the spleen of the mouse, a device for disrupting the separated spleen of the mouse to obtain spleen fines A disruption element (e.g., metal screen, plastic screen) for cells and a suspension element (e.g., RPMI medium) for preparing the spleen cells into the leukemia cell suspension. The modeling module may also include liquid nitrogen.

In this application, the term "subject" generally refers to an individual having some disease characterization, which may refer to symptoms of a disease, as well as to a deleterious physiological state that cannot be altered in a prophylactic setting. The individual may comprise a male and/or female, typically comprising a human or non-human animal, such as a non-human mammal. In certain embodiments, the individual includes, but is not limited to, a human, dog, cat, horse, sheep, goat, pig, cow, rabbit, rat, mouse, monkey, and the like. For example, the subject may be a human patient.

In this application, the term "subject-specific humanized disease model" generally refers to a disease model that is capable of exhibiting subject-specific, humanized modifications. For example, disease models are shown that characterize a disease characteristic of a subject, are humanized by comprising and/or expressing human-derived tissues, cells and/or genes. In certain embodiments, the subject-specific humanized disease model comprises a subject-specific leukemia humanized mouse model. For example, the subject-specific leukemia humanized mouse model comprises leukemia cells derived from the subject, and the proportion of hucd45+, hucd19+, hucd3+, and/or hucd33+ cells in the peripheral blood of the mouse model can be at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, or at least about 90% by total number of cells.

For example, the subject-specific humanized disease model (e.g., leukemia humanized disease model) can be prepared by: a) Preparing a bone marrow sample from the subject (e.g., leukemia patient) as a cell suspension, and using a monocyte isolation fluid to isolate the subjectCentrifuging the cell suspension; b) Obtaining a cell layer comprising leukemia cells and preparing a leukemia cell suspension; c) Judging whether the leukemia is T-cell leukemia; for non-T cell leukemia, removing T cells in the leukemia cell suspension obtained in b) to obtain a leukemia cell suspension to be inoculated, and making the final density of leukemia cells in the leukemia cell suspension to be inoculated 2x10 ⁷ Ml to 5x10 ⁷ /ml; for T-cell leukemia, preparing a leukemia cell suspension to be inoculated from said leukemia cell suspension obtained from b), wherein the final density of leukemia cells is 2x10 ⁷ Ml to 5x10 ⁷ /ml; d) Selecting an appropriate immunodeficient mouse according to the type of leukemia of the patient and subjecting the immunodeficient mouse to a radioactive treatment; e) Injecting and seeding the leukemia cell suspension to be vaccinated obtained from c) into the radiation-treated immunodeficient mice of d).

In the present application, the term "sample unit" generally refers to a functional unit comprising a sample derived from a subject, e.g. a leukemic cell suspension of the subject. The sample unit may comprise a sample carrier device for obtaining a subject sample and a sample processing device for processing the subject sample to obtain a leukemic cell suspension for the subject. For example, the sample-carrying device may include a device that obtains a sample (e.g., a lancet, a vacuum tube, a urine collection device, a saliva collection device, a fecal collection device, etc.) and a device that carries a sample (e.g., a test tube, a centrifuge tube, etc.). For example, the sample processing device can include a solution for suspending leukemia cells (e.g., fetal bovine serum solution containing about 10% DMSO, caCl) ₂ Solutions) and test tubes.

The sample unit may comprise a suspension of leukemia cells derived from the subject, the density of leukemia cells in the suspension may be 1x10 ⁷ Ml to 5x10 ⁷ /ml，1.5x10 ⁷ Ml to 5x10 ⁷ /ml，2x10 ⁷ Ml to 5x10 ⁷ /ml，2.5x10 ⁷ Ml to 5x10 ⁷ /ml，3x10 ⁷ Ml to 5x10 ⁷ /ml，3.5x10 ⁷ Ml to 5x10 ⁷ /ml，4x10 ⁷ Ml to 5x10 ⁷ /ml，4.5x10 ⁷ Ml to 5x10 ⁷ /ml，4.8x10 ⁷ Ml to 5x10 ⁷ /ml，4.9x10 ⁷ Ml to 5x10 ⁷ /ml，2x10 ⁷ Ml to 2.5x10 ⁷ /ml，2x10 ⁷ Ml to 3x10 ⁷ /ml，2x10 ⁷ Ml to 3.5x10 ⁷ /ml, etc.

In the present application, the term "sample" generally refers to a sample for the sample unit from which a leukemia cell suspension can be obtained, which can be taken directly or indirectly from a subject. In certain embodiments, the sample taken directly from the subject is not further treated, e.g., blood may be obtained from the subject's peripheral circulatory system (e.g., by a blood lancet). The sample may include, for example, blood, urine, feces, saliva, cerebrospinal fluid, sweat, and the like. Non-limiting examples of such samples include blood (or components of blood-e.g., white blood cells, red blood cells, platelets) obtained from any anatomical location (e.g., tissue, circulatory system, bone marrow) of a subject, cells obtained from any anatomical location of a subject, skin, heart, lung, kidney, exhaled breath, bone marrow, stool, semen, vaginal fluid, interstitial fluid derived from tumor tissue, breast, pancreas, cerebrospinal fluid, tissue, throat swab, biopsy, placental fluid, amniotic fluid, liver, muscle, smooth muscle, bladder, gall bladder, colon, intestine, brain, luminal fluid, sputum, pus, microbiota (micropilota), fetal manure, milk, prostate, esophagus, thyroid, serum, saliva, urine, gastric fluid and digestive fluid, tears, ocular fluid, sweat, mucus, earwax, oil, glandular secretions, spinal fluid, hair, nails, skin cells, plasma, nasal swab or nasopharyngeal wash, spinal fluid, blood, lymph, and/or other bodily excretions or tissues. In certain embodiments, the sample is a bone marrow specimen derived from a subject, e.g., comprising bone marrow cells and/or blood cells of the subject. For another example, the sample is a bone marrow sample of a leukemia patient, wherein the leukemia cells account for more than 90%.

In this application, the term "suspension" generally refers to a cell suspension in which one or more cells are dispersed in a liquid, wherein the cells may be separated as an individual or in a pellet consisting of no more than about 50, no more than about 40, no more than about 30, no more than about 20, no more than about 10, or less cells.

In the present application, the term "leukemia cells" generally refers to immature leukocytes resulting from the pathological differentiation of hematopoietic stem cells. For example, leukemia cells generally do not function as normal cells and can also have a strong proliferative capacity.

In the present application, the term "cell density" or "density" generally refers to the number of cells contained per unit volume in a cell suspension. For example, the density of leukemia cells in the suspension may be 2x10 ⁷ Ml to 5x10 ⁷ Per ml, 2.5x10 ⁷ Ml to 5x10 ⁷ Per ml, 3x10 ⁷ Ml to 5x10 ⁷ Per ml, 3.5x10 ⁷ Ml to 5x10 ⁷ Per ml, 4x10 ⁷ Ml to 5x10 ⁷ Per ml, 4.5x10 ⁷ Ml to 5x10 ⁷ Per ml, 4.8x10 ⁷ Ml to 5x10 ⁷ /ml or 4.9x10 ⁷ Ml to 5x10 ⁷ /ml。

Cell suspensions may be obtained in this application by using a medium, provided that the medium is capable of allowing the cells to grow normally. In certain embodiments, the medium also places the cells in suspension. For example, leukemia cell suspensions can be prepared using RPMI cell culture media. For another example, DMEM medium, IMDM medium, HAMF12 medium, MEM medium, 199 cell medium, MDSS2 cell medium, and the like can be used.

In this application, the term "radiation unit" generally refers to a structural unit comprising a radioactive treatment device. For example, the radiating element may be a functional element for the radioactive treatment of a suitable immunodeficient mouse.

In this application, the term "radioactive treatment device" generally refers to a device that is irradiated by a radiation source capable of emitting radiation (e.g., alpha rays, beta rays, gamma rays, X rays, etc.). For example, an X-ray accelerator for radiotherapy, an electron beam accelerator for radiotherapy, a medical accelerator, an X-ray deep therapeutic machine, a medical X-ray CT machine, a heavy ion therapeutic accelerator, a proton therapeutic device, an accelerator for irradiation device, a neutron generator, and the like.

In the present application, the term "immunodeficient mouse" generally refers to a mouse that has a defect in one or more immune system components, which may be caused by congenital genetic mutations and/or by artificial methods. In the present application, the immunodeficient mouse may be a T-lymphocyte function deficient mouse, a B-lymphocyte function deficient mouse, an N-cell function deficient mouse, a combination immunodeficient mouse, or the like. For example, the immunodeficient mouse may be an NSG mouse, an MISTRG mouse, a nude mouse, a CBA/N mouse, a Beige mouse, a Scid mouse, or the like. The immunodeficient mice may be 5-7 weeks old (e.g., 5-6 weeks old, 5-6.5 weeks old, 5.5-6.5 weeks old) and the immunodeficient mice may also be 5-8 weeks old, 5-9 weeks old, 5-10 weeks old, 4-12 weeks old, 3-10 weeks old, 3-12 weeks old.

In this application, the term "NSG mouse" generally refers to a NOD-scid interleukin 2 receptor gamma knockout mouse that lacks mature T cells, B cells, and natural killer cells.

In this application, the term "MISTRG mouse" generally refers to mice that express the human macrophage colony-stimulating factor (M-CSF), human interleukin 3 (IL-3)/granulocyte-macrophage colony-stimulating factor (GM-CSF), human signal-regulating protein alpha (SIRPa), human Thrombopoietin (TPO), and human Erythropoietin (EPO) genes, but do not express the recombinant activating gene 2 (RAG 2) or interleukin 2 receptor gamma (IL 2 Rg).

In the present application, when the leukemia is acute lymphoblastic leukemia, the immunodeficient mouse may be an NSG mouse. When the leukemia is acute myelogenous leukemia, the immunodeficient mouse can be a MISTRG mouse.

The radiation treatment is performed on the immunodeficient mice within 12-24 hours (e.g., 10-24 hours, 10-36 hours, 10-72 hours, 8-24 hours, 8-36 hours, 8-72 hours) prior to injection of the leukemia cell suspension.

The method of radioactive treatment may be, for example, X-ray radiation, gamma-ray radiation, or the like. The conditions of the radioactive treatment can be adjusted by those skilled in the art according to the kind of mice, the condition of inoculation, etc. For example, the mice can be irradiated with X-rays (e.g., at least 1MV, at least 2MV, at least 3MV, at least 4MV, at least 5MV, or higher energy X-rays). The X-ray intensity may be, for example, at least 100 cGy/min, at least 150 cGy/min, at least 200 cGy/min, at least 250 cGy/min, at least 300 cGy/min, at least 310 cGy/min, at least 320 cGy/min, at least 325 cGy/min, at least 340 cGy/min, at least 360 cGy/min, at least 380 cGy/min, at least 400 cGy/min or higher. The radiation dose employed in performing the radiation treatment may be about 50cGy to 100cGy, about 100cGy to 150cGy, about 150cGy to 200cGy, about 200cGy to 250cGy, about 250cGy to 300cGy, about 300cGy to 350cGy, about 350cGy to 400cGy, about 400cGy to 450cGy, about 450cGy to 500cGy, about 500cGy to 550cGy, about 550cGy to 600cGy, about 600cGy to 650cGy, about 650cGy to 700cGy, about 700cGy to 750cGy, about 750cGy to 800cGy, about 800cGy to 850cGy, or more. For example, the radiation treatment may be performed on the immunodeficient mice for a period of about 6-8 hours, about 8-12 hours, about 12-16 hours, about 16-20 hours, about 20-24 hours, about 24-28 hours, about 28-32 hours, or more prior to injection of the leukemia cell suspension.

In certain embodiments, when the immunodeficient mouse is an NSG mouse, it may be subjected to a radioactive treatment using X-rays. The radiation dose may be from about 200cGy to about 300cGy, for example about 250cGy. For example, 4MV X-rays may be used, and the intensity is about 325 cGy/min.

In certain embodiments, when the immunodeficient mouse is a MISTRG mouse, it can be subjected to a radioactive treatment using X-rays. The radiation dose may be from about 550cGy to about 650cGy, for example about 600cGy. For example, 4MV X-rays may be used, and the intensity is about 325 cGy/min.

In the present application, the term "inoculation unit" generally refers to a functional unit for inoculating a leukemia cell suspension into an immunodeficient mouse treated with said irradiation unit. For example, the inoculating unit may include an inoculating device, such as an injection apparatus (e.g., syringe, needleless syringe, etc.), a fully automated inoculating machine, or the like.

In this application, the term "seeding" generally refers to a process of inputting cells, solutions, reagents or the like to be seeded into an injection subject through an injection device. For example, the cells, solutions or reagents to be inoculated, etc., may be a leukemia cell suspension derived from the subject.

The preparation method of the leukemia humanized disease model can further comprise the following steps: g) huCD45 in peripheral blood of the mice vaccinated when injected ⁺ 、huCD19 ⁺ 、huCD3 ⁺ And/or huCD33 ⁺ Isolating the spleen of the mouse using an isolation unit at a cell fraction of at least 50%, disrupting the spleen, and suspending the disrupted cells of the spleen in a cell culture medium to obtain a cell suspension from the spleen; h) Centrifuging the spleen-derived cell suspension using a mononuclear cell separation fluid; i) Obtaining a cell layer comprising leukemia cells, suspending cells in the cell layer in fetal bovine serum containing 10% DMSO to prepare a final cell density of 2x10 ⁷ Ml to 5x10 ⁷ Stock solution/ml; and j) storing the stock liquid obtained from i) in liquid nitrogen for later use.

In the present application, the term "separation unit" generally refers to a functional unit that utilizes the difference in physical or chemical properties of the components in a mixture to distribute the components to different spatial regions or to the same spatial region sequentially at different times by a suitable method. For example, the separation unit is capable of separating a sample of the subject. The separation unit may comprise reagents for separating cells and/or means for separating cells. For example, the cell-separating agent may be a mononuclear cell separating fluid, such as Ficoll. For another example, the cell separation device may be a centrifuge such as a high-speed refrigerated centrifuge, a normal temperature high-speed centrifuge, a desktop general-purpose centrifuge, or the like.

In the present application, the term "monocyte separation liquid" generally refers to a reagent for separating monocytes in blood. In certain embodiments, the monocyte separation fluid utilizes differences in volume and/or morphology and/or density of cells, etc., to separate and/or purify monocytes. For example, the mononuclear cell separation fluid is Ficoll. For another example, the mononuclear cell separation liquid may be an aqueous solution of dextran and meglumine diatrizoate, a Percoll solution, or the like. For example, the separation is centrifugation. The centrifugation may be density gradient centrifugation.

In the present application, the term "T cell removal unit" generally refers to a functional unit for removing T cells in a sample derived from a non-T cell leukemia subject, thereby obtaining the leukemia cell suspension. For example, the T cell removal unit may include a high magnetic field and/or a T cell separation reagent. In certain embodiments, the T cells that are removed are CD3 positive T cells (T lymphocytes (cd3+)). To remove the CD3 positive T cells, the T cell removal unit may further comprise a CD3 positive T cell screening reagent. For example, the T cell separation reagent may include heparin, lymphocyte separation fluid, cell culture fluid, and the like. The CD3 positive T cell screening reagent may comprise magnetic beads comprising CD3 antibodies. For example, the magnetic beads are magnetic beads coated with a CD3 monoclonal antibody. For example, the magnetic beads may be anti-human CD3 mAb coated magnetic beads or anti-CD 3/anti-CD 28 monoclonal antibody coated magnetic beads. In certain embodiments, the CD3 positive T cell screening reagent may be a magnetic bead from Miltenyi

In this application, the term "high magnetic field" generally refers to a magnetic field having a magnetic field strength of not less than about 0.05 tesla, not less than about 0.1 tesla, not less than about 0.3 tesla, not less than about 0.5 tesla, not less than about 0.55 tesla, not less than about 0.6 tesla, not less than about 0.7 tesla, not less than about 0.8 tesla, not less than about 0.9 tesla, not less than about 1.0 tesla, not less than about 2.0 tesla, not less than about 3.0 tesla, or higher.

In this application, the term "T cell removal" generally refers to a proportion of T cells in the monocyte population that is no greater than about 0.5%, no greater than about 0.4%, no greater than about 0.3%, no greater than about 0.2%, or no greater than about 0.1% after removal by a removal procedure.

In the present application, the term "non-T-cell leukemia" generally refers to a type of leukemia other than T-cell leukemia, such as acute B-cell leukemia, acute myelogenous leukemia, chronic B-cell leukemia, chronic myelogenous leukemia, and the like.

In this application, the term "infrared irradiation and heating unit" generally refers to a functional unit that irradiates an individual with an infrared light source. For example, the infrared irradiation and heating unit may comprise an infrared light source. Wherein the infrared light source refers to electromagnetic radiation with a certain range of wavelengths greater than the wavelength of red light, such as 0.78-1000 μm. The infrared light source may include a near infrared, mid infrared or far infrared light source. The wavelength of the near infrared light source may be 0.78 to 1.4 μm, 0.78 to 1.3 μm, 0.78 to 1.2 μm, 0.78 to 1.1 μm, 0.78 to 1.0 μm, 0.78 to 0.9 μm, 0.78 to 0.85 μm, 0.78 to 0.8 μm. The wavelength of the mid-infrared light source may be 1.4-3 μm, 1.5-3 μm, 1.6-3 μm, 1.7-3 μm, 1.8-3 μm, 1.9-3 μm, 2.0-3 μm, 2.2-3 μm, 2.4-3 μm, 2.6-3 μm, 2.8-3 μm, 2.9-3 μm. The wavelength of the far infrared light source may be 3 to 1000 μm, 5 to 1000 μm, 7 to 1000 μm, 10 to 1000 μm, 50 to 1000 μm, 100 to 1000 μm, 200 to 1000 μm, 300 to 1000 μm, 400 to 1000 μm, 500 to 1000 μm, 600 to 1000 μm, 700 to 1000 μm, 800 to 1000 μm, 900 to 1000 μm, 950 to 1000 μm, 980 to 1000 μm, 990 to 1000 μm. For example, the infrared light source is a 175 watt infrared lamp.

In the present application, the term "monitoring unit" generally refers to a functional unit for monitoring the growth of leukemia cells from the subject in the vaccinated immunodeficient mice. For example, the monitoring unit may comprise monitoring huCD45 in the peripheral blood of the mice vaccinated with the injection ⁺ 、huCD19 ⁺ 、huCD3 ⁺ And/or huCD33 ⁺ Monitoring device for cell proportion. For example, the number of the cells to be processed,the detection device may be a flow cytometer. Also for example, the monitoring unit may further comprise monitoring huCD45 in the peripheral blood of the mice vaccinated with the injection ⁺ 、huCD19 ⁺ 、huCD3 ⁺ And/or huCD33 ⁺ Monitoring reagent for cell proportion. For example, the monitoring agent may be an anti-CD 45 antibody, an anti-CD 19 antibody, an anti-CD 3 antibody, and/or an anti-CD 33 antibody.

In the subject-specific humanized disease model, leukemia cells from the patient can be monitored for growth in the mouse. In certain embodiments, huCD45 is detected by monitoring peripheral blood of the mice vaccinated with the injection ⁺ 、huCD19 ⁺ 、huCD3 ⁺ And/or huCD33 ⁺ Cell ratio to monitor the growth of leukemia cells from the patient in the mice, so that huCD45 in the peripheral blood of the obtained mouse model was prepared ⁺ 、huCD19 ⁺ 、huCD3 ⁺ And/or huCD33 ⁺ The proportion of cells reaches the range (e.g., at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, or at least about 90%) of the total number of cells. For example, when the leukemia of the patient is B-cell leukemia, huCD19 can be detected in the peripheral blood of the mice vaccinated by injection ⁺ The proportion of cells was used to monitor the growth of leukemic cells from the patient in the mice. For example, when the leukemia of the patient is a T-cell leukemia, huCD3 can be detected in the peripheral blood of the mice vaccinated by injection ⁺ The proportion of cells was used to monitor the growth of leukemic cells from the patient in the mice. For example, when the leukemia of the patient is myelogenous leukemia, huCD33 can be detected in the peripheral blood of the mice vaccinated by injection ⁺ The proportion of cells was used to monitor the growth of leukemic cells from the patient in the mice.

In this application, the term "spleen processing unit" generally refers to a functional unit that processes the spleen of the disease model (e.g., mouse). For example, spleen cells can be obtained when the ratio of hucd45+, hucd19+, hucd3+, and/or hucd33+ cells in the vaccinated peripheral blood of the mouse is at least 50% (at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, or at least about 90%), and the spleen cells are further prepared as the leukemia cell suspension by the spleen processing unit. The spleen processing unit may include separation elements (e.g., surgical scissors, ligature, sterile funnel, etc.), disruption elements (e.g., ultrasonic vibrator, high pressure homogenizer, metal screen, plastic screen, etc.), and suspension elements (e.g., RPMI medium, fetal bovine serum solution containing about 10% dmso, caCl) ₂ A solution), wherein the separation element is used to separate the spleen of the mouse; the disruption element may disrupt the spleen of the isolated mouse to obtain spleen cells; the suspension element may prepare the spleen cells as the leukemia cell suspension.

In this application, the term "liquid nitrogen" generally refers to liquid nitrogen.

Candidate drug screening module

In this application, the term "drug candidate screening module" generally refers to a functional unit that provides a subject with a specific drug candidate for the subject-specific humanized disease model, thereby enabling accurate diagnostic treatment. For example, the drug candidate screening module may include a first drug candidate set comprising one or more drugs, a second drug candidate set comprising one or more drugs. For example, the candidate drug screening module may include vincristine, dexamethasone, levoasparaginase, a topoisomerase inhibitor, a purine nucleoside derivative, a proteasome inhibitor, an mTOR inhibitor, dasatinib, an antibody drug, all-trans retinoic acid, a DNA damage inducer, a folate reductase inhibitor, a deacetylase inhibitor, a multi-receptor tyrosine kinase inhibitor, a cytotoxic drug, and a vitamin a amide. For example, the candidate drug screening module may include one or more drugs selected from the group consisting of: vincristine, dexamethasone, levoasparaginase, topotecan, clofarabine, carfilzomib, temsirolimus, dasatinib, bortezomib, CD19 antibody, all-trans retinoic acid, doxorubicin, carbamate, SAHA, sunitinib, cyclophosphamide, and retinol. For another example, the drug candidate screening module may include one or more of protein kinase inhibitors, apoptosis modulators, DNA disintegrants, cell division inhibitors, MDM 2-type oncogene inhibitors, antibodies, and other chemotherapeutic drug additives.

The candidate drug screening module may further comprise a monitoring unit that monitors the growth of leukemia cells from the subject in the vaccinated immunodeficient mice. Thus, the candidate drug screening module may include a detection element (e.g., a flow cytometer) that detects the growth of leukemia cells from the subject in the vaccinated immunodeficient mice, a decision element (e.g., a CPU processor) that determines the grade of the candidate drug based on the growth detected by the detection element, and a feedback element (e.g., a display) that displays the grade result of the decision element.

In the present application, one or more drug candidates may be included in the drug candidate screening module for administration to the subject-specific humanized disease model as desired. The dosage, dosage form, mode of administration, etc. of each candidate drug included in the candidate drug screening module are determined according to the characteristics of the candidate drug itself.

In the present application, the term "drug candidate" generally refers to substances that may be used as drugs, which may be evaluated by appropriate methods to obtain information on their biological activity, pharmacological effect and efficacy.

In this application, the term "first drug candidate set" generally refers to a collection of one or more drug candidates that may be used to receive a screen in a first stage. The first stage may be a conventional leukemic chemotherapy stage. The first drug candidate group may include drugs conventionally used in leukemia chemotherapy. For example, the first drug candidate group may include one or more drugs selected from the group consisting of: vincristine, dexamethasone, levoasparaginase, topoisomerase inhibitor, purine nucleoside derivative, proteasome inhibitor, mTOR inhibitor, dasatinib, antibody drug, all-trans retinoic acid, DNA damage inducer, folic acid reductase inhibitor, deacetylase inhibitor, multi-receptor tyrosine kinase inhibitor, cytotoxic drug and vitamin a amide. In certain embodiments, the first drug candidate group comprises one or more drugs selected from the group consisting of: vincristine, dexamethasone, levoasparaginase, topotecan, clofarabine, carfilzomib, temsirolimus, dasatinib, bortezomib, CD19 antibody, all-trans retinoic acid, doxorubicin, carbamate, SAHA, sunitinib, cyclophosphamide, and valphenamide.

