CN115989242A

CN115989242A - Mesothelin-targeted antibody, chimeric antigen receptor and application thereof

Info

Publication number: CN115989242A
Application number: CN202180005566.1A
Authority: CN
Inventors: 赵阳兵; 朱庚振
Original assignee: Shanghai Youtijisheng Biomedical Co ltd
Current assignee: Shanghai Youtijisheng Biomedical Co ltd
Priority date: 2021-08-16
Filing date: 2021-08-16
Publication date: 2023-04-18
Also published as: WO2023019396A1

Abstract

The present invention discloses anti-mesothelin antibodies and antigen-binding fragments, chimeric antigen receptors ("CARs") ("mesothelin CARs") having such anti-mesothelin antibodies and antigen-binding fragments, and genetically engineered immune effector cells having such mesothelin CARs. The invention also provides polynucleotides encoding anti-mesothelin antibodies and antigen-binding fragments, and mesothelin CARs. The invention also provides compositions comprising anti-mesothelin antibodies and antigen binding fragments, and a mesothelin CAR. The invention also relates to the anti-mesothelin antibodies and antigen binding fragments, and the use of genetically engineered immune effector cells having such mesothelin CARs in the treatment of cancer.

Description

Mesothelin-targeted antibody, chimeric antigen receptor and application thereof

1. Field of the invention

The present invention relates to molecular biology, cell biology and immunooncology. In particular, provided herein include anti-mesothelin antibodies, chimeric antigen receptors ("mesothelin CARs" comprising such anti-mesothelin antibodies, the chimeric antigen receptor being a CAR), genetically engineered immune effector cells expressing such mesothelin CARs, and uses thereof in the treatment of tumors or cancers.

2. Background of the invention

Cellular immunotherapy is a potentially therapeutic approach to tumor therapy. T cells and other immune cells can be modified to target tumor antigens by introducing genetic material encoding artificial or synthetic receptors for the antigens that are specific for the particular antigen, such as Chimeric Antigen Receptors (CARs). Targeted T cell therapy using CARs (CART) has recently achieved clinical success in treating certain hematologic malignancies. However, there are several obstacles to applying CAR-expressing T cell therapy to solid tumors that must be overcome to gain clinical benefit. Thus, there is a need for new therapeutic strategies to design CARs for the treatment of cancer (especially solid tumors) that can induce potent tumor eradication with minimal toxicity and immunogenicity. Mesothelin is expressed in a variety of human cancers, such as mesothelioma, pancreatic cancer, and ovarian cancer. However, current therapies targeting mesothelin have met with limited success. Thus, other mesothelin-targeted therapeutic regimens represent an unmet need. The present invention provides compositions and methods that meet these needs and have other related advantages.

3. Summary of the invention

The present invention provides an antibody or antigen-binding fragment thereof that specifically binds mesothelin (e.g., human mesothelin), comprising: (a) A light chain variable region (VL) comprising (1) a light chain CDR1 (VL CDR 1) having an amino acid sequence selected from the group consisting of SEQ ID NOs: 1-15; (2) A light chain CDR2 (VL CDR 2) having an amino acid sequence selected from the group consisting of SEQ ID NOs 16-29; and (3) a light chain CDR3 (VL CDR 3) having an amino acid sequence selected from the group consisting of SEQ ID NOs 30-44; or a variant thereof having up to about 5 amino acid substitutions, additions and/or deletions in the VL CDRs; and/or (b) a heavy chain variable region (VH) comprising (1) a heavy chain CDR1 (VH CDR 1) having an amino acid sequence selected from the group consisting of SEQ ID NOS: 45-57; (2) A heavy chain CDR2 (VH CDR 2) having an amino acid sequence selected from the group consisting of SEQ ID NOs 58-70; and (3) a heavy chain CDR3 (VH CDR 3) having an amino acid sequence selected from the group consisting of SEQ ID NOS 71-85; or a variant thereof having up to about 5 amino acid substitutions, additions and/or deletions in the VH CDRs.

In some embodiments of the antibodies and antigen-binding fragments provided herein, (a) the VL CDR1, CDR2, and CDR3 have (1) the amino acid sequences set forth in

SEQ ID NOs

1, 16, and 30, respectively; (2) the amino acid sequences shown in SEQ ID NO 2, 17 and 31; (3) amino acid sequences shown in SEQ ID NOS: 3, 18 and 32; (4) the amino acid sequences shown in SEQ ID NOS: 4, 19 and 33; (5) the amino acid sequences shown in SEQ ID NOS: 5, 20 and 34; (6) the amino acid sequences shown in SEQ ID NOS: 6, 21 and 35; (7) the amino acid sequences shown in SEQ ID NOS: 7, 22 and 36; (8) the amino acid sequences shown in SEQ ID NOS: 8, 23 and 37; (9) the amino acid sequences shown in SEQ ID NOS: 2, 24 and 38; (10) the amino acid sequences shown in SEQ ID NO 10, 25 and 39; (11) the amino acid sequences shown as SEQ ID NOS: 11, 26 and 40; (12) the amino acid sequences shown as SEQ ID NOS: 12, 27 and 41; (13) the amino acid sequences shown as SEQ ID NOS: 13, 28 and 42; (14) the amino acid sequences shown as SEQ ID NOS: 14, 29 and 43; or (15) the amino acid sequences shown in SEQ ID NOS: 15, 18 and 44; or a variant thereof having up to about 5 amino acid substitutions, additions and/or deletions in the VL CDR; and/or, (b) said VH CDR1, CDR2 and CDR3 have (1) the amino acid sequences shown in SEQ ID NO:45, 58 and 71, respectively; (2) the amino acid sequences shown as SEQ ID NOS: 46, 59 and 72; (3) the amino acid sequences shown as SEQ ID NOS: 47, 60 and 73; (4) the amino acid sequences shown as SEQ ID NOS: 48, 61 and 74; (5) the amino acid sequences shown in SEQ ID NOS: 49, 62 and 75; (6) the amino acid sequences shown as SEQ ID NOS: 50, 63 and 76; (7) amino acid sequences shown as SEQ ID NOS: 51, 64 and 77; (8) the amino acid sequences shown as SEQ ID NOS 52, 65 and 78; (9) amino acid sequences shown as SEQ ID NOS: 53, 66 and 79; (10) the amino acid sequences shown as SEQ ID NOS: 48, 61 and 80; (11) amino acid sequences shown as SEQ ID NOS: 54, 67 and 81; (12) the amino acid sequences shown as SEQ ID NOS: 53, 66 and 82; (13) the amino acid sequences shown in SEQ ID NOS: 55, 68 and 83; (14) the amino acid sequences shown as SEQ ID NOS: 56, 69 and 84; or (15) the amino acid sequences shown in SEQ ID NOS: 57, 70 and 85; or a variant thereof, said variant having up to about 5 amino acid substitutions, additions and/or deletions in said VH CDR.

In some embodiments of the antibodies and antigen-binding fragments provided herein, (1) the VL CDR1, CDR2, and CDR3 have the amino acid sequences set forth in

SEQ ID NOs

1, 16, and 30, respectively; and/or the VH CDR1, CDR2 and CDR3 have amino acid sequences shown in SEQ ID NO 45, 58 and 71 respectively; (2) The VL CDR1, CDR2 and CDR3 have amino acid sequences shown in SEQ ID NO 2, 17 and 31, respectively; and/or, the VH CDR1, CDR2 and CDR3 have amino acid sequences shown in SEQ ID NO 46, 59 and 72, respectively; (3) The VL CDR1, CDR2 and CDR3 have amino acid sequences shown in SEQ ID NO 3, 18 and 32 respectively; and/or the VH CDR1, CDR2 and CDR3 have amino acid sequences shown in SEQ ID NO 47, 60 and 73 respectively; (4) The VL CDR1, CDR2 and CDR3 have amino acid sequences shown in SEQ ID NO 4, 19 and 33 respectively; and/or, the VH CDR1, CDR2 and CDR3 have amino acid sequences shown in SEQ ID NO 48, 61 and 74 respectively; (5) The VL CDR1, CDR2 and CDR3 have amino acid sequences shown in

SEQ ID NO

5, 20 and 34 respectively; and/or the VH CDR1, CDR2 and CDR3 have amino acid sequences shown in SEQ ID NO. 49, 62 and 75 respectively; (6) The VL CDR1, CDR2 and CDR3 have amino acid sequences shown in SEQ ID NO 6, 21 and 35 respectively; and/or the VH CDR1, CDR2 and CDR3 have amino acid sequences shown in SEQ ID NO 50, 63 and 76 respectively; (7) The VL CDR1, CDR2 and CDR3 have amino acid sequences shown in SEQ ID NO 7, 22 and 36 respectively; and/or the VH CDR1, CDR2 and CDR3 have amino acid sequences shown in SEQ ID NO 51, 64 and 77 respectively; (8) The VL CDR1, CDR2 and CDR3 have amino acid sequences shown in SEQ ID NO 8, 23 and 37 respectively; and/or said VH CDR1, CDR2 and CDR3 have amino acid sequences shown in SEQ ID NOs 52, 65 and 78, respectively; (9) The VL CDR1, CDR2 and CDR3 have amino acid sequences shown in SEQ ID NO. 9, 24 and 38 respectively; and/or the VH CDR1, CDR2 and CDR3 have amino acid sequences shown in SEQ ID NO:53, 66 and 79, respectively; (10) The VL CDR1, CDR2 and CDR3 have amino acid sequences shown in SEQ ID NO. 10, 25 and 39 respectively; and/or said VH CDR1, CDR2 and CDR3 have amino acid sequences shown in SEQ ID NO 48, 61 and 80, respectively; (11) The VL CDR1, CDR2 and CDR3 have amino acid sequences shown in

SEQ ID NO

11, 26 and 40 respectively; and/or said VH CDR1, CDR2 and CDR3 have amino acid sequences shown in SEQ ID NO:54, 67 and 81, respectively; (12) The VL CDR1, CDR2 and CDR3 have amino sequences shown in SEQ ID NO 12, 27 and 41, respectively; and/or said VH CDR1, CDR2 and CDR3 have amino acid sequences shown in SEQ ID NO 53, 66 and 82, respectively; (13) The VL CDR1, CDR2 and CDR3 have amino acid sequences shown in SEQ ID NO 13, 28 and 42 respectively; and/or the VH CDR1, CDR2 and CDR3 have amino acid sequences shown in SEQ ID NO:55, 68 and 83 respectively; (14) The VL CDR1, CDR2 and CDR3 have amino acid sequences shown in SEQ ID NO. 14, 29 and 43 respectively; and/or said VH CDR1, CDR2 and CDR3 have amino acid sequences shown in

SEQ ID NOs

56, 69 and 84, respectively; or (15) the VL CDR1, CDR2 and CDR3 have amino acid sequences shown in SEQ ID NOS: 15, 18 and 44, respectively; and/or the VH CDR1, CDR2 and CDR3 have amino acid sequences shown in SEQ ID NO:57, 70 and 85, respectively.

In some embodiments, the invention provides an antibody or antigen-binding fragment comprising a VL CDR1, VL CDR2, VL CDR3, VH CDR1, VH CDR2, and VH CDR3, wherein (a) the VL CDR1, CDR2, CDR3 have the amino acid sequences set forth in

SEQ ID NOs

5, 20, and 34, respectively; and (b) the VH CDR1, CDR2 and CDR3 have amino acid sequences shown in SEQ ID NOS: 49, 62 and 75, respectively.

In some embodiments, the antibodies or antigen-binding fragments provided herein comprise a VL CDR1, a VL CDR2, a VL CDR3, a VH CDR1, a VH CDR2, and a VH CDR3, wherein (a) the VL CDR1, CDR2, and CDR3 have the amino acid sequences set forth in SEQ ID NOs 10, 25, and 39, respectively; and (b) the VH CDR1, CDR2 and CDR3 have amino acid sequences of SEQ ID NOS: 48, 61 and 80, respectively.

In some embodiments, the antibodies or antigen-binding fragments provided herein comprise a VL CDR1, VL CDR2, VL CDR3, VH CDR1, VH CDR2, and VH CDR3, wherein (a) the VL CDR1, CDR2, CDR3 have the amino acid sequences set forth in SEQ ID NOs 14, 29, and 43, respectively; and (b) the VH CDR1, CDR2 and CDR3 have amino acid sequences shown in SEQ ID NOs: 56, 69 and 84, respectively.

The present invention provides an antibody or antigen-binding fragment thereof that specifically binds mesothelin, comprising: (a) A VL having at least 85%, at least 90%, at least 95%, at least 98% or 100% sequence identity to an amino acid sequence selected from the group consisting of SEQ ID NOs 86-100; and/or (b) a VH having at least 85%, at least 90%, at least 95%, at least 98% or 100% sequence identity to an amino acid sequence selected from the group consisting of SEQ ID NOS 101-115.

In some embodiments, the antibodies or antigen-binding fragments provided herein comprise a VL and a VH, wherein the VL and VH have (1) the amino acid sequences shown in SEQ ID NOs 86 and 101, respectively; (2) amino acid sequences shown as SEQ ID NOS: 87 and 102; (3) the amino acid sequences shown as SEQ ID NOS: 88 and 103; (4) the amino acid sequences shown in SEQ ID NOS: 89 and 104; (5) the amino acid sequences shown as SEQ ID NOS: 90 and 105; (6) the amino acid sequences shown in SEQ ID NOS: 91 and 106; (7) the amino acid sequences shown as SEQ ID NO 92 and 107; (8) amino acid sequences shown as SEQ ID NOS: 93 and 108; (9) amino acid sequences shown as SEQ ID NOS: 94 and 109; (10) the amino acid sequences shown as SEQ ID NOS: 95 and 110; (11) the amino acid sequences shown in SEQ ID NOS: 96 and 111; (12) the amino acid sequences shown as SEQ ID NOS: 97 and 112; (13) the amino acid sequences shown as SEQ ID NOS: 98 and 113; (14) the amino acid sequences shown as SEQ ID NOS 99 and 114; or (15) the amino acid sequences shown in SEQ ID NOS: 100 and 115.

In some embodiments, the antibodies and antigen-binding fragments provided herein comprise a VL and a VH, wherein the VL and VH have the amino acid sequences shown in SEQ ID NOs 90 and 105, respectively. In some embodiments, the antibodies and antigen-binding fragments provided herein comprise a VL and a VH, wherein the VL and VH have the amino acid sequences shown in SEQ ID NOs 95 and 110, respectively. In some embodiments, the antibodies and antigen-binding fragments provided herein comprise a VL and a VH, wherein the VL and VH have the amino acid sequences shown in SEQ ID NOs 99 and 114, respectively.

The invention provides an antibody or antigen-binding fragment thereof that specifically binds mesothelin, comprising (a) a VL comprising a VL CDR1, CDR2, and CDR3, said VL CDR1, CDR2, and CDR3 derived from a VL having an amino acid sequence selected from the group consisting of SEQ ID NOs 86-100; and/or, (b) a VH comprising a VH CDR1, CDR2, and CDR3, said VH CDR1, CDR2, and CDR3 derived from a VH having an amino acid sequence selected from the group consisting of SEQ ID NOs 101-115.