In this application, the term "second drug candidate set" generally refers to a collection of one or more drug candidates that can be used to receive a screen in a second stage. The second stage may be subsequent to the first stage of the conventional leukemia chemotherapy. The second drug candidate set may include one or more drugs selected from the group consisting of: protein kinase inhibitors, apoptosis modulators, DNA disintegrants, cell division inhibitors, MDM2 oncogene inhibitors, antibodies and other chemotherapeutic agents.

In the present application, the term "protease inhibitor" generally refers to a substance that is capable of binding to some group on the center of the protease molecule activity, causing the protease to decrease in activity, even disappear, but not the protease itself to denature. The protease inhibitors may include leupeptin, antinociceptin, chymotrypsin, elastase aldehyde, pepstatin, and phosphoramidate. For example, the protease inhibitor may be a pharmaceutical comprising one or more drugs selected from the group consisting of: AZD8055, MLN0128, GSK690693, MK-2206, SAR245408, rapamycin, MLN0128, selumetinib, AZD6244, PCI-32765, ibrutinib, SGI-1776, dinaciclib, VS-4718, sorafenib, sunitinib and AZD1480.

In this application, the term "apoptosis modulator" generally refers to a substance capable of modulating the occurrence and extent of apoptosis. Apoptosis generally refers to the autonomous, orderly death of cells controlled by a gene. The apoptosis regulator can regulate the apoptosis process by regulating the break condition of the cell nuclear DNA and other ways. For example, the apoptosis modulator may comprise one or more drugs selected from the group consisting of: ABT-263 (naviteclmax), ABT-199 (venetoclax), LCL161 and birinaptant.

In the present application, the term "DNA degrading agent" generally refers to an agent capable of degrading DNA. For example, the agent may decompose the DNA by crosslinking the DNA, modifying nitrogen atoms and/or exocyclic oxygen groups on the DNA ring, and the like. For example, the DNA breaker may comprise one or more drugs selected from the group consisting of: PR-104, cytarabine (CPX-351), daunorubicin (Vyxeos) and temozolomide.

In the present application, the term "cell division inhibitor" generally refers to a substance capable of inhibiting cell division. Cell division generally refers to the process of dividing a cell into two or more cells in number from one cell during cell proliferation. For example, the cell-dividing agent may inhibit interactions between FtsZ and ZipA. For example, the cell division inhibitor may comprise one or more drugs selected from the group consisting of: eribulin, ispinesib and alilerib.

In the present application, the term "MDM2 class oncogene inhibitor" generally refers to a substance that inhibits the expression of MDM2 class oncogenes. The MDM2 protein, an expression product of the MDM2 oncogene, can be combined with p53 protein to inhibit normal biological functions of p53, so that tumors are generated. And p53 is a very important human tumor suppressor gene, which has the functions of controlling DNA repair, cell cycle arrest, apoptosis and the like. For example, the MDM2 class oncogene inhibitor may comprise one or more drugs selected from the group consisting of: MK-8242 (SCH 900242) and RG7112.

In this application, the term "antibody-based drug" generally refers to an antibody-based drug suitable for the treatment of leukemia. For example, the antibody drug may comprise one or more drugs selected from the group consisting of: SAR3419.

In this application, the term "other chemotherapeutic drug adjunctive" generally refers to substances used to aid in enhancing the therapeutic effects of chemotherapy during leukemia chemotherapy. For example, the other chemotherapeutic drug additives may include one or more drugs selected from the group consisting of: alvershimycin, AT13387, PF-03084014, RO-4929097, MLN4924, PG11047, CX-5461, BMN-673, selinexor, bortezomib, curaxin and CBL0137.

In this application, the dosage and time of administration of the drug candidate may be adjusted according to the characteristics of the drug candidate itself. For example, the drug candidate may comprise vincristine, and the vincristine is administered to the model in the following manner: the administration was by intraperitoneal injection, at an amount of 0.5mg/kg each time, once a week for 3-6 weeks. For example, the drug candidate comprises a carbamate and the carbamate is administered to the model in the following manner: the administration was by intraperitoneal injection, at an amount of 3-6mg/kg each time, once daily, every other week and for 6-10 weeks. For example, the drug candidate comprises dexamethasone, and the dexamethasone is administered to the model in the following manner: the administration is by intraperitoneal injection, each time the administration amount is 10-20mg/kg, once daily and continuously for 3-6 weeks. For example, the drug candidate comprises doxorubicin and the doxorubicin is administered to the model in the following manner: the administration is by intravenous injection, with each administration amount of 0.5-3mg/kg, once a week and for 3-6 weeks. For example, the drug candidate comprises levo-asparagine and the levo-asparagine is administered to the model in the following manner: the administration is by intraperitoneal injection, with the dosage of 500-2000KU/kg each time, once daily and for 3-6 weeks. For example, the drug candidate comprises topotecan, and the topotecan is administered to the model in the following manner: the administration is by intraperitoneal injection, the dosage is 0.1-5mg/kg each time, the administration is carried out once daily for 2-8 weeks, and the administration is stopped for one week after two weeks of administration. For example, the drug candidate comprises clofarabine and the clofarabine is administered to the model in the following manner: the administration is by intraperitoneal injection, each time the administration amount is 10-100mg/kg, once daily and continuously for 3-6 weeks. For example, the drug candidate comprises carfilzomib, and the carfilzomib is administered to the model in the following manner: the administration is by intravenous injection, with the dosage of 0.1-10mg/kg each time, twice weekly and for 3-6 weeks. For example, the drug candidate comprises temsirolimus and the temsirolimus is administered to the model in the following manner: the administration is by intraperitoneal injection, each time with the dosage of 5-50mg/kg, once daily and continuously for 1-3 weeks. For example, the drug candidate comprises dasatinib, and the dasatinib is administered to the model in the following manner: by oral administration, each dose is 5-50mg/kg, once daily and for 2-6 weeks. For example, the drug candidate comprises bortezomib and the bortezomib is administered to the model in the following manner: the administration is by intraperitoneal injection, with the dosage of 0.1-20mg/kg each time, twice a week and for 4-8 weeks. For example, the drug candidate includes SAR3419, and the SAR3419 is administered to the model in the following manner: the administration is by intraperitoneal injection, each time with the dosage of 0.5-50mg/kg, once a week for 4-8 weeks. For example, the drug candidate comprises all-trans retinoic acid, and the all-trans retinoic acid is administered to the model in the following manner: the administration is by intraperitoneal injection, each time with the dosage of 0.5-10mg/kg, once a week for 2-6 weeks. For example, the drug candidate comprises SAHA, and the SAHA is administered to the model in the following manner: the administration is by intraperitoneal injection, each time with the dosage of 100-500mg/kg, once daily and continuously for 3-6 weeks. For example, the drug candidate comprises sunitinib, and the sunitinib is administered to the model in the following manner: by oral administration, the dose is 10-100mg/kg each time, once daily and for 2-6 weeks. For example, the drug candidate comprises cyclophosphamide and the cyclophosphamide is administered to the model in the following manner: the administration is by intraperitoneal injection, each time with the dosage of 30-300mg/kg, once daily and continuously for 2-6 weeks. For example, the drug candidate comprises a vitamin a amide, and the vitamin a amide is administered to the model in the following manner: the administration is by intraperitoneal injection, each time with the dosage of 20-200mg/kg, once daily and continuously for 2-6 weeks.

In the present application, the term "monitoring unit" generally refers to a functional unit for monitoring the growth of leukemia cells from the subject in the vaccinated immunodeficient mice. For example, the monitoring unit may comprise a detection element (e.g., a flow cytometer, e.g., an antibody required to detect specific cells) to detect the growth of leukemia cells from the subject in the vaccinated immunodeficient mice and a decision element (e.g., a CPU processor, an algorithm) to determine the class of the candidate drug based on the detection of the growth by the detection element. The monitoring unit may also include a feedback element (e.g., a display screen, a voice output device, etc.) that displays the ranking results of the decision element.

The detection element detects the growth of leukemia cells from the subject in the vaccinated immunodeficient mice and transmits the detected growth to the decision element. And the decision element judges the growth condition obtained by transmission according to the set conditions for determining the grade of the candidate medicine, so as to obtain a grade result, and the grade result can be transmitted to the feedback element. The feedback element feeds back the transmitted grade result in the form of images, sounds, etc. to the suitability of the candidate drug for the subject, so as to provide a reliable reference for subsequent clinical treatment.

The monitoring unit can evaluate the efficacy of the candidate drug by detecting the proportion of leukemia cells (e.g., by monitoring the proportion of hucd45+, hucd19+, hucd3+, and/or hucd33+ cells in the peripheral blood of the mouse) and/or changes thereof within the subject-specific humanized disease model. The monitoring unit may include reagents and devices to detect the proportion of hucd45+, hucd19+, hucd3+, and/or hucd33+ cells in the peripheral blood of the mice. For example, the monitoring unit may comprise a flow cytometer, an ELISA kit to detect CD45, CD19, CD3 and/or CD33, and the like. The reagents and means for detecting the proportion of hucd45+, hucd19+, hucd3+, and/or hucd33+ cells in the peripheral blood of the mouse may continuously monitor the change in the proportion of hucd45+, hucd19+, hucd3+, and/or hucd33+ cells in the peripheral blood of the mouse after administration of the candidate drug and indicate the efficacy of the candidate drug based on the change.

Candidate drug administration to the mouse is considered when the monitoring unit detects that the proportion of hucd45+, hucd19+, hucd3+, and/or hucd33+ cells in the peripheral blood of the mouse reaches 1% -5% (e.g., reaches 1.2% -5%,2% -5%,2.5% -5%,3% -5%,3.5% -5%,4% -5%,4.5% -5%). For another example, the monitoring unit may be configured to suggest that a candidate drug may be administered to the mouse when the ratio reaches 1% -5%. The candidate drug is considered effective when the monitoring unit detects that the ratio of hucd45+, hucd19+, hucd3+ and/or hucd33+ cells in the mouse peripheral blood remains below 1% (e.g., below 0.9%, 0.8%, 0.7%, 0.6%, 0.5%, 0.4%, 0.3%, 0.2%, 0.1%, 0.05%) and maintains the ratio for at least 2 weeks (e.g., at least 3 weeks, at least 4 weeks, at least 5 weeks, at least 6 weeks, at least 7 weeks, at least 8 weeks, at least 9 weeks, at least 10 weeks). For another example, the monitoring unit may be configured to indicate that the drug candidate is effective when the ratio remains below 1% and the ratio is maintained for at least 2 weeks.

Depending on the clinical setting, the system described herein can also make stringent standards far above common statistical standards. During dosing, the proportion of human leukemia cells in the peripheral blood of the model in the subject-specific humanized disease model was monitored using the monitoring unit, and the drug candidates were classified into 6 classes according to the proportion. In some embodiments, the monitoring unit may include a feedback element in information communication with the detection element, which may display the level of the candidate drug. For example, the 6 grades may be respectively:

grade 1 progressive disease 1 (PD 1): there was substantially no therapeutic effect on the subject-specific humanized disease model. For example, the monitoring unit detects that the proportion of hucd45+ cells in the mouse peripheral blood reaches at least 8% (e.g., at least 8.5%,9%,9.5%, 10%) within 7 days (e.g., up to 6 days, 5 days, 4 days, 3 days) and at least 25% (e.g., at least 26%,27%,28%,29%, 30%) within 12 days (e.g., up to 11 days, 10 days, 9 days, 8 days).

Grade 2 progressive disease 2 (PD 2): the therapeutic effect on subject-specific humanized disease models is very limited. For example, the monitoring unit detects that the proportion of hucd45+ cells in the mouse peripheral blood reaches at least 6% (e.g., at least 6.5%,7%,7.5%, 7.8%) within 7 days (e.g., up to 6 days, 5 days, 4 days, 3 days) and at least 20% (e.g., at least 21%,22%,23%,24%, 25%) within 21 days (e.g., up to 20 days, 19 days, 18 days, 17 days).

Grade 3 Stable Disease (SD): the therapeutic effect on subject-specific humanized disease models is limited. For example, the monitoring unit detects that the proportion of hucd45+ cells in the mouse peripheral blood reaches at least 3% (e.g., at least 3.5%,4%,4.5%, 5%) within 7 days (e.g., at most 6 days, 5 days, 4 days, 3 days) and at least 10% (e.g., at least 10.5%,11%,11.5%, 12%) within 21 days (e.g., at most 20 days, 19 days, 18 days, 17 days).

Grade 4 partial mitigation (PR): the hucd45+, hucd19+, hucd3+, and/or hucd33+ cells in the peripheral blood of the mice can be reduced to 0% and maintained at a 0% ratio for 1 week (e.g., 6 days, 5 days, 4 days, 3 days) with a therapeutic effect on the subject-specific humanized disease model. For example, the monitoring unit detects that the proportion of hucd45+ cells in the mouse peripheral blood reaches 0% within 7 days (e.g., up to 6 days, 5 days, 4 days, 3 days), and maintains the proportion of 0% within 1 week (e.g., 6 days, 5 days, 4 days, 3 days), while at the same time at most 3% (e.g., up to 2.5%,2%,1.5%, 1%) within 21 days (e.g., up to 20 days, 19 days, 18 days, 17 days).

Grade 5 Complete Remission (CR): has good therapeutic effect on the subject-specific humanized disease model, can reduce the ratio of huCD45+, huCD19+, huCD3+, and/or huCD33+ cells in the peripheral blood of the mice to 0%, and can maintain the ratio of 0% in about 2 weeks (for example, 20 days, 19 days, 18 days, 17 days, 16 days, 14 days, 13 days, 12 days, 11 days, 10 days, 9 days, 8 days). For example, the monitoring unit detects that the proportion of hucd45+ cells in the mouse peripheral blood reaches 0% within 7 days (e.g., within 6 days, 5 days, 4 days, 3 days) and maintains a proportion of 0% for about 2 weeks (e.g., 20 days, 19 days, 18 days, 17 days, 16 days, 14 days, 13 days, 12 days, 11 days, 10 days, 9 days, 8 days) while maintaining a proportion of at most 2% (e.g., at most 1.5%,1%,0.5%, 0.1%) within 28 days (e.g., within 27 days, 26 days, 25 days, 24 days).

Grade 6 sustained complete remission (MCR): significantly superior therapeutic effect on the subject-specific humanized disease model, was able to decrease the proportion of hucd45+, hucd19+, hucd3+, and/or hucd33+ cells to 0% in the mouse peripheral blood and maintain the proportion of 0% over 3 weeks (e.g., 21 days, 22 days, 23 days, 24 days, 25 days, 26 days, 27 days, 28 days, 29 days, 30 days, 35 days, 40 days, 45 days). For example, the monitoring unit detects that the proportion of hucd45+ cells in the mouse peripheral blood reaches 0% within 7 days (e.g., within 6 days, 5 days, 4 days, 3 days) and maintains a proportion of 0% over 3 weeks (e.g., 21 days, 22 days, 23 days, 24 days, 25 days, 26 days, 27 days, 28 days, 29 days, 30 days, 35 days, 40 days, 45 days) while maintaining a proportion of at most 1% (e.g., at most 0.5%,0.4%,0.3%,0.2%, 0.1%) within 42 days (e.g., within 41 days, 40 days, 38 days, 36 days).

The above 6 classes of classification can provide reliable drug detection data and administer this specific drug candidate to a subject for clinical treatment. The system of the application selects the candidate drug according to the candidate drug screening module, takes the candidate drug as the clinical drug which is most suitable for the subjects, and recommends the clinical administration of the subjects.

Detection module

In the present application, the term "detection module" generally refers to a functional unit that detects the presence and/or proportion of leukemia cells in the subject. The detection moduleAmplification units that specifically amplify a target gene to obtain a target-specific amplified product (e.g., may include materials and reagents necessary to perform the PCR amplification, such as a PCR instrument, nucleic acid polymerase, reverse transcriptase, dNTPs, mg ²⁺ Ions, buffers required for amplification reactions, etc.).

For example, the detection module can further comprise an identification unit capable of identifying a characteristic amplification product of the target-specific amplification product derived from the leukemia cells of the subject (e.g., can comprise materials and reagents described for isolation of a characteristic amplification product derived from leukemia cells of the subject, such as an electrophoresis apparatus, electrophoresis tank, gel, electrophoresis buffer, etc.). For example, the detection module can further include an analysis unit capable of obtaining a characteristic gene sequence specific for leukemia cells of the subject (e.g., can include reagents and devices for analyzing the characteristic amplification products, such as sequencing primers, sequencing kits, sequence analysis programs, and the like). For example, the detection module can further include a recognition unit capable of determining the presence and/or proportion of residual leukemia cells in the subject (e.g., can include reagents or devices that specifically amplify a gene sequence specific for a leukemia cell of the subject, such as materials and reagents required for a qPCR reaction, such as a qPCR instrument, a,

Green I, DNA polymerase, dntps, amplification buffer, and the like; such as sequence-specific oligonucleotide probes, e.g., fluorescent probes, that are optically active when hybridized to the amplification products). For example, the detection module may further comprise a treatment prompting unit capable of prompting a subsequent treatment regimen to be applied to the respective subject based on the detected presence and/or proportion of leukemia cells in the subject. For example, a detection element (e.g., a flow cytometer) that detects the presence and/or proportion of leukemia cells in a subject, and a decision element (e.g., a CPU processor, an algorithm) that determines the result of the presence and/or proportion detected by the detection element may be included. The treatment prompting unit may further include a prompting element (for exampleSuch as a display, a screen, a voice output device, etc.).

In the present application, the term "amplification unit" generally refers to a functional unit that specifically amplifies a target gene to obtain a target-specific amplification product. In this application, the amplification unit may include materials and reagents necessary to perform the PCR amplification, and/or one or more reporter reagents (e.g., detectable nucleic acid binding reagents) to detect the amplified product. For example, the amplification unit may use or include a nucleic acid polymerase, reverse transcriptase, dNTPs, mg ²⁺ Ions, buffers required for the amplification reaction, and/or reporters for detection of the amplified products, etc.

In this application, the term "amplification" generally refers to amplification of a target nucleic acid and the production of amplification products. Amplification of nucleic acids may be linear, exponential, or a combination thereof. Amplification may be emulsion-based or not. Non-limiting examples of nucleic acid amplification methods include reverse transcription, primer extension, polymerase chain reaction, ligase chain reaction, helicase-dependent amplification, asymmetric amplification, rolling circle amplification, and Multiple Displacement Amplification (MDA). In certain embodiments, the amplification product may be DNA. In the case of amplification of target RNA, DNA may be obtained by reverse transcription of the RNA and subsequent DNA amplification may be utilized to generate amplified DNA products. The amplified DNA product may be indicative of the presence of the target RNA in the biological sample. In the case of amplifying DNA, any DNA amplification method known in the art may be used. Non-limiting examples of DNA amplification methods include Polymerase Chain Reaction (PCR), variants of PCR (e.g., real-time PCR, allele-specific PCR, assembly PCR, asymmetric PCR, digital PCR, emulsion PCR, etc.), helicase-dependent PCR, nested PCR, hot start PCR, inverse PCR, methylation-specific PCR, micro primer PCR (miniprimer PCR), multiplex PCR, nested PCR, overlap-extension PCR, hot asymmetric interleave PCR (thermal asymmetric interlaced PCR), gradient PCR, and Ligase Chain Reaction (LCR). In some cases, DNA amplification is linear. In some cases, DNA amplification is exponential. In some cases, DNA amplification is achieved using nested PCR, which can improve the sensitivity of detecting amplified DNA products

In some cases, the amplification unit may use or include a DNA polymerase. Any suitable DNA polymerase may be used, including commercially available DNA polymerases. DNA polymerase generally refers to an enzyme capable of incorporating nucleotides into a DNA strand in a template-binding manner. Non-limiting examples of DNA polymerases include Taq polymerase, tth polymerase, tli polymerase, pfu polymerase, VENT polymerase, DEEPVENT polymerase, EX-Taq polymerase, LA-Taq polymerase, expand polymerase, sso polymerase, poc polymerase, pab polymerase, mth polymerase, pho polymerase, ES4 polymerase, tru polymerase, tac polymerase, tne polymerase, tma polymerase, tih polymerase, tfi polymerase, platinum Taq polymerase, hi-Fi polymerase, tbr polymerase, tfl polymerase, pneubo polymerase, pyrobest polymerase, pwo polymerase, KOD polymerase, bst polymerase, sac polymerase, klenow fragments, and variants, modified products and derivatives thereof. For a certain hot start polymerase, a denaturation step of 2 to 10 minutes at 94℃to 95℃may be required, which may vary from one polymerase to another. In some cases, the amplification unit may use or include a reverse transcriptase. Reverse transcriptase generally refers to an enzyme that is capable of incorporating nucleotides into the DNA strand when bound to an RNA template. Non-limiting examples of reverse transcriptases include HIV-1 reverse transcriptase, M-MLV reverse transcriptase, AMV reverse transcriptase, telomerase reverse transcriptase, and variants, modified products, and derivatives thereof. For example, the DNA polymerase is Taq polymerase.

In some cases, the amplification unit may use or include an amplification buffer. For example, the amplification buffer may comprise 50-200mmol/L Tris-HCl buffer (e.g., 60-200mmol/L, 70-200mmol/L, 80-200mmol/L, 90-200mmol/L, 100-200mmol/L, 110-200mmol/L, 120-200mmol/L, 130-200mmol/L, 140-200mmol/L, 150-200mmol/L, 160-200mmol/L, 170-200mmol/L, 180-200mmol/L, or 190-200 mmol/L). The pH of the amplification buffer may be from 6.0 to 9.0 (e.g., about 6.5, 7.0, 7.5, 8.0, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7, 8.8, 8.9, or 9.0, etc.), and the amplification buffer may contain from about 5 to 30mmol/L Mg ²⁺ (e.g., 10-30mmol/L Mg ²⁺ 、15-30mmol/L Mg ²⁺ 、20-30mmol/L Mg ²⁺ 、5-15mmol/L Mg ²⁺ 、10-15mmol/L Mg ²⁺ Etc.). The amplification buffer may also comprise, for example, 300-800mmol/L KCl (e.g., 400-800mmol/L, 450-800mmol/L, 500-800mmol/L, 550-800mmol/L, 600-800mmol/L, or 700-800mmol/L, etc.). For example, the amplification Buffer may be 10 XLA Taq Buffer II (Mg ²⁺ free), available from TaKaRa company.

In this application, the amplification unit can be subjected to an amplification reaction (e.g., a PCR reaction) whose system can be adjusted accordingly as the amplification step or amplification module involves a difference in components, so long as the target gene can be obtained effectively (e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95% or more, based on 100% of the amount of amplification product obtained by the reaction performed under fully ideal conditions). For example, the amplification reaction system may comprise, in total reaction volume of 100 μl: about 10. Mu.L of amplification buffer, 200. Mu. Mol/L of each of 4 dNTPs, 100pmol/L of primer composition, 2. Mu.g of template, 2.5. Mu.g of Taq DNA polymerase, 1.5mmol/L of Mg ²⁺ And water (e.g., double distilled water) to make up to a volume of 100 μl.

In some cases, the conditions of the amplification reaction can be adjusted accordingly with the length of the target gene, so long as the target gene is effectively obtained (e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95% or more, based on 100% of the amount of amplification product obtained by performing the reaction under fully ideal conditions). For example, in one embodiment, taking a PCR reaction as an example, the conditions of the reaction may be: the temperature was kept at 4℃after cycling at 94℃for 10 minutes, 94℃for 45 seconds and 55℃for 45 seconds for 35 times, 72℃for 90 seconds, and 72℃for 15 minutes.

The amplification unit may also use or include materials and reagents necessary to perform PCR amplification, and/or one or more reporter reagents (e.g., detectable nucleic acid binding reagents) to detect the amplified product. For example, nucleic acid polymerase, reverse transcriptase, dNTPs, mg ²⁺ Ions, buffers required for the amplification reaction, and/or reporters for detection of the amplified products, etc.

The amplification unit may also use or include materials and reagents to obtain the amplification templates required for the amplification reaction (e.g., PCR reaction). For example, the amplification unit may use or include materials and reagents required to obtain DNA from a bone marrow sample of a B-cell acute lymphoblastic leukemia or T-cell acute lymphoblastic leukemia patient. The materials and reagents required to obtain DNA may include DNA extraction kits. For example, the DNA extraction kit may be NucleoBond Kit CB, nucleoBond CB 100 or NucleoBond CB 500 or the like (available from NucleoBond Corp.).

Where a lysing agent is desired, any suitable lysing agent known in the art may be used, including commercially available lysing agents. Non-limiting examples of lysing agents include Tris-HCl, EDTA, detergents (e.g., triton X-100, SDS), lysozyme, staphylose (glucolase), proteinase E, viral endolysin, exolysin (exolysin), digestive enzyme (zymolose), lysozyme (Iytiase), proteinase K, endolysin and exolysin from phage, endolysin from phage PM2, endolysin from Bacillus subtilis (B.subilis) phage PBSX, endolysin from Lactobacillus prophage Lj928, lj965, phage 15Phiadh, endolysin from Streptococcus pneumoniae phage Cp-I, bifunctional peptidoglycan lysin from Streptococcus agalactiae B30, endolysin and exolysin from prophage bacteria, endolysin from Listeria phage, cave protein (holin) -endolysin, cell 20 lytic genes, hoWMWMY staphylococcal phage (Staphylococcus wameri), staphylococcal phage M, and combinations thereof, and Iphirpy WMY. In some cases, the buffer may comprise a lysing agent (e.g., a lysis buffer). An example of a lysis buffer is sodium hydroxide (NaOH).

In the present application, the term "specific amplification" generally refers to the use of the primer combination to obtain target specific amplification products by a PCR reaction. These particular primer combinations are effective (e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95% or more based on 100% of the amount of amplification product obtained by performing the reaction under fully ideal conditions) to amplify the target gene.

In this application, the term "primer" generally refers to a small piece of single-stranded DNA or RNA that can serve as a starting point for extension of a polynucleotide strand in a nucleic acid polymerization reaction (e.g., a PCR reaction). Where "reverse primer" generally refers to a primer that binds to (e.g., is complementary to) the coding strand (coding strand). "Forward primer" generally refers to a primer that binds to a template strand.

In this application, the term "target gene" generally refers to a gene that can reflect the presence and/or proportion of leukemia cells in a subject. For example, the target gene may comprise one or more genes, fragments thereof, or variants thereof selected from the group consisting of: igH, igK, T cell receptor A, T cell receptor D, T cell receptor B, T cell receptor G and Tal 1. The target gene may include IgH gene rearrangements, igK gene rearrangements, gene rearrangements of T cell receptor regions, and the like.

In the present application, the term "gene rearrangement" generally refers to the alteration of the gene expression product and/or the manner of gene transcription by rearrangement of the gene coding sequences. Gene rearrangement can be achieved by cleavage and religation of the DNA molecule. For example, the polypeptide chains that make up the T cell receptor may include alpha, beta, gamma, and/or delta peptide chains, and the T cell receptor genes encoding these polypeptide chains may allow for diversity and/or specificity of the T cell receptor by gene rearrangement (V-D-J).

In this application, the term "IgH gene rearrangement" generally refers to a gene rearrangement that occurs in the genes encoding immunoglobulin heavy chains (IgH) (e.g., VH-JH and DH-JH gene rearrangements).

In the present application, the term "IgK gene rearrangement" generally refers to a gene rearrangement (e.g., vk-jk gene rearrangement, or Kde deletion) that occurs in a gene encoding an immunoglobulin kappa light chain (IgK).

In the present application, the term "acute lymphoblastic leukemia" (also called acute lymphoblastic leukemia, or simply ALL) generally refers to an acute hematological malignancy caused by abnormal proliferation of lymphocytes in the body.

In the present application, the term "B-cell acute lymphoblastic leukemia" (B-ALL) generally refers to an acute lymphoblastic leukemia caused by excessive B-cell lymphoblastic cells (immature leukocytes) in the blood and/or bone marrow.

In the present application, the term "T-cell acute lymphoblastic leukemia" (T-ALL) generally refers to an acute lymphoblastic leukemia caused by the presence of excessive T-cell lymphoblastic cells (immature leukocytes) in blood and/or bone marrow and/or tissue (e.g., mediastinal lymph nodes).

In this application, the term "T cell receptor" (TCR) generally refers to a specific receptor expressed on the surface of T cells. T cell receptors may be responsible for recognizing antigens presented by the Major Histocompatibility Complex (MHC). The same antigen may be recognized by different T cell receptors, and a certain T cell receptor may recognize a variety of antigens. T cell receptors can exist on the surface of T cells in complex form with CD3 molecules. The T cell receptor may be a heterodimer, for example consisting of alpha and beta peptide chains, or gamma and delta peptide chains.

In this application, the term "gene rearrangement of the T cell receptor region" generally refers to a gene rearrangement that occurs in the gene encoding the T cell receptor β subunit (TCRB) (e.g., vβ -jβ and dβ -jβ gene rearrangements). For example, the gene for the T cell receptor region comprises one or more selected from the group consisting of: t cell receptor A, T cell receptor D, T cell receptor B and T cell receptor G.

In this application, the term "coding strand" generally refers to the strand of double-stranded DNA that is not used for transcription, and whose nucleotide sequence corresponds to the sequence of RNA produced by transcription (U replaces T in DNA in RNA), also known as sense strand (sense strand).

In this application, the term "template strand" generally refers to the strand of double-stranded DNA that is used to carry out transcription, also known as the antisense strand (anti-sense strand).

In this application, the term "conserved nucleic acid sequences" generally refers to nucleic acid sequences (e.g., RNA or DNA sequences) that have a high degree of similarity or identity, which may be based on sequence alignment results between species (inter-species homologous sequences) or between different molecules produced by the same organism (intra-species homologous sequences).

In the present application, the term "subject-specific nucleic acid sequence" generally refers to a nucleic acid sequence derived from a specific subject having a unique base arrangement order. For example, it may be used to uniquely identify the subject, or it may be used to distinguish sequences derived from the subject (or tissues, parts, cells (e.g., leukemia cells), etc. thereof) from sequences derived from other sources (e.g., from other subjects).

In this application, the term "non-characteristic gene sequence" generally refers to a gene sequence that is broadly present in a plurality of subjects and that is not significantly associated with a particular subject source.

In this application, the term "PCR" generally refers to the polymerase chain reaction (Polymerase Chain Reaction), which can be used to amplify specific DNA fragments. For example, in a PCR reaction, a target fragment of DNA to be amplified may be used as a template, and a pair of oligonucleotide fragments complementary to the 5 'and 3' ends of the template, respectively, may be used as primers, and extended along the template strand by a mechanism of semi-retained replication under the action of a thermostable DNA polymerase until synthesis of a new target fragment is completed. The desired fragment can be amplified in large amounts by repeating this process.

In the present application, the term "qPCR" generally refers to quantitative polymerase chain reaction, which performs an accurate analysis of the number of nucleic acid molecules of interest by quantitative nucleic acid amplification detection.

In this application, the term "sequencing" generally refers to techniques for determining the sequence composition of a target molecule (e.g., a nucleic acid molecule) that can be used to determine a particular nucleotide sequence of a nucleic acid molecule of interest. The techniques currently used for sequencing are mainly the dideoxy chain termination method of Sanger et al (1977), the chemical degradation method of Maxam et al (1977), and the Taq cycle sequencing method.

In this application, the primer "VH1/7" generally refers to a primer that specifically binds and/or amplifies exon 1/7 of the V region of the IgH gene. For example, the region of the gene targeted by the primer is the VH1/7 exon.

In the present application, the primer "JH ons" generally refers to a primer that specifically binds and/or amplifies a portion of the J region consensus (concensus) sequence of the IgH gene. For example, the region of the gene targeted by the primer is JH content.

In the present application, the primer "VH2" generally refers to a primer that specifically binds and/or amplifies exon 2 of the V region of IgH gene. For example, the region of the gene targeted by the primer is the VH2 exon.

In this application, primer "VH3" generally refers to a primer that specifically binds and/or amplifies exon 3 of the V region of an IgH gene. For example, the region of the gene targeted by the primer is the VH3 exon.

In this application, primer "VH4" generally refers to a primer that specifically binds and/or amplifies exon 4 of the V region of an IgH gene. For example, the region of the gene targeted by the primer is the VH4 exon.

In this application, primer "VH5" generally refers to a primer that specifically binds and/or amplifies exon 5 of the V region of an IgH gene. For example, the region of the gene targeted by the primer is the VH5 exon.

In this application, primer "VH6" generally refers to a primer that specifically binds and/or amplifies exon 6 of the V region of an IgH gene. For example, the region of the gene targeted by the primer is the VH6 exon.

In this application, primer "DH1" generally refers to a primer that specifically binds to and/or amplifies exon 1 of the D region of the IgH gene. For example, the region of the gene targeted by the primer is the DH1 exon.

In this application, primer "DH2" generally refers to a primer that specifically binds to and/or amplifies exon 2 of the D region of the IgH gene. For example, the region of the gene targeted by the primer is the DH2 exon.

In this application, primer "DH3" generally refers to a primer that specifically binds to and/or amplifies exon 3 of the D region of the IgH gene. For example, the region of the gene targeted by the primer is the DH3 exon.

In this application, primer "DH4" generally refers to a primer that specifically binds to and/or amplifies exon 4 of the D region of the IgH gene. For example, the region of the gene targeted by the primer is the DH4 exon.

In this application, the primer "DH5" generally refers to a primer that specifically binds to and/or amplifies exon 5 of the D region of the IgH gene. For example, the region of the gene targeted by the primer is the DH5 exon.

In this application, the primer "DH6" generally refers to a primer that specifically binds to and/or amplifies exon 6 of the D region of the IgH gene. For example, the region of the gene targeted by the primer is the DH6 exon.

In this application, the primer "DH7" generally refers to a primer that specifically binds and/or amplifies exon 7 of the D region of the IgH gene. For example, the region of the gene targeted by the primer is the DH7 exon.

In the present application, the primer "Vk1" generally refers to a primer that specifically binds and/or amplifies exon 1 of the V region of the IgK gene. For example, the region of the gene targeted by the primer is the Vk1 exon.

In the present application, the primer "Vk2" generally refers to a primer that specifically binds and/or amplifies exon 2 of the V region of the IgK gene. For example, the region of the gene targeted by the primer is the Vk2 exon.

In the present application, the primer "Vk3" generally refers to a primer that specifically binds and/or amplifies exon 3 of the V region of the IgK gene. For example, the region of the gene targeted by the primer is the Vk3 exon.

In the present application, the primer "Kdel" generally refers to a primer that specifically binds to and/or amplifies the kappa deletion element (kappa deleting element) of the IgK gene. For example, the region of the gene targeted by the primer is the Kdel region.

In the present application, the primer "Intron RSS" generally refers to a primer that specifically binds and/or amplifies the Intron recombination signal sequence (Intron recombination signal sequence) of the IgK gene. For example, the primer targets the Intron RSS region of IgK.

In this application, primer "Vd2" generally refers to a primer that specifically binds and/or amplifies exon 2 of the V region of the TCR Delta (TCR Delta) gene. For example, the region of the gene targeted by the primer is the vδ2 (Vd 2) exon.

In this application, primer "Dd3" generally refers to a primer that specifically binds and/or amplifies exon 3 of the D region of the TCR delta gene. For example, the region of the gene targeted by the primer is the dδ3 (Dd 3) exon.

In this application, primer "Dd2" generally refers to a primer that specifically binds and/or amplifies exon 2 of the D region of the TCR delta gene. For example, the region of the gene targeted by the primer is the dδ2 (Dd 2) exon.

In this application, primer "Ja29" generally refers to a primer that specifically binds and/or amplifies exon 29 of the J region of the TCR Alpha (tcra) gene. For example, the region of the gene targeted by the primer is the J.alpha.29 (Ja 29) exon.

In this application, primer "Ja9" generally refers to a primer that specifically binds and/or amplifies exon 9 of the J region of the tcra gene. For example, the region of the gene targeted by the primer is the J.alpha.9 (Ja 9) exon.

In this application, primer "Ja30" generally refers to a primer that specifically binds to and/or amplifies exon 30 of the J region of the tcra gene. For example, the region of the gene targeted by the primer is the J.alpha.30 (Ja 30) exon.

In this application, primer "Ja48" generally refers to a primer that specifically binds and/or amplifies exon 48 of the J region of the tcra gene. For example, the region of the gene targeted by the primer is the J.alpha.48 (Ja 48) exon.

In this application, primer "Ja49" generally refers to a primer that specifically binds and/or amplifies exon 49 of the J region of the tcra gene. For example, the region of the gene targeted by the primer is the J.alpha.49 (Ja 49) exon.

In this application, primer "Ja52" generally refers to a primer that specifically binds and/or amplifies exon 52 of the J region of the tcra gene. For example, the region of the gene targeted by the primer is the J.alpha.52 (Ja 52) exon.

In this application, primer "Ja54" generally refers to a primer that specifically binds to and/or amplifies exon 54 of the J region of the tcra gene. For example, the region of the gene targeted by the primer is the J.alpha.54 (Ja 54) exon.

In this application, primer "Ja55" generally refers to a primer that specifically binds and/or amplifies exon 55 of the tcra gene J region. For example, the region of the gene targeted by the primer is the J.alpha.55 (Ja 55) exon.

In this application, primer "Ja56" generally refers to a primer that specifically binds to and/or amplifies exon 56 of the J region of the tcra gene. For example, the region of the gene targeted by the primer is the J.alpha.56 (Ja 56) exon.

In this application, primer "Ja57" generally refers to a primer that specifically binds to and/or amplifies exon 57 of the tcra gene J region. For example, the region of the gene targeted by the primer is the J.alpha.57 (Ja 57) exon.

In this application, primer "Ja58" generally refers to a primer that specifically binds to and/or amplifies exon 58 of the J region of the tcra gene. For example, the region of the gene targeted by the primer is the J.alpha.58 (Ja 58) exon.

In this application, primer "Ja59" generally refers to a primer that specifically binds to and/or amplifies exon 59 of the J region of the tcra gene. For example, the region of the gene targeted by the primer is the J.alpha.59 (Ja 59) exon.

In this application, primer "Ja61" generally refers to a primer that specifically binds and/or amplifies exon 61 of the J region of the tcra gene. For example, the region of the gene targeted by the primer is the J.alpha.61 (Ja 61) exon.

In this application, primer "Vg1" generally refers to a primer that specifically binds and/or amplifies exon 1 of the V region of the TCR Gamma (TCRG) gene. For example, the region of the gene targeted by the primer is the Vg1 exon.

In this application, primer "Vg2" generally refers to a primer that specifically binds and/or amplifies exon 2 of the V region of the TCR Gamma (TCRG) gene. For example, the region of the gene targeted by the primer is the Vg2 exon.

In this application, primer "Vg4" generally refers to a primer that specifically binds and/or amplifies exon 4 of the V region of the TCR Gamma (TCRG) gene. For example, the region of the gene targeted by the primer is the Vg4 exon.

In this application, primer "Jg1" generally refers to a primer that specifically binds and/or amplifies exon 1 of the J region of the TCR Gamma (TCRG) gene. For example, the region of the gene targeted by the primer is the Jg1 exon.

In this application, primer "Jg2" generally refers to a primer that specifically binds and/or amplifies exon 2 of the J region of the TCR Gamma (TCRG) gene. For example, the region of the gene targeted by the primer is the Jg2 exon.

In this application, primer "Vd1" generally refers to a primer that specifically binds and/or amplifies exon 1 of the V region of the TCR Delta (TCR Delta) gene. For example, the region of the gene targeted by the primer is the vδ1 (Vd 1) exon.

In this application, primer "Jd1" generally refers to a primer that specifically binds and/or amplifies exon 1 of the J region of the TCR Delta (TCR Delta) gene. For example, the region of the gene targeted by the primer is the J.delta.1 (Jd 1) exon.

In this application, primer "Vd3" generally refers to a primer that specifically binds and/or amplifies exon 3 of the V region of the TCR Delta (TCR Delta) gene. For example, the region of the gene targeted by the primer is the vδ3 (Vd 3) exon.

In this application, primer "Vg3" generally refers to a primer that specifically binds and/or amplifies exon 3 of the V region of the TCR Gamma (TCRG) gene. For example, the region of the gene targeted by the primer is the Vg3 exon.

In this application, primer "Sildb" generally refers to a primer that specifically binds and/or amplifies a cleavage site (break point) in the sil gene. For example, the region of the gene targeted by the primer is the sil cleavage site.

In the present application, the primer "Taldb1" generally refers to a primer that specifically binds and/or amplifies cleavage site 1 (break point 1) in the tal-1 gene. For example, the primer targets the gene region of tal-1 cleavage site 1.

In this application, primer "Vb2" generally refers to a primer that specifically binds and/or amplifies exon 2 of the V region of the TCR Beta (TCR Beta) gene. For example, the region of the gene targeted by the primer is the vβ2 (Vb 2) exon.

In this application, primer "Vb4" generally refers to a primer that specifically binds and/or amplifies exon 4 of the V region of the TCR Beta (TCR Beta) gene. For example, the region of the gene targeted by the primer is the vβ4 (Vb 4) exon.

In this application, primer "Vb5/1" generally refers to a primer that specifically binds and/or amplifies exon 5/1 of the V region of the TCR Beta (TCR Beta) gene. For example, the primer targets the gene region that is the Vbeta 5/1 (Vb 5/1) exon.

In this application, primer "Vb6a/11" generally refers to a primer that specifically binds and/or amplifies exon 6a/11 of the V region of the TCR Beta (TCR Beta) gene. For example, the region of the gene targeted by the primer is the Vβ6a/11 (Vb6a/11) exon.

In this application, primer "Vb6b/25" generally refers to a primer that specifically binds and/or amplifies exon 6b/25 of the V region of the TCR Beta (TCR Beta) gene. For example, the region of the gene targeted by the primer is the Vbeta 6b/25 (Vb 6 b/25) exon.

In this application, primer "Vb6c" generally refers to a primer that specifically binds and/or amplifies exon 6c of the V region of the TCR Beta (TCR Beta) gene. For example, the region of the gene targeted by the primer is the vβ6c (Vb 6 c) exon.

In this application, primer "Vb7" generally refers to a primer that specifically binds and/or amplifies exon 7 of the V region of the TCR Beta (TCR Beta) gene. For example, the region of the gene targeted by the primer is the vβ7 (Vb 7) exon.

In this application, primer "Vb8a" generally refers to a primer that specifically binds and/or amplifies exon 8a of the V region of the TCR Beta (TCR Beta) gene. For example, the region of the gene targeted by this primer is the vβ8a (Vb 8 a) exon.

In this application, primer "Vb9" generally refers to a primer that specifically binds and/or amplifies exon 9 of the V region of the TCR Beta (TCR Beta) gene. For example, the region of the gene targeted by the primer is the vβ9 (Vb 9) exon.

In this application, primer "Vb10" generally refers to a primer that specifically binds and/or amplifies exon 10 of the V region of the TCR Beta (TCR Beta) gene. For example, the region of the gene targeted by the primer is the vβ10 (Vb 10) exon.

In this application, primer "Vb11" generally refers to a primer that specifically binds and/or amplifies exon 11 of the V region of the TCR Beta (TCR Beta) gene. For example, the region of the gene targeted by the primer is the vβ11 (Vb 11) exon.

In this application, the primer "Vb12a/3/13a/15" generally refers to a primer that specifically binds and/or amplifies exon 12a/3/13a/15 of the V region of the TCR Beta (TCR Beta) gene. For example, the region of the gene targeted by the primer is the Vβ12a/3/13a/15 (Vb12a/3/13 a/15) exon.

In this application, primer "Vb13b" generally refers to a primer that specifically binds and/or amplifies exon 13b of the V region of the TCR Beta (TCR Beta) gene. For example, the region of the gene targeted by this primer is the vβ13b (Vb 13 b) exon.

In this application, the primer "Vb13c/12b/14" generally refers to a primer that specifically binds and/or amplifies exon 13c/12b/14 of the V region of the TCR Beta (TCRbeta) gene. For example, the region of the gene targeted by the primer is the V.beta.13c/12 b/14 (Vb 13c/12 b/14) exon.

In this application, primer "Vb16" generally refers to a primer that specifically binds and/or amplifies exon 16 of the V region of the TCR Beta (TCR Beta) gene. For example, the region of the gene targeted by the primer is the vβ16 (Vb 16) exon.

In this application, primer "Vb17" generally refers to a primer that specifically binds and/or amplifies exon 17 of the V region of the TCR Beta (TCR Beta) gene. For example, the region of the gene targeted by the primer is the vβ17 (Vb 17) exon.

In this application, primer "Vb18" generally refers to a primer that specifically binds and/or amplifies exon 18 of the V region of the TCR Beta (TCR Beta) gene. For example, the region of the gene targeted by the primer is the vβ18 (Vb 18) exon.

In this application, primer "Vb19" generally refers to a primer that specifically binds and/or amplifies exon 19 of the V region of the TCR Beta (TCR Beta) gene. For example, the region of the gene targeted by the primer is the vβ19 (Vb 19) exon.

In this application, primer "Vb20" generally refers to a primer that specifically binds and/or amplifies exon 20 of the V region of the TCR Beta (TCR Beta) gene. For example, the region of the gene targeted by the primer is the vβ20 (Vb 20) exon.

In this application, primer "Vb21" generally refers to a primer that specifically binds and/or amplifies exon 21 of the V region of the TCR Beta (TCR Beta) gene. For example, the region of the gene targeted by the primer is the vβ21 (Vb 21) exon.

In this application, primer "Vb22" generally refers to a primer that specifically binds and/or amplifies exon 22 of the V region of the TCR Beta (TCR Beta) gene. For example, the region of the gene targeted by the primer is the vβ22 (Vb 22) exon.

In this application, primer "Vb23/8b" generally refers to a primer that specifically binds and/or amplifies exon 23/8b of the V region of the TCR Beta (TCR Beta) gene. For example, the region of the gene targeted by the primer is the V.beta.23/8 b (Vb 23/8 b) exon.

In this application, primer "Vb24" generally refers to a primer that specifically binds and/or amplifies exon 24 of the V region of the TCR Beta (TCR Beta) gene. For example, the region of the gene targeted by the primer is the vβ24 (Vb 24) exon.

In this application, primer "Db1" generally refers to a primer that specifically binds and/or amplifies exon 1 of the D region of the TCR Beta (TCR Beta) gene. For example, the region of the gene targeted by the primer is the dβ1 (Db 1) exon.

In this application, primer "Db2" generally refers to a primer that specifically binds and/or amplifies exon 2 of the D region of the TCR Beta (TCR Beta) gene. For example, the region of the gene targeted by the primer is the dβ2 (Db 2) exon.

In this application, primer "Jb1" generally refers to a primer that specifically binds and/or amplifies exon 1 of the J region of the TCR Beta (TCR Beta) gene. For example, the region of the gene targeted by the primer is the J.beta.1 (Jb 1) exon.

In this application, primer "Jb2" generally refers to a primer that specifically binds and/or amplifies exon 2 of the J region of the TCR Beta (TCR Beta) gene. For example, the region of the gene targeted by the primer is the jβ2 (Jb 2) exon.

For example, the agent capable of specifically amplifying a target gene (IgH gene rearrangement) comprises one or more primer combinations selected from the group consisting of: 1) Forward primer: VH1/7, reverse primer: JH cos; 2) Forward primer: VH2, reverse primer: JH cos; 3) Forward primer: VH3, reverse primer: JH cos; 4) Forward primer: VH4, reverse primer: JH cos; 5) Forward primer: VH5, reverse primer: JH cos; 6) Forward primer: VH6, reverse primer: JH cos; 7)

Forward primer: DH1, DH4, DH5 and DH7, reverse primers: JH cos; 8) Forward primer: DH2, reverse primer: JH cos; 9) Forward primer: DH3, reverse primer: JH cos; and 10) forward primer: DH6, reverse primer: JH con. Wherein the primer JH ons comprises a sequence selected from the group consisting of seq id nos: SEQ ID NO. 19; and the sequence shown in SEQ ID No. 20. The primer VH1/7 comprises a sequence selected from the group consisting of: SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO. 3. The primer VH2 comprises a sequence selected from the group consisting of: SEQ ID No.4, SEQ ID No.5 and SEQ ID No. 6. The primer VH3 comprises a sequence selected from the group consisting of: SEQ ID NO.7, SEQ ID NO.8 and SEQ ID NO. 9. The primer VH4 comprises a sequence selected from the group consisting of: SEQ ID NO.10, SEQ ID NO.11 and SEQ ID NO. 12. The primer VH5 comprises a sequence selected from the group consisting of: SEQ ID NO.13, SEQ ID NO.14 and SEQ ID NO. 15. The primer VH6 comprises a sequence selected from the group consisting of: SEQ ID No.16, SEQ ID No.17 and SEQ ID No. 18. The primer DH1 comprises a sequence selected from the group consisting of: SEQ ID NO.21 and SEQ ID NO. 22. The primer DH2 comprises a sequence selected from the group consisting of: SEQ ID No.23 and SEQ ID No. 24. The primer DH3 comprises a sequence selected from the group consisting of: SEQ ID NO.25 and SEQ ID NO. 26. The primer DH4 comprises a sequence selected from the group consisting of: SEQ ID NO.27 and SEQ ID NO. 28. The primer DH5 comprises a sequence selected from the group consisting of: SEQ ID NO.29 and SEQ ID NO. 30. The primer DH6 comprises a sequence selected from the group consisting of: SEQ ID NO.31 and SEQ ID NO. 32. The primer DH7 comprises a sequence selected from the group consisting of: SEQ ID NO.33 and SEQ ID NO. 34.