In some embodiments, the invention provides an antibody or antigen-binding fragment comprising (1) a VL comprising a VL CDR1, CDR2, and CDR3, said VL CDR1, CDR2, and CDR3 derived from a VL having an amino acid sequence set forth in SEQ ID No. 86, and/or a VH comprising a VH CDR1, CDR2, and CDR3, said VH CDR1, CDR2, and CDR3 derived from a VH having an amino acid sequence set forth in SEQ ID No. 101; (2) A VL comprising VL CDR1, CDR2 and CDR3, said VL CDR1, CDR2 and CDR3 derived from a VL having an amino acid sequence shown in SEQ ID No. 87, and/or a VH comprising VH CDR1, CDR2 and CDR3, said VH CDR1, CDR2 and CDR3 derived from a VH having an amino acid sequence shown in SEQ ID No. 102; (3) A VL comprising a VL CDR1, CDR2 and CDR3, said VL CDR1, CDR2 and CDR3 being derived from a VL having an amino acid sequence as set forth in SEQ ID No. 88, and/or a VH comprising a VH CDR1, CDR2 and CDR3, said VH CDR1, CDR2 and CDR3 being derived from a VH having an amino acid sequence as set forth in SEQ ID No. 103; (4) A VL comprising a VL CDR1, CDR2 and CDR3, said VL CDR1, CDR2 and CDR3 derived from a VL having the amino acid sequence shown in SEQ ID No. 89, and/or a VH comprising a VH CDR1, CDR2 and CDR3, said VH CDR1, CDR2 and CDR3 derived from a VH having the amino acid sequence shown in SEQ ID No. 104; (5) A VL comprising a VL CDR1, CDR2 and CDR3, said VL CDR1, CDR2 and CDR3 derived from a VL having an amino acid sequence as set forth in SEQ ID No. 90, and/or a VH comprising a VH CDR1, CDR2 and CDR3, said VH CDR1, CDR2 and CDR3 derived from a VH having an amino acid sequence as set forth in SEQ ID No. 105; (6) A VL comprising VL CDR1, CDR2 and CDR3, said VL CDR1, CDR2 and CDR3 derived from a VL having an amino acid sequence as set forth in SEQ ID No. 91, and/or a VH comprising VH CDR1, CDR2 and CDR3, said VH CDR1, CDR2 and CDR3 derived from a VH having an amino acid sequence as set forth in SEQ ID No. 106; (7) A VL comprising a VL CDR1, CDR2 and CDR3, said VL CDR1, CDR2 and CDR3 being derived from a VL having an amino acid sequence as set forth in SEQ ID No. 92, and/or a VH comprising a VH CDR1, CDR2 and CDR3, said VH CDR1, CDR2 and CDR3 being derived from a VH having an amino acid sequence as set forth in SEQ ID No. 107; (8) A VL comprising a VL CDR1, CDR2 and CDR3, said VL CDR1, CDR2 and CDR3 derived from a VL having an amino acid sequence depicted in SEQ ID No. 93, and/or a VH comprising a VH CDR1, CDR2 and CDR3, said VH CDR1, CDR2 and CDR3 derived from a VH having an amino acid sequence depicted in SEQ ID No. 108; (9) A VL comprising a VL CDR1, CDR2 and CDR3, said VL CDR1, CDR2 and CDR3 being derived from a VL having an amino acid sequence as set forth in SEQ ID No. 94, and/or a VH comprising a VH CDR1, CDR2 and CDR3, said VH CDR1, CDR2 and CDR3 being derived from a VH having an amino acid sequence as set forth in SEQ ID No. 109; (10) A VL comprising VL CDR1, CDR2 and CDR3, said VL CDR1, CDR2 and CDR3 derived from a VL having an amino acid sequence as set forth in SEQ ID No. 95, and/or a VH comprising VH CDR1, CDR2 and CDR3, said VH CDR1, CDR2 and CDR3 derived from a VH having an amino acid sequence as set forth in SEQ ID No. 110; (11) A VL comprising a VL CDR1, CDR2 and CDR3, said VL CDR1, CDR2 and CDR3 being derived from a VL having the amino acid sequence shown in SEQ ID No. 96, and/or a VH comprising a VH CDR1, CDR2 and CDR3, said VH CDR1, CDR2 and CDR3 being derived from a VH having the amino acid sequence shown in SEQ ID No. 111; (12) A VL comprising a VL CDR1, CDR2 and CDR3, said VL CDR1, CDR2 and CDR3 derived from a VL having an amino acid sequence as set forth in SEQ ID No. 97, and/or a VH comprising a VH CDR1, CDR2 and CDR3, said VH CDR1, CDR2 and CDR3 derived from a VH having an amino acid sequence as set forth in SEQ ID No. 112; (13) A VL comprising a VL CDR1, CDR2 and CDR3, said VL CDR1, CDR2 and CDR3 derived from a VL having the amino acid sequence shown in SEQ ID No. 98, and/or a VH comprising a VH CDR1, CDR2 and CDR3, said VH CDR1, CDR2 and CDR3 derived from a VH having the amino acid sequence shown in SEQ ID No. 113; (14) A VL comprising VL CDR1, CDR2 and CDR3, said VL CDR1, CDR2 and CDR3 derived from a VL having an amino acid sequence as set forth in SEQ ID No. 99, and/or a VH comprising VH CDR1, CDR2 and CDR3, said VH CDR1, CDR2 and CDR3 derived from a VH having an amino acid sequence as set forth in SEQ ID No. 114; or (15) a VL comprising VL CDR1, CDR2 and CDR3, said VL CDR1, CDR2 and CDR3 being derived from a VL having the amino acid sequence shown in SEQ ID NO. 100, and/or a VH comprising VH CDR1, CDR2 and CDR3, said VH CDR1, CDR2 and CDR3 being derived from a VH having the amino acid sequence shown in SEQ ID NO. 115.

In some embodiments, the antibodies or antigen-binding fragments provided herein comprise a VL and a VH, wherein the VL comprises a VL CDR1, CDR2, and CDR3, and the VL CDR1, CDR2, and CDR3 are derived from a VL having the amino acid sequence set forth in SEQ ID No. 90; and, the VH comprises a VH CDR1, CDR2, and CDR3, the VH CDR1, CDR2, and CDR3 are derived from a VH having the amino acid sequence shown in SEQ ID NO: 105. In some embodiments, the antibodies or antigen-binding fragments provided herein comprise a VL and a VH, wherein the VL comprises a VL CDR1, CDR2, and CDR3, the VL CDR1, CDR2, and CDR3 are derived from a VL having the amino acid sequence set forth in SEQ ID No. 95; and, the VH comprises a VH CDR1, CDR2, and CDR3, the VH CDR1, CDR2, and CDR3 are derived from a VH having the amino acid sequence set forth in SEQ ID NO: 110. In some embodiments, the antibodies or antigen-binding fragments provided herein comprise a VL and a VH, wherein the VL comprises a VL CDR1, CDR2, and CDR3, the VL CDR1, CDR2, and CDR3 are derived from a VL having the amino acid sequence set forth in SEQ ID No. 99; and, the VH comprises a VH CDR1, CDR2, and CDR3, the VH CDR1, CDR2, and CDR3 are derived from a VH having the amino acid sequence set forth in SEQ ID NO: 114.

In some embodiments, the invention provides that an antibody or antigen-binding fragment competes with an antibody or antigen-binding fragment described herein for binding to mesothelin.

In some embodiments, the antibody or antigen-binding fragment is a monoclonal antibody or antigen-binding fragment. In some embodiments, the antibody or antigen-binding fragment is a bispecific or multispecific antibody. In some embodiments, the antibody is a bispecific T cell engager (BiTE). In some embodiments, the antibodies provided herein are selected from the group consisting of IgG1 antibodies, igG2 antibodies, igG3 antibodies, and IgG4 antibodies. In some embodiments, the antibodies or antigen-binding fragments provided herein are selected from the group consisting of Fab, fab ', F (ab') 2, fv, scFv, (scFv) 2, single domain antibodies (sdAb), and heavy chain antibodies (HCAb). In some embodiments, the antibody or antigen-binding fragment is an scFv.

In some embodiments, the antibody or antigen-binding fragment is a chimeric antibody or antigen-binding fragment, a humanized antibody or antigen-binding fragment, or a human antibody or antigen-binding fragment. In some embodiments, the antibody or antigen-binding fragment is a human antibody or antigen-binding fragment.

The invention also provides polynucleotides encoding the antibodies or antigen-binding fragments of the invention. In some embodiments, the polynucleotide is messenger RNA (mRNA).

The present invention provides vectors comprising the polynucleotides of the invention.

The invention also provides a host cell comprising a polynucleotide of the invention, or a vector of the invention.

The invention also provides a Chimeric Antigen Receptor (CAR) that specifically binds mesothelin, comprising from N-terminus to C-terminus: (a) A mesothelin binding domain comprising an antibody or antigen-binding fragment of the invention; (b) a transmembrane domain; and (c) a cytoplasmic domain. In some embodiments, the transmembrane domain is derived from CD8, CD28, CD3 ζ, CD4, 4-1BB, OX40, ICOS, CTLA-4, PD-1, LAG-3, 2B4, BTLA, TCR α chain, TCR β chain, or TCR ζ chain, CD3 ε, CD45, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, or CD154. In some embodiments, the transmembrane domain comprises a CD8 transmembrane region or a CD28 transmembrane region. In some embodiments, the cytoplasmic domain comprises a signaling domain derived from CD3 ζ, fcR γ, fc γ RIIa, fcR β, CD3 γ, CD3 δ, CD3 epsilon, CD5, CD22, CD79a, CD79b, DAP10, DAP12, or any combination thereof. In some embodiments, the cytoplasmic domain further comprises a costimulatory domain derived from CD28, 4-1BB (CD 137), OX40, ICOS, DAP10, 2B4, CD27, CD30, CD40, CD2, CD7, LIGHT, GITR, TLR, DR3, CD43, or any combination thereof. In some embodiments, the cytoplasmic domain comprises a CD3 zeta signaling domain and a 4-1BB co-stimulatory domain. In some embodiments, the cytoplasmic domain comprises a CD3 zeta signaling domain and a CD28 costimulatory domain. In some embodiments, the CARs provided herein further comprise a CD8 hinge, the CD8 hinge being located between the antibody or antigen-binding fragment and the transmembrane domain.

In some embodiments, the CARs provided herein that specifically bind mesothelin comprise: an amino acid sequence selected from the group consisting of SEQ ID NOs 161-175.

The invention also provides a polynucleotide encoding a CAR of the invention. In some embodiments, the polynucleotide is mRNA. The invention also provides vectors comprising the polynucleotides of the invention. The invention also provides a host cell comprising a polynucleotide of the invention, or a vector of the invention.

In some embodiments, the cells provided herein are immune effector cells. In some embodiments, the cells are derived from cells isolated from peripheral blood or bone marrow. In some embodiments, the cells are derived from cells differentiated in vitro from stem or progenitor cells selected from the group consisting of T cell progenitors, hematopoietic stem/progenitors, hematopoietic multipotent progenitors, embryonic stem cells, and induced pluripotent cells. In some embodiments, the cell is a T cell or an NK cell. In some embodiments, the cell is a cytotoxic T cell, a helper T cell, a γ δ T cell, a CD4+/CD8+ double positive T cell, a CD4+ T cell, a CD8+ T cell, a CD4/CD8 double negative T cell, a CD3+ T cell, a naive T cell, an effector T cell, a helper T cell, a memory T cell, a regulatory T cell, a Th0 cell, a Th1 cell, a Th2 cell, a Th3 (Treg) cell, a Th9 cell, a Th17 cell, a Th α β helper cell, a TEM cell, a stem cell memory TSCM cell, a central memory TCM cell, an effector memory cell, or an effector memory TEMRA cell. In some embodiments, the cell is a cytotoxic T cell.

In some embodiments, the invention provides a cell population of the cells of the invention, wherein the cell population is derived from Peripheral Blood Mononuclear Cells (PBMCs), peripheral Blood Lymphocytes (PBLs), tumor Infiltrating Lymphocytes (TILs), cytokine-induced killer Cells (CIKs), lymphokine-activated killer cells (LAKs), or bone marrow infiltrating lymphocytes (mls).

The invention provides a pharmaceutical composition comprising a therapeutically effective amount of an antibody or antigen-binding fragment of the invention, and a pharmaceutically acceptable carrier. The invention also provides a pharmaceutical composition comprising a therapeutically effective amount of a cell or population of cells of the invention, and a pharmaceutically acceptable carrier.

The invention provides the use of an antibody or antigen-binding fragment of the invention, a cell or population of cells of the invention, or a pharmaceutical composition of the invention in the treatment of cancer. The invention also provides the use of an antibody or antigen-binding fragment of the invention, a cell or population of cells of the invention, or a pharmaceutical composition of the invention in the manufacture of a medicament for the treatment of cancer.

In some use embodiments of the invention, the cell, cell population or pharmaceutical composition is used in combination with an additional therapy.

The invention provides a method of treating cancer in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of an antibody or antigen-binding fragment of the invention, or a pharmaceutical composition of the invention. The invention provides a method of treating cancer in a subject in need thereof comprising administering to the subject a therapeutically effective amount of a cell or population of cells of the invention. In some embodiments, the cell or population of cells is autologous to the subject.

In some embodiments, the methods provided herein further comprise obtaining the cell from a subject. In some embodiments, the methods provided herein further comprise administering an additional treatment to the subject.

In some embodiments of the methods provided herein, the subject is a human.

In some embodiments of the uses or methods provided herein, the cancer is a mesothelin-expressing cancer. In some embodiments, the cancer is a solid tumor or a hematologic cancer. In some embodiments, the cancer is mesothelioma. In some embodiments, the mesothelioma is pleural mesothelioma, peritoneal mesothelioma, or pericardial mesothelioma. In some embodiments, the cancer is pancreatic cancer. In some embodiments, the pancreatic cancer is ductal pancreatic cancer. In some embodiments, the cancer is ovarian cancer. In some embodiments, the ovarian cancer is an ovarian epithelial cancer.

The invention provides a method of making a cell capable of expressing a CAR that specifically binds mesothelin, comprising transferring a polynucleotide of the invention into the cell. The cell may be selected from the group consisting of a T cell, an NK cell, an NKT cell, a macrophage, a neutrophil, and a granulocyte. In some embodiments, the polynucleotide is transferred by electroporation. In some embodiments, the polynucleotide is transferred by viral transduction. In some embodiments, the invention provides methods comprising viral transduction using a lentivirus, retrovirus, adenovirus, or adeno-associated virus. In some embodiments, the polynucleotide is transferred by a transposon system. In some embodiments, the transposon system is Sleeping Beauty (Sleeping Beauty) or PiggyBac. In some embodiments, the polynucleotide is transferred using gene editing. In some embodiments, the polynucleotide is transferred by a CRISPR-Cas system, a ZFN system, or a TALEN system.

4. Description of the drawings

FIG. 1 provides readings from two 96-well plates against human mesothelin-Fc monoclonal phage ELISA.

Figure 2 provides a schematic of a pDA-CAR vector for the production of anti-mesothelin CAR mRNA.

Fig. 3 provides FACS staining results showing the binding of anti-mesothelin scFv expressed in CART cells to mesothelin-Fc protein.

Fig. 4 provides FACS staining of a549 cells electroporated with varying amounts of mesothelin mRNA by anti-mesothelin antibodies.

Figure 5 provides different mRNA-based mesothelin CART cells at E/T ratios =10: killing curves against A549-GFP tumor cells at 1.