For example, the agent capable of specifically amplifying a target gene (IgK gene rearrangement) comprises one or more primer combinations selected from the group consisting of: 1) Forward primer: vk1, reverse primer: kdel; 2) Forward primer: vk2, reverse primer: kdel; 3) Forward primer: vk3, reverse primer: kdel; and 4) forward primer: intron RSS, reverse primer: kdel. Wherein the primer Vk1 comprises a sequence selected from the group consisting of: SEQ ID NO.35 and SEQ ID NO. 36. The primer Vk2 comprises a sequence selected from the group consisting of: SEQ ID NO.37 and SEQ ID NO. 38. The primer Vk3 comprises a sequence selected from the group consisting of: SEQ ID NO.39 and SEQ ID NO. 40. The primer Vk4 comprises a sequence selected from the group consisting of: SEQ ID NO.41 and SEQ ID NO. 42. The primer Intron RSS comprises a sequence selected from the group consisting of: SEQ ID NO.43 and SEQ ID NO. 44. The primer Kdel comprises a sequence selected from the group consisting of: SEQ ID NO.45 and SEQ ID NO. 46.

For example, for B-cell acute lymphoblastic leukemia, the agent capable of specifically amplifying the target gene (T-cell receptor region gene rearrangement) comprises one or more primer combinations selected from the group consisting of: 1) Forward primer: vd2, reverse primer: dd3; 2) Forward primer: dd2, reverse primer: dd3; 3) Forward primer: vd2, reverse primer: ja29; 4)

Forward primer: vd2, reverse primer: ja9, ja29, ja30, ja48, ja49, ja52, ja54, ja55, ja56, ja57, ja58, ja59 and Ja61; 5) Forward primer: vg1, reverse primer: jg1 and Jg2; 6) Forward primer: vg2, reverse primer: jg1 and Jg2; 7) Forward primer: vg4, reverse primer: jg1 and Jg2; 8) TCRB multiple primer combination A; 9) TCRB multi-primer combination B; and 10) TCRB multiple primer combination C. Wherein the primer Vg1 comprises a sequence selected from the group consisting of: SEQ ID NO.47 and SEQ ID NO. 48. The primer Vg2 comprises a sequence selected from the group consisting of: SEQ ID NO.49 and SEQ ID NO. 50. The primer Vg4 comprises a sequence selected from the group consisting of: SEQ ID NO.53 and SEQ ID NO. 54. The primer Jg1 comprises a sequence selected from the group consisting of: SEQ ID No.55 and SEQ ID No. 56. The primer Jg2 comprises a sequence selected from the group consisting of: SEQ ID NO.57 and SEQ ID NO. 58. The primer Vd2 comprises a sequence selected from the group consisting of: SEQ ID NO.61 and SEQ ID NO. 62. The primer Dd2 comprises a sequence selected from the group consisting of: SEQ ID NO.65 and SEQ ID NO. 66. The primer Dd3 comprises a sequence selected from the group consisting of: SEQ ID NO.67 and SEQ ID NO. 68. The primer Ja9 comprises a sequence selected from the group consisting of: SEQ ID NO. 71. The primer Ja29 comprises a sequence selected from the group consisting of: SEQ ID NO. 72. The primer Ja30 comprises a sequence selected from the group consisting of: SEQ ID NO. 73. The primer Ja48 comprises a sequence selected from the group consisting of: SEQ ID NO. 74. The primer Ja49 comprises a sequence selected from the group consisting of: SEQ ID NO. 75. The primer Ja52 comprises a sequence selected from the group consisting of: SEQ ID NO. 76. The primer Ja54 comprises a sequence selected from the group consisting of: SEQ ID NO. 77. The primer Ja55 comprises a sequence selected from the group consisting of: SEQ ID NO. 78. The primer Ja56 comprises a sequence selected from the group consisting of: SEQ ID NO. 79. The primer Ja57 comprises a sequence selected from the group consisting of: SEQ ID NO. 80. The primer Ja58 comprises a sequence selected from the group consisting of: SEQ ID NO. 81. The primer Ja59 comprises a sequence selected from the group consisting of: SEQ ID NO. 82. The primer Ja61 comprises a sequence selected from the group consisting of: SEQ ID NO. 83. The multi-primer combination a comprises one or more sequences selected from the group consisting of: SEQ ID No.86, SEQ ID No.87, SEQ ID No.88, SEQ ID No.89, SEQ ID No.90, SEQ ID No.91, SEQ ID No.92, SEQ ID No.93, SEQ ID No.94, SEQ ID No.95, SEQ ID No.96, SEQ ID No.97, SEQ ID No.98, SEQ ID No.99, SEQ ID No.100, SEQ ID No.101, SEQ ID No.102, SEQ ID No.103, SEQ ID No.104, SEQ ID No.105, SEQ ID No.106, SEQ ID No.107, SEQ ID No.108, SEQ ID No.111, SEQ ID No.112, SEQ ID No.113, SEQ ID No.114, SEQ ID No.115, SEQ ID No.116, SEQ ID No.118, SEQ ID No.122 and SEQ ID No. 123. The multi-primer combination B comprises one or more sequences selected from the group consisting of: SEQ ID No.86, SEQ ID No.87, SEQ ID No.88, SEQ ID No.89, SEQ ID No.90, SEQ ID No.91, SEQ ID No.92, SEQ ID No.93, SEQ ID No.94, SEQ ID No.95, SEQ ID No.96, SEQ ID No.97, SEQ ID No.98, SEQ ID No.99, SEQ ID No.100, SEQ ID No.101, SEQ ID No.102, SEQ ID No.103, SEQ ID No.104, SEQ ID No.105, SEQ ID No.106, SEQ ID No.107, SEQ ID No.108, SEQ ID No.117, SEQ ID No.119, SEQ ID No.120 and SEQ ID No. 121. The multi-primer combination C comprises one or more sequences selected from the group consisting of: SEQ ID No.109, SEQ ID No.110, SEQ ID No.111, SEQ ID No.112, SEQ ID No.113, SEQ ID No.114, SEQ ID No.115, SEQ ID No.116, SEQ ID No.117, SEQ ID No.118, SEQ ID No.119, SEQ ID No.120, SEQ ID No.121, SEQ ID No.122 and SEQ ID No. 123.

For example, for T cell acute lymphoblastic leukemia, the agent capable of specifically amplifying the target gene (T cell receptor region gene rearrangement) comprises one or more primer combinations selected from the group consisting of: 1) Forward primer: vd1, reverse primer: jd1; 2) Forward primer: vd2, reverse primer: jd1; 3) Forward primer: vd3, reverse primer: jd1; 4) Forward primer: vd2, reverse primer: dd3; 5) Forward primer: dd2, reverse primer: dd3; 6) Forward primer: dd2, reverse primer: jd1; 7) Forward primer: vd2, reverse primer: ja29; 8) Forward primer: vd2, reverse primer: ja9, ja29, ja30, ja48, ja49, ja52, ja54, ja55, ja56, ja57, ja58, ja59 and Ja61; 9) Forward primer: vg1, reverse primer: jg1 and Jg2;10 Forward primer: vg2, reverse primer: jg1 and Jg2; 11)

Forward primer: vg3, reverse primer: jg1 and Jg2;12 Forward primer: vg4, reverse primer: jg1 and Jg2; 13)

Forward primer: sildb, reverse primer: taldb1;14 TCRB multi-primer combination a;15 TCRB multi-primer combination B; and 16) TCRB multiple primer combination C. Wherein the primer Vg3 comprises a sequence selected from the group consisting of: SEQ ID NO.51 and SEQ ID NO. 52. The primer Vd3 comprises a sequence selected from the group consisting of: SEQ ID NO.63 and SEQ ID NO. 64. The primer Vg1 comprises a sequence selected from the group consisting of: SEQ ID NO.47 and SEQ ID NO. 48. The primer Vg2 comprises a sequence selected from the group consisting of: SEQ ID NO.49 and SEQ ID NO. 50. The primer Vg4 comprises a sequence selected from the group consisting of: SEQ ID NO.53 and SEQ ID NO. 54. The primer Jg1 comprises a sequence selected from the group consisting of: SEQ ID No.55 and SEQ ID No. 56. The primer Jg2 comprises a sequence selected from the group consisting of: SEQ ID NO.57 and SEQ ID NO. 58. The primer Vd2 comprises a sequence selected from the group consisting of: SEQ ID NO.61 and SEQ ID NO. 62. The primer Dd2 comprises a sequence selected from the group consisting of: SEQ ID NO.65 and SEQ ID NO. 66. The primer Dd3 comprises a sequence selected from the group consisting of: SEQ ID NO.67 and SEQ ID NO. 68. The primer Ja9 comprises a sequence selected from the group consisting of: SEQ ID NO. 71. The primer Ja29 comprises a sequence selected from the group consisting of: SEQ ID NO. 72. The primer Ja30 comprises a sequence selected from the group consisting of: SEQ ID NO. 73. The primer Ja48 comprises a sequence selected from the group consisting of: SEQ ID NO. 74. The primer Ja49 comprises a sequence selected from the group consisting of: SEQ ID NO. 75. The primer Ja52 comprises a sequence selected from the group consisting of: SEQ ID NO. 76. The primer Ja54 comprises a sequence selected from the group consisting of: SEQ ID NO. 77. The primer Ja55 comprises a sequence selected from the group consisting of: SEQ ID NO. 78. The primer Ja56 comprises a sequence selected from the group consisting of: SEQ ID NO. 79. The primer Ja57 comprises a sequence selected from the group consisting of: SEQ ID NO. 80. The primer Ja58 comprises a sequence selected from the group consisting of: SEQ ID NO. 81. The primer Ja59 comprises a sequence selected from the group consisting of: SEQ ID NO. 82. The primer Ja61 comprises a sequence selected from the group consisting of: SEQ ID NO. 83. The multi-primer combination a comprises one or more sequences selected from the group consisting of: SEQ ID No.86, SEQ ID No.87, SEQ ID No.88, SEQ ID No.89, SEQ ID No.90, SEQ ID No.91, SEQ ID No.92, SEQ ID No.93, SEQ ID No.94, SEQ ID No.95, SEQ ID No.96, SEQ ID No.97, SEQ ID No.98, SEQ ID No.99, SEQ ID No.100, SEQ ID No.101, SEQ ID No.102, SEQ ID No.103, SEQ ID No.104, SEQ ID No.105, SEQ ID No.106, SEQ ID No.107, SEQ ID No.108, SEQ ID No.111, SEQ ID No.112, SEQ ID No.113, SEQ ID No.114, SEQ ID No.115, SEQ ID No.116, SEQ ID No.118, SEQ ID No.122 and SEQ ID No. 123. The multi-primer combination B comprises one or more sequences selected from the group consisting of: SEQ ID No.86, SEQ ID No.87, SEQ ID No.88, SEQ ID No.89, SEQ ID No.90, SEQ ID No.91, SEQ ID No.92, SEQ ID No.93, SEQ ID No.94, SEQ ID No.95, SEQ ID No.96, SEQ ID No.97, SEQ ID No.98, SEQ ID No.99, SEQ ID No.100, SEQ ID No.101, SEQ ID No.102, SEQ ID No.103, SEQ ID No.104, SEQ ID No.105, SEQ ID No.106, SEQ ID No.107, SEQ ID No.108, SEQ ID No.117, SEQ ID No.119, SEQ ID No.120 and SEQ ID No. 121. The multi-primer combination C comprises one or more sequences selected from the group consisting of: SEQ ID No.109, SEQ ID No.110, SEQ ID No.111, SEQ ID No.112, SEQ ID No.113, SEQ ID No.114, SEQ ID No.115, SEQ ID No.116, SEQ ID No.117, SEQ ID No.118, SEQ ID No.119, SEQ ID No.120, SEQ ID No.121, SEQ ID No.122 and SEQ ID No. 123. The primer Vd1 comprises a sequence selected from the group consisting of: SEQ ID NO.59 and SEQ ID NO. 60. The primer Jd1 comprises a sequence selected from the group consisting of: SEQ ID NO.69 and SEQ ID NO. 70. The primer Sildb comprises a sequence selected from the group consisting of: SEQ ID NO. 84. The primer Taldb1 comprises a sequence selected from the group consisting of: SEQ ID NO. 85.

In the present application, the term "identification unit" generally refers to a functional unit capable of identifying a characteristic amplification product of the target-specific amplification product derived from leukemia cells of the subject, which identification unit may comprise reagents and means for identifying the target-specific amplification product. The identification unit is effective (e.g., at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or more) to separate a characteristic amplification product of leukemia cells derived from the subject from the target-specific amplification product. For example, a characteristic amplification product derived from a leukemia cell of a subject can be isolated by gel electrophoresis. During the identification process, the isolated product (e.g., target to isolate a characteristic amplification product derived from a leukemia cell of a subject) may be displayed at a specific location of the gel in gel electrophoresis, and by comparing it to the corresponding nucleic acid fragments in the positive control group (e.g., both nucleic acid fragments having a length of about 400 pb), the product isolated by the identification module (e.g., DNA fragment) may be initially judged to be the characteristic amplification product derived from the leukemia cell of the subject.

The gel electrophoresis separation is capable of effectively (e.g., at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or more) separating the target-specific amplification products obtained from the amplification step or amplification module from the amplification products characteristic of the leukemia cells of the subject. The identification unit may contain reagents and means required for performing gel electrophoresis separation, for example reagents and means for performing agarose gel electrophoresis or polyacrylamide gel electrophoresis. For example, the identification unit may comprise reagents and/or running buffers required to formulate the gel. For example, the reagents required to formulate the gel may include one or more of agarose, acrylamide (Acr), N-methylenebisacrylamide (Bis), tetramethylethylenediamine (TEMED), and Tris (Tris). For example, 2% (w/w) agarose gel is used.

The running buffer may contain one or more of Tris-HCl, dithiothreitol (DTT), SDS, bromophenol blue, beta-mercaptoethanol, and glycerol. For example, the running buffer contains 100mmol/L Tris-HCl (6.8), 200mmol/L Dithiothreitol (DTT), 4% SDS, 0.2% bromophenol blue and 20% glycerol. For example, in one embodiment, the running buffer contains 60mmol/L Tris-HCl (pH 6.8), 2% SDS, 0.1% bromophenol blue, 25% glycerol, and 14.4mmol/L beta-mercaptoethanol. For another example, the authentication unit may further comprise an electrophoresis tank and/or an electrophoresis apparatus. For example, the electrophoresis tank may be a disk electrophoresis tank, a vertical plate electrophoresis tank, or a horizontal electrophoresis tank. The electrophoresis apparatus can be a voltage-stabilizing and current-stabilizing electrophoresis apparatus, a full-automatic fluorescence/visible light dual-system electrophoresis apparatus or a full-automatic agarose electrophoresis apparatus. The authentication unit may further comprise additional means for facilitating gel electrophoresis separation, such as a gel-making plate, a power supply, etc. The conditions for the gel electrophoresis separation can be adjusted accordingly according to the length of the separated nucleic acid (e.g., DNA) fragments, and the separation requirement can be satisfied by making the strips of the separated product fragments (e.g., DNA fragments) clear. The conditions of the gel electrophoresis separation can be that the gel electrophoresis separation is continuously electrified for 2-3 hours under the voltage of 100V; or to continue to be energized at a voltage of 40-50V overnight.

In the present application, the term "analysis unit" generally refers to a functional unit that obtains a gene sequence characteristic of leukemia cells specific to the subject, which analysis unit may comprise reagents and means for analyzing the characteristic amplification products.

The analysis unit can accurately (e.g., by comparing the gene sequence obtained by the analysis unit to a true gene sequence for at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or more) obtain a gene sequence characteristic of leukemia cells of the subject.

In the present application, the term "characteristic gene sequence" generally refers to a nucleic acid sequence derived from a specific subject having a unique base arrangement order. For example, it may be used to uniquely identify the subject, or it may be used to distinguish sequences derived from the subject (or tissues, parts, cells (e.g., leukemia cells), etc. thereof) from sequences derived from other sources (e.g., from other subjects).

In this application, the term "characteristic amplification product" generally refers to an amplification product reflecting the specificity of a subject. For example, an amplification product reflecting a gene sequence characteristic of leukemia cells of the subject.

In this application, the term "nucleic acid sequencing" generally refers to techniques for determining the sequence composition of a target nucleic acid molecule, which can be used to determine a specific nucleotide sequence of a nucleic acid molecule of interest. The techniques currently used for sequencing are mainly the dideoxy chain termination method of Sanger et al (1977), the chemical degradation method of Maxam et al (1977), and the Taq cycle sequencing method.

The analysis unit may include reagents and devices necessary for nucleic acid sequencing and sequence analysis of the characteristic amplification products. For example, the analysis unit may comprise reagents and equipment required to perform a sequencing method, a Taq cycle sequencing method, or a SILVER SEQUENCETM DNA sequencing system method. When Taq cycle sequencing is used, the analysis unit may comprise universal forward sequencing primers and Ready Reaction Dye Deoxy Terminator Cycle sequencing kit (ABI). Alternatively, the analysis unit may be used to analyze the subject for amplification products characteristic of leukemia cells, for specific steps, see Kneba M, bolz I, linke B, hiddemann W.analysis of rearranged T-cell receptor beta-chain genes by Polymerase Chain Reaction (PCR) DNA sequencing and automated high resolution PCR fragment analysis. Blood 1995;86:3930-3937 or see Linke B, bolz I, fayyazi A, von Hofen M, pott C, bertram J et al automated high resolution PCR fragment analysis for identification of clonally rearranged immunoglobulin heavy chain genes Leukemia 1997;11:1055-1062. Section "Cloning and DNA sequencing", which is incorporated by reference in its entirety.

In the present application, the term "sequence analysis" generally refers to the analysis of the results of the nucleic acid sequencing, and it can be determined whether the obtained nucleic acid sequencing results belong to the gene sequences characteristic of the leukemia cells of the subject.

The analysis unit may comprise reagents and means for analysing the results of the nucleic acid sequencing, for example may comprise the equipment and means required to perform BLAST (Basic Local Alignment Search Tool), bioEdit software or MEGA software analysis. For example, the results of the nucleic acid sequencing and the non-characteristic gene sequences that are commonly present in any subject are input to the analysis module, respectively, and the characteristic gene sequences that characterize leukemia cells of the subject are obtained by analysis.

In the present application, the term "recognition unit" generally refers to a functional unit that determines the presence and/or proportion of residual leukemia cells in the subject. The recognition unit may comprise reagents and devices capable of specifically recognizing and/or amplifying the characteristic gene sequence of the subject, thereby determining the presence and/or proportion of residual leukemia cells in the subject. For example, the recognition unit can be effective to obtain (e.g., obtain at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95% or more based on 100% of the amount of product obtained by performing the reaction under fully ideal conditions) the characteristic gene sequence specific to the subject leukemia cell.

The recognition unit may comprise reagents or devices that specifically amplify a gene sequence specific for a leukemia cell of the subject.

The recognition unit may comprise a probe that binds to a non-characteristic gene sequence, and a reagent or device capable of amplifying the non-characteristic gene sequence. In this application, the term "non-characteristic gene sequence" generally refers to a gene sequence that is broadly present in a plurality of subjects and that is not significantly associated with a particular subject source.

For example, the non-characteristic gene sequence may comprise a nucleic acid sequence derived from one or more genes from the group consisting of: igH, igK, T cell receptor A, T cell receptor D, T cell receptor B, T cell receptor G and Tal 1. Wherein the non-characteristic gene sequence comprises a nucleic acid sequence derived from IgH and the agent or device capable of amplifying the non-characteristic gene sequence comprises a sequence selected from the group consisting of: sequences shown in SEQ ID No.124, SEQ ID No.125, SEQ ID No.126, SEQ ID No.127, SEQ ID No.128, SEQ ID No.129, SEQ ID No.130 and SEQ ID No. 131. The non-characteristic gene sequence comprises a nucleic acid sequence derived from IgH, and the probe that binds to the non-characteristic gene sequence comprises a sequence selected from the group consisting of: sequences shown in SEQ ID No.173, SEQ ID No.174, SEQ ID No.175, SEQ ID No.176, SEQ ID No.177, SEQ ID No.178, SEQ ID No.179 and SEQ ID No. 180. The non-characteristic gene sequence comprises a nucleic acid sequence derived from IgK, and the agent or device capable of amplifying the non-characteristic gene sequence comprises a sequence selected from the group consisting of: SEQ ID NO.132, SEQ ID NO.133, SEQ ID NO.134, SEQ ID NO.135, SEQ ID NO.136, SEQ ID NO.137, SEQ ID NO.138, SEQ ID NO.139, SEQ ID NO.140 and SEQ ID NO. 141. The non-characteristic gene sequence comprises a nucleic acid sequence derived from IgK, and the probe that binds to the non-characteristic gene sequence comprises a sequence selected from the group consisting of: sequences shown in SEQ ID No.181, SEQ ID No.182, SEQ ID No.183, SEQ ID No.184, SEQ ID No.185, SEQ ID No.186, SEQ ID No.187, SEQ ID No.188, SEQ ID No.189 and SEQ ID No. 190. The non-characteristic gene sequence comprises a nucleic acid sequence derived from T cell receptor G, and the agent or device capable of amplifying the non-characteristic gene sequence comprises a sequence selected from the group consisting of: sequences shown in SEQ ID No.142, SEQ ID No.143, SEQ ID No.144, SEQ ID No.145, SEQ ID No.146, SEQ ID No.147, SEQ ID No.148, SEQ ID No.149, SEQ ID No.150 and SEQ ID No. 151. The non-characteristic gene sequence comprises a nucleic acid sequence derived from T cell receptor G, and the probe that binds to the non-characteristic gene sequence comprises a sequence selected from the group consisting of: sequences shown in SEQ ID No.191, SEQ ID No.192, SEQ ID No.193, SEQ ID No.194, SEQ ID No.195, SEQ ID No.196, SEQ ID No.197, SEQ ID No.198, SEQ ID No.199 and SEQ ID No. 200. The non-characteristic gene sequence comprises a nucleic acid sequence derived from T cell receptor D and/or T cell receptor a, and the agent or device capable of amplifying the non-characteristic gene sequence comprises a sequence selected from the group consisting of: SEQ ID No.152, SEQ ID No.153, SEQ ID No.154, SEQ ID No.155, SEQ ID No.156 and SEQ ID No. 157. The non-characteristic gene sequence comprises a nucleic acid sequence derived from T cell receptor D and/or T cell receptor a, and the probe that binds to the non-characteristic gene sequence comprises a sequence selected from the group consisting of: the sequences shown in SEQ ID No.201, SEQ ID No.202, SEQ ID No.203, SEQ ID No.204, SEQ ID No.205 and SEQ ID No. 206. The non-characteristic gene sequence comprises a nucleic acid sequence derived from T cell receptor B, and the agent or device capable of amplifying the non-characteristic gene sequence comprises a sequence selected from the group consisting of: SEQ ID No.158, SEQ ID No.159, SEQ ID No.160, SEQ ID No.161, SEQ ID No.162, SEQ ID No.163, SEQ ID No.164, SEQ ID No.165, SEQ ID No.166, SEQ ID No.167, SEQ ID No.168, SEQ ID No.169 and SEQ ID No. 170. The non-characteristic gene sequence comprises a nucleic acid sequence derived from T cell receptor B, and the probe that binds to the non-characteristic gene sequence comprises a sequence selected from the group consisting of: SEQ ID No.207, SEQ ID No.208, SEQ ID No.209, SEQ ID No.210, SEQ ID No.211, SEQ ID No.212, SEQ ID No.213, SEQ ID No.214, SEQ ID No.215, SEQ ID No.216, SEQ ID No.217, SEQ ID No.218 and SEQ ID No. 219. The non-characteristic gene sequence comprises a nucleic acid sequence derived from Tal 1, and the agent or device capable of amplifying the non-characteristic gene sequence comprises a sequence selected from the group consisting of: SEQ ID NO.171 and SEQ ID NO. 172. The non-characteristic gene sequence comprises a nucleic acid sequence derived from Tal 1, and the probe that binds to the non-characteristic gene sequence comprises a sequence selected from the group consisting of: SEQ ID NO.220 and SEQ ID NO. 221.

In the recognition unit, a reagent for specifically amplifying the characteristic gene sequence (e.g., comprising one or more sets of primers capable of specific nucleic acid amplification for the characteristic gene sequence) can be amplified by a nucleic acid amplification reaction (e.g., qPCR reaction), thereby obtaining the characteristic gene sequence specific for the leukemia cells of the subject.

The recognition unit can amplify the gene sequence specific for the subject leukemia cells by performing a qPCR reaction. The recognition unit may include materials and reagents necessary to perform a qPCR reaction. For example, the identification unit includes

Green I, DNA polymerase, dntps, amplification buffer, and one or more sets of primer combinations effective to obtain (e.g., amplify) the gene sequences specific for leukemia cells of the subject. The DNA polymerase may be taq DNA polymerase. The amplification buffer may be MasterMIX.

When a qPCR reaction is performed in the recognition unit, the system of the qPCR reaction may be adjusted accordingly depending on the components contained in the recognition unit, as long as the characteristic gene sequence specific to the leukemia cells of the subject can be effectively and specifically amplified. For example, the qPCR reaction system may be, in 25 μl system: 2 mu LDNA template, 0.5 mu L forward primer, 0.5 mu L reverse primer, 12.5μL

PremixEx Taq ^TM And 9.5. Mu.L dH ₂ O. In certain embodiments, the qPCR reaction system may be, in a 20 μl system: 2. Mu.L of DNA template, 0.3. Mu.L of forward primer, 0.3. Mu.L of reverse primer, 0.4. Mu.L of fluorescent probe, 10. Mu. L Taqman Universal PCR Master Mix and 7. Mu.LdH ₂ O。

When a qPCR reaction is performed in the recognition unit, the conditions of the qPCR reaction may be adjusted accordingly as the length of the characteristic gene sequence specific to the leukemia cells of the subject varies, so long as the characteristic gene sequence specific to the leukemia cells of the subject can be effectively and specifically amplified. The conditions of the qPCR reaction may be: cycling at 95℃for 30 seconds, 94℃for 5 seconds and 60℃for 34 seconds 40 times, 95℃for 15 seconds, and 60℃for 1 minute, maintaining 4 ℃. Alternatively, it may be: after 10 minutes at 94℃the cycle was repeated 35 times at 94℃for 45 seconds, 55℃for 45 seconds and 72℃for 45 seconds, and after 15 minutes at 72℃the temperature was maintained at 4 ℃. The identification unit may include instrumentation and equipment to perform the qPCR reaction. For example, ABI

7000/7700/7900HT, lightCycler Real Time PCR or Smart Cycler II System Real Time PCR amplification apparatus.

In the present application, the term "probe" generally refers to a sequence-specific oligonucleotide probe that is optically active when hybridized to an amplification product. The probes may be attached to any optically active reporter (e.g., dye), and may also include a quencher capable of blocking the optical activity of the associated dye. Non-limiting examples of probes that can be used as a reporter include TaqMan probes, taqMan Tamara probes, taqMan MGB probes, or Lion probes. Non-limiting examples of such optically active reporters include SYBR Green, SYBR blue, DAPI, propidium iodide (propidium iodide), hoeste, SYBR gold, ethidium bromide, acridine, proflavine, acridine orange, acridine yellow, fluorocoumarin (fluorokumannin), ellipticine, daunomycin, chloroquine, distamycin D, chromomycin, hu Mixiu ammonium (hominium), mithramycin, polypyridinium (ruthenium polypyridyl), aflavine (anthramycin), phenanthridine and acridine, ethidium bromide, propidium iodide, hexidine iodide (hexidine) and ethidium homodimer-1 and ethidium homodimer-2, ethidium monoazide (ethidium monoazide) and ACMA, hoechst 33258,Hoechst 33342,Hoechst 34580,DAPI, acridine orange, 7-AAD, actinomycin D, LDS751, hydroxystilbene palmidine (hydroxystilbamidine), SYTOX blue, SYTOX green, SYTOX orange, POPO-1, POPO-3, YOYO-1, YOYO-3, TOTO-1, TOTO-3, JOJO-1, LOLOLO-1, BOBO-3, PO-PRO-1, PO-PRO-3, BO-PRO-1, BO-PRO-3, TO-PRO-1, TO-PRO-3, TO-PRO-5, JO-PRO-1, LO-PRO-1, YO-PRO-3, picoGreen, oligreen, riboGreen, SYBR gold, SYBR Green I, SYBR Green II, SYBR DX, SYTO-40, -41, -42, -43, -44, -45 (blue), SYTO-13, -16, -24, -21, -23, -12, -11, -20, -22, -15, -14, -25 (green), SYTO-81, -80, -82, -83, -84, -85 (orange), SYTO-64, -17, -59, -61, -62, -60, -63 (Red), fluorescein Isothiocyanate (FITC), tetramethylrhodamine isothiocyanate (TRITC), rhodamine, tetramethylrhodamine, R-phycoerythrin, cy-2, cy-3, cy-3.5, cy-5, cy5.5, cy-7, texas Red (Texas Red), phar-Red, allophycocyanin (APC), sybr green I, sybr green II, sybr gold, cell tracker green, 7-AAD, ethidium homodimer I, ethidium homodimer II, ethidium homodimer III, ethidium bromide, umbelliferone, eosin, green fluorescent protein, erythrosine, coumarin, methylcoumarin, pyrene, malachite green, stilbene, fluorescein, cascade blue (cascade blue), dichlorotriazinamine fluorescein, dansyl chloride, fluorescent lanthanide complexes (such as those including europium and terbium), carboxytetrachlorofluorescein, 5 and/or 6-carboxyfluorescein (FAM), 5- (or 6-) iodoacetamido fluorescein, 5- { [2 (and 3) -5- (acetylmercapto) -succinyl ] amino } fluorescein (SAMSA-fluorescein), lissamine rhodamine B sulfonyl chloride, 5 and/or 6 carboxyrhodamine (ROX), 7-amino-methyl-coumarin, 7-amino-4-methylcoumarin-3-acetic acid (AMCA), BODIPY fluorophores, 8-methoxypyrene-1, 3, 6-trisulfonic acid trisodium salt, 3, 6-disulfonic acid-4-amino-naphthalimide, phycobiliprotein, alexaFluor 350, 405, 430, 488, 532, 546, 555, 568, 594, 610, 633, 635, 647, 660, 680, 700, 750, and 790 dyes, dylight350, 405, 488, 550, 594, 633, 650, 680, 755, and 800 dyes, or other fluorophores.

The system described herein may comprise 2 or more detection modules, wherein at least one detection module is for detecting the presence and/or proportion of leukemia cells therein prior to the subject receiving the treatment, and wherein at least one detection module is for detecting the presence and/or proportion of leukemia cells therein after the subject receiving the treatment.

In this application, the term "treatment" generally refers to drug treatment and/or radiation treatment. The drug may be selected from protein kinase inhibitors, apoptosis modulators, pro-genolytic drugs, cell division inhibitors, MDM2 class oncogene inhibitors, antibody class drugs and/or other chemotherapeutic drug additives. The medicament may further comprise one or more of the following group: vincristine, dexamethasone, cyclophosphamide, vincristine, dexamethasone and levoasparaginase in combination, NSC750854, topotecan, volasertib, seremetan, JNJ-2648185 and KTP-330. The protein kinase inhibitors may include AZD8055, MLN0128, GSK690693, MK-2206, SAR245408, rapamycin, MLN0128, selumetinib, AZD6244, PCI-32765, ibrutinib, SGI-1776, dinaciclib, VS-4718, temsirolimus, sorafenib, sunitinib, ruxolitinib, AZD1480 and/or dasatinib. The apoptosis modulator may include ABT-263 (navitocrax), ABT-199 (venteclax), LCL161 and/or bininaant. The MDM2 class oncogene inhibitor may comprise MK-8242 (SCH 900242) and/or RG7112. The pro-genolysis drug may include PR-104, cytarabine (CPX-351), daunorubicin (Vyxeos), topotecan, clofaabine and/or temozolomide. The cell division inhibitor may include eribulin, ispinestib, bortezomib, carfilzomib and/or alilertin. The antibody class of drugs may include SAR3419, blinatumomab, and/or inotuzumab. The other chemotherapeutic agents may include alvershimycin, AT13387, PF-03084014, RO-4929097, MLN4924, PG11047, CX-5461, BMN-673, selinexor, curaxin, and/or CBL0137. The radiation therapy may include irradiation with x-rays, alpha rays, beta rays, gamma rays, proton beams, or other particle beams.

In certain embodiments, a sample derived from a subject (e.g., a blood cell sample, or a DNA sample extracted from the cells) is obtained and serial dilutions (e.g., 10-fold, 100-fold, 1000-fold, 1-fold, 10-fold or more) of the sample are made prior to administration of the treatment to the subject. The identification module is then used to individually amplify (e.g., qPCR amplify) the characteristic gene sequences of the subject in the diluted sample, thereby establishing a series of standard amplification curves corresponding to samples of different concentrations (e.g., different DNA concentrations). After administration of the treatment, a sample of the subject (e.g., a corresponding blood cell sample, or a corresponding DNA sample extracted from the cells) is again obtained after treatment, and the identification module is used to amplify the subject's characteristic gene sequence in the sample (e.g., using the same amplification method as when the standard amplification curve was made, such as the same qPCR amplification method).

A period of time may be between the amplification before the treatment is administered and the amplification after the treatment is administered. For example, at least 1 day, at least 2 days, at least 3 days, at least 4 days, at least 5 days, at least 6 days, at least 7 days, at least 8 days, at least 9 days, at least 10 days, at least 11 days, at least 12 days apart. The proportion of the characteristic gene sequences of leukemia cells in the subject after the treatment can then be determined by comparing the recognition and/or amplification (e.g., qPCR amplification) results of the characteristic gene sequences for the subject obtained after administration of the treatment to the standard amplification curve.

In the present application, the term "treatment-prompting unit" generally refers to a functional unit that prompts a subsequent treatment regimen to be applied to a corresponding subject based on the detected presence and/or proportion of leukemia cells in the subject. For example, the treatment prompting unit may comprise a detection element (e.g., a flow cytometer) that detects the presence and/or proportion of leukemia cells in a subject, and a decision element (e.g., a CPU processor, an algorithm) that determines the result of the presence and/or proportion detected by the detection element. The treatment prompting unit may further include a prompting element (e.g., a display screen, a voice output device, etc.) that displays a result of the determination by the decision element.

The detection element detects the presence and/or proportion of leukemia cells in the detected subject and transmits the result of the detected presence and/or proportion to the decision element. The decision element judges the result of the presence and/or proportion obtained by transmission according to the conditions of different follow-up treatment schemes according to the proportion of leukemia cells in the subjects, so as to obtain the result of the follow-up treatment scheme, and the result can be transmitted to the prompt element. The prompting element feeds back the grade result obtained by transmission to the application condition of the candidate medicine to the subject in the form of images, sounds and the like so as to provide reliable reference for the selection of the subsequent clinical treatment scheme.

For example, different follow-up treatment regimens may be indicated for the respective subjects based on the size of the proportion of leukemia cells detected in the subject. For example, when the proportion of leukemic cells in the subject being examined<1/10 ⁴ When this treatment is successful, no additional treatments are needed; when the proportion of leukemic cells in the subject is examined>1/10 ⁴ When this is the case, it may be indicated that the treatment is incomplete and a new round of treatment or an increase in the intensity of the treatment is required.

Proportion of leukemia cells in the examined subject>1/10 ⁴ In the case of a bone marrow transplant, the proportion of leukemia cells in the subject being examined may be further analyzed to determine whether or not it is suitable for the bone marrow transplant. For example, if 1/10 ⁴ <Proportion of leukemia cells in the examined subject<1/10 ³ It may be indicated that a bone marrow transplant procedure may be performed on the subject; if the proportion of leukemia cells in the subject is detected>1/10 ³ Can indicate the presence of substantial amounts of white in the subjectIn case of hematopathy cells, the likelihood of leukemia recurrence is greatly increased due to the higher leukemia cell residue, and therefore the subject should be considered unsuitable for bone marrow transplantation surgery, but should receive other treatments or increase the intensity of the treatments.

In this application, the term "recurrence" generally refers to the phenomenon in which a disease trait of a patient is reoccurring or aggravated after the disease trait has been eliminated or reduced.

In this application, the term "other treatment" generally refers to a method of treatment other than the mode of treatment that the subject being tested has received.

One embodiment of the method and system of the present application is shown in fig. 6. Wherein the target gene (e.g., the target gene may comprise IgH, igK, T cell receptor A, T cell receptor D, T cell receptor B, T cell receptor G and Tal 1, etc., and wherein gene recombination may occur) is amplified in step or module "1" (i.e., an amplification unit); isolating the amplification product obtained from said "1" in step or module "2" (i.e., an identification unit and an analysis unit) and subjecting the resulting amplified fragment of interest to nucleic acid sequencing, thereby determining the gene sequence of the amplification product specific for leukemia cells of the subject; the gene sequence obtained from "2" is quantitatively analyzed in step or module "3" (i.e., recognition unit), wherein the content of the characteristic amplification product derived from the leukemia cells of the subject in the sample is quantitatively detected by designing a personalized primer pair having a specific nucleotide sequence, a universal probe specifically binding to a non-characteristic gene sequence, and a universal primer pair specifically amplifying the non-characteristic gene sequence, thereby detecting the residual level of the leukemia cells in the subject at a molecular level.

In this application, the operation flow of the leukemia diagnosis and treatment system may include the following contents: after the subject goes to a hospital for diagnosis, the subject is diagnosed as having leukemia, and a subject-specific humanized disease model is constructed through a modeling module of the leukemia diagnosis and treatment system; thereafter the subject may receive a standard treatment (e.g., standard chemotherapy) conventional in the art, and after the treatment is completed, the presence and/or proportion of leukemia cells in the subject is detected at the molecular level by a detection module of the leukemia diagnostic system; if the test results indicate that the subject has a greater chance of relapsing leukemia, or that the proportion of leukemia cells is too high, then it indicates that the subject has developed resistance to the conventional, standardized treatment described above; it can be seen that in such cases, an effective drug specific to the subject is required, and therefore, the candidate drug screening module of the leukemia diagnosis and treatment system described in the application is utilized to screen candidate drugs (chemotherapeutic drugs, targeted drugs) by using the subject-specific humanized disease model, and according to the grade results of the candidate drugs described above, a candidate drug of grade 5 or grade 6 is selected to guide clinical treatment, so that the subject receives treatment specific to the screened drug; after a period of treatment, if the detection module of the leukemia diagnosis and treatment system displays that the proportion of leukemia cells detected by the subject on the molecular level is very low or no, the screened medicine obtained by the leukemia diagnosis and treatment system is considered to have very obvious curative effect on the subject.

The present application also relates to the following specific embodiments:

1. a system for conducting leukemia diagnostics, comprising:

a) A modeling module for constructing a subject-specific humanized disease model, the subject being a leukemia patient;

b) At least one detection module for detecting the presence and/or proportion of leukemia cells in the subject;

wherein the modeling module comprises:

a1 A sample unit comprising a suspension of leukemia cells derived from the subject, the density of leukemia cells in the suspension being 2x10 ⁷ Ml to 5x10 ⁷ /ml；

a2 A radiation unit comprising a radioactive treatment device for the radioactive treatment of a suitable immunodeficient mouse;

a3 An inoculation unit for inoculating the leukemia cell suspension into the immunodeficient mice treated with the irradiation unit;

wherein the at least one detection module comprises:

b1 An amplification unit comprising a reagent capable of specifically amplifying a target gene to obtain a target-specific amplification product.

2. The system of embodiment 1, further comprising c) a drug candidate screening module comprising a first drug candidate set and a second drug candidate set;

Wherein the first drug candidate group comprises one or more drugs selected from the group consisting of: vincristine, dexamethasone, levoasparaginase, topoisomerase inhibitor, purine nucleoside derivative, proteasome inhibitor, mTOR inhibitor, dasatinib, antibody drug, all-trans retinoic acid, DNA damage inducer, folic acid reductase inhibitor, deacetylase inhibitor, multi-receptor tyrosine kinase inhibitor, cytotoxic drug, and vitamin a amide; and is also provided with

Wherein the second drug candidate group comprises one or more drugs selected from the group consisting of: protein kinase inhibitors, apoptosis modulators, DNA disintegrants, cell division inhibitors, MDM2 oncogene inhibitors, antibodies and other chemotherapeutic agents.

3. The system of any one of embodiments 1-2, wherein the modeling module further comprises a 4) a separation unit comprising a mononuclear cell separation liquid for centrifuging leukemia cells of the subject.

4. The system according to any one of embodiments 1-3, wherein the modeling module further comprises a 5) a T cell removal unit for removing T cells in a sample derived from a non-T cell leukemia subject, thereby obtaining the leukemia cell suspension.

5. The system of any one of embodiments 3-4, wherein the monocyte separation liquid is Ficoll and the centrifugation is density gradient centrifugation.

6. The system of any one of embodiments 1-5, wherein the leukemia cell suspension comprises RPMI cell culture medium.

7. The system of any one of embodiments 4-6, wherein the T cells that are removed are CD3 positive T cells.

8. The system of embodiment 7, wherein the T cell removal unit comprises magnetic beads comprising CD3 antibodies.

9. The system of any of embodiments 7-8, wherein the T cell removal unit further comprises a high magnetic field.

10. The system of any one of embodiments 1-9, wherein the leukemia is acute lymphoblastic leukemia and the immunodeficient mouse is an NSG mouse.

11. The system of any one of embodiments 1-9, wherein the leukemia is acute myelogenous leukemia and the immunodeficient mouse is a MISTRG mouse.

12. The system of embodiment 10, wherein the radiation treatment device is an X-ray radiation device and produces a radiation dose of 200cGy to 300cGy.

13. The system of embodiment 11, wherein the radiation treatment device is an X-ray radiation device and produces a radiation dose of 550cGy to 650cGy.

14. The system of any one of embodiments 1-13, wherein the radiating element is configured to subject the immunodeficient mice to the radioactive treatment within 12-24 hours prior to a predetermined inoculation time.

15. The system of any one of embodiments 1-14, wherein the immunodeficient mouse is 5-7 weeks old.

16. The system of any one of embodiments 1-15, wherein the modeling module further comprises a 6) an infrared irradiation and heating unit for infrared lamp irradiation and heating of the immunodeficient mouse.

17. The system of any one of embodiments 1-16, wherein the modeling module further comprises a 7) a monitoring unit for monitoring the growth of leukemia cells from the subject in the vaccinated immunodeficient mice.

18. The system of embodiment 17, wherein the monitoring unit comprises reagents and devices that detect the proportion of hucd45+, hucd19+, hucd3+, and/or hucd33+ cells in the mouse peripheral blood.

19. The system according to embodiment 18, wherein the modeling module further comprises a 8) a spleen processing unit comprising a separation element by which the spleen of the mice can be separated, a disruption element by which the spleen of the mice separated is disrupted to obtain spleen cells, and a suspension element by which the spleen cells are prepared as the leukemia cell suspension when the proportion of hucd45+, hucd19+, hucd3+, and/or hucd33+ cells in the inoculated peripheral blood of the mice is at least 50%.

20. The system of any one of embodiments 1-19, wherein the modeling module further comprises a 9) liquid nitrogen for cryopreserving the leukemia cell suspension.

21. The system of any one of embodiments 2-20, wherein the drug candidate screening module further comprises a monitoring unit for monitoring the growth of leukemia cells from the subject in the vaccinated immunodeficient mice.

22. The system of embodiment 21, wherein the monitoring unit comprises reagents and means for detecting the proportion of hucd45+, hucd19+, hucd3+, and/or hucd33+ cells in the peripheral blood of the mouse, and the monitoring unit is configured to suggest that a candidate drug may be administered to the mouse when the proportion reaches 1% -5%.

23. The system of embodiment 21 or 22, wherein the monitoring unit comprises reagents and means for detecting the proportion of hucd45+, hucd19+, hucd3+, and/or hucd33+ cells in the peripheral blood of the mouse, and the monitoring unit is configured to continuously monitor a change in the proportion of the hucd45+, hucd19+, hucd3+, and/or hucd33+ cells in the peripheral blood of the mouse after administration of the drug, and to indicate the efficacy of the candidate drug based on the change.

24. The system of embodiment 23, wherein the monitoring unit is configured to: when the ratio of hucd45+, hucd19+, hucd3+, and/or hucd33+ cells in the peripheral blood cells of the mice is monitored to remain below 1% and maintained for at least 2 weeks after administration of the drug candidate, the drug candidate is indicated to be effective.

25. The system of any one of embodiments 2-24, wherein the first drug candidate set comprises one or more drugs selected from the group consisting of: vincristine, dexamethasone, levoasparaginase, topotecan, clofarabine, carfilzomib, temsirolimus, dasatinib, bortezomib, CD19 antibody, all-trans retinoic acid, doxorubicin, carbamate, SAHA, sunitinib, cyclophosphamide, and valphenamide.

26. The system of any one of embodiments 2-25, wherein the protein kinase inhibitor in the second drug candidate group comprises one or more drugs selected from the group consisting of: AZD8055, MLN0128, GSK690693, MK-2206, SAR245408, rapamycin, MLN0128, selumetinib, AZD6244, PCI-32765, ibrutinib, SGI-1776, dinaciclib, VS-4718, sorafenib, sunitinib and AZD1480.

27. The system of any one of embodiments 2-26, wherein the apoptosis modulator in the second drug candidate set comprises one or more drugs selected from the group consisting of: ABT-263 (naviteclmax), ABT-199 (venetoclax), LCL161 and birinaptant.

28. The system of any one of embodiments 2-27, wherein the DNA breaking agent in the second drug candidate set comprises one or more drugs selected from the group consisting of: PR-104, cytarabine (CPX-351), daunorubicin (Vyxeos) and temozolomide.

29. The system of any one of embodiments 2-28, wherein the cell division inhibitor in the second drug candidate group comprises one or more drugs selected from the group consisting of: eribulin, ispinesib and alilerib.

30. The system of any one of embodiments 2-29, wherein the MDM2 class oncogene inhibitor in the second drug candidate group comprises one or more drugs selected from the group consisting of: MK-8242 (SCH 900242) and RG7112.

31. The system of any one of embodiments 2-30, wherein the antibody drug in the second drug candidate group comprises one or more drugs selected from the group consisting of: SAR3419.

32. The system of any one of embodiments 2-31, wherein the other chemotherapeutic drug adjunct in the second drug candidate group comprises one or more drugs selected from the group consisting of: alvershimycin, AT13387, PF-03084014, RO-4929097, MLN4924, PG11047, CX-5461, BMN-673, selinexor, bortezomib, curaxin and CBL0137.

33. The system of any one of embodiments 2-32, wherein vincristine is included in the first drug candidate group, and is adapted for administration to the subject-specific humanized disease model according to the following requirements: is suitable for being administrated by intraperitoneal injection, and the dosage of each administration is 0.5mg/kg, once a week and continuously for 3-6 weeks.

34. The system according to any one of embodiments 2-33, wherein the first candidate drug group comprises a carbamate folate, and the carbamate folate is suitable for administration to the leukemia humanized disease model according to the following requirements: is suitable for being applied by intraperitoneal injection, and the application amount is 3-6mg/kg each time, is applied once every two weeks, and is continuously applied for 6-10 weeks.

35. The system according to any one of embodiments 2-34, wherein dexamethasone is included in the first drug candidate group, and is adapted for administration to the leukemia-humanized disease model according to the following requirements: is suitable for being applied by intraperitoneal injection, and the application amount is 10-20mg/kg each time, once daily and continuously for 3-6 weeks.

36. The system according to any one of embodiments 2-35, wherein doxorubicin is included in the first drug candidate set and is adapted to be administered to the leukemia humanized disease model according to the following requirements: is suitable for intravenous administration, each time at an amount of 0.5-3mg/kg, once a week for 3-6 weeks.

37. The system of any one of embodiments 2-36, wherein the first drug candidate group comprises a l-asparaginase therein and the l-asparaginase is adapted for administration to the leukemia humanized disease model according to the following requirements: is suitable for being applied by intraperitoneal injection, and the application amount is 500-2000KU/kg each time, once daily and continuously for 3-6 weeks.

38. The system of any one of embodiments 2-37, wherein topotecan is included in the first drug candidate group and is adapted for administration to the leukemia humanized disease model according to the following requirements: is suitable for being applied by intraperitoneal injection, the dosage of each application is 0.1-5mg/kg, the application is carried out once daily for 2-8 weeks, and the application is stopped for one week after two weeks of administration.