Fig. 6 provides different mRNA-based mesothelin CART cells, at E/T ratios =10:1, a killing curve for a549-GFP tumor cells, wherein the a549-GFP tumor cells were electroporated with 10 μ g mesothelin mRNA.

Fig. 7 provides different mRNA-based mesothelin CART cells, at E/T ratios =10:1, a killing curve for a549-GFP tumor cells, wherein the a549-GFP tumor cells were electroporated with 2 μ g mesothelin mRNA.

Fig. 8 provides different mRNA-based mesothelin CART cells, at E/T ratio =10:1, a killing curve for a549-GFP tumor cells, wherein the a549-GFP tumor cells are electroporated with 0 μ g, 2 μ g, or 10 μ g mesothelin mRNA.

Figure 9 provides FACS staining of OVCAR3, H226, ASPC1, a549 and HCC70 with isotype control and anti-mesothelin mAb.

Figure 10 provides CD107a staining of anti-mesothelin M12 and M32 CART cells in coculture and killing assays with OVCAR3, H226, ASPC1, a549, and HCC70 tumor cell lines.

5. Detailed description of the preferred embodiments

Before the present invention is further described, it is to be understood that this invention is not limited to particular embodiments recited herein, and that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting.

The present invention provides novel antibodies, including antigen-binding fragments, that specifically bind mesothelin (e.g., human mesothelin). In addition, the invention provides Chimeric Antigen Receptors (CARs) comprising such antibodies or antigen-binding fragments that specifically bind mesothelin (e.g., human mesothelin), as well as genetically engineered immune effector cells (e.g., T cells) and cell populations that recombinantly express CARs (e.g., CART) that specifically bind mesothelin (e.g., human mesothelin). Also disclosed are pharmaceutical compositions comprising a therapeutically effective amount of such antibodies or antigen-binding fragments, as well as pharmaceutical compositions comprising a therapeutically effective amount of a cell or population of cells. The invention also discloses the use of such pharmaceutical compositions for the treatment of cancer (e.g., mesothelin-expressing cancer) and methods of cancer treatment.

Mesothelin was originally identified as a tumor-associated antigen by Pastan and co-workers, due to its limited expression in normal tissues, but over-expression on tumors. Chang K, et al, cancer Res. (1992) 52 (1): 181-186and Chang K, et al, PNAS (1996) 93 (1): 136-140. The mesothelin gene encodes a precursor 71kDa protein, which is processed to produce a 40kDa mesothelin protein that is immobilized on the cell membrane by Glycosylphosphatidylinositol (GPI) linkage, and an amino-terminal 31kDa shed fragment, which is called megakaryocyte enhancing factor (MPF). Both fragments contain N-glycosylation sites. A soluble splice variant of the 40kDa carboxy-terminal fragment, termed "soluble mesothelin/MPF-associated", was found in the serum of patients with pancreatic ductal carcinoma (PDA). Johnston et al, clinical Cancer research, (2009) 15 (21): 6511. Mesothelin can be used as a therapeutic target, and can also be used as a biomarker for disease activity and therapeutic response. Argani et al, clin Cancer Res. (2001) 7 (12): 3862-3868.

Mesothelin is a differentiated antigen and is also present on normal tissues. Using the murine anti-human mesothelin antibody K1 developed by the Pastan team, strong K1 reactivity was shown in mesothelial cells in the peritoneal, pleural and pericardial cavities, although at levels lower than commonly seen in malignant tissues. Chang et al, cancer Res. (1992) 52 (1): 181-186. Weak K1 reactivity was detected in oviduct epithelium, airway basal epithelium and tonsil epithelium. Mesothelin is also found on all layers of the cornea. Jirsova et al, experimental eye research (2010) 91 (5): 623-629. However, no K1 reactivity was detected in most normal tissues including liver, kidney, spleen, bone marrow, lymph node, thymus, cardiac muscle, tongue, skeletal muscle, skin, cerebral cortex, cerebellum, spinal cord, peripheral nerve, pituitary, adrenal gland, salivary gland, breast, thyroid, parathyroid, testis, prostate, epididymis, cervical epithelium, lung parenchyma, esophagus, small intestine epithelium, colon epithelium, bladder epithelium, and gallbladder epithelium. Chang 1992, supra.

Mesothelin is overexpressed in the vast majority of primary pancreatic adenocarcinomas, and is rarely and weakly expressed in benign pancreatic tissues. Argani 2001, supra. Epithelial Malignant Pleural Mesothelioma (MPM) ubiquitously expresses mesothelin, whereas sarcoma-like MPM does not. Most serous epithelial ovarian cancers and related primary peritoneal cancers express mesothelin.

Mesothelin is the target of the ovarian cancer natural immune response and also the target of tumor immunotherapy. Bracci et al, clin Cancer Res. (2007) 13 (2Pt 1): 644-653; moschella et al, cancer Res. (2011) 71 (10): 3528-3539; sadelain et al, nat. Rev. Cancer (2003) 3 (1): 35-45; muul et al, blood (2003) 101 (7): 2563-2569; yee et al, proc Natl Acad Sci U S A. (2002) 99 (25): 16168-16173. The presence of mesothelin-specific CTLs in pancreatic cancer patients correlates with overall survival. Thomas et al, J Exp med. (2004) 200. In addition, soluble antibody fragments of anti-mesothelin antibodies conjugated to antitoxins were used to treat mesothelin-positive tumor patients, demonstrating adequate safety and some clinical activity in pancreatic cancer. Hassan et al, clin Cancer Res, (2007) 13 (17): 5144-5149.

5.1Definition of

Unless defined otherwise, scientific and technical terms used herein shall have the meanings that are commonly understood by one of ordinary skill in the art. Furthermore, unless the context requires otherwise, singular terms shall include the plural and plural terms shall include the singular. In general, the use and techniques of the cell and tissue culture, molecular biology, immunology, microbiology, genetics and protein and nucleic acid chemistry and hybridization-related terms described herein are all terms well known and commonly used in the art.

The present invention provides novel antibodies, including antigen-binding fragments, that specifically bind mesothelin (e.g., human mesothelin). The term "mesothelin" includes any variant or subtype of mesothelin that is naturally expressed by a cell. Thus, the antibodies of the invention are capable of cross-reacting with mesothelin (e.g., cynomolgus monkey mesothelin) of species other than human. Alternatively, the antibody may specifically bind human mesothelin and not show any cross-reactivity with other species. Mesothelin, or any variant or subtype thereof, may be isolated from the cell or tissue in which it is naturally expressed or recombinantly produced using techniques well known in the art and/or described herein.

The term "antibody" and grammatical equivalents thereof as used herein refers to an immunoglobulin molecule that recognizes and specifically binds a target, such as a protein, polypeptide, peptide, carbohydrate, polynucleotide, lipid, or combination of any of the foregoing, through at least one antigen binding site, which is typically within the variable region of the immunoglobulin molecule. As used herein, the term includes intact polyclonal antibodies, intact monoclonal antibodies, single domain antibodies (sdabs, e.g., camel antibodies, alpaca antibodies), single chain Fv (scFv) antibodies, heavy chain antibodies (HCAb), light chain antibodies (LCAb), multispecific antibodies, bispecific antibodies, monospecific antibodies, monovalent antibodies, and any other modified immunoglobulin molecule (e.g., a dual variable domain immunoglobulin molecule) that comprises an antigen binding site, so long as the antibody exhibits the desired biological activity. The antibodies also include, but are not limited to, mouse antibodies, camelid antibodies, chimeric antibodies, humanized antibodies, and human antibodies. The antibody may be any one of the five major immunoglobulins: igA, igD, igE, igG, and IgM or subclasses (isotypes) thereof (e.g., igG1, igG2, igG3, igG4, igA1, and IgA 2) are based on the identity of their heavy chain constant regions (referred to as α, δ, ε, γ, and μ, respectively). The term "antibody" as used herein includes "antigen-binding fragments" of intact antibodies, unless otherwise specifically indicated. The term "antigen-binding fragment" as used herein refers to a portion or fragment of an intact antibody, which is the epitope variable region of an intact antibody. Examples of antigen binding fragments include, but are not limited to, fab ', F (ab') 2, fv, linear antibodies, single chain antibody molecules (e.g., scFv), heavy chain antibodies (HCAbs), light chain antibodies (LCAbs), disulfide linked scFv (dsscFv), diabodies, triabodies, tetrabodies, minibodies, diabody (DVD), single variable region antibodies (sdabs, e.g., camel, alpaca antibodies), and single variable regions of heavy chain antibodies (VHH), and bi-or multispecific antibodies formed from antibody fragments.

The term "humanized antibody" as used herein refers to a form of non-human (e.g., mouse) antibody that is a specific immunoglobulin chain, a chimeric immunoglobulin, or a fragment thereof containing minimal non-human sequences. Typically, the humanized antibody is a human immunoglobulin. In some instances, fv framework region residues of the human immunoglobulin are replaced by corresponding residues in antibodies from non-human species. In some cases, CDR residues are replaced with CDR residues from a non-human species (e.g., mouse, rat, hamster, camel) that have the desired specificity, affinity, and/or binding capability. The humanized antibodies may be further modified by substitution of additional residues in the Fv framework regions and/or substituted non-human residues to refine and optimize antibody specificity, affinity, and/or binding capacity. The term "human antibody" as used herein refers to an antibody produced by a human or an antibody having an amino acid sequence corresponding to an antibody produced by a human, wherein the antibody produced by a human can be made using any technique known in the art.

When used in reference to an antibody, the term "heavy chain" refers to a polypeptide chain of about 50-70kDa, wherein the amino terminal portion comprises a variable region of about 120-130 or more amino acids and the carboxy terminal portion comprises a constant region. Depending on the amino acid sequence of the heavy chain constant region, the constant region can be one of five different types, called alpha (α), delta (δ), epsilon (ε), gamma (γ), and mu (μ). Different chains differ in size: alpha, delta, and gamma comprise about 450 amino acids, while mu and epsilon comprise about 550 amino acids. When combined with light chains, these different types of heavy chains produce five well-known classes of antibodies, igA, igD, igE, igG, and IgM, respectively, including the four subclasses of IgG, known as IgGl, igG2, igG3, and IgG4. The heavy chain may be a human heavy chain.

The term "light chain" when used in reference to an antibody refers to an about 25kDa polypeptide chain, wherein the amino terminal portion comprises a variable region of about 100 to about 110 or more amino acids and the carboxy terminal portion comprises a constant region. The light chain is about 211 to 217 amino acids in length. Depending on the amino acid sequence of the constant region, there are two different types of light chains, called kappa (κ) and lambda (λ). The amino acid sequence of light chains is well known in the art. The light chain may be a human light chain.

The term "variable domain" or "variable region" refers to a portion of a light or heavy chain of an antibody, which is typically located at the amino terminus of the light or heavy chain, and has a length of about 120 to 130 amino acids in the heavy chain and a length of about 100 to 110 amino acids in the light chain, which is used for the binding and specificity of each particular antibody for its particular antigen. The variable domains differ greatly in sequence between different antibodies. The variability of the sequence is concentrated in the CDRs, and the less variable portions of the variable domains are called Framework Regions (FRs). The CDRs of the light and heavy chains are primarily responsible for the interaction between the antibody and the antigen. Amino acid position numbering as used herein is according to the EU index, kabat et al, (1991) Sequences of proteins of immunological interest, (U.S. department of Health and Human Services, washington, D.C.) 5 the. The variable region may be a human variable region.

One CDR refers to one of the three hypervariable regions (H1, H2 or H3) in the non-framework region of the β -sheet framework in an immunoglobulin (Ig or antibody) VH, or one of the three hypervariable regions (L1, L2 or L3) in the non-framework region of the β -sheet framework of an antibody VL. Thus, a CDR is a variable region sequence interspersed within a framework region sequence. CDR regions are well known to those skilled in the art and have been defined by a variety of methods/systems. These systems and/or definitions have evolved and are perfected over the years, including Kabat, chothia, IMGT, abM, and Contact. For example, kabat defines the region of highest variability within the variable (V) domain of an antibody ((Kabat et Al, J.biol.chem.252:6609-6616 (1977); kabat, adv. Prot. Chem.32:1-75 (1978)). Chothia defines CDR region sequences as those residues that do not belong to a conserved β -sheet framework based on the positions of structural loop regions, thereby enabling adaptation to different conformations (Chothia and Lesk j. Mol. Biol.196:901-917 (1987)). Both terms are well known in the art. Furthermore, IMGT systems are based on sequence variability and positions within the variable region structure. AbM definition is a compromise between Kabat and Chothia. Contact definition is based on analysis of the variable antibody crystal structure.

For example, the CDRs defined according to Kabat (high variability) or Chothia (structure) nomenclature are listed in the table below.

	Kabat ¹	Chothia ²	Loop Location
				VHCDRl	31-35	26-32	linking B and C strands
VHCDR2	50-65	53-55	linking C’and C”strands
				VHCDR3	95-102	96-101	linking F and G strands
VLCDRl	24-34	26-32	linking B and C strands
				VLCDR2	50-56	50-52	linking C’and C”strands
VLCDR3	89-97	91-96	linking F and G strands

¹ Residue numbering follows the nomenclature of Kabat et al, supra

² Residue numbering follows the nomenclature of Chothia et al, supra

One or more CDRs may also be covalently or non-covalently incorporated into a molecule, making it an immunoadhesin. Immunoadhesins can have CDRs as part of a larger polypeptide chain, can covalently link CDRs to another polypeptide chain, or can non-covalently bind CDRs. The CDRs enable the immunoadhesin to bind to a specific antigen. CDR regions can be analyzed, for example, by the abysis website (http:// abysis. Org /).

The terms "epitope" and "antigenic determinant" are used interchangeably herein to refer to a site on the surface of a target molecule to which an antibody or antigen-binding fragment binds, e.g., a localized region on the surface of an antigen. The target molecule may comprise a protein, peptide, nucleic acid, carbohydrate or lipid. An immunologically active epitope is a portion of a target molecule that induces an immune response in an animal. An epitope of a target molecule having antigenic activity is the portion of the target molecule to which an antibody binds, as determined by any method known in the art, including, for example, by immunoassay. An epitope need not be immunogenic. Epitopes usually consist of chemically active surface groups of molecules such as amino acids or sugar side chains, with specific three-dimensional structural characteristics and specific charge characteristics. The term "epitope" includes linear epitopes and conformational epitopes. A region of a target molecule (e.g., a polypeptide) that can serve as an epitope can be contiguous amino acids of the polypeptide, or can be from an aggregate of two or more non-contiguous regions of the target molecule. The epitope may or may not be a three-dimensional surface feature of the target molecule. Epitopes formed by contiguous amino acids (also known as linear epitopes) are typically retained when the protein is denatured, while epitopes formed by tertiary folding (also known as conformational epitopes) are typically lost when the protein is denatured. An epitope typically comprises at least 3, more typically at least 5, 6, 7, or 8-10 amino acids in a unique spatial conformation.