39. The system according to any one of embodiments 2-38, wherein clofarabine is included in the first drug candidate group and is adapted for administration to the leukemia humanized disease model according to the following requirements: is suitable for being applied by intraperitoneal injection, and the application amount is 10-100mg/kg each time, once daily and continuously for 3-6 weeks.

40. The system of any one of embodiments 2-39, wherein carfilzomib is included in the first drug candidate group and is adapted for administration to the leukemia humanized disease model according to the following requirements: is suitable for intravenous injection, and each time is 0.1-10mg/kg, twice weekly for 3-6 weeks.

41. The system of any one of embodiments 2-40, wherein the first drug candidate group comprises temsirolimus therein, and the temsirolimus is adapted for administration to the leukemia humanized disease model according to the following requirements: is suitable for being administrated by intraperitoneal injection, and the administration amount is 5-50mg/kg each time, once daily and continuously for 1-3 weeks.

42. The system of any one of embodiments 2-41, wherein dasatinib is included in the first drug candidate group and is adapted for administration to the leukemia humanized disease model according to the following requirements: suitable for administration by oral administration, each time at an amount of 5-50mg/kg, once daily and for 2-6 weeks.

43. The system of any one of embodiments 2-42, wherein bortezomib is included in the first drug candidate set, and is adapted for administration to the leukemia humanized disease model according to the following requirements: is suitable for being applied by intraperitoneal injection, and the application amount is 0.1-20mg/kg each time, and the application is carried out twice a week for 4-8 weeks.

44. The system according to any one of embodiments 2-43, wherein SAR3419 is included in the first drug candidate set, and wherein said SAR3419 is adapted for administration to said leukemia humanized disease model according to the following requirements: is suitable for being applied by intraperitoneal injection, and the application amount is 0.5-50mg/kg each time, once a week and continuously for 4-8 weeks.

45. The system of any one of embodiments 2-44, wherein all-trans retinoic acid is included in the first candidate drug group, and is adapted for administration to the leukemia humanized disease model according to the following requirements: is suitable for being applied by intraperitoneal injection, and the application amount is 0.5-10mg/kg each time, once a week and continuously for 2-6 weeks.

46. The system of any one of embodiments 2-45, wherein SAHA is included in the first drug candidate group and is adapted for administration to the leukemia humanized disease model according to the following requirements: is suitable for being applied by intraperitoneal injection, and the application amount is 100-500mg/kg each time, once daily and continuously for 3-6 weeks.

47. The system of any one of embodiments 2-46, wherein sunitinib is included in the first drug candidate group and is adapted for administration to the leukemia humanized disease model according to the following requirements: suitable for administration by oral administration, each at a dose of 10-100mg/kg, once daily and for 2-6 weeks.

48. The system of any one of embodiments 2-47, wherein cyclophosphamide is included in the first drug candidate set and is adapted for administration to the leukemia humanized disease model according to the following requirements: is suitable for being administrated by intraperitoneal injection, and the administration amount is 30-300mg/kg each time, once daily and continuously for 2-6 weeks.

49. The system of any one of embodiments 2-48, wherein the first drug candidate group comprises a vitamin a amide, and the vitamin a amide is adapted for administration to the leukemia humanized disease model according to the following requirements: is suitable for being applied by intraperitoneal injection, and the application amount is 20-200mg/kg each time, once daily and continuously for 2-6 weeks.

50. The system of any one of embodiments 1-49, wherein the leukemia comprises B-cell acute lymphoblastic leukemia and/or T-cell acute lymphoblastic leukemia.

51. The system of any one of embodiments 1-50, wherein the target gene comprises one or more genes selected from the group consisting of: igH, igK, T cell receptor A, T cell receptor D, T cell receptor B, T cell receptor G and Tal 1.

52. The system of embodiment 51, wherein the target gene comprises an IgH gene rearrangement and the agent capable of specifically amplifying the target gene comprises one or more primer combinations selected from the group consisting of:

1) Forward primer: VH1/7, reverse primer: JH cos;

2) Forward primer: VH2, reverse primer: JH cos;

3) Forward primer: VH3, reverse primer: JH cos;

4) Forward primer: VH4, reverse primer: JH cos;

5) Forward primer: VH5, reverse primer: JH cos;

6) Forward primer: VH6, reverse primer: JH cos;

7) Forward primer: DH1, DH4, DH5 and DH7, reverse primers: JH cos;

8) Forward primer: DH2, reverse primer: JH cos;

9) Forward primer: DH3, reverse primer: JH cos; and

10 Forward primer: DH6, reverse primer: JH con.

53. The system of embodiment 52, wherein the primer JH ons comprises a sequence selected from the group consisting of seq id nos: SEQ ID NO. 19; and the sequence shown in SEQ ID No. 20.

54. The system of any one of embodiments 52-53, wherein the primer VH1/7 comprises a sequence selected from the group consisting of: SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO. 3.

55. The system of any one of embodiments 52-54, wherein the primer VH2 comprises a sequence selected from the group consisting of: SEQ ID No.4, SEQ ID No.5 and SEQ ID No. 6.

56. The system of any one of embodiments 52-55, wherein said primer VH3 comprises a sequence selected from the group consisting of: SEQ ID NO.7, SEQ ID NO.8 and SEQ ID NO. 9.

57. The system of any one of embodiments 52-56, wherein the primer VH4 comprises a sequence selected from the group consisting of: SEQ ID NO.10, SEQ ID NO.11 and SEQ ID NO. 12.

58. The system of any one of embodiments 52-57, wherein said primer VH5 comprises a sequence selected from the group consisting of: SEQ ID NO.13, SEQ ID NO.14 and SEQ ID NO. 15.

59. The system of any one of embodiments 52-58, wherein said primer VH6 comprises a sequence selected from the group consisting of: SEQ ID No.16, SEQ ID No.17 and SEQ ID No. 18.

60. The system of any one of embodiments 52-59, wherein the primer DH1 comprises a sequence selected from the group consisting of seq id nos: SEQ ID NO.21 and SEQ ID NO. 22.

61. The system of any one of embodiments 52-60, wherein the primer DH2 comprises a sequence selected from the group consisting of seq id nos: SEQ ID No.23 and SEQ ID No. 24.

62. The system of any one of embodiments 52-61, wherein the primer DH3 comprises a sequence selected from the group consisting of seq id nos: SEQ ID NO.25 and SEQ ID NO. 26.

63. The system of any one of embodiments 52-62, wherein the primer DH4 comprises a sequence selected from the group consisting of seq id nos: SEQ ID NO.27 and SEQ ID NO. 28.

64. The system of any one of embodiments 52-63, wherein the primer DH5 comprises a sequence selected from the group consisting of seq id nos: SEQ ID NO.29 and SEQ ID NO. 30.

65. The system of any one of embodiments 52-64, wherein the primer DH6 comprises a sequence selected from the group consisting of seq id nos: SEQ ID NO.31 and SEQ ID NO. 32.

66. The system of any one of embodiments 52-65, wherein the primer DH7 comprises a sequence selected from the group consisting of seq id nos: SEQ ID NO.33 and SEQ ID NO. 34.

67. The system of any one of embodiments 51-66, wherein the target gene comprises an IgK gene rearrangement and the agent capable of specifically amplifying the target gene comprises one or more primer combinations selected from the group consisting of:

1) Forward primer: vk1, reverse primer: kdel;

2) Forward primer: vk2, reverse primer: kdel;

3) Forward primer: vk3, reverse primer: kdel; and

4) Forward primer: intron RSS, reverse primer: kdel.

68. The system of embodiment 67, wherein the primer Vk1 comprises a sequence selected from the group consisting of: SEQ ID NO.35 and SEQ ID NO. 36.

69. The system of any one of embodiments 67-68, wherein the primer Vk2 comprises a sequence selected from the group consisting of: SEQ ID NO.37 and SEQ ID NO. 38.

70. The system of any one of embodiments 67-69, wherein the primer Vk3 comprises a sequence selected from the group consisting of: SEQ ID NO.39 and SEQ ID NO. 40.

71. The system of any one of embodiments 67-70, wherein the primer Vk4 comprises a sequence selected from the group consisting of: SEQ ID NO.41 and SEQ ID NO. 42.

72. The system of any one of embodiments 67-71, wherein the primer Intron RSS comprises a sequence selected from the group consisting of: SEQ ID NO.43 and SEQ ID NO. 44.

73. The system of any one of embodiments 67-72, wherein the primer Kdel comprises a sequence selected from the group consisting of: SEQ ID NO.45 and SEQ ID NO. 46.

74. The system of any one of embodiments 51-73, wherein the leukemia comprises B-cell acute lymphoblastic leukemia, and the target gene comprises a gene rearrangement of the T-cell receptor region; the genes of the T cell receptor region include one or more selected from the group consisting of: t cell receptor A, T cell receptor D, T cell receptor B and T cell receptor G; and the agent capable of specifically amplifying the target gene comprises one or more primer combinations selected from the group consisting of:

1) Forward primer: vd2, reverse primer: dd3;

2) Forward primer: dd2, reverse primer: dd3;

3) Forward primer: vd2, reverse primer: ja29;

4) Forward primer: vd2, reverse primer: ja9, ja29, ja30, ja48, ja49, ja52, ja54, ja55, ja56, ja57, ja58, ja59 and Ja61;

5) Forward primer: vg1, reverse primer: jg1 and Jg2;

6) Forward primer: vg2, reverse primer: jg1 and Jg2;

7) Forward primer: vg4, reverse primer: jg1 and Jg2;

8) TCRB multiple primer combination A;

9) TCRB multi-primer combination B; and

10 TCRB multi-primer combination C.

75. The system of embodiment 74, wherein the primer Vg1 comprises a sequence selected from the group consisting of: SEQ ID NO.47 and SEQ ID NO. 48.

76. The system of any one of embodiments 74-75, wherein the primer Vg2 comprises a sequence selected from the group consisting of: SEQ ID NO.49 and SEQ ID NO. 50.

77. The system of any one of embodiments 74-76, wherein the primer Vg4 comprises a sequence selected from the group consisting of: SEQ ID NO.53 and SEQ ID NO. 54.

78. The system of any one of embodiments 74-77, wherein the primer Jg1 comprises a sequence selected from the group consisting of: SEQ ID No.55 and SEQ ID No. 56.

79. The system of any one of embodiments 74-78, wherein the primer Jg2 comprises a sequence selected from the group consisting of seq id nos: SEQ ID NO.57 and SEQ ID NO. 58.

80. The system of any one of embodiments 74-79, wherein said primer Vd2 comprises a sequence selected from the group consisting of: SEQ ID NO.61 and SEQ ID NO. 62.

81. The system of any one of embodiments 74-80, wherein the primer Dd2 comprises a sequence selected from the group consisting of: SEQ ID NO.65 and SEQ ID NO. 66.

82. The system of any one of embodiments 74-81, wherein the primer Dd3 comprises a sequence selected from the group consisting of: SEQ ID NO.67 and SEQ ID NO. 68.

83. The system of any one of embodiments 74-82, wherein the primer Ja9 comprises a sequence selected from the group consisting of seq id nos: SEQ ID NO. 71.

84. The system of any one of embodiments 74-83, wherein the primer Ja29 comprises a sequence selected from the group consisting of seq id nos: SEQ ID NO. 72.

85. The system of any one of embodiments 74-84, wherein the primer Ja30 comprises a sequence selected from the group consisting of: SEQ ID NO. 73.

86. The system of any one of embodiments 74-85, wherein the primer Ja48 comprises a sequence selected from the group consisting of seq id nos: SEQ ID NO. 74.

87. The system of any one of embodiments 74-86, wherein the primer Ja49 comprises a sequence selected from the group consisting of seq id nos: SEQ ID NO. 75.

88. The system of any one of embodiments 74-87, wherein the primer Ja52 comprises a sequence selected from the group consisting of seq id nos: SEQ ID NO. 76.

89. The system of any one of embodiments 74-88, wherein the primer Ja54 comprises a sequence selected from the group consisting of: SEQ ID NO. 77.

90. The system of any one of embodiments 74-89, wherein the primer Ja55 comprises a sequence selected from the group consisting of seq id nos: SEQ ID NO. 78.

91. The system of any one of embodiments 74-90, wherein the primer Ja56 comprises a sequence selected from the group consisting of seq id nos: SEQ ID NO. 79.

92. The system of any one of embodiments 74-91, wherein the primer Ja57 comprises a sequence selected from the group consisting of seq id nos: SEQ ID NO. 80.

93. The system of any one of embodiments 74-92, wherein the primer Ja58 comprises a sequence selected from the group consisting of seq id nos: SEQ ID NO. 81.

94. The system of any one of embodiments 74-93, wherein the primer Ja59 comprises a sequence selected from the group consisting of seq id nos: SEQ ID NO. 82.

95. The system of any one of embodiments 74-94, wherein the primer Ja61 comprises a sequence selected from the group consisting of: SEQ ID NO. 83.

96. The system of any one of embodiments 74-95, wherein the multi-primer combination a comprises one or more sequences selected from the group consisting of: SEQ ID No.86, SEQ ID No.87, SEQ ID No.88, SEQ ID No.89, SEQ ID No.90, SEQ ID No.91, SEQ ID No.92, SEQ ID No.93, SEQ ID No.94, SEQ ID No.95, SEQ ID No.96, SEQ ID No.97, SEQ ID No.98, SEQ ID No.99, SEQ ID No.100, SEQ ID No.101, SEQ ID No.102, SEQ ID No.103, SEQ ID No.104, SEQ ID No.105, SEQ ID No.106, SEQ ID No.107, SEQ ID No.108, SEQ ID No.111, SEQ ID No.112, SEQ ID No.113, SEQ ID No.114, SEQ ID No.115, SEQ ID No.116, SEQ ID No.118, SEQ ID No.122 and SEQ ID No. 123.

97. The system of any one of embodiments 74-96, wherein the multi-primer combination B comprises one or more sequences selected from the group consisting of: SEQ ID No.86, SEQ ID No.87, SEQ ID No.88, SEQ ID No.89, SEQ ID No.90, SEQ ID No.91, SEQ ID No.92, SEQ ID No.93, SEQ ID No.94, SEQ ID No.95, SEQ ID No.96, SEQ ID No.97, SEQ ID No.98, SEQ ID No.99, SEQ ID No.100, SEQ ID No.101, SEQ ID No.102, SEQ ID No.103, SEQ ID No.104, SEQ ID No.105, SEQ ID No.106, SEQ ID No.107, SEQ ID No.108, SEQ ID No.117, SEQ ID No.119, SEQ ID No.120 and SEQ ID No. 121.

98. The system of any one of embodiments 74-97, wherein the multi-primer combination C comprises one or more sequences selected from the group consisting of: SEQ ID No.109, SEQ ID No.110, SEQ ID No.111, SEQ ID No.112, SEQ ID No.113, SEQ ID No.114, SEQ ID No.115, SEQ ID No.116, SEQ ID No.117, SEQ ID No.118, SEQ ID No.119, SEQ ID No.120, SEQ ID No.121, SEQ ID No.122 and SEQ ID No. 123.

99. The system of embodiment 51, wherein the leukemia comprises T-cell acute lymphoblastic leukemia and the target gene comprises a gene rearrangement of the T-cell receptor region; the genes of the T cell receptor region include one or more selected from the group consisting of: t cell receptor A, T cell receptor D, T cell receptor B and T cell receptor G; and the agent capable of specifically amplifying the target gene comprises one or more primer combinations selected from the group consisting of:

1) Forward primer: vd1, reverse primer: jd1;

2) Forward primer: vd2, reverse primer: jd1;

3) Forward primer: vd3, reverse primer: jd1;

4) Forward primer: vd2, reverse primer: dd3;

5) Forward primer: dd2, reverse primer: dd3;

6) Forward primer: dd2, reverse primer: jd1;

7) Forward primer: vd2, reverse primer: ja29;

8) Forward primer: vd2, reverse primer: ja9, ja29, ja30, ja48, ja49, ja52, ja54, ja55, ja56, ja57, ja58, ja59 and Ja61;

9) Forward primer: vg1, reverse primer: jg1 and Jg2;

10 Forward primer: vg2, reverse primer: jg1 and Jg2;

11 Forward primer: vg3, reverse primer: jg1 and Jg2;

12 Forward primer: vg4, reverse primer: jg1 and Jg2;

13 Forward primer: sildb, reverse primer: taldb1;

14 TCRB multi-primer combination a;

15 TCRB multi-primer combination B; and

16 TCRB multi-primer combination C.

100. The system of embodiment 99, wherein the primer Vg3 comprises a sequence selected from the group consisting of: SEQ ID NO.51 and SEQ ID NO. 52.

101. The system according to any one of embodiments 99-100, wherein said primer Vd3 comprises a sequence selected from the group consisting of: SEQ ID NO.63 and SEQ ID NO. 64.

102. The system of any one of embodiments 99-101, wherein the primer Vg1 comprises a sequence selected from the group consisting of: SEQ ID NO.47 and SEQ ID NO. 48.

103. The system of any one of embodiments 99-102, wherein the primer Vg2 comprises a sequence selected from the group consisting of: SEQ ID NO.49 and SEQ ID NO. 50.

104. The system of any one of embodiments 99-103, wherein the primer Vg4 comprises a sequence selected from the group consisting of: SEQ ID NO.53 and SEQ ID NO. 54.

105. The system of any one of embodiments 99-104, wherein the primer Jg1 comprises a sequence selected from the group consisting of seq id nos: SEQ ID No.55 and SEQ ID No. 56.

106. The system of any one of embodiments 99-105, wherein the primer Jg2 comprises a sequence selected from the group consisting of seq id nos: SEQ ID NO.57 and SEQ ID NO. 58.

107. The system according to any one of embodiments 99-106, wherein the primer Vd2 comprises a sequence selected from the group consisting of: SEQ ID NO.61 and SEQ ID NO. 62.

108. The system of any one of embodiments 99-107, wherein the primer Dd2 comprises a sequence selected from the group consisting of: SEQ ID NO.65 and SEQ ID NO. 66.

109. The system of any one of embodiments 99-108, wherein the primer Dd3 comprises a sequence selected from the group consisting of: SEQ ID NO.67 and SEQ ID NO. 68.

110. The system of any one of embodiments 99-109, wherein the primer Ja9 comprises a sequence selected from the group consisting of seq id nos: SEQ ID NO. 71.

111. The system of any one of embodiments 99-110, wherein the primer Ja29 comprises a sequence selected from the group consisting of seq id nos: SEQ ID NO. 72.

112. The system of any one of embodiments 99-111, wherein the primer Ja30 comprises a sequence selected from the group consisting of seq id nos: SEQ ID NO. 73.

113. The system of any one of embodiments 99-112, wherein the primer Ja48 comprises a sequence selected from the group consisting of seq id nos: SEQ ID NO. 74.

114. The system of any one of embodiments 99-113, wherein the primer Ja49 comprises a sequence selected from the group consisting of seq id nos: SEQ ID NO. 75.

115. The system of any one of embodiments 99-114, wherein the primer Ja52 comprises a sequence selected from the group consisting of seq id nos: SEQ ID NO. 76.

116. The system of any one of embodiments 99-115, wherein the primer Ja54 comprises a sequence selected from the group consisting of seq id nos: SEQ ID NO. 77.

117. The system of any one of embodiments 99-116, wherein the primer Ja55 comprises a sequence selected from the group consisting of seq id nos: SEQ ID NO. 78.

118. The system of any one of embodiments 99-117, wherein the primer Ja56 comprises a sequence selected from the group consisting of seq id nos: SEQ ID NO. 79.

119. The system of any one of embodiments 99-118, wherein the primer Ja57 comprises a sequence selected from the group consisting of seq id nos: SEQ ID NO. 80.

120. The system of any one of embodiments 99-119, wherein the primer Ja58 comprises a sequence selected from the group consisting of seq id nos: SEQ ID NO. 81.

121. The system of any one of embodiments 99-120, wherein the primer Ja59 comprises a sequence selected from the group consisting of seq id nos: SEQ ID NO. 82.

122. The system of any one of embodiments 99-121, wherein the primer Ja61 comprises a sequence selected from the group consisting of seq id nos: SEQ ID NO. 83.

123. The system of any one of embodiments 99-122, wherein the multi-primer combination a comprises one or more sequences selected from the group consisting of: SEQ ID No.86, SEQ ID No.87, SEQ ID No.88, SEQ ID No.89, SEQ ID No.90, SEQ ID No.91, SEQ ID No.92, SEQ ID No.93, SEQ ID No.94, SEQ ID No.95, SEQ ID No.96, SEQ ID No.97, SEQ ID No.98, SEQ ID No.99, SEQ ID No.100, SEQ ID No.101, SEQ ID No.102, SEQ ID No.103, SEQ ID No.104, SEQ ID No.105, SEQ ID No.106, SEQ ID No.107, SEQ ID No.108, SEQ ID No.111, SEQ ID No.112, SEQ ID No.113, SEQ ID No.114, SEQ ID No.115, SEQ ID No.116, SEQ ID No.118, SEQ ID No.122 and SEQ ID No. 123.

124. The system of any one of embodiments 99-123, wherein the multi-primer combination B comprises one or more sequences selected from the group consisting of: SEQ ID No.86, SEQ ID No.87, SEQ ID No.88, SEQ ID No.89, SEQ ID No.90, SEQ ID No.91, SEQ ID No.92, SEQ ID No.93, SEQ ID No.94, SEQ ID No.95, SEQ ID No.96, SEQ ID No.97, SEQ ID No.98, SEQ ID No.99, SEQ ID No.100, SEQ ID No.101, SEQ ID No.102, SEQ ID No.103, SEQ ID No.104, SEQ ID No.105, SEQ ID No.106, SEQ ID No.107, SEQ ID No.108, SEQ ID No.117, SEQ ID No.119, SEQ ID No.120 and SEQ ID No. 121.

125. The system of any one of embodiments 99-124, wherein the multi-primer combination C comprises one or more sequences selected from the group consisting of: SEQ ID No.109, SEQ ID No.110, SEQ ID No.111, SEQ ID No.112, SEQ ID No.113, SEQ ID No.114, SEQ ID No.115, SEQ ID No.116, SEQ ID No.117, SEQ ID No.118, SEQ ID No.119, SEQ ID No.120, SEQ ID No.121, SEQ ID No.122 and SEQ ID No. 123.

126. The system according to any one of embodiments 99-125, wherein the primer Vd1 comprises a sequence selected from the group consisting of: SEQ ID NO.59 and SEQ ID NO. 60.

127. The system of any one of embodiments 99-126, wherein the primer Jd1 comprises a sequence selected from the group consisting of seq id nos: SEQ ID NO.69 and SEQ ID NO. 70.

128. The system of any one of embodiments 99-127, wherein the primer Sildb comprises a sequence selected from the group consisting of seq id nos: SEQ ID NO. 84.

129. The system of any one of embodiments 99-128, wherein the primer taddb 1 comprises a sequence selected from the group consisting of: SEQ ID NO. 85.

130. The system of any one of embodiments 52-98, wherein the leukemia is B-cell acute lymphoblastic leukemia.

131. The system of any one of embodiments 99-129, wherein the leukemia is T-cell acute lymphoblastic leukemia.

132. The system of any one of embodiments 1-131, wherein the detection module further comprises an identification unit comprising reagents and means for identifying the target-specific amplification product, thereby identifying a characteristic amplification product of the target-specific amplification product derived from leukemia cells of the subject.

133. The system of embodiment 132, wherein the identification unit comprises reagents and apparatus required for gel electrophoresis separation of the target-specific amplification products.

134. The system of any of embodiments 132-133, wherein the detection module further comprises an analysis unit comprising reagents and means for analyzing the characteristic amplification products to obtain a characteristic gene sequence specific for leukemia cells of the subject.

135. The system of embodiment 134, wherein the analysis unit comprises reagents and devices required for nucleic acid sequencing and sequence analysis of the characteristic amplification products.

136. The system of embodiment 135, wherein the analysis unit comprises reagents and apparatus necessary to identify a nucleic acid sequence that is conserved among nucleic acid sequences of the characteristic amplification products and a subject-specific nucleic acid sequence, thereby obtaining a characteristic gene sequence specific for leukemia cells of the subject.

137. The system of any of embodiments 135-136, wherein the detection module further comprises a recognition unit comprising reagents and means capable of specifically recognizing and/or amplifying the characteristic gene sequence of the subject, thereby determining the presence and/or proportion of residual leukemia cells in the subject.

138. The system of embodiment 137, wherein the recognition unit comprises an agent or device that specifically amplifies a gene sequence that is characteristic of leukemia cells of the subject.

139. The system of embodiment 138, wherein the recognition unit further comprises a probe that binds to a non-characteristic gene sequence and a reagent or device capable of amplifying the non-characteristic gene sequence.

140. The system of embodiment 139, wherein the non-characteristic gene sequence comprises a nucleic acid sequence derived from one or more genes in the group consisting of: igH, igK, T cell receptor A, T cell receptor D, T cell receptor B, T cell receptor G and Tal 1.

141. The system of embodiment 140, wherein the non-characteristic gene sequence comprises a nucleic acid sequence derived from IgH and the agent or device capable of amplifying the non-characteristic gene sequence comprises a sequence selected from the group consisting of: sequences shown in SEQ ID No.124, SEQ ID No.125, SEQ ID No.126, SEQ ID No.127, SEQ ID No.128, SEQ ID No.129, SEQ ID No.130 and SEQ ID No. 131.

142. The system of any of embodiments 140-141, wherein the non-characteristic gene sequence comprises a nucleic acid sequence derived from IgH and the probe that binds to the non-characteristic gene sequence comprises a sequence selected from the group consisting of: sequences shown in SEQ ID No.173, SEQ ID No.174, SEQ ID No.175, SEQ ID No.176, SEQ ID No.177, SEQ ID No.178, SEQ ID No.179 and SEQ ID No. 180.

143. The system of any one of embodiments 140-142, wherein the non-characteristic gene sequence comprises a nucleic acid sequence derived from IgK, and the agent or device capable of amplifying the non-characteristic gene sequence comprises a sequence selected from the group consisting of: SEQ ID NO.132, SEQ ID NO.133, SEQ ID NO.134, SEQ ID NO.135, SEQ ID NO.136, SEQ ID NO.137, SEQ ID NO.138, SEQ ID NO.139, SEQ ID NO.140 and SEQ ID NO. 141.

144. The system of any one of embodiments 140-143, wherein the non-characteristic gene sequence comprises a nucleic acid sequence derived from IgK, and the probe that binds to the non-characteristic gene sequence comprises a sequence selected from the group consisting of: sequences shown in SEQ ID No.181, SEQ ID No.182, SEQ ID No.183, SEQ ID No.184, SEQ ID No.185, SEQ ID No.186, SEQ ID No.187, SEQ ID No.188, SEQ ID No.189 and SEQ ID No. 190.

145. The system of any of embodiments 140-144, wherein the non-characteristic gene sequence comprises a nucleic acid sequence derived from T cell receptor G, and the agent or device capable of amplifying the non-characteristic gene sequence comprises a sequence selected from the group consisting of: sequences shown in SEQ ID No.142, SEQ ID No.143, SEQ ID No.144, SEQ ID No.145, SEQ ID No.146, SEQ ID No.147, SEQ ID No.148, SEQ ID No.149, SEQ ID No.150 and SEQ ID No. 151.

146. The system of any of embodiments 140-145, wherein the non-characteristic gene sequence comprises a nucleic acid sequence derived from T cell receptor G, and the probe that binds to the non-characteristic gene sequence comprises a sequence selected from the group consisting of: sequences shown in SEQ ID No.191, SEQ ID No.192, SEQ ID No.193, SEQ ID No.194, SEQ ID No.195, SEQ ID No.196, SEQ ID No.197, SEQ ID No.198, SEQ ID No.199 and SEQ ID No. 200.

147. The system of any of embodiments 140-146, wherein the non-characteristic gene sequence comprises a nucleic acid sequence derived from T cell receptor D and/or T cell receptor a, and the agent or device capable of amplifying the non-characteristic gene sequence comprises a sequence selected from the group consisting of: SEQ ID No.152, SEQ ID No.153, SEQ ID No.154, SEQ ID No.155, SEQ ID No.156 and SEQ ID No. 157.

148. The system of any of embodiments 140-147, wherein the non-characteristic gene sequence comprises a nucleic acid sequence derived from T cell receptor D and/or T cell receptor a, and the probe that binds to the non-characteristic gene sequence comprises a sequence selected from the group consisting of: the sequences shown in SEQ ID No.201, SEQ ID No.202, SEQ ID No.203, SEQ ID No.204, SEQ ID No.205 and SEQ ID No. 206.

149. The system of any of embodiments 140-148, wherein the non-characteristic gene sequence comprises a nucleic acid sequence derived from T cell receptor B, and the agent or device capable of amplifying the non-characteristic gene sequence comprises a sequence selected from the group consisting of: SEQ ID No.158, SEQ ID No.159, SEQ ID No.160, SEQ ID No.161, SEQ ID No.162, SEQ ID No.163, SEQ ID No.164, SEQ ID No.165, SEQ ID No.166, SEQ ID No.167, SEQ ID No.168, SEQ ID No.169 and SEQ ID No. 170.

150. The system of any of embodiments 140-149, wherein the non-characteristic gene sequence comprises a nucleic acid sequence derived from T cell receptor B, and the probe that binds to the non-characteristic gene sequence comprises a sequence selected from the group consisting of: SEQ ID No.207, SEQ ID No.208, SEQ ID No.209, SEQ ID No.210, SEQ ID No.211, SEQ ID No.212, SEQ ID No.213, SEQ ID No.214, SEQ ID No.215, SEQ ID No.216, SEQ ID No.217, SEQ ID No.218 and SEQ ID No. 219.

151. The system of any of embodiments 140-150, wherein the non-characteristic gene sequence comprises a nucleic acid sequence derived from Tal 1 and the agent or device capable of amplifying the non-characteristic gene sequence comprises a sequence selected from the group consisting of: SEQ ID NO.171 and SEQ ID NO. 172.

152. The system of any of embodiments 140-151, wherein the non-characteristic gene sequence comprises a nucleic acid sequence derived from Tal 1 and the probe that binds to the non-characteristic gene sequence comprises a sequence selected from the group consisting of: SEQ ID NO.220 and SEQ ID NO. 221.

153. The system of any one of embodiments 1-152, comprising 2 or more detection modules, wherein at least one detection module is for detecting the presence and/or proportion of leukemia cells therein prior to the subject receiving treatment, and wherein at least one detection module is for detecting the presence and/or proportion of leukemia cells therein after the subject receiving the treatment.

154. The system of any one of embodiments 1-153, wherein the detection module comprises a treatment prompting unit that prompts a subsequent treatment regimen to be employed for the respective subject based on the detected presence and/or proportion of leukemia cells in the subject.

155. The system of embodiment 154, wherein the ratio of leukemia cells in the detected subject is 1/10 ⁴ In the following, the treatment prompting unit prompts success of the treatment and no additional treatment is required.

156. The system of any of embodiments 154-155, wherein the proportion of leukemia cells in the subject tested is 1/10 ⁴ In the above cases, the treatment prompting unit prompts that the treatment is imperfect and other treatments are needed or the treatment intensity is improved.

157. The system of any of embodiments 154-156, wherein the proportion of leukemia cells in the subject tested is 1/10 ⁴ 1/10 of the above ³ In the following, the treatment prompting unit prompts that the subject can be subjected to bone marrow transplantation operation.

158. The system of any of embodiments 154-157, wherein the proportion of leukemia cells in the subject tested is 1/10 ³ In the above cases, the treatment presentation unit presents that the bone marrow transplantation operation is not suitable for the subject, and further treatment or improvement of the treatment intensity should be continued for the subject.

159. The system of embodiment 158, wherein said monitoring unit of said other therapy selected from said candidate drug screening module prompts said candidate drug to be effective or a therapy and/or drug that is similar in function and/or efficacy thereto.

Without intending to be limited by any theory, the following examples are presented merely to illustrate the manner in which the devices, methods, and systems of the present application operate and are not intended to limit the scope of the invention of the present application.

Examples

Embodiment a modeling module: establishing leukemia patient specific humanized disease model

EXAMPLE A1 cryopreservation of leukemia cells from leukemia patients:

about and 4 ml of a leukemia patient's bone marrow sample (wherein leukemia cells account for 90% or more) was collected, and 5 ml of a cell suspension was prepared in the medium and subjected to density gradient centrifugation using Ficoll. In this procedure, 5 ml of Ficoll mononuclear cell separation solution was injected into the lower layer of the cell suspension and centrifuged at 800g for 30 minutes at room temperature. After centrifugation, the cells in the middle layer were carefully collected and transferred to RPMI cell culture medium to obtain leukemia cell suspension. After that, the cell suspension was centrifuged at 300g for 8 minutes at room temperature. The precipitated cells were washed with RPMI cell culture medium and centrifuged at 300g for 8 min at room temperature to remove the supernatant. The resulting cells were suspended in fetal bovine serum containing about 10% dmso and prepared to a cell density of about 2x10 ⁷ /ml to about 5x10 ⁷ /ml of cell suspension. Cells that are not ready for immediate use are stored frozen in liquid nitrogen.

EXAMPLE A2 preparation of leukemia cells

The stored leukemia cells were rapidly lysed in example A1 at 37 ℃ and the frozen cells were suspended in RPMI medium by RPMI slow titration to resuscitate the leukemia cells obtained in example A1 from liquid nitrogen. Centrifugation at 180g for 8 min at room temperature, the supernatant was removed to give enriched cells. The cells were washed once with sterile PBS buffer and centrifuged at 80g for 8 min at room temperature. Then, the cell concentration was 4X10 prepared with PBS buffer ⁷ /ml of cell suspension.

EXAMPLE A3 removal of T cells from cell suspensions

Magnetic beads from Miltenyi

CD3 positive cells (i.e., T cells) in the cell suspension are removed. The CD3 positive T cells in the blood samples of patients with leukemia were detected by flow cytometry analysis, as shown in fig. 1, with the upper right hand corner showing that the samples contained 22.6% CD45/CD3 co-positive cells. 90 microliters of the isolated leukemia cell suspension prepared in example A2 was combined with 10 microliters of CD3 antibody coated +.>

Magnetic beads (manufactured by Miltenyi Co., ltd., SEQ ID NO: 130-050-101) were incubated for 1 hour. Passing the culture broth obtained by the co-culture through a high magnetic field screening tube, thereby binding CD3 positive cells in the screening tube by the high magnetic field. And collecting the cells which smoothly pass through the screening tube, namely, the leukemia cell sample from the patient, from which the CD3 positive T cells are removed. The results are shown in FIGS. 2 and 3, wherein FIG. 2 shows leukemia cells passed through the screening tube with CD3 positive T cells removed. Figure 3 shows CD3 positive T cells retained in the screening tube.

EXAMPLE A4 treatment of immunodeficient mice

The deficient mice selected for acute lymphoblastic leukemia ALL are NSG mice, and the deficient mice selected for acute myelogenous leukemia AML are MISTRG mice. The two types of mice were respectively subjected to X-ray irradiation at the following doses: NSG mice were 250cGy and MISTRG mice were 600cGy. The irradiation was performed by using 4MV X-rays, and the irradiation intensity was 325 cGy/min. The mice were subjected to X-ray irradiation 12-24 hours before cell inoculation, and after the irradiation was completed, the mice were returned to the feeder cages.

EXAMPLE A5 leukemia cell inoculation and monitoring of growth status in mice

Mice deficient in the immune system described in reproductive example A4 were bred in specific pathogen free (SFB) class mouse houses and selected for inoculation between 5 and 7 weeks of age. Before inoculation, 175W of infrared ray is usedThe mice were irradiated with a lamp and heated, and leukemia cells prepared in example A3, from which CD 3-positive T cells were removed, were inoculated into the mice by tail vein injection (the inoculation amount is shown in table 1), and behavior of the mice was monitored every day after inoculation. huCD45 was monitored weekly by flow cytometry starting from 2-3 weeks post inoculation ⁺ CD19 ⁺ The proportion of cells in the peripheral blood of the vaccinated mice was monitored for the implantation and growth status of leukemia cells in the mice. The monitoring initiation date was different for different patient-derived cells, as shown in table 1. As can be seen from Table 1, in each sample, a leukemia humanized disease model was successfully constructed.

TABLE 1

/>

EXAMPLE A6 isolation of humanized leukemia cells from mouse spleen

huCD45 in peripheral blood of the disease model described in example A5 ⁺ When cells reached more than 50% (see table above), the model mice were sacrificed with carbon dioxide. Spleens of the mice were isolated with sterile surgical scissors and placed in RPMI medium. The spleens of mice were crushed in a sterile metal screen and tissue fragments were collected in RPMI medium. The spleen tissue fragments were further crushed using a plastic sieve with a pore size of 40 microns to prepare 30 ml of cell suspension. 15 ml of lymph isolation (Ficoll solution) was injected into the lower layer of the cell suspension, and centrifuged at 800g for 30 minutes at room temperature. Intermediate layer cells (cell layer enriched with leukemia cells) were carefully collected and transferred to RPMI cell culture medium. The leukemia cell suspension obtained was centrifuged at 300g for 8 min at room temperature. The precipitated cells were washed with RPMI cell culture medium and centrifuged at 300g at room temperature. The cell pellet obtained after centrifugation was suspended in fetal bovine serum containing 10% dmso And is prepared to have a cell density of 2x10 ⁷ -5x10 ⁷ Cell stock/mL, which was stored frozen in liquid nitrogen for later use.

EXAMPLE B application of leukemia patient-specific humanized disease model in candidate drug screening

EXAMPLE B1 evaluation of drug efficacy Using leukemia humanized disease model

huCD45 in peripheral blood of model mice constructed ⁺ When the cells reached 1-5%, the mice were randomly grouped into vehicle control and dosing groups of 6 mice each, and a drug candidate was administered for treatment. The exemplary drug candidates selected for use and the time, amount and mode of administration corresponding to the drug are as follows:

vincristine: intraperitoneal injection, 0.5mg/kg, once a week for 4 weeks;

aminomethyl folic acid: intraperitoneal injection, 5mg/kg, once daily, weekly injections for 8 weeks;

dexamethasone: intraperitoneal injection, 15mg/kg, once daily for 4 weeks;

doxorubicin: intravenous injection, 1.5mg/kg, once a week for 4 weeks;

left-handed asparagine: intraperitoneal injection, 1000KU/kg, once daily for 4 weeks.

After administration of drug candidates to model mice, huCD45 was monitored weekly using flow cytometry ⁺ And/or CD19 ⁺ The ratio of cells in the peripheral blood cells of the mice was varied and the mice of the vehicle control group and the administration group were compared to understand the efficacy of the candidate drug for leukemia treatment.

In this example, the evaluation criteria for drug efficacy are shown in FIG. 4, where the left-hand curve portion of FIG. 4 is the proportion of human leukemia cells in the peripheral blood of mice during administration, and the right-hand legend shows the response of the candidate drug to human cells (huCD 45 ⁺ And/or CD19 ⁺ ) The effect of the ratio, the drugs were classified into six classes. It can be seen that the drug is considered to complete the disease only when it kills leukemia cells in mice and maintains the ratio below 1% for more than 2 weeksAll alleviating.

Example B2 verification of clinical relevance of disease models of the present application

In this example, clinical relevance of the disease model of the present application was verified using dexamethasone as an example, and the results are shown in table 2. The cure or alleviation of the condition, i.e. the complete or partial disappearance of leukemia cells in the blood of the patient after treatment, is an important indicator for clinical evaluation of the efficacy of the drug. As shown in table 2, for patients in the clinically resistant group, the duration of complete remission was short relative to the drug candidate sensitive group. Accordingly, the duration of complete remission following administration of the drug candidate is also shorter in the disease model to which it corresponds.

TABLE 2

Subsequently, genomic analysis was also performed on cells in the disease model of the present application. Briefly, whole genome gene expression analysis was performed on leukemia cells in the patient-derived disease model of the drug sensitive group and the drug resistant group, and the results are shown in fig. 5. In vivo dexamethasone drug experiments (FIGS. 5A and B) were first performed on disease models of the present application derived from leukemia-50 (clinically shown drug resistance) and leukemia-54 (clinically shown drug sensitivity) patients, and the methods and dosages were as described in example 7. In addition, in vivo cytotoxicity experiments were performed on leukemia cells derived from both patients leukemia-50 and leukemia-54 (FIG. 5C) by Almarblue fluorescence staining. These results all indicate that the effect of the drug tested in the disease model described herein is consistent with the effect in the patient from which the model was derived.

Thereafter, gene expression analysis was performed on cells in the disease model described in the present application using a microarray gene chip for whole gene expression. Briefly, dexamethasone was administered to the disease model, leukemia cells in mice were extracted 8 hours after administration, RNA was isolated, cDNA was obtained by reverse transcription, and cDNA was placed on a microarray gene chip for total gene expression analysis. Comparing the results with the results of the control group without administration, information of dexamethasone-induced gene expression is obtained. In fig. 5D, the reliability of the data is first verified by Principal Component Analysis (PCA); the gene expression profile of drug-sensitive and drug-resistant disease models with or without dexamethasone (Dex) administration (only a portion of the representative gene is shown, FIG. 5E) was then compared, and it was seen that the same gene expression profile in both models and the changes in expression before and after administration were significantly different. Further, extending the experiment to disease models of the present application derived from genotype-matched 5 susceptible group patients and 5 resistant group patients (fig. 5F), it was seen that the changes in gene expression were similar between drug-sensitive disease models, and the changes in gene expression were similar between drug-resistant disease models, and were completely different between these two types of models.

In addition, the patient cells and the cells in the disease model constructed therefrom were also aligned with the microarray gene chip of total gene expression (fig. 5G), and the bioinformatics study of hierarchical clustering (Hierarchy Clustering) was performed based on the total gene expression data, demonstrating that the genome of the patient-derived cells was perfectly matched with the genome of the leukemia cells in the corresponding disease model constructed. In fig. 5G, P in the patient numbers represents primary cells of the patient, X1 represents cells obtained after primary modeling, and X2 represents cells obtained after secondary modeling.

EXAMPLE C detection of the presence and/or proportion of leukemia cells in the subject

EXAMPLE C1 amplification and identification of target genes in Acute Lymphoblastic Leukemia (ALL) subjects

C1.1 acquisition of subject DNA

Prior to each subject diagnosed with acute lymphoblastic leukemia receiving treatment, a sample (e.g., a blood cell sample, or a DNA sample extracted from the cells) from the subject is obtained and serial dilutions (e.g., 10-fold, 100-fold, 1000-fold, 1-fold, 10-fold or more) of the sample are made. After the subject has been subjected to the treatment, a sample derived from the subject (e.g., a blood cell sample, or a DNA sample extracted from the cells) is again obtained.

For each subject, about 2 milliliters of its bone marrow samples were collected at a time (in this bone marrow sample, the proportion of leukemia cells was at least 90%). 5 ml of the cell suspension of the sample was prepared in the medium and subjected to density gradient centrifugation using Ficoll. In this procedure, 5 ml of Ficoll lymphocyte separation solution was injected into the lower layer of the cell suspension and centrifuged at 800g for 30 minutes at room temperature. After centrifugation, the cells of the intermediate layer were carefully collected and transferred to RPMI cell culture medium to obtain a leukemic cell suspension derived from the subject.

Thereafter, the leukemia cell suspension was centrifuged at 300g for 8 minutes at room temperature. The precipitated cells were washed with RPMI cell culture medium and centrifuged at 300g for 8 min at room temperature to remove the supernatant. The resulting cells were suspended in fetal bovine serum containing about 10% dmso and prepared to a cell density of about 2x10 ⁷ /ml to about 5x10 ⁷ /ml of cell suspension. Cells that are not ready for immediate use are stored frozen in liquid nitrogen.

And (3) separating DNA in the cell suspension by using a NucleoBond CB 20 kit (purchased from NucleoBond company and operated according to the instructions in the kit), so as to obtain the DNA of the subject. The obtained subject DNA sample is diluted as necessary.

Amplification of target genes in C1.2 subjects

(1) Target genes include: igH, igK, igL, TCRA/D, TCRB and the coding region of TCRG.

(2) The PCR reaction system used was: 10. Mu.L of amplification buffer, 200. Mu. Mol/L of each of the 4 dNTPs, 100pmol/L of primer, 2. Mu.g of template (subject-derived DNA obtained in example C1.1), 2.5. Mu.g of TaqDNA polymerase, 1.5mmol/L of Mg ²⁺ And double distilled water to make up to a volume of 100 μl. Among them, reagents required for performing the PCR reaction are purchased from Takara corporation.

(3) The PCR conditions are shown in the following table:

(4) For the different target genes, PCR was performed using different primer combinations:

a) For samples derived from B-cell acute lymphoblastic leukemia (B-ALL) subjects, 24 sets of primer combinations were used in total, wherein:

for the target gene IgH, the primer combinations shown in table 3 were used:

TABLE 3 Table 3

	Forward primer name	Reverse primer name
			Group
1	VH1/7	JH cons
			Group
2	VH2	JH cons
			Group
3	VH3	JH cons
			Group
4	VH4	JH cons
			Group
5	VH5	JH cons
			Group
6	VH6	JH cons
			Group
7	DH1/4/5/7	JH cons
			Group
8	DH2	JH cons
			Group
9	DH3	JH cons
			Group
10	DH6	JH cons

For the target gene IgK, the primer combinations shown in table 4 were used:

TABLE 4 Table 4

For the target gene TCR, the primer combinations shown in table 5 were used:

TABLE 5

b) For samples derived from T-cell acute lymphoblastic leukemia (T-ALL) subjects, 16 primer combinations were used in total, wherein:

For the target gene TCR, the primer combinations shown in table 6 were used:

TABLE 6

/>

c) The specific nucleotide sequences of the primers are shown in Table 7:

TABLE 7

/>

/>

/>

Isolation of PCR amplification products of the C1.3 target Gene:

the PCR amplification product obtained in example C1.2 was subjected to gel electrophoresis separation using 2% (w/w) agarose gel at 100V for 2 hours.

FIG. 7 reflects the results of gel electrophoresis of amplification of target gene IgH using a combination of VH3 and JH con primers. In FIG. 7, the positive control group is an amplified product of a PCR reaction using a cell line (e.g., B-cell non-Hodgkin's lymphoma (B-NHL) cell line) rearranged by a known IgH, as a template, extracted according to example C1.1, and showing a distinct and clear DNA band around 400bp, whereas in the 4 subjects shown, similar DNA bands were shown in both

subjects

2 and 3. This indicates that this band is specific for both subjects.

Similarly, by comparing the results of gel electrophoresis analysis of PCR amplification products obtained by amplification against 30 target gene regions (including 10 IgH regions, 4 IgK regions and 16 TCR regions as shown in tables 1-4 of the present application), PCR amplification products specific for each subject (i.e., amplification products characteristic of leukemia cells of the subject) were obtained.

Since leukemia is generally a monoclonal disease, essentially all leukemia cells are derived from a genetically altered cell clone. Based on the diversity of cells, normal humans do not develop specific immunoglobulin rearrangements, whereas leukemia cell populations exhibit specificity for a specific gene rearrangement, i.e., the specific region is greatly amplified, revealing a DNA amplification product band specific to a specific subject.

EXAMPLE C2 analysis of a subject for amplification products characteristic of leukemia cells

C2.1 Gene sequencing

Recovering the characteristic amplification product of the leukemia cells of each subject identified in example C1.3, and then carrying out gene sequencing on the obtained characteristic amplification product of the leukemia cells of the subjects by adopting a method of 'GeneScanning', thereby obtaining a specific nucleotide sequence of the characteristic amplification product of the leukemia cells of each subject.

Specific procedures for "GeneScanning" are described in the literature Linke B, bolz I, fayyazi A, von Hofen M, pott C, bertram J et al automated high resolution PCR fragment analysis for identification of clonally rearranged immunoglobulin heavy chain genes Leukemia 1997;11:1055-1062. Section "Cloning and DNA sequencing".

Analysis of results of C2.2 Gene sequencing

The nucleotide sequence of the amplification product characteristic of leukemia cells of each subject obtained in example C2.1 was aligned with the nucleotide sequence of the corresponding target gene possessed by normal persons without leukemia in the NCBI database using BLAST tool (see BLAST. NCBI. Nrm. Nih. Gov), thereby identifying which of the nucleotide sequences of the amplification product characteristic of leukemia cells of each subject are conserved sequences (i.e., also present in other subjects), which are the gene sequences characteristic of leukemia cells of the subject (i.e., useful for characterizing and identifying leukemia cells of the subject, and are substantially absent in other subjects or non-leukemia cells).

The BLAST results of the characteristic amplification products of 400bp in fragment length recovered from subject 2 in FIG. 7 are shown in FIG. 8. In fig. 8, the sequences in the boxes represent conserved sequences (i.e., also present in other subjects), while the nucleotide sequence between the two boxes is the sequence of a gene characteristic of the leukemia cells of the subject. As can be seen from fig. 8, the characteristic gene sequence of leukemia cells of the subject was ACGGGGGCCGTAG.