The term "specifically binds" as used herein refers to a polypeptide or molecule that interacts with an epitope, protein or target molecule more frequently and more rapidly than it interacts with other substances (including related and unrelated proteins) with greater duration, greater affinity or binding as described above. Binding moieties (e.g., antibodies) that specifically bind to a target molecule (e.g., an antigen) can be determined, for example, by immunoassay, ELISA, SPR (e.g., biacore), or other techniques known to those skilled in the art. Typically, the specified response is at least twice that of the background signal or noise, and may be more than 10 times that of the background. See, e.g., paul, ed.,1989,Fundamental Immunology Second Editiondiscussion of antibody specificity, in Raven Press, new York at pages 332-336. A binding moiety that specifically binds a target molecule, which can have a higher affinity for the target molecule than for other molecules. In some embodiments, a binding moiety that specifically binds to a target molecule may have at least 20-fold, at least 30-fold, at least 40-fold, at least 50-fold, at least 60-fold, at least 70-fold, at least 80-fold, at least 90-fold, or at least 100-fold greater affinity for the target molecule than for other molecules. In some embodiments, specifically binding to a particular target molecule A binding moiety that binds to other molecules with such low affinity that binding is undetectable by assays described herein or known in the art. In some embodiments, "specifically binds" means, e.g., that the binding moiety has a K of about 0.1mM or less _D The values bind to the molecular target. In some embodiments, "specifically binds" means that the polypeptide or molecule has a K of about 10. Mu.M or less, or about 1. Mu.M or less _D The values bind to the target. In some embodiments, "specifically binds" means that the polypeptide or molecule has a K of about 0.1 μ M or less, about 0.01 μ M or less, or about 1nM or less _D The values bind to the target. Due to sequence identity between homologous proteins in different species, specific binding may include polypeptides or molecules that recognize proteins or targets in multiple species. Likewise, due to homology within certain regions of the polypeptide sequences of different proteins, specific binding may include polypeptides or molecules that recognize multiple proteins or targets. It is understood that in some embodiments, a binding moiety (e.g., an antibody) that specifically binds a first target molecule may or may not bind a second target. As such, "specifically binds" does not necessarily have to be (although it may include) bind alone, i.e. bind to a single target. Thus, in some embodiments, a binding moiety (e.g., an antibody) can specifically bind to multiple targets. For example, in certain instances, an antibody may comprise two identical antigen binding sites, each site specifically binding to the same epitope on two or more proteins. In certain alternative embodiments, the antibody may be bispecific and include at least two antigen binding sites with different specificities.

The term "binding affinity" as used herein generally refers to the strength of the sum of non-covalent interactions between a binding moiety and a target molecule (e.g., an antigen). Binding of a binding moiety to a target molecule is a reversible process, and the affinity of the binding is usually reported as the equilibrium dissociation constant (K) _D )。K _D Is the dissociation rate (k) _off Or k _d ) And the rate of binding (k) _on Or k _a ) The ratio of (a) to (b). K of a binding pair _D The lower the affinity, the higher. Various methods for measuring binding affinity are known in the art, any of whichEither of which can be used in the present invention. Specific illustrative embodiments include the following. In some embodiments, "K _D 'OR' K _D The value "can be determined by assays known in the art, for example by binding. K is _D Can be measured in a radiolabeled antigen binding assay (RIA) (Chen, et al, (1999) J.mol Biol 293. Said K _D Or K _D Values may also be analyzed by surface plasmon resonance using Biacore, for example using BIAcore TM-2000 or BIAcore TM-3000 (Biacore, inc., piscataway, NJ) or using biolayer interferometry, for example the OctetQK384 system (ForteBio, menlo Park, calif.).

The term "variant" as used herein in relation to a protein or polypeptide having a particular sequence feature ("reference protein" or "reference polypeptide"), refers to a different protein or polypeptide having one or more (e.g., about 1 to about 25, about 1 to about 20, about 1 to about 15, about 1 to about 10, or about 1 to about 5) amino acid substitutions, deletions, and/or additions as compared to the reference protein or reference polypeptide. The change in the amino acid sequence may be an amino acid substitution. The change in the amino acid sequence may be a conservative amino acid substitution. A functional fragment or functional variant of a protein or polypeptide retains the basic structural and functional properties of a reference protein or polypeptide.

The terms "polypeptide", "peptide", "protein" and grammatical equivalents thereof, as used interchangeably herein, refer to a polymer of amino acids of any length, which may be linear or branched. It may include non-natural or modified amino acids, or be interrupted by non-amino acids. The polypeptide, peptide or protein may also be modified, for example by disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation or any other manipulation or modification.

The terms "polynucleotide", "nucleic acid" and grammatical equivalents thereof, used interchangeably herein, refer to a polymer of nucleotides of any length, including DNA and RNA. The nucleotides may be deoxyribonucleotides, ribonucleotides, modified nucleotides or bases, and/or their analogs, or any substrate that can be incorporated into the polymer by DNA or RNA polymerase.

The term "identity," percent "identity," and grammatical equivalents thereof, as used herein in the context of two or more polynucleotides or polypeptides, refers to two or more sequences or subsequences that are the same or have a specified percentage of nucleotides or amino acid residues that are the same, regardless of any conservative amino acid substitutions as part of sequence identity, when compared and aligned (gaps introduced, if necessary) to obtain maximum correspondence. The percentage of sequence can be measured using sequence comparison software or algorithms or by visual inspection. Various algorithms and software that can be used to obtain an amino acid or nucleotide sequence alignment are well known in the art. These algorithms or software include, but are not limited to, BLAST, ALIGN, megalign, bestFit, GCG Wisconsin Package, and variants thereof. In some embodiments, the two polynucleotides or polypeptides provided herein are substantially identical, meaning that they have at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, and in some embodiments at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% nucleotide or amino acid residue identity when compared and aligned for maximum correspondence using a sequence comparison algorithm or by visual inspection. In some embodiments, there is identity over a region of an amino acid sequence that is at least about 10 residues, at least about 20 residues, at least about 40-60 residues, at least about 60-80 residues, or any integer value therebetween in length. In some embodiments, identity exists over a region that is longer than 60-80 residues, e.g., at least about 80-100 residues, and in some embodiments, the sequences are substantially identical over the entire length of the sequences compared, e.g., the coding region of the protein or antibody of interest. In some embodiments, the identity exists over a region of a nucleotide sequence that is at least about 10 bases in length, at least about 20 bases in length, at least about 40-60 bases in length, at least about 60-80 bases in length, or any integer value therebetween. In some embodiments, identity exists over a region that is longer than 60-80 bases, e.g., at least about 80-1000 bases or more, and in some embodiments, the sequences are substantially identical over the entire length of the sequences being compared (e.g., nucleotide sequences encoding a protein of interest).

As used herein, the term "vector" and its grammatical equivalents refer to a vector for carrying genetic material (e.g., a polynucleotide sequence) that may be introduced into a host cell where it may be replicated and/or expressed. Vectors that can be used include, for example, expression vectors, plasmids, phage vectors, viral vectors, episomes, and artificial chromosomes, which can include a selection sequence or marker operable for stable integration into the chromosome of the host cell. In addition, the vector may include one or more selectable marker genes and appropriate expression control sequences. The selectable marker gene that may be included can, for example, provide resistance to antibiotics or toxins, supplement auxotrophy, or provide key nutrients not present in the culture medium. The expression control sequences may include constitutive and inducible promoters, transcription enhancers, transcription terminators, and the like, which are well known in the art. When two or more polynucleotides are to be co-expressed, both polynucleotides may be inserted, for example, in a single expression vector or in separate expression vectors. For single vector expression, the encoding polynucleotides may be operably linked to a common expression control sequence, or to different expression control sequences, such as an inducible promoter and a constitutive promoter. Introduction of the polynucleotide into the host cell can be confirmed using methods well known in the art. One skilled in the art understands that a polynucleotide is expressed in sufficient amounts to produce a desired product (e.g., an anti-mesothelin antibody or antigen-binding fragment thereof as described herein), and further understands that the expression level can be optimized to obtain sufficient expression using methods well known in the art.

The term "chimeric antigen receptor" or "CAR" as used herein refers to an artificially constructed hybrid protein or polypeptide that contains a binding moiety (e.g., an antibody) linked to an immune cell (e.g., a T cell) signaling or activation domain. In some embodiments, the CAR is a synthetic receptor that retards T cells to tumor surface antigens (Sadelain et al, nat. Rev. Cancer.3 (1): 35-45 (2003); sadelain et al, cancer Discovery 3 (4): 388-398 (2013)). The CAR can provide antigen binding and immune cell activation functions for immune cells (e.g., T cells). CARs are able to redirect T cell specificity and reactivity to selected targets in a non-MHC-restricted manner, taking advantage of the antigen binding properties of monoclonal antibodies. Such non-MHC-restricted antigen recognition may enable CAR-expressing T cells to have antigen recognition capabilities independent of antigen processing, thereby avoiding tumor escape mechanisms.

The term "genetic engineering" or grammatical equivalents thereof, when used in reference to a cell, means the alteration of the genetic material of the cell that is not normally found in naturally occurring cells. Genetic alterations include, for example, modifications introduced into the expressible polynucleotide, other additions, mutations/alterations, deletions and/or other functional disruptions of the cellular gene. Such modifications can be made, for example, in the coding region of the gene and functional fragments thereof. Additional modifications can be made, for example, in non-coding regulatory regions, wherein the modifications alter expression of the gene.

The terms "transfer," "transduction," "transfection," and grammatical equivalents thereof, as used herein, refer to the process of introducing an exogenous polynucleotide into a host cell. A "transferred," "transfected" or "transduced" cell refers to a cell that has been transferred, transduced or transfected with an exogenous polynucleotide. The cells include primary recipient cells and their progeny. Polynucleotides may be "transferred" into a host cell using any type of method known in the art, including chemical, physical, or biological methods. Polynucleotides are typically "transduced" into a host cell using a virus. In contrast, polynucleotides are typically "transfected" into host cells using non-viral methods. These terms are sometimes used interchangeably and, when used in context, their meanings are readily understood by one of ordinary skill in the art.

As used herein, the term "encode" and grammatical equivalents thereof refer to the inherent nature of a particular nucleotide sequence in a polynucleotide or nucleic acid, such as a gene, cDNA, or mRNA, that serves as a template for the synthesis of other polymers and macromolecules having a particular nucleotide sequence (i.e., rRNA, tRNA, and mRNA) or a particular amino acid sequence in a biological process, and the biological properties resulting therefrom. Thus, if transcription and translation of the mRNA corresponding to the gene produces a protein, the gene encodes the protein. Unless otherwise indicated, a "nucleotide sequence encoding an amino acid sequence" includes all nucleotide sequences that are degenerate with respect to one another or that encode the same amino acid sequence. Nucleotide sequences encoding proteins and RNAs may include introns.

An "isolated" polypeptide, peptide, protein, antibody, polynucleotide, vector, cell, or composition is in the form of a polypeptide, peptide, protein, antibody, polynucleotide, vector, cell, or composition not found in nature. An isolated polypeptide, protein, antibody, polynucleotide, vector, cell or composition includes those polypeptides, peptides, proteins, antibodies, polynucleotides, vectors, cells or compositions that have been purified to an extent that they no longer exist in the form found in nature. In some embodiments, the isolated polypeptide, peptide, protein, antibody, polynucleotide, vector, cell, or composition is substantially purified.

As used herein and as understood in the art, "immune effector cell" refers to a cell that has hematopoietic origin and plays a direct role in the immune response against a target (e.g., a pathogen, cancer cell, or foreign substance). Immune effector cells include T cells, B cells, natural Killer (NK) cells, NKT cells, macrophages, granulocytes, neutrophils, eosinophils, mast cells and basophils.

As used herein, the term "treatment" and grammatical equivalents thereof in connection with a disease or condition, or a subject having a disease or condition, refers to the act of inhibiting, eliminating, reducing, and/or ameliorating symptoms, symptom severity, and/or symptom frequency associated with the disease or disorder being treated. For example, when referring to a cancer or tumor, the term "treating" and grammatical equivalents thereof refers to a act of reducing the severity of, or delaying or slowing the progression of, the cancer or tumor, including (a) inhibiting the growth or arresting the development of the cancer or tumor, (b) causing regression of the cancer or tumor, or (c) delaying, ameliorating or minimizing one or more symptoms associated with the presence of the cancer or tumor.

The term "administration" and grammatical equivalents thereof as used herein refers to the act of delivering or causing the delivery of a therapeutic agent or pharmaceutical composition to the body of a subject by the methods described herein or other methods known in the art. The therapeutic agent may be a compound, polypeptide, cell, or population of cells. Administering the therapeutic agent or pharmaceutical composition comprises prescribing delivery of a therapeutic or pharmaceutical composition to a subject. Typical forms of administration include oral dosage forms such as tablets, capsules, syrups, suspensions; injectable dosage forms, such as Intravenous (IV), intramuscular (IM), or Intraperitoneal (IP); transdermal dosage forms, including creams, gels, powders or patches; an oral dosage form; inhalation powders, sprays, suspensions, and rectal suppositories.

As used herein, the terms "effective amount," "therapeutically effective amount," and grammatical equivalents thereof, refer to an amount administered to a subject alone or as part of a pharmaceutical composition, in a single dose, or as part of a series of doses, that is capable of having any detectable positive effect on any symptom, aspect, or characteristic of a disease, disorder, or condition when administered. A therapeutically effective amount can be determined by measuring the relevant physiological effects. The exact amount required will vary from subject to subject, depending on the age, weight, and general health of the subject, the severity of the condition being treated, the judgment of the clinician, and the like. In any individual case, an appropriate "effective amount" may be determined by one of ordinary skill in the art using routine experimentation.

The term "pharmaceutically acceptable carrier" or "pharmaceutically acceptable excipient" refers to a material suitable for administration to an individual with an active agent without causing undesirable biological effects or interacting in a deleterious manner with any of the other components of the pharmaceutical composition.

The term "subject" as used herein refers to any animal (e.g., a mammal), including but not limited to humans, non-human primates, dogs, felines, rodents, etc., which is the animal to be subjected to a particular treatment. The subject may be a human. The subject may be a patient suffering from a particular disease or disorder.

The term "autologous" as used herein refers to any material that is derived from the same individual and subsequently reintroduced into the individual.

The term "allogenic" as used herein refers to grafts derived from different individuals of the same species.

The range is as follows: throughout this disclosure, various aspects of the present invention may be presented in a range format. It is to be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the invention. Accordingly, the description of a range should be considered to have specifically disclosed all the possible subranges as well as individual numerical values within that range. For example, description of a range from 1 to 6 should be considered to have disclosed sub-ranges, such as from 1 to 3, 1 to 4, 1 to 5, 2 to 4, 2 to 6, 3 to 6, etc., as well as individual numbers within that range, such as 1, 2, 2.7, 3, 4, 5, 5.3, and 6. This applies regardless of the breadth of the range.

Exemplary genes and polypeptides are described herein with reference to GenBank accession numbers, GI accession numbers, and/or SEQ ID NOs. It is understood that homologous sequences can be readily identified by one skilled in the art by reference to sequence sources including, but not limited to, genBank (ncbi.

5.2 anti-mesothelin antibodies and antigen-binding fragments

The invention provides antibodies or antigen-binding fragments thereof that specifically bind mesothelin (e.g., human mesothelin). In some embodiments, the invention provides anti-mesothelin antibodies. In some embodiments, the antibody is an IgA, igD, igE, igG, or IgM antibody. In some embodiments, the antibody is an IgA antibody. In some embodiments, the antibody is an IgD antibody. In some embodiments, the antibody is an IgE antibody. In some embodiments, the antibody is an IgG antibody. In some embodiments, the antibody is an IgM antibody. In some embodiments, the antibodies provided herein can be IgG1 antibodies, igG2 antibodies, igG3 antibodies, or IgG4 antibodies. In some embodiments, the antibody is an IgG1 antibody. In some embodiments, the antibody is an IgG2 antibody. In some embodiments, the antibody is an IgG3 antibody. In some embodiments, the antibody is an IgG4 antibody.

In some embodiments, the invention provides antigen-binding fragments of anti-mesothelin antibodies. In some embodiments, the antigen-binding fragments provided herein can be single domain antibodies (sdabs), heavy chain antibodies (hcabs), fabs, fab ', F (ab') ₂ Fv, single chain variable fragment (scFv) or (scFv) ₂ . In some embodiments, the antigen-binding fragment of the anti-mesothelin antibody is a single domain antibody (sdAb). In some embodiments, the antigen-binding fragment of the anti-mesothelin antibody is a heavy chain antibody (HCAb). In some embodiments, the antigen-binding fragment of the anti-mesothelin antibody is a Fab. In some embodiments, the antigen binding fragment of the anti-mesothelin antibody is a Fab'. In some embodiments, the antigen-binding fragment of the anti-mesothelin antibody is F (ab') ₂ . In some embodiments, the antigen-binding fragment of the anti-mesothelin antibody is an Fv. In some embodiments, the antigen-binding fragment of the anti-mesothelin antibody is an scFv. In some embodiments, the antigen-binding fragment of the anti-mesothelin antibody is a disulfide-linked scFv [ (scFv) ₂ ]. In some embodiments, the antigen-binding fragment of the anti-mesothelin antibody is a bispecific antibody (dAb).

In some embodiments, the anti-mesothelin antibodies or antigen-binding fragments provided herein include recombinant antibodies or antigen-binding fragments. In some embodiments, the anti-mesothelin antibodies or antigen binding fragments provided herein include monoclonal antibodies or antigen binding fragments. In some embodiments, the anti-mesothelin antibodies or antigen-binding fragments provided herein include polyclonal antibodies or antigen-binding fragments. In some embodiments, the anti-mesothelin antibodies or antigen-binding fragments provided herein include camelidae (e.g., camel, dromedary, and llama) antibodies or antigen-binding fragments. In some embodiments, the anti-mesothelin antibodies or antigen-binding fragments provided herein include chimeric antibodies or antigen-binding fragments. In some embodiments, the anti-mesothelin antibodies or antigen-binding fragments provided herein include humanized antibodies or antigen-binding fragments. In some embodiments, the anti-mesothelin antibodies or antigen-binding fragments provided herein include human antibodies or antigen-binding fragments. In some embodiments, the invention provides an anti-mesothelin human scFv.

In some embodiments, the anti-mesothelin antibody or antigen-binding fragment provided herein is an isolated antibody or antigen-binding fragment. In some embodiments, the anti-mesothelin antibodies or antigen-binding fragments provided herein are substantially purified.

In some embodiments, the anti-mesothelin antibodies or antigen binding fragments provided herein include multispecific antibodies or antigen binding fragments. In some embodiments, the anti-mesothelin antibodies or antigen-binding fragments provided herein include bispecific antibodies or antigen-binding fragments. In some embodiments, the invention provides a bispecific T cell engager (BiTE). BiTEs are bispecific antibodies that bind to T cell antigens (e.g., CD 3) and tumor antigens. BiTEs have been shown to induce directed lysis of targeted tumor cells, providing a vast potential therapy for cancer and other diseases. In some embodiments, the invention provides BiTE that specifically binds CD3 and mesothelin. In some embodiments, the BiTE comprises an anti-mesothelin antibody or antigen-binding fragment provided herein. In some embodiments, the BiTE comprises an anti-mesothelin scFv provided herein.

In some embodiments, the anti-mesothelin antibodies or antigen-binding fragments provided herein include a monovalent antigen binding site. In some embodiments, the anti-mesothelin antibody or antigen binding fragment comprises a monospecific binding site. In some embodiments, the anti-mesothelin antibody or antigen-binding fragment comprises a bivalent binding site.

In some embodiments, the anti-mesothelin antibody or antigen-binding fragment is a monoclonal antibody or antigen-binding fragment. Monoclonal antibodies can be prepared by any method known to those skilled in the art. One exemplary method is to screen protein expression libraries, such as phage or ribosome display libraries. Phage display is described, for example, in Ladner et al, U.S. Pat. nos. 5,223,409; smith (1985) Science 228; and WO 92/18619. In some embodiments, recombinant monoclonal antibodies are isolated from phage display libraries capable of expressing the variable regions or CDRs of the desired species. Screening of phage libraries can be accomplished by a variety of techniques known in the art.

In some embodiments, monoclonal antibodies are prepared using hybridoma methods known to those of skill in the art. For example, using the hybridoma method, mice, rats, rabbits, hamsters or other suitable host animals are immunized as described above. In some embodiments, the lymphocytes are immunized in vitro. In some embodiments, the immunizing antigen is a human protein or fragment thereof. In some embodiments, the immunizing antigen is a human protein or fragment thereof.

Following immunization, lymphocytes are isolated and fused with a suitable myeloma cell line using, for example, polyethylene glycol. Hybridoma cells were selected using proprietary media known in the art, and unfused lymphocytes and myeloma cells failed to survive the selection process. Hybridomas that produce monoclonal antibodies to a selected antigen can be identified by a variety of methods, including but not limited to immunoprecipitation, immunoblotting, and in vitro binding assays (e.g., flow cytometry, FACS, ELISA, SPR (e.g., biacore), and radioimmunoassay). Once hybridoma cells producing the desired specificity, affinity, and/or activity antibodies are identified, the clones may be subcloned by limiting dilution or other techniques. Hybridomas can be propagated in vitro in culture using standard methods, or in vivo as in animal ascites tumors. The monoclonal antibodies can be purified from the culture medium or ascites fluid according to standard methods in the art, including but not limited to affinity chromatography, ion exchange chromatography, gel electrophoresis, and dialysis.

In some embodiments, monoclonal antibodies are prepared using recombinant DNA techniques known to those skilled in the art. For example, polynucleotides encoding the antibody are isolated from mature B cells or hybridoma cells, and the genes encoding the heavy and light chains of the antibody are specifically amplified by, e.g., RT-PCR using oligonucleotide primers and their sequences determined using standard techniques. The isolated polynucleotides encoding the heavy and light chains are then cloned into a suitable expression vector that produces monoclonal antibodies when transfected into a host cell such as e.coli, simian COS cells, chinese Hamster Ovary (CHO) cells, or myeloma cells, but otherwise does not produce immunoglobulins.

In some embodiments, the monoclonal antibody is modified by using recombinant DNA techniques to produce a surrogate antibody. In some embodiments, the light and heavy chain constant regions of the mouse monoclonal antibody are replaced with the constant regions of a human antibody to produce a chimeric antibody. In some embodiments, the constant regions are truncated or removed to generate antibody fragments of the desired monoclonal antibodies. In some embodiments, site-directed or high-density mutations of the variable regions are used to optimize the specificity and/or affinity of the monoclonal antibody.

In some embodiments, the anti-mesothelin antibody or antigen-binding fragment is a humanized antibody or antigen-binding fragment. Various methods for making humanized antibodies are known in the art. Methods for achieving high affinity binding to humanized antibodies are known in the art. One non-limiting example of such a method is the hypermutation of the variable region and the selection of cells expressing such high affinity antibodies (affinity maturation). In addition to the use of display libraries, specific antigens (e.g., recombinant mesothelin or epitopes thereof) may be used to immunize non-human animals, such as rodents. In certain embodiments, rodent antigen-binding fragments (e.g., mouse antigen-binding fragments) can be prepared and isolated using methods known in the art and/or disclosed herein. In some embodiments, the mouse may be immunized with an antigen (e.g., recombinant mesothelin or an epitope thereof).

In some embodiments, the anti-mesothelin antibody or antigen-binding fragment is a human antibody or antigen-binding fragment. Human antibodies can be made using various techniques known in the art. In some embodiments, the human antibody is produced by immortalized human B lymphocytes immunized in vitro. In some embodiments, the human antibody is produced by lymphocytes isolated from an immunized individual. In any case, cells producing antibodies against the target antigen can be prepared and isolated. In some embodiments, the human antibody is selected from a phage library, wherein the phage library expresses the human antibody. Alternatively, phage display technology can be used to produce human antibodies and antibody fragments in vitro from immunoglobulin variable region gene libraries from unimmunized donors. Techniques for generating and using antibody phage libraries are well known in the art. Once antibodies are identified, affinity maturation techniques known in the art can be used to produce higher affinity human antibodies, including but not limited to chain replacement and site-directed mutagenesis. In some embodiments, human antibodies are produced in transgenic mice containing human immunoglobulin loci. After immunization, these mice are capable of producing fully human antibodies in the absence of endogenous immunoglobulin production.

The specific CDR sequences defined in the present invention are generally based on the combination defined by Kabat and Chothia. However, it is understood that reference to one or more heavy chain CDRs, and/or one or more light chain CDRs, of a specific antibody includes all CDR definitions known to those skilled in the art.

The anti-mesothelin antibody or antigen-binding fragment provided by the invention comprises the following clones: m6, M7, M8, M10, M12, M13, M15, M20, M22, M24, M27, M28, M31, M32 and M37. The sequence characteristics are as follows.

In some embodiments, an anti-mesothelin antibody or antigen-binding fragment provided herein includes one, two, three, four, five and/or six CDRs of any of the antibodies described herein. In some embodiments, the anti-mesothelin antibodies or antigen-binding fragments provided herein comprise a VL comprising one, two and/or three VL CDRs of table 1. In some embodiments, the anti-mesothelin antibodies or antigen-binding fragments provided herein comprise a VH comprising one, two and/or three VH CDRs in table 2. In some embodiments, the anti-mesothelin antibodies or antigen-binding fragments provided herein include one, two and/or three VL CDRs from table 1 and one, two and/or three VH CDRs from table 2.

TABLE 1 amino acid sequence of light chain variable region CDR (VL CDR) of anti-mesothelin Abs

/>

TABLE 2 amino acid sequences of the heavy chain variable region CDR (VH CDR) of anti-mesothelin Abs

In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof is a humanized antibody or antigen-binding fragment. In some embodiments, an anti-mesothelin antibody or antigen-binding fragment thereof comprises a VL CDR1, VL CDR2, VL CDR3, VH CDR1, VH CDR2 and/or VH CDR3 of an antibody or antigen-binding fragment of the invention. In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof comprises a variant of the antibody or antigen-binding fragment of the invention. In some embodiments, the variant of the anti-mesothelin antibody or antigen-binding fragment comprises a substitution, addition and/or deletion of 1 to 30 amino acids in the anti-mesothelin antibody or antigen-binding fragment. In some embodiments, the variant of the anti-mesothelin antibody or antigen binding fragment comprises a substitution, addition, and/or deletion of 1 to 25 amino acids in the anti-mesothelin antibody or antigen binding fragment. In some embodiments, the variant of the anti-mesothelin antibody or antigen-binding fragment comprises a substitution, addition and/or deletion of 1 to 20 amino acids in the anti-mesothelin antibody or antigen-binding fragment. In some embodiments, the variant of the anti-mesothelin antibody or antigen-binding fragment comprises a substitution, addition and/or deletion of 1 to 15 amino acids in the anti-mesothelin antibody or antigen-binding fragment. In some embodiments, the variant of the anti-mesothelin antibody or antigen binding fragment comprises a substitution, addition, and/or deletion of 1 to 10 amino acids in the anti-mesothelin antibody or antigen binding fragment. In some embodiments, the variant of the anti-mesothelin antibody or antigen-binding fragment comprises a substitution, addition and/or deletion of 1 to 5 amino acids in the anti-mesothelin antibody or antigen-binding fragment. In some embodiments, the variant of the anti-mesothelin antibody or antigen-binding fragment comprises a substitution, addition and/or deletion of 1 to 3 amino acids in the anti-mesothelin antibody or antigen-binding fragment. In some embodiments, the substitution, addition, and/or deletion of an amino acid is a conservative amino acid substitution. In some embodiments, the conservative amino acid substitution is in a CDR of the antibody or antigen-binding fragment. In some embodiments, the conservative amino acid substitution is not in a CDR of the antibody or antigen-binding fragment. In some embodiments, the conservative amino acid substitution is in a framework region of the antibody or antigen-binding fragment.

In some embodiments, the present invention provides an antibody or antigen-binding fragment thereof that specifically binds mesothelin (e.g., human mesothelin) comprising a light chain variable region (VL) comprising (1) a light chain CDR1 (VL CDR 1) having an amino acid sequence selected from the group consisting of SEQ ID NOs 1-15; (2) A light chain CDR2 (VL CDR 2) having an amino acid sequence selected from the group consisting of SEQ ID NOs 16-29; or (3) a light chain CDR3 (VL CDR 3) having an amino acid sequence selected from the group consisting of SEQ ID NOS: 30-44; or a variant thereof having up to about 3, about 5, about 8, about 10, about 12, or about 15 amino acid substitutions, additions and/or deletions in the VL CDR. In some embodiments, the variant has substitutions, additions and/or deletions of about 5 amino acids in the VL CDRs.

In some embodiments, the invention provides an antibody or antigen-binding fragment thereof that specifically binds mesothelin (e.g., human mesothelin) comprising a VL that comprises (1) a VL CDR1 having an amino acid sequence selected from the group consisting of SEQ ID NOs 1-15; (2) VL CDR2 having an amino acid sequence selected from the group consisting of SEQ ID NOs 16-29; and (3) a VL CDR3 having an amino acid sequence selected from the group consisting of SEQ ID NOs 30-44; or a variant thereof having up to about 3, about 5, about 8, about 10, about 12, or about 15 amino acid substitutions, additions and/or deletions in the VL CDR. In some embodiments, the variant has up to about 5 amino acid substitutions, additions and/or deletions in the VL CDRs.

In some embodiments, the present invention provides an antibody or antigen-binding fragment thereof that specifically binds mesothelin (e.g., human mesothelin) comprising a heavy chain variable region (VH) comprising (1) a heavy chain CDR1 (VH CDR 1) having an amino acid sequence selected from the group consisting of SEQ ID NOs: 45-57; (2) A heavy chain CDR2 (VH CDR 2) having an amino acid sequence selected from the group consisting of SEQ ID NOs 58-70; or (3) a heavy chain CDR3 (VH CDR 3) having an amino acid sequence selected from the group consisting of SEQ ID NOS 71-85; or a variant thereof having up to about 3, about 5, about 8, about 10, about 12, or about 15 amino acid substitutions, additions and/or deletions in the VH CDRs. In some embodiments, the variant has up to about 5 amino acid substitutions, additions and/or deletions in the VH CDRs.

In some embodiments, the invention provides an antibody or antigen-binding fragment thereof that specifically binds mesothelin (e.g., human mesothelin), comprising a VH comprising (1) a VH CDR1 having an amino acid sequence selected from the group consisting of SEQ ID NOs 45-57; (2) A VH CDR2 having an amino acid sequence selected from the group consisting of SEQ ID NOs 58-70; and (3) a VH CDR3 having an amino acid sequence selected from the group consisting of SEQ ID NOs 71-85; or a variant thereof having up to about 3, about 5, about 8, about 10, about 12, or about 15 amino acid substitutions, additions and/or deletions in the VH CDRs. In some embodiments, the variant has up to about 5 amino acid substitutions, additions and/or deletions in the VH CDRs.