EXAMPLE C3 analysis of the characteristic Gene sequences of leukemia cells

C3.1 qPCR detection of a Gene sequence characteristic of leukemia cells in a subject

(1) Based on the characteristic gene sequences (for example, the gene sequence ACGGGGGCCGTAG as an example) of leukemia cells of each subject obtained by the analysis in example C2.2, a personalized amplification primer set capable of specifically amplifying it was designed.

(2) Performing fluorescent quantitative PCR amplification reaction

The qPCR reaction was performed by combining the primers designed in step (1) with probes specifically binding to non-characteristic gene sequences and primer sets specifically amplifying non-characteristic gene sequences, i.e., using primers designed for the characteristic gene sequences of leukemia cells of a specific subject, non-characteristic gene amplification primers (as shown in table 8) and fluorescent probes (as shown in table 8) suitable for all subjects. In qPCR, one primer of each pair is specific for a gene sequence characteristic of leukemia cells of a particular subject, while the other primer is directed against a non-characteristic gene of all subjects, and the fluorescent probe used is also directed against a non-characteristic gene of all subjects.

TABLE 8

/>

/>

(3) The qPCR reaction system is as follows: 2. Mu.L of DNA template (i.e., the subject leukemia cell DNA obtained in example 1.1), 0.3. Mu.L of forward primer, 0.3. Mu.L of reverse primer, 0.4. Mu.L of fluorescent probe, 10. Mu. L Taqman Universal PCR Master Mix and 7. Mu.L of dH ₂ O。

(4) qPCR reaction conditions are shown in the following table:

(5) qPCR reaction results

The qPCR reactions were performed separately as described in this example using serial dilutions (e.g., 10-fold, 100-fold, 1000-fold, 1-fold or 10-fold) of the pre-treatment subject DNA samples obtained in step (1) as templates, thereby creating a series of standard amplification curves corresponding to the concentrations of each of the different DNA samples.

In addition, the post-treatment assay results were obtained by performing qPCR reactions as described in this example using the DNA sample of the subject obtained in step (1) as a template. Comparing the post-treatment measurement result with the standard amplification curve to judge the proportion of the leukemia cell characteristic gene sequence in the subject after treatment, and judging the proportion A of the leukemia cells in the subject after treatment according to the proportion.

The results of qPCR amplification of the exemplary gene sequence ACGGGGGCCGTAG described in example C2 using IgH primer (GCGCGRAACAGGTACTGG (SEQ ID NO: 126) and its corresponding probe TCTCCTATACTACACGCTCT) (SEQ ID NO: 175) and patient-specific primer (CCGTGGTGTCACA (SEQ ID NO: 222)) from subject 2 of Table 6 are shown in FIG. 9. The subject's DNA sample after 15 days of treatment was used as a template, and qPCR results were obtained as indicated by the arrow on "15 th day" in FIG. 9, and the results were compared with a series of standard curves (leukemia cell DNA ratios of 1/10, respectively, in FIG. 9 ² 、1/10 ³ 、1/10 ⁴ 、5/10 ⁵ The results obtained by performing the qPCR reaction described in this example were labeled 10, respectively ^-1 、10 ^-2 、10 ^-3 、10 ^-4 5x10 ^-5 ) By comparison, it can be seen that the subject contains leukemia cells in a proportion of about 1/10 after 15 days of treatment ² 。

Similarly, the residual leukemia cell fraction in all subjects can be detected using the methods and systems described herein.

C3.2 Analysis of results of qPCR detection

The proportion a of leukemic cells in the subject as determined in example C3.1 can be used to guide a subsequent treatment regimen (as shown in table 9): at A>1/10 ⁴ The magnitude of the ratio a may be further analyzed to determine whether it is suitable for bone marrow transplantation in the subject. For example, if 1/10 ⁴ <A<1/10 ³ It may be indicated that a bone marrow transplant procedure may be performed on the subject; if A>1/10 ³ It can be shown that the subject has a large number of leukemia cells, and that the likelihood of leukemia recurrence is greatly increased due to the high residual leukemia cells, and therefore the subject should be considered unsuitable for bone marrow transplantation surgery and should continue to receive a new round of therapy or increase the intensity of therapy

TABLE 9

It can be seen that according to the results of fig. 9, the subject should also continue to receive treatment or increase the intensity of treatment.

Fig. 10 and 11 further illustrate the leukemia diagnosis and treatment system according to the present application reflected in the above-described embodiments a to C. Specifically, fig. 10 is a schematic diagram of an example of an operation flow of the leukemia diagnosis and treatment system described in the present application. For example, a subject is diagnosed as having leukemia after going to a hospital for a visit, at which time a subject-specific humanized disease model is constructed by a modeling module of the leukemia diagnostic system; thereafter the subject is subjected to a treatment conventional and standardized in the art, and after the treatment is finished, the presence and/or proportion of leukemia cells of the subject are detected at the molecular level by means of a detection module of the leukemia diagnosis and treatment system; if the test results indicate that the subject has a greater chance of relapsing leukemia, or that the proportion of leukemia cells is too high, then it indicates that the subject has developed resistance to the conventional, standardized treatment described above; it can be seen that in such cases, an effective drug specific to the subject is required, and therefore, the candidate drug screening module of the leukemia diagnosis and treatment system is utilized to screen candidate drugs (chemotherapeutic drugs and targeted drugs) by using a subject-specific humanized disease model, and according to the grade results of the candidate drugs, selecting a candidate drug of grade 5 or grade 6 to guide clinical treatment, so that the subject receives treatment specific to the screening drug; after a period of treatment, if the molecular level of the detection module of the leukemia diagnosis and treatment system shows that the proportion of leukemia cells detected by the subject is very low or none at all, the screened medicine obtained by the leukemia diagnosis and treatment system is considered to have very obvious curative effect on the subject.

Fig. 11 is a schematic diagram of an example of the relationship between functional units in the leukemia diagnosis and treatment system according to the present application. The leukemia diagnosis and treatment system can comprise a modeling module, a detection module and a candidate drug screening module, wherein the detection module can comprise 2 or more. Each module contains several units that perform different functions.

In particular, the modeling module may comprise a sample unit comprising a leukemia cell suspension derived from the subject, a radiation unit comprising a radioactive treatment device, and an inoculation unit for inoculating the leukemia cell suspension to an immunodeficient mouse treated with the radiation unit.

The modeling module may further comprise a separation unit capable of separating the subject sample. Before being processed by the sample unit, it may be processed by the separation unit. The modeling module may further comprise a T cell removal unit that removes T cells in a sample derived from a non-T cell leukemia subject to obtain the leukemia cell suspension. The T cell removal unit may be used before treatment with the sample unit, or after treatment with the separation unit and before treatment with the sample unit. The modeling module may also include an infrared illumination and heating unit that illuminates the individual with an infrared light source. Before being treated by the radiation unit, it may be treated by the infrared irradiation and heating unit. The modeling module may further comprise a monitoring unit that monitors the growth of leukemia cells from the subject in the vaccinated immunodeficient mice. After treatment by the inoculation unit, treatment by the monitoring unit may be performed. The modeling module may further include a spleen processing unit that processes the spleen of the disease model. After treatment by the inoculation unit, or after treatment by the inoculation unit and before treatment by the monitoring unit, may be treated by the monitoring unit. The modeling module may also include liquid nitrogen. After treatment by the inoculation monitoring unit, it may be treated with liquid nitrogen.

The detection module may comprise an amplification unit that specifically amplifies the target gene to obtain a target-specific amplified product. The detection module may further comprise an identification unit capable of identifying a characteristic amplification product of the target-specific amplification product derived from leukemia cells of the subject. After treatment by the amplification unit, it may be treated by the identification unit. The detection module may further comprise an analysis unit capable of obtaining a gene sequence characteristic of leukemia cells specific to the subject. After treatment by the amplification unit, it may be treated by the identification unit. The detection module may further comprise a recognition unit capable of determining the presence and/or proportion of residual leukemia cells in the subject. After being processed by the analysis unit, it may be processed by the identification unit. The detection module may further comprise a treatment prompting unit capable of prompting a subsequent treatment regimen to be adopted for the respective subject according to the detected presence and/or proportion of leukemia cells in the subject. After being processed by the identification unit, the treatment prompting unit can be used for processing.

The drug candidate screening module may include a first drug candidate set comprising one or more drugs, a second drug candidate set comprising one or more drugs. The candidate drug screening module may further comprise a monitoring unit that monitors the growth of leukemia cells from the subject in the vaccinated immunodeficient mice. After administration of the first drug candidate set and the second drug candidate set, they may be processed by the monitoring unit.

The foregoing detailed description is provided by way of explanation and example and is not intended to limit the scope of the appended claims. Numerous variations of the presently exemplified embodiments will be apparent to those of ordinary skill in the art and remain within the scope of the appended claims and equivalents thereof.

Claims

1. A system for conducting leukemia diagnostics, comprising:

c) A candidate drug screening module; wherein the modeling module comprises:

a1 Sample sheetA cell comprising a suspension of leukemia cells derived from said subject, said suspension having a density of leukemia cells of 2x10 ⁷ Ml to 5x10 ⁷ /ml；

a7 A monitoring unit for monitoring the growth of leukemia cells from the subject in the vaccinated immunodeficient mice;

Wherein the at least one detection module comprises:

b1 An amplification unit comprising a reagent capable of specifically amplifying a target gene to obtain a target-specific amplification product;

wherein the target gene comprises the following genes, fragments thereof, or variants thereof: igH, igK, T cell receptor D and T cell receptor G;

wherein, the target gene is IgH gene rearranged reagent comprising the following primer combination:

1) Forward primer: DH1, DH4, DH5 and DH7, the sequences are shown as SEQ ID NO.21, SEQ ID NO.27, SEQ ID NO.29 and SEQ ID NO.33 respectively, the reverse primer: JH ons, the sequence of which is shown as SEQ ID NO. 19;

2) Forward primer: DH2, sequence shown as SEQ ID NO.23, reverse primer: JH ons, the sequence of which is shown as SEQ ID NO. 19;

wherein, the target gene is IgK gene rearranged reagent comprising the following primer combination:

1) Forward primer: intron RSS, SEQ ID NO.43 sequence, reverse primer: kdel, sequence shown as SEQ ID NO. 45;

wherein the target gene is a gene of a T cell receptor region comprising: t cell receptor D and T cell receptor G; and the reagent capable of specifically amplifying the target gene comprises the following primer combination:

1) Forward primer: vg1, sequence shown as SEQ ID No.47, reverse primer: jg1 and Jg2, the sequences are shown as SEQ ID NO.55 and SEQ ID NO. 57;

2) Forward primer: vg2, sequence shown as SEQ ID No.49, reverse primer: jg1 and Jg2, the sequences are shown as SEQ ID NO.55 and SEQ ID NO. 57;

3) Forward primer: vd1, sequence shown as SEQ ID NO.59, reverse primer: jd1, the sequence is shown as SEQ ID NO. 69;

4) Forward primer: vd2, sequence shown as SEQ ID NO.61, reverse primer: jd1, the sequence is shown as SEQ ID NO. 69;

5) Forward primer: vd3, sequence shown as SEQ ID NO.63, reverse primer: jd1, SEQ ID NO. 69.

2. The system of claim 1, the drug candidate screening module comprising a first drug candidate set and a second drug candidate set;

3. The system of claim 1, the candidate drug screening module further comprising a monitoring unit for monitoring the growth of leukemia cells from the subject in the vaccinated, immunodeficient mice, the monitoring unit comprising reagents and means for detecting the proportion of hucd45+, hucd19+, hucd3+, and/or hucd33+ cells in the peripheral blood of the mice, and the monitoring unit being configured to indicate administration of a candidate drug to the mice when the proportion reaches 1% -5%, to continuously monitor the change in the proportion of the hucd45+, hucd19+, hucd3+, and/or hucd33+ cells in the peripheral blood cells of the mice after drug administration, and to indicate the efficacy of the candidate drug based on the change, and to indicate the efficacy of the candidate drug when the proportion of the hucd45+, hucd19+, hucd3+, and/or hucd33+ cells in the peripheral blood cells of the mice remains below 1% and is maintained for at least 2 weeks after drug administration.

4. The system of claim 1, wherein the modeling module further comprises:

a4 A separation unit comprising a monocyte separation liquid, which is Ficoll, for centrifuging leukemia cells of the subject, which is density gradient centrifugation,

a5 A T cell removal unit comprising magnetic beads comprising CD3 antibodies for removing T cells in a sample derived from a non-T cell leukemia subject, the T cells being removed as CD3 positive T cells, thereby obtaining the leukemia cell suspension comprising RPMI cell culture medium,

a6 An infrared irradiation and heating unit for irradiating and heating the immunodeficient mice with an infrared lamp,

a8 A spleen processing unit including a separating element by which the spleen of the mouse can be separated when the ratio of hucd45+, hucd19+, hucd3+, and/or hucd33+ cells in the inoculated peripheral blood of the mouse is at least 50%, a disrupting element by which the spleen of the isolated mouse is disrupted to obtain spleen cells, and a suspending element by which the spleen cells are prepared as the leukemia cell suspension.

5. The system of claim 2, wherein the first drug candidate group comprises one or more drugs selected from the group consisting of: vincristine, dexamethasone, L-asparaginase, topotecan, clofarabine, carfilzomib, temsirolimus, dasatinib, bortezomib, CD19 antibody, all-trans retinoic acid, doxorubicin, carbamate, SAHA, sunitinib, cyclophosphamide and valphenamide,

wherein the vincristine is suitable for administration to the subject-specific humanized disease model according to the following requirements: is suitable for being administrated by intraperitoneal injection, the dosage of each administration is 0.5mg/kg, the administration is once weekly and the administration lasts for 3 to 6 weeks,

wherein the aminomethyl folate is suitable for administration to the leukemia humanized disease model according to the following requirements: is suitable for being applied by intraperitoneal injection, the application amount is 3-6mg/kg each time, the application is carried out once every two weeks, and the application is continued for 6-10 weeks,

wherein the dexamethasone is suitable for administration to the leukemia humanized disease model according to the following requirements: is suitable for being applied by intraperitoneal injection, the application amount is 10-20mg/kg each time, the application is carried out once daily for 3-6 weeks,

wherein said doxorubicin is suitable for administration to said leukemia humanized disease model according to the following requirements: is suitable for intravenous injection, and each time is 0.5-3mg/kg, once a week for 3-6 weeks,

Wherein the levoasparaginase is suitable for administration to the leukemia humanized disease model according to the following requirements: is suitable for being applied by intraperitoneal injection, the application amount is 500-2000KU/kg each time, once daily and continuously for 3-6 weeks,

wherein the topotecan is suitable for administration to the leukemia humanized disease model according to the following requirements: is suitable for being applied by intraperitoneal injection, the dosage of each application is 0.1-5mg/kg, the application is carried out once daily for 2-8 weeks, the application is stopped for one week after two weeks of administration,

wherein the clofarabine is adapted for administration to the leukemia humanized disease model according to the following requirements: is suitable for being applied by intraperitoneal injection, the application amount is 10-100mg/kg each time, the application is carried out once daily for 3-6 weeks,

wherein the carfilzomib is adapted for administration to the leukemia humanized disease model according to the following requirements: is suitable for intravenous injection, and each time is 0.1-10mg/kg, twice weekly for 3-6 weeks,

wherein the temsirolimus is suitable for administration to the leukemia humanized disease model according to the following requirements: is suitable for being applied by intraperitoneal injection, the application amount is 5-50mg/kg each time, once daily and continuously for 1-3 weeks,

Wherein the dasatinib is suitable for administration to the leukemia humanized disease model according to the following requirements: is suitable for oral administration, each time at an amount of 5-50mg/kg, once daily for 2-6 weeks,

wherein the bortezomib is adapted for administration to the leukemia humanized disease model according to the following requirements: is suitable for being applied by intraperitoneal injection, the application amount is 0.1-20mg/kg each time, the application is carried out twice a week for 4-8 weeks,

wherein the SAR3419 is adapted for administration to the leukemia humanized disease model according to the following requirements: is suitable for being applied by intraperitoneal injection, the application amount is 0.5-50mg/kg each time, once a week and continuously for 4-8 weeks,

wherein the all-trans retinoic acid is suitable for administration to the leukemia humanized disease model according to the following requirements: is suitable for being applied by intraperitoneal injection, the application amount is 0.5-10mg/kg each time, once a week and continuously for 2-6 weeks,

wherein the SAHA is adapted for administration to the leukemia humanized disease model according to the following requirements: is suitable for being applied by intraperitoneal injection, the application amount is 100-500mg/kg each time, once daily and continuously for 3-6 weeks,

wherein the sunitinib is suitable for administration to the leukemia humanized disease model according to the following requirements: is suitable for oral administration, each time at an amount of 10-100mg/kg, once daily for 2-6 weeks,

Wherein the cyclophosphamide is suitable for administration to the leukemia humanized disease model according to the following requirements: is suitable for being applied by intraperitoneal injection, the application amount is 30-300mg/kg each time, once daily and continuously for 2-6 weeks,

wherein said vitamin a carboxamide is suitable for administration to said leukemia humanized disease model according to the following requirements: is suitable for being applied by intraperitoneal injection, and the application amount is 20-200mg/kg each time, once daily and continuously for 2-6 weeks.

6. The system of claim 2, the protein kinase inhibitor in the second drug candidate group comprising one or more drugs selected from the group consisting of: AZD8055, MLN0128, GSK690693, MK-2206, SAR245408, rapamycin, MLN0128, selumetinib, AZD6244, PCI-32765, ibrutinib, SGI-1776, dinaciclib, VS-4718, sorafenib, sunitinib and AZD1480,

the apoptosis modulator in the second drug candidate group comprises one or more drugs selected from the group consisting of: ABT-263 (naviteclmax), ABT-199 (venetoclax), LCL161 and birinaptant,

the DNA breaking agent in the second drug candidate group comprises one or more drugs selected from the group consisting of: PR-104, cytarabine (CPX-351), daunorubicin (Vyxeos) and temozolomide,

The cell division inhibitor in the second drug candidate group comprises one or more drugs selected from the group consisting of: eribulin, ispinesib and alilerib,

the MDM2 class oncogene inhibitor of the second drug candidate group comprises one or more drugs selected from the group consisting of: MK-8242 (SCH 900242) and RG7112,

the antibody class drug in the second drug candidate group is SAR3419,

the other chemotherapeutic agent in the second candidate drug group comprises one or more drugs selected from the group consisting of: alvershimycin, AT13387, PF-03084014, RO-4929097, MLN4924, PG11047, CX-5461, BMN-673, selinexor, bortezomib, curaxin and CBL0137.

7. The system of claim 1, wherein the detection module further comprises an identification unit comprising reagents and means for identifying the target-specific amplification product, thereby identifying a characteristic amplification product of the target-specific amplification product derived from leukemia cells of the subject, the identification unit comprising reagents and means required for gel electrophoresis separation of the target-specific amplification product,

the detection module further comprises an analysis unit comprising reagents and means for analyzing the characteristic amplification products, thereby obtaining a characteristic gene sequence specific for leukemia cells of the subject,

The detection module further comprises a recognition unit comprising reagents and means capable of specifically recognizing and/or amplifying the characteristic gene sequence of the subject, thereby judging the presence and/or proportion of residual leukemia cells in the subject, the recognition unit comprising reagents or means for specifically amplifying a characteristic gene sequence specific for leukemia cells of the subject, the recognition unit further comprising probes bound to a non-characteristic gene sequence comprising nucleic acid sequences derived from one or more genes of the group: igH, igK, T cell receptor A, T cell receptor D, T cell receptor B, T cell receptor G and Tal 1,

wherein the nucleic acid sequence of IgH is selected from the group consisting of: SEQ ID NO.124, SEQ ID NO.125, SEQ ID NO.126, SEQ ID NO.127, SEQ ID NO.128, SEQ ID NO.129, SEQ ID NO.130 and SEQ ID NO.131,

wherein the nucleic acid sequence of IgH is selected from the group consisting of: sequences shown in SEQ ID No.173, SEQ ID No.174, SEQ ID No.175, SEQ ID No.176, SEQ ID No.177, SEQ ID No.178, SEQ ID No.179 and SEQ ID No.180,

Wherein the nucleic acid sequence of IgK is selected from the group consisting of: a sequence shown in SEQ ID No.132, SEQ ID No.133, SEQ ID No.134, SEQ ID No.135, SEQ ID No.136, SEQ ID No.137, SEQ ID No.138, SEQ ID No.139, SEQ ID No.140 and SEQ ID No.141, or a sequence selected from the group consisting of: sequences shown in SEQ ID No.181, SEQ ID No.182, SEQ ID No.183, SEQ ID No.184, SEQ ID No.185, SEQ ID No.186, SEQ ID No.187, SEQ ID No.188, SEQ ID No.189 and SEQ ID No.190,

wherein the nucleic acid sequence derived from T cell receptor G is selected from the group consisting of: a sequence shown in SEQ ID No.142, SEQ ID No.143, SEQ ID No.144, SEQ ID No.145, SEQ ID No.146, SEQ ID No.147, SEQ ID No.148, SEQ ID No.149, SEQ ID No.150, and SEQ ID No.151, or a sequence selected from the group consisting of: sequences shown in SEQ ID No.191, SEQ ID No.192, SEQ ID No.193, SEQ ID No.194, SEQ ID No.195, SEQ ID No.196, SEQ ID No.197, SEQ ID No.198, SEQ ID No.199 and SEQ ID No.200,

Wherein the nucleic acid sequence derived from T cell receptor D and/or T cell receptor a is selected from the group consisting of: a sequence shown in SEQ ID No.152, SEQ ID No.153, SEQ ID No.154, SEQ ID No.155, SEQ ID No.156 and SEQ ID No.157, or a sequence selected from the group consisting of: sequences shown in SEQ ID No.201, SEQ ID No.202, SEQ ID No.203, SEQ ID No.204, SEQ ID No.205 and SEQ ID No.206,

wherein the nucleic acid sequence derived from T cell receptor B is selected from the group consisting of: a sequence shown in SEQ ID No.158, SEQ ID No.159, SEQ ID No.160, SEQ ID No.161, SEQ ID No.162, SEQ ID No.163, SEQ ID No.164, SEQ ID No.165, SEQ ID No.166, SEQ ID No.167, SEQ ID No.168, SEQ ID No.169, and SEQ ID No.170, or a sequence selected from the group consisting of: SEQ ID NO.207, SEQ ID NO.208, SEQ ID NO.209, SEQ ID NO.210, SEQ ID NO.211, SEQ ID NO.212, SEQ ID NO.213, SEQ ID NO.214, SEQ ID NO.215, SEQ ID NO.216, SEQ ID NO.217, SEQ ID NO.218 and SEQ ID NO.219,

Wherein the nucleic acid sequence of Tal 1 is selected from the group consisting of: the sequence shown in SEQ ID NO.171 and SEQ ID NO.172, or a sequence selected from the group consisting of: SEQ ID NO.220 and SEQ ID NO. 221.

8. The system of claim 7, comprising 2 or more detection modules, wherein at least one detection module is for detecting the presence and/or proportion of leukemia cells therein prior to the subject receiving treatment, and wherein at least one detection module is for detecting the presence and/or proportion of leukemia cells therein after the subject receiving the treatment.

9. The system of claim 1, wherein the detection module comprises a treatment prompting unit that prompts a subsequent treatment regimen to be applied to the respective subject based on the presence and/or proportion of leukemia cells in the detected subject, wherein the proportion of leukemia cells in the detected subject is 1/10 ⁴ In the following, the treatment prompting unit prompts the success of the treatment without additional treatment, wherein when the ratio of leukemia cells in the detected subject is 1/10 ⁴ In the above cases, the treatment prompting unit prompts that the treatment is imperfect and other treatments are needed or the intensity of the treatment is improved, wherein when the ratio of leukemia cells in the detected subjects is 1/10 ⁴ 1/10 of the above ³ In the following, the treatment prompting unit prompts that the subject can be subjected to bone marrow transplantation operation, wherein when the ratio of leukemia cells in the detected subject is 1/10 ³ In the above cases, the treatment prompting unit prompts that the bone marrow transplantation operation is not suitable for the subject, and further treatment or improvement of treatment intensity should be continued on the subject, wherein the further treatment is selected from the candidate drugs for which the monitoring unit of the candidate drug screening module prompts to be effective, or treatment sums or benefits similar to the functions and/or effects thereofOr a drug.

10. The system of claim 1, wherein the leukemia comprises B-cell acute lymphoblastic leukemia and/or T-cell acute lymphoblastic leukemia.