In some embodiments, the invention provides an antibody or antigen-binding fragment thereof that specifically binds mesothelin (e.g., human mesothelin) comprising (a) a VL comprising (1) a VL CDR1 having an amino acid sequence selected from the group consisting of SEQ ID NOs 1-15; (2) VL CDR2 having an amino acid sequence selected from the group consisting of SEQ ID NOs 16-29; and (3) a VL CDR3 having an amino acid sequence selected from the group consisting of SEQ ID NOs 30-44; or a variant thereof having up to about 5 amino acid substitutions, additions and/or deletions in the VL CDR; and (b) a VH comprising (1) a VH CDR1 having an amino acid sequence selected from the group consisting of SEQ ID NOS 45-57; (2) A VH CDR2 having an amino acid sequence selected from the group consisting of SEQ ID NOs 58-70; and (3) a VH CDR3 having an amino acid sequence selected from the group consisting of SEQ ID NOs 71-85; or a variant thereof having up to about 5 amino acid substitutions, additions and/or deletions in the VH CDRs.

In some embodiments, the invention provides an antibody or antigen-binding fragment thereof that specifically binds mesothelin (e.g., human mesothelin) having a VL that includes a VL CDR1, CDR2, and CDR3, said VL CDR1, CDR2, and CDR3 having (1) the amino acid sequences set forth in SEQ ID NOs 1, 16, and 30, respectively; (2) the amino acid sequences shown in SEQ ID NO 2, 17 and 31; (3) amino acid sequences shown as SEQ ID NOS: 3, 18 and 32; (4) the amino acid sequences shown in SEQ ID NOS: 4, 19 and 33; (5) the amino acid sequences shown in SEQ ID NOS: 5, 20 and 34; (6) the amino acid sequences shown in SEQ ID NOS: 6, 21 and 35; (7) the amino acid sequences shown as SEQ ID NOS: 7, 22 and 36; (8) the amino acid sequences shown in SEQ ID NOS: 8, 23 and 37; (9) the amino acid sequences shown in SEQ ID NOS: 9, 24 and 38; (10) amino acid sequences shown in SEQ ID NOS: 10, 25 and 39; (11) the amino acid sequences shown as SEQ ID NOS: 11, 26 and 40; (12) the amino acid sequences shown as SEQ ID NOS: 12, 27 and 41; (13) the amino acid sequences shown as SEQ ID NOS: 13, 28 and 42; (14) the amino acid sequences shown as SEQ ID NOS: 14, 29 and 43; or (15) the amino acid sequences shown in SEQ ID NOS: 15, 18 and 44; or a variant thereof having up to about 3, about 5, about 8, about 10, about 12, or about 15 amino acid substitutions, additions and/or deletions in the VL CDR. In some embodiments, the variant has up to about 5 amino acid substitutions, additions and/or deletions in the VL CDRs.

In some embodiments, the invention provides an antibody or antigen-binding fragment thereof that specifically binds mesothelin (e.g., human mesothelin) having a VH comprising a VH CDR1, CDR2, and CDR3, said VH CDR1, CDR2, and CDR3 having (1) the amino acid sequences set forth in SEQ ID NOs 45, 58, and 71, respectively; (2) the amino acid sequences shown as SEQ ID NOS: 46, 59 and 72; (3) the amino acid sequences shown as SEQ ID NOS: 47, 60 and 73; (4) the amino acid sequences shown as SEQ ID NOS: 48, 61 and 74; (5) the amino acid sequences shown in SEQ ID NOS: 49, 62 and 75; (6) the amino acid sequences shown as SEQ ID NOS: 50, 63 and 76; (7) amino acid sequences shown as SEQ ID NOS: 51, 64 and 77; (8) the amino acid sequences shown as SEQ ID NOS: 52, 65 and 78; (9) amino acid sequences shown as SEQ ID NOS: 53, 66 and 79; (10) the amino acid sequences shown as SEQ ID NOS: 48, 61 and 80; (11) amino acid sequences shown as SEQ ID NOS: 54, 67 and 81; (12) the amino acid sequences shown as SEQ ID NOS: 53, 66 and 82; (13) the amino acid sequences shown in SEQ ID NOS: 55, 68 and 83; (14) the amino acid sequences shown as SEQ ID NOS: 56, 69 and 84; or (15) the amino acid sequences shown in SEQ ID NOS: 57, 70 and 85; or a variant thereof having up to about 3, about 5, about 8, about 10, about 12, or about 15 amino acid substitutions, additions and/or deletions in the VH CDR. In some embodiments, the variant has up to about 5 amino acid substitutions, additions and/or deletions in the VH CDRs.

In some embodiments, the invention provides an antibody or antigen-binding fragment thereof that specifically binds mesothelin (e.g., human mesothelin), having a VL and a VH. In some embodiments, the VL and VH are connected by a linker. The linker may be a flexible linker or a rigid linker. In some embodiments, the linker has an amino acid sequence of (GGGGS) n, n =1, 2, 3, 4, or 5 (SEQ ID NO: 191). In some embodiments, the linker has an amino acid sequence of (EAAAK) n, n =1, 2, 3, 4, or 5 (SEQ ID NO: 192). In some embodiments, the linker has an amino acid sequence of (PA) nP, n =1, 2, 3, 4, or 5 (SEQ ID NO: 193). In some embodiments, the linker has the amino acid sequence GGGGSGGGGSGGGS (SEQ ID NO: 194).

In some embodiments, the invention provides an antibody or antigen-binding fragment thereof that specifically binds mesothelin (e.g., human mesothelin) having a VL and a VH, wherein (a) the VL comprises a VL CDR1, CDR2 and CDR3, the VL CDR1, CDR2 and CDR3 having (1) the amino acid sequences set forth in

SEQ ID NOs

1, 16 and 30, respectively; (2) the amino acid sequences shown in SEQ ID NOS: 2, 17 and 31; (3) amino acid sequences shown in SEQ ID NOS: 3, 18 and 32; (4) the amino acid sequences shown in SEQ ID NOS: 4, 19 and 33; (5) the amino acid sequences shown in SEQ ID NOS: 5, 20 and 34; (6) the amino acid sequences shown in SEQ ID NOS: 6, 21 and 35; (7) the amino acid sequences shown as SEQ ID NOS: 7, 22 and 36;

(8) Amino acid sequences shown as SEQ ID NOS 8, 23 and 37; (9) the amino acid sequences shown in SEQ ID NOS: 9, 24 and 38; (10) the amino acid sequences shown in SEQ ID NO 10, 25 and 39; (11) the amino acid sequences shown as SEQ ID NOS: 11, 26 and 40; (12) the amino acid sequences shown as SEQ ID NOS: 12, 27 and 41; (13) the amino acid sequences shown as SEQ ID NOS: 13, 28 and 42; (14) the amino acid sequences shown as SEQ ID NOS: 14, 29 and 43; or (15) the amino acid sequences shown in SEQ ID NOS: 15, 18 and 44; or a variant thereof having up to about 5 amino acid substitutions, additions and/or deletions in the VL CDR; and (b) said VH comprises VH CDR1, CDR2 and CDR3, said VH CDR1, CDR2 and CDR3 having (1) the amino acid sequences shown in SEQ ID Nos. 45, 58 and 71, respectively; (2) the amino acid sequences shown as SEQ ID NOS: 46, 59 and 72; (3) amino acid sequences shown by SEQ ID NOS: 47, 60 and 73; (4) the amino acid sequences shown as SEQ ID NOS: 48, 61 and 74; (5) the amino acid sequences shown in SEQ ID NOS: 49, 62 and 75; (6) the amino acid sequences shown as SEQ ID NOS: 50, 63 and 76; (7) amino acid sequences shown by SEQ ID NOS: 51, 64 and 77; (8) the amino acid sequences shown as SEQ ID NOS: 52, 65 and 78; (9) amino acid sequences shown by SEQ ID NOS: 53, 66 and 79; (10) amino acid sequences shown as SEQ ID NOS 48, 61 and 80; (11) amino acid sequences shown as SEQ ID NOS: 54, 67 and 81; (12) the amino acid sequences shown as SEQ ID NOS: 53, 66 and 82; (13) the amino acid sequences shown in SEQ ID NOS: 55, 68 and 83; (14) the amino acid sequences shown as SEQ ID NOS: 56, 69 and 84; or (15) the amino acid sequences shown in SEQ ID NOS: 57, 70 and 85; or a variant thereof having up to about 5 amino acid substitutions, additions and/or deletions in the VH CDRs.

In some embodiments, the invention provides an antibody or antigen-binding fragment thereof that specifically binds mesothelin (e.g., human mesothelin) having a VL and a VH, wherein the VL comprises a VL CDR1, CDR2 and CDR3, and the VH comprises a VH CDR1, CDR2 and CDR3, and wherein the VL CDR1, VL CDR2, VL CDR3, VH CDR1, VH CDR2 and VH CDR3 have the amino acid sequences shown in (1) SEQ ID NOs 1, 16, 30, 45, 58 and 71, respectively; (2) 2, 17, 31, 46, 59 and 72; (3) 3, 18, 32, 47, 60 and 73; (4) Amino acid sequences shown as SEQ ID NOS 4, 19, 33, 48, 61 and 74; (5) Amino acid sequences shown as SEQ ID NOS 5, 20, 34, 49, 62 and 75; (6) Amino acid sequences shown as SEQ ID NOS 6, 21, 35, 50, 63 and 76; (7) Amino acid sequences shown as SEQ ID NOS 7, 22, 36, 51, 64 and 77; (8) The amino acid sequences shown as SEQ ID NOS: 8, 23, 37, 52, 65 and 78; (9) 9, 24, 38, 53, 66 and 79; (10) 10, 25, 39, 48, 61 and 80; (11) 11, 26, 40, 54, 67 and 81; (12) 12, 27, 41, 53, 66 and 82; (13) 13, 28, 42, 55, 68 and 83 of SEQ ID NO; (14) 14, 29, 43, 56, 69 and 84; or (15) the amino acid sequences shown in SEQ ID NOS: 15, 18, 44, 57, 70 and 85; or a variant thereof having substitutions, additions and/or deletions of about 5 amino acids in the CDRs.

In some embodiments, the invention provides an antibody or antigen-binding fragment thereof that specifically binds mesothelin (e.g., human mesothelin) having a VL that includes (1) a VL CDR1 having the amino acid sequence set forth in SEQ ID No. 1; (2) VL CDR2 having the amino acid sequence shown in SEQ ID NO. 16, or (3) VL CDR3 having the amino acid sequence shown in SEQ ID NO. 30. The VL can have VL CDR1, VL CDR2, and VL CDR3, the VL CDR1, VL CDR2, and VL CDR3 having the amino acid sequences shown in

SEQ ID NOs

1, 16, and 30, respectively. In some embodiments, the invention provides an antibody or antigen-binding fragment thereof that specifically binds mesothelin (e.g., human mesothelin) having a VH comprising (1) a VH CDR1 having the amino acid sequence shown in SEQ ID NO: 45; (2) VH CDR2 having an amino acid sequence shown in SEQ ID NO: 58; or (3) VH CDR3 having the amino acid sequence shown in SEQ ID NO: 71. The VH may have VH CDR1, VH CDR2 and VH CDR3, the VH CDR1, VH CDR2 and VH CDR3 having the amino acid sequences shown in SEQ ID Nos 45, 58 and 71, respectively. In some embodiments, the invention provides an antibody or antigen-binding fragment thereof that specifically binds mesothelin (e.g., human mesothelin) comprising (a) a VL comprising a VL CDR1, a VL CDR2, and a VL CDR3, the VL CDR1, VL CDR2, and VL CDR3 having the amino acid sequences set forth in

SEQ ID NOs

1, 16, and 30, respectively; and (b) a VH comprising VH CDR1, VH CDR2 and VH CDR3, said VH CDR1, VH CDR2 and VH CDR3 having the amino acid sequences shown in SEQ ID NO:45, 58 and 71, respectively.

In some embodiments, the invention provides an antibody or antigen-binding fragment thereof that specifically binds mesothelin (e.g., human mesothelin) with a VL that includes (1) a VL CDR1 having the amino acid sequence set forth in SEQ ID No. 2; (2) VL CDR2 having the amino acid sequence shown in SEQ ID NO:17, or (3) VL CDR3 having the amino acid sequence shown in SEQ ID NO: 31. The VL can have a VL CDR1, a VL CDR2, and a VL CDR3, the VL CDR1, VL CDR2, and VL CDR3 having the amino acid sequences shown in SEQ ID NOs 2, 17, and 31, respectively. In some embodiments, the invention provides an antibody or antigen-binding fragment thereof that specifically binds mesothelin (e.g., human mesothelin) having a VH comprising (1) a VH CDR1 having the amino acid sequence set forth in SEQ ID NO: 46; (2) VH CDR2 having the amino acid sequence shown in SEQ ID NO:59, or (3) VH CDR3 having the amino acid sequence shown in SEQ ID NO: 72. The VH can have VH CDR1, VH CDR2 and VH CDR3, and the VH CDR1, VH CDR2 and VH CDR3 have amino acid sequences shown in SEQ ID NO 46, 59 and 72 respectively. In some embodiments, the invention provides an antibody or antigen-binding fragment thereof that specifically binds mesothelin (e.g., human mesothelin), comprising (a) a VL comprising a VL CDR1, a VL CDR2 and a VL CDR3, said VL CDR1, VL CDR2 and VL CDR3 having the amino acid sequences set forth in SEQ ID NOs 2, 17 and 31, respectively; and (b) a VH comprising VH CDR1, VH CDR2 and VH CDR3, said VH CDR1, VH CDR2 and VH CDR3 having the amino acid sequences shown in SEQ ID NOs 46, 59 and 72, respectively.

In some embodiments, the invention provides an antibody or antigen-binding fragment thereof that specifically binds mesothelin (e.g., human mesothelin) with a VL that includes (1) a VL CDR1 having the amino acid sequence set forth in SEQ ID No. 3; (2) VL CDR2 having the amino acid sequence shown in SEQ ID NO:18, or (3) VL CDR3 having the amino acid sequence shown in SEQ ID NO: 32. The VL can have VL CDR1, VL CDR2, and VL CDR3, the VL CDR1, VL CDR2, and VL CDR3 having the amino acid sequences shown in SEQ ID NOs 3, 18, and 32, respectively. In some embodiments, the invention provides an antibody or antigen-binding fragment thereof that specifically binds mesothelin (e.g., human mesothelin) having a VH comprising (1) a VH CDR1 having the amino acid sequence shown in SEQ ID NO: 47; (2) VH CDR2 having the amino acid sequence shown in SEQ ID NO:60, or (3) VH CDR3 having the amino acid sequence shown in SEQ ID NO: 73. The VH may have VH CDR1, VH CDR2 and VH CDR3, the VH CDR1, VH CDR2 and VH CDR3 having the amino acid sequences shown in SEQ ID Nos 47, 60 and 73, respectively. In some embodiments, the invention provides an antibody or antigen-binding fragment thereof that specifically binds mesothelin (e.g., human mesothelin), comprising (a) a VL comprising a VL CDR1, VL CDR2 and VL CDR3, said VL CDR1, VL CDR2 and VL CDR3 having the amino acid sequences set forth in SEQ ID NOs 3, 18 and 32, respectively; and (b) a VH comprising a VH CDR1, a VH CDR2, and a VH CDR3, the VH CDR1, VH CDR2, and VH CDR3 having amino acid sequences shown in SEQ ID NOs 47, 60, and 73, respectively.

In some embodiments, the invention provides an antibody or antigen-binding fragment thereof that specifically binds mesothelin (e.g., human mesothelin) with a VL that includes (1) a VL CDR1 having the amino acid sequence set forth in SEQ ID No. 4; (2) VL CDR2 having the amino acid sequence shown by SEQ ID NO:19, or (3) VL CDR3 having the amino acid sequence shown by SEQ ID NO: 33. The VL may have VL CDR1, VL CDR2 and VL CDR3, the VL CDR1, VL CDR2 and VL CDR3 having amino acid sequences shown in SEQ ID Nos. 4, 19 and 33, respectively. In some embodiments, the invention provides an antibody or antigen-binding fragment thereof that specifically binds mesothelin (e.g., human mesothelin) having a VH comprising (1) a VH CDR1 having the amino acid sequence set forth in SEQ ID No. 48; (2) VH CDR2 having the amino acid sequence shown in SEQ ID NO:61, or (3) VH CDR3 having the amino acid sequence shown in SEQ ID NO: 74. The VH may have VH CDR1, VH CDR2 and VH CDR3, the VH CDR1, VH CDR2 and VH CDR3 having the amino acid sequences shown in SEQ ID Nos 48, 61 and 74, respectively. In some embodiments, the invention provides an antibody or antigen-binding fragment thereof that specifically binds mesothelin (e.g., human mesothelin) comprising (a) a VL comprising a VL CDR1, a VL CDR2, and a VL CDR3, the VL CDR1, VL CDR2, and VL CDR3 having the amino acid sequences set forth in SEQ ID NOs 4, 19, and 33, respectively; and (b) a VH comprising VH CDR1, VH CDR2 and VH CDR3, said VH CDR1, VH CDR2 and VH CDR3 having amino acid sequences shown in SEQ ID NOS: 48, 61 and 74, respectively.

In some embodiments, the invention provides an antibody or antigen-binding fragment thereof that specifically binds mesothelin (e.g., human mesothelin) with a VL that includes (1) a VL CDR1 having the amino acid sequence set forth in SEQ ID No. 5; (2) VL CDR2 having the amino acid sequence shown in SEQ ID NO. 20, or (3) VL CDR3 having the amino acid sequence shown in SEQ ID NO. 34. The VL can have a VL CDR1, a VL CDR2, and a VL CDR3, the VL CDR1, VL CDR2, and VL CDR3 having the amino acid sequences shown in

SEQ ID NOs

5, 20, and 34, respectively. In some embodiments, the invention provides an antibody or antigen-binding fragment thereof that specifically binds mesothelin (e.g., human mesothelin) having a VH comprising (1) a VH CDR1 having the amino acid sequence shown in SEQ ID No. 49; (2) VH CDR2 having the amino acid sequence shown in SEQ ID NO:62, or (3) VH CDR3 having the amino acid sequence shown in SEQ ID NO: 75. The VH may have VH CDR1, VH CDR2 and VH CDR3, the VH CDR1, VH CDR2 and VH CDR3 having the amino acid sequences shown in SEQ ID Nos 49, 62 and 75, respectively. In some embodiments, the invention provides an antibody or antigen-binding fragment thereof that specifically binds mesothelin (e.g., human mesothelin) comprising (a) a VL comprising a VL CDR1, a VL CDR2, and a VL CDR3, the VL CDR1, VL CDR2, and VL CDR3 having the amino acid sequences set forth in

SEQ ID NOs

5, 20, and 34, respectively; and (b) a VH comprising VH CDR1, VH CDR2 and VH CDR3, said VH CDR1, VH CDR2 and VH CDR3 having the amino acid sequences shown in SEQ ID NOS: 49, 62 and 75, respectively.

In some embodiments, the invention provides an antibody or antigen-binding fragment thereof that specifically binds mesothelin (e.g., human mesothelin) with a VL that includes (1) a VL CDR1 having the amino acid sequence set forth in SEQ ID No. 6; (2) VL CDR2 having the amino acid sequence shown in SEQ ID NO:21, or (3) VL CDR3 having the amino acid sequence shown in SEQ ID NO: 35. The VL can have a VL CDR1, a VL CDR2, and a VL CDR3, the VL CDR1, VL CDR2, and VL CDR3 having the amino acid sequences shown in SEQ ID NOs 6, 21, and 35, respectively. In some embodiments, the invention provides an antibody or antigen-binding fragment thereof that specifically binds mesothelin (e.g., human mesothelin) having a VH comprising (1) a VH CDR1 having the amino acid sequence shown in SEQ ID NO: 50; (2) VH CDR2 having the amino acid sequence shown in SEQ ID NO:63, or (3) VH CDR3 having the amino acid sequence shown in SEQ ID NO: 76. The VH may have VH CDR1, VH CDR2 and VH CDR3, the VH CDR1, VH CDR2 and VH CDR3 having the amino acid sequences shown in SEQ ID Nos 50, 63 and 76, respectively. In some embodiments, the invention provides an antibody or antigen-binding fragment thereof that specifically binds mesothelin (e.g., human mesothelin), comprising (a) a VL comprising a VL CDR1, a VL CDR2 and a VL CDR3, said VL CDR1, VL CDR2 and VL CDR3 having the amino acid sequences set forth in SEQ ID NOs 6, 21 and 35, respectively; and (b) a VH comprising a VH CDR1, a VH CDR2, and a VH CDR3, the VH CDR1, VH CDR2, and VH CDR3 having amino acid sequences shown in SEQ ID NOs 50, 63, and 76, respectively.

In some embodiments, the invention provides an antibody or antigen-binding fragment thereof that specifically binds mesothelin (e.g., human mesothelin) with a VL that includes (1) a VL CDR1 having the amino acid sequence set forth in SEQ ID No. 7; (2) VL CDR2 having the amino acid sequence shown in SEQ ID NO:22, or (3) VL CDR3 having the amino acid sequence shown in SEQ ID NO: 36. The VL can have a VL CDR1, a VL CDR2, and a VL CDR3, the VL CDR1, VL CDR2, and VL CDR3 having the amino acid sequences shown in SEQ ID NOs 7, 22, and 36, respectively. In some embodiments, the present invention provides an antibody or antigen-binding fragment thereof that specifically binds mesothelin (e.g., human mesothelin) having a VH comprising (1) a VH CDR1 having the amino acid sequence set forth in SEQ ID NO: 51; (2) VH CDR2 having the amino acid sequence shown in SEQ ID NO:64, or (3) VH CDR3 having the amino acid sequence shown in SEQ ID NO: 77. The VH may have VH CDR1, VH CDR2 and VH CDR3, the VH CDR1, VH CDR2 and VH CDR3 having the amino acid sequences shown in SEQ ID NO 51, 64 and 77 respectively. In some embodiments, the invention provides an antibody or antigen-binding fragment thereof that specifically binds mesothelin (e.g., human mesothelin), comprising (a) a VL comprising a VL CDR1, a VL CDR2 and a VL CDR3, said VL CDR1, VL CDR2 and VL CDR3 having the amino acid sequences set forth in SEQ ID NOs 7, 22 and 36, respectively; and (b) a VH comprising VH CDR1, VH CDR2 and VH CDR3, said VH CDR1, VH CDR2 and VH CDR3 having the amino acid sequences shown in SEQ ID NO:51, 64 and 77, respectively.

In some embodiments, the invention provides an antibody or antigen-binding fragment thereof that specifically binds mesothelin (e.g., human mesothelin) with a VL that includes (1) a VL CDR1 having the amino acid sequence set forth in SEQ ID No. 8; (2) VL CDR2 having the amino acid sequence shown in SEQ ID NO. 23, or (3) VL CDR3 having the amino acid sequence shown in SEQ ID NO. 37. The VL can have VL CDR1, VL CDR2, and VL CDR3, the VL CDR1, VL CDR2, and VL CDR3 having the amino acid sequences shown in SEQ ID NOs 8, 23, and 37, respectively. In some embodiments, the invention provides an antibody or antigen-binding fragment thereof that specifically binds mesothelin (e.g., human mesothelin) having a VH comprising (1) a VH CDR1 having the amino acid sequence shown in SEQ ID No. 52; (2) VH CDR2 having the amino acid sequence shown in SEQ ID NO:65, or (3) VH CDR3 having the amino acid sequence shown in SEQ ID NO: 78. The VH may have VH CDR1, VH CDR2 and VH CDR3, the VH CDR1, VH CDR2 and VH CDR3 having the amino acid sequences shown in SEQ ID Nos 52, 65 and 78, respectively. In some embodiments, the invention provides an antibody or antigen-binding fragment thereof that specifically binds mesothelin (e.g., human mesothelin), comprising (a) a VL comprising a VL CDR1, a VL CDR2 and a VL CDR3, said VL CDR1, VL CDR2 and VL CDR3 having the amino acid sequences set forth in SEQ ID NOs 8, 23 and 37, respectively; and (b) a VH comprising VH CDR1, VH CDR2 and VH CDR3, said VH CDR1, VH CDR2 and VH CDR3 having the amino acid sequences shown in SEQ ID NOs 52, 65 and 78, respectively.

In some embodiments, the invention provides an antibody or antigen-binding fragment thereof that specifically binds mesothelin (e.g., human mesothelin) having a VL that includes (1) a VL CDR1 having the amino acid sequence set forth in SEQ ID No. 9; (2) VL CDR2 having the amino acid sequence shown in SEQ ID NO. 24, or (3) VL CDR3 having the amino acid sequence shown in SEQ ID NO. 38. The VL can have a VL CDR1, a VL CDR2, and a VL CDR3, the VL CDR1, VL CDR2, and VL CDR3 having the amino acid sequences shown in SEQ ID NOs 9, 24, and 38, respectively. In some embodiments, the invention provides an antibody or antigen-binding fragment thereof that specifically binds mesothelin (e.g., human mesothelin) having a VH comprising (1) a VH CDR1 having the amino acid sequence shown in SEQ ID NO: 53; (2) VH CDR2 having the amino acid sequence shown in SEQ ID NO:66, or (3) VH CDR3 having the amino acid sequence shown in SEQ ID NO: 79. The VH may have VH CDR1, VH CDR2 and VH CDR3, the VH CDR1, VH CDR2 and VH CDR3 having amino acid sequences shown in SEQ ID Nos 53, 66 and 79, respectively. In some embodiments, the invention provides an antibody or antigen-binding fragment thereof that specifically binds mesothelin (e.g., human mesothelin), comprising (a) a VL comprising a VL CDR1, VL CDR2 and VL CDR3, said VL CDR1, VL CDR2 and VL CDR3 having the amino acid sequences set forth in SEQ ID NOs 9, 24 and 38, respectively; and (b) a VH comprising VH CDR1, VH CDR2 and VH CDR3, said VH CDR1, VH CDR2 and VH CDR3 having the amino acid sequences shown in SEQ ID NO:53, 66 and 79, respectively.

In some embodiments, the invention provides an antibody or antigen-binding fragment thereof that specifically binds mesothelin (e.g., human mesothelin) having a VL that includes (1) a VL CDR1 having the amino acid sequence set forth in SEQ ID No. 10; (2) VL CDR2 having the amino acid sequence shown in SEQ ID NO. 25, or (3) VL CDR3 having the amino acid sequence shown in SEQ ID NO. 39. The VL can have a VL CDR1, a VL CDR2, and a VL CDR3, the VL CDR1, VL CDR2, and VL CDR3 having the amino acid sequences shown in SEQ ID NOs 10, 25, and 39, respectively. In some embodiments, the invention provides an antibody or antigen-binding fragment thereof that specifically binds mesothelin (e.g., human mesothelin) having a VH comprising (1) a VH CDR1 having the amino acid sequence set forth in SEQ ID No. 48; (2) VH CDR2 having the amino acid sequence shown in SEQ ID NO:61, or (3) VH CDR3 having the amino acid sequence shown in SEQ ID NO: 80. The VH can have VH CDR1, VH CDR2 and VH CDR3, and the VH CDR1, VH CDR2 and VH CDR3 have amino acid sequences shown in SEQ ID NO 48, 61 and 80 respectively. In some embodiments, the invention provides an antibody or antigen-binding fragment thereof that specifically binds mesothelin (e.g., human mesothelin) comprising (a) a VL comprising a VL CDR1, a VL CDR2, and a VL CDR3, the VL CDR1, VL CDR2, and VL CDR3 having the amino acid sequences set forth in SEQ ID NOs 10, 25, and 39, respectively; and (b) a VH comprising a VH CDR1, a VH CDR2 and a VH CDR3, said VH CDR1, VH CDR2 and VH CDR3 having amino acid sequences shown in SEQ ID Nos. 48, 61 and 80, respectively.

In some embodiments, the invention provides an antibody or antigen-binding fragment thereof that specifically binds mesothelin (e.g., human mesothelin) with a VL that includes (1) a VL CDR1 having the amino acid sequence set forth in SEQ ID No. 11; (2) VL CDR2 having the amino acid sequence shown in SEQ ID NO. 26, or (3) VL CDR3 having the amino acid sequence shown in SEQ ID NO. 40. The VL may have VL CDR1, VL CDR2 and VL CDR3, the VL CDR1, VL CDR2 and VL CDR3 having amino acid sequences shown in SEQ ID Nos. 11, 26 and 40, respectively. In some embodiments, the invention provides an antibody or antigen-binding fragment thereof that specifically binds mesothelin (e.g., human mesothelin) having a VH comprising (1) a VH CDR1 having the amino acid sequence shown in SEQ ID NO: 54; (2) VH CDR2 having the amino acid sequence shown in SEQ ID NO:67, or (3) VH CDR3 having the amino acid sequence shown in SEQ ID NO: 81. The VH may have VH CDR1, VH CDR2 and VH CDR3, the VH CDR1, VH CDR2 and VH CDR3 having the amino acid sequences shown in SEQ ID NO:54, 67 and 81, respectively. In some embodiments, the invention provides an antibody or antigen-binding fragment thereof that specifically binds mesothelin (e.g., human mesothelin), comprising (a) a VL comprising a VL CDR1, VL CDR2 and VL CDR3, said VL CDR1, VL CDR2 and VL CDR3 having the amino acid sequences set forth in

SEQ ID NOs

11, 26 and 40, respectively; and (b) a VH comprising VH CDR1, VH CDR2 and VH CDR3, said VH CDR1, VH CDR2 and VH CDR3 having the amino acid sequences shown in SEQ ID NOS: 54, 67 and 81, respectively.

In some embodiments, the invention provides an antibody or antigen-binding fragment thereof that specifically binds mesothelin (e.g., human mesothelin) with a VL that includes (1) a VL CDR1 having the amino acid sequence set forth in SEQ ID No. 12; (2) VL CDR2 having the amino acid sequence shown by SEQ ID NO:27, or (3) VL CDR3 having the amino acid sequence shown by SEQ ID NO: 41. The VL may have VL CDR1, VL CDR2 and VL CDR3, the VL CDR1, VL CDR2 and VL CDR3 having amino acid sequences shown in SEQ ID Nos. 12, 27 and 41, respectively. In some embodiments, the invention provides an antibody or antigen-binding fragment thereof that specifically binds mesothelin (e.g., human mesothelin) having a VH comprising (1) a VH CDR1 having the amino acid sequence shown in SEQ ID No. 53; (2) VH CDR2 having the amino acid sequence shown in SEQ ID NO:66, or (3) VH CDR3 having the amino acid sequence shown in SEQ ID NO: 82. The VH may have VH CDR1, VH CDR2 and VH CDR3, the VH CDR1, VH CDR2 and VH CDR3 having the amino acid sequences shown in SEQ ID Nos 53, 66 and 82, respectively. In some embodiments, the invention provides an antibody or antigen-binding fragment thereof that specifically binds mesothelin (e.g., human mesothelin), comprising (a) a VL comprising a VL CDR1, VL CDR2 and VL CDR3, said VL CDR1, VL CDR2 and VL CDR3 having the amino acid sequences set forth in SEQ ID NOs 12, 27 and 41, respectively; and (b) a VH comprising VH CDR1, VH CDR2 and VH CDR3, said VH CDR1, VH CDR2 and VH CDR3 having the amino acid sequences shown in SEQ ID NO:53, 66 and 82, respectively.

In some embodiments, the invention provides an antibody or antigen-binding fragment thereof that specifically binds mesothelin (e.g., human mesothelin) having a VL that includes (1) a VL CDR1 having the amino acid sequence set forth in SEQ ID No. 13; (2) VL CDR2 having the amino acid sequence shown in SEQ ID NO. 28, or (3) VL CDR3 having the amino acid sequence shown in SEQ ID NO. 42. The VL may have VL CDR1, VL CDR2 and VL CDR3, the VL CDR1, VL CDR2 and VL CDR3 having amino acid sequences shown in SEQ ID Nos. 13, 28 and 42, respectively. In some embodiments, the invention provides an antibody or antigen-binding fragment thereof that specifically binds mesothelin (e.g., human mesothelin) having a VH comprising (1) a VH CDR1 having the amino acid sequence shown in SEQ ID NO: 55; (2) VH CDR2 having the amino acid sequence shown in SEQ ID NO:68, or (3) VH CDR3 having the amino acid sequence shown in SEQ ID NO: 83. The VH may have VH CDR1, VH CDR2 and VH CDR3, the VH CDR1, VH CDR2 and VH CDR3 having the amino acid sequences shown in SEQ ID Nos 55, 68 and 83, respectively. In some embodiments, the invention provides an antibody or antigen-binding fragment thereof that specifically binds mesothelin (e.g., human mesothelin), comprising (a) a VL comprising a VL CDR1, a VL CDR2 and a VL CDR3, said VL CDR1, VL CDR2 and VL CDR3 having the amino acid sequences set forth in SEQ ID NOs 13, 28 and 42, respectively; and (b) a VH comprising VH CDR1, VH CDR2 and VH CDR3, said VH CDR1, VH CDR2 and VH CDR3 having amino acid sequences shown in SEQ ID NOS: 55, 68 and 83, respectively.

In some embodiments, the invention provides an antibody or antigen-binding fragment thereof that specifically binds mesothelin (e.g., human mesothelin) with a VL that includes (1) a VL CDR1 having the amino acid sequence set forth in SEQ ID No. 14; (2) VL CDR2 having the amino acid sequence shown in SEQ ID NO. 29, or (3) VL CDR3 having the amino acid sequence shown in SEQ ID NO. 43. The VL may have VL CDR1, VL CDR2 and VL CDR3, the VL CDR1, VL CDR2 and VL CDR3 having amino acid sequences shown in SEQ ID Nos. 14, 29 and 43, respectively. In some embodiments, the invention provides an antibody or antigen-binding fragment thereof that specifically binds mesothelin (e.g., human mesothelin) having a VH comprising (1) a VH CDR1 having the amino acid sequence shown in SEQ ID No. 56; (2) VH CDR2 having the amino acid sequence shown in SEQ ID NO:69, or (3) VH CDR3 having the amino acid sequence shown in SEQ ID NO: 84. The VH can have VH CDR1, VH CDR2 and VH CDR3, and the VH CDR1, VH CDR2 and VH CDR3 have amino acid sequences shown in

SEQ ID NO

56, 69 and 84 respectively. In some embodiments, the invention provides an antibody or antigen-binding fragment thereof that specifically binds mesothelin (e.g., human mesothelin), comprising (a) a VL comprising a VL CDR1, VL CDR2 and VL CDR3, said VL CDR1, VL CDR2 and VL CDR3 having the amino acid sequences set forth in SEQ ID NOs 14, 29 and 43, respectively; and (b) a VH comprising a VH CDR1, a VH CDR2, and a VH CDR3, the VH CDR1, VH CDR2, and VH CDR3 having amino acid sequences shown in

SEQ ID NOs

56, 69, and 84, respectively.

In some embodiments, the invention provides an antibody or antigen-binding fragment thereof that specifically binds mesothelin (e.g., human mesothelin) with a VL that includes (1) a VL CDR1 having the amino acid sequence set forth in SEQ ID No. 15; (2) VL CDR2 having the amino acid sequence shown in SEQ ID NO. 18, or (3) VL CDR3 having the amino acid sequence shown in SEQ ID NO. 44. The VL may have VL CDR1, VL CDR2 and VL CDR3, the VL CDR1, VL CDR2 and VL CDR3 having amino acid sequences shown in SEQ ID Nos. 15, 18 and 44, respectively. In some embodiments, the invention provides an antibody or antigen-binding fragment thereof that specifically binds mesothelin (e.g., human mesothelin) having a VH comprising (1) a VH CDR1 having the amino acid sequence shown in SEQ ID No. 57; (2) VH CDR2 having the amino acid sequence shown in SEQ ID NO:70, or (3) VH CDR3 having the amino acid sequence shown in SEQ ID NO: 85. The VH may have VH CDR1, VH CDR2 and VH CDR3, the VH CDR1, VH CDR2 and VH CDR3 having the amino acid sequences shown in SEQ ID Nos 57, 70 and 85, respectively. In some embodiments, the invention provides an antibody or antigen-binding fragment thereof that specifically binds mesothelin (e.g., human mesothelin), comprising (a) a VL comprising a VL CDR1, VL CDR2 and VL CDR3, said VL CDR1, VL CDR2 and VL CDR3 having the amino acid sequences set forth in SEQ ID NOs 15, 18 and 44, respectively; and (b) a VH comprising VH CDR1, VH CDR2 and VH CDR3, said VH CDR1, VH CDR2 and VH CDR3 having the amino acid sequences shown in SEQ ID NOs: 57, 70 and 85, respectively.

In some embodiments, the antibodies or antigen-binding fragments thereof that specifically bind mesothelin (e.g., human mesothelin) provided herein include a VL that has at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to an amino acid sequence selected from the group consisting of SEQ ID NOs 86-100. In some embodiments, the antibodies or antigen-binding fragments thereof that specifically bind mesothelin (e.g., human mesothelin) provided herein include a VH having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to an amino acid sequence selected from the group consisting of SEQ ID NOs 101-115.

TABLE 3 amino acid sequences of light chain variable regions (VLs) and heavy chain variable regions (VHs) of anti-mesothelin antibodies

/>

/>

In some embodiments, the invention provides an antibody or antigen-binding fragment thereof that specifically binds mesothelin (e.g., human mesothelin) comprising: (a) A VL having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to an amino acid sequence selected from the group consisting of SEQ ID NO 86-100; and (b) a VH having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to an amino acid sequence selected from the group consisting of SEQ ID NOs 101-115.

In some embodiments, the antibodies or antigen-binding fragments thereof that specifically bind mesothelin (e.g., human mesothelin) provided herein include a VL that has at least 80%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the amino acid sequence set forth in SEQ ID No. 86. In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof has a VL that has at least 85% sequence identity to the sequence set forth in SEQ ID No. 86. In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof has a VL that has at least 90% sequence identity to the sequence set forth in SEQ ID No. 86. In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof has a VL that has at least 95% sequence identity to the sequence set forth in SEQ ID No. 86. In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof has a VL that has at least 98% sequence identity to the sequence set forth in SEQ ID No. 86. In some embodiments, an antibody or antigen-binding fragment thereof that specifically binds mesothelin (e.g., human mesothelin) provided herein comprises a VL having an amino acid sequence set forth in SEQ ID NO: 86.

In some embodiments, the antibodies or antigen-binding fragments thereof that specifically bind mesothelin (e.g., human mesothelin) provided herein include a VL that has at least 80%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the amino acid sequence set forth in SEQ ID No. 87. In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof has a VL that has at least 85% sequence identity to the sequence set forth in SEQ ID No. 87. In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof has a VL that has at least 90% sequence identity to the sequence set forth in SEQ ID No. 87. In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof has a VL that has at least 95% sequence identity to the sequence set forth in SEQ ID No. 87. In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof has a VL that has at least 98% sequence identity to the sequence set forth in SEQ ID No. 87. In some embodiments, an antibody or antigen-binding fragment thereof that specifically binds mesothelin (e.g., human mesothelin) provided herein comprises a VL having an amino acid sequence set forth in SEQ ID NO: 87.

In some embodiments, the antibodies or antigen-binding fragments thereof that specifically bind mesothelin (e.g., human mesothelin) provided herein include a VL that has at least 80%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the amino acid sequence set forth in SEQ ID No. 88. In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof has a VL that has at least 85% sequence identity to the sequence set forth in SEQ ID NO: 88. In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof has a VL that has at least 90% sequence identity to the sequence set forth in SEQ ID NO: 88. In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof has a VL that has at least 95% sequence identity to the sequence set forth in SEQ ID NO: 88. In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof has a VL that has at least 98% sequence identity to the sequence set forth in SEQ ID NO: 88. In some embodiments, an antibody or antigen-binding fragment thereof that specifically binds mesothelin (e.g., human mesothelin) provided herein comprises a VL having an amino acid sequence set forth in SEQ ID NO: 88.

In some embodiments, the antibodies or antigen-binding fragments thereof that specifically bind mesothelin (e.g., human mesothelin) provided herein include a VL that has at least 80%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the amino acid sequence set forth in SEQ ID No. 89. In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof has a VL that has at least 85% sequence identity to the sequence set forth in SEQ ID No. 89. In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof has a VL that has at least 90% sequence identity to the sequence set forth in SEQ ID No. 89. In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof has a VL that has at least 95% sequence identity to the sequence set forth in SEQ ID No. 89. In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof has a VL that has at least 98% sequence identity to the sequence set forth in SEQ ID No. 89. In some embodiments, an antibody or antigen-binding fragment thereof that specifically binds mesothelin (e.g., human mesothelin) provided herein comprises a VL having the amino acid sequence set forth in SEQ ID NO: 89.

In some embodiments, the antibodies or antigen-binding fragments thereof that specifically bind mesothelin (e.g., human mesothelin) provided herein include a VL that has at least 80%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the amino acid sequence set forth in SEQ ID No. 90. In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof has a VL that has at least 85% sequence identity to the sequence set forth in SEQ ID No. 90. In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof has a VL that has at least 90% sequence identity to the sequence set forth in SEQ ID No. 90. In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof has a VL that has at least 95% sequence identity to the sequence set forth in SEQ ID No. 90. In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof has a VL that has at least 98% sequence identity to the sequence set forth in SEQ ID No. 90. In some embodiments, an antibody or antigen-binding fragment thereof that specifically binds mesothelin (e.g., human mesothelin) provided herein comprises a VL having the amino acid sequence set forth in SEQ ID NO: 90.

In some embodiments, the antibodies or antigen-binding fragments thereof that specifically bind mesothelin (e.g., human mesothelin) provided herein include a VL that has at least 80%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the amino acid sequence set forth in SEQ ID No. 91. In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof has a VL that has at least 85% sequence identity to the sequence set forth in SEQ ID No. 91. In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof has a VL that has at least 90% sequence identity to the sequence set forth in SEQ ID No. 91. In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof has a VL that has at least 95% sequence identity to the sequence set forth in SEQ ID No. 91. In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof has a VL that has at least 98% sequence identity to the sequence set forth in SEQ ID No. 91. In some embodiments, the antibodies or antigen-binding fragments thereof that specifically bind mesothelin (e.g., human mesothelin) provided herein include a VL having the amino acid sequence set forth in SEQ ID NO: 91.

In some embodiments, the antibodies or antigen-binding fragments thereof that specifically bind mesothelin (e.g., human mesothelin) provided herein include a VL that has at least 80%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the amino acid sequence set forth in SEQ ID No. 92. In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof has a VL that has at least 85% sequence identity to the sequence set forth in SEQ ID NO: 92. In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof has a VL that has at least 90% sequence identity to the sequence set forth in SEQ ID No. 92. In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof has a VL that has at least 95% sequence identity to the sequence set forth in SEQ ID NO: 92. In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof has a VL that has at least 98% sequence identity to the sequence set forth in SEQ ID NO: 92. In some embodiments, an antibody or antigen-binding fragment thereof that specifically binds mesothelin (e.g., human mesothelin) provided herein comprises a VL having an amino acid sequence set forth in SEQ ID NO: 92.

In some embodiments, the antibodies or antigen-binding fragments thereof that specifically bind mesothelin (e.g., human mesothelin) provided herein include a VL that has at least 80%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the amino acid sequence set forth in SEQ ID No. 93. In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof has a VL that has at least 85% sequence identity to the sequence set forth in SEQ ID No. 93. In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof has a VL that has at least 90% sequence identity to the sequence set forth in SEQ ID No. 93. In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof has a VL that has at least 95% sequence identity to the sequence set forth in SEQ ID No. 93. In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof has a VL that has at least 98% sequence identity to the sequence set forth in SEQ ID No. 93. In some embodiments, an antibody or antigen-binding fragment thereof that specifically binds mesothelin (e.g., human mesothelin) provided herein comprises a VL having an amino acid sequence set forth in SEQ ID NO: 93.

In some embodiments, the antibodies or antigen-binding fragments thereof that specifically bind mesothelin (e.g., human mesothelin) provided herein include a VL that has at least 80%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the amino acid sequence set forth in SEQ ID No. 94. In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof has a VL that has at least 85% sequence identity to the sequence set forth in SEQ ID No. 94. In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof has a VL that has at least 90% sequence identity to the sequence set forth in SEQ ID No. 94. In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof has a VL that has at least 95% sequence identity to the sequence set forth in SEQ ID No. 94. In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof has a VL that has at least 98% sequence identity to the sequence set forth in SEQ ID No. 94. In some embodiments, an antibody or antigen-binding fragment thereof that specifically binds mesothelin (e.g., human mesothelin) provided herein comprises a VL having an amino acid sequence set forth in SEQ ID NO: 94.

In some embodiments, the antibodies or antigen-binding fragments thereof that specifically bind mesothelin (e.g., human mesothelin) provided herein include a VL that has at least 80%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the amino acid sequence set forth in SEQ ID No. 95. In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof has a VL that has at least 85% sequence identity to the sequence set forth in SEQ ID No. 95. In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof has a VL that has at least 90% sequence identity to the sequence set forth in SEQ ID No. 95. In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof has a VL that has at least 95% sequence identity to the sequence set forth in SEQ ID NO: 95. In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof has a VL that has at least 98% sequence identity to the sequence set forth in SEQ ID No. 95. In some embodiments, an antibody or antigen-binding fragment thereof that specifically binds mesothelin (e.g., human mesothelin) provided herein comprises a VL having the amino acid sequence set forth in SEQ ID NO: 95.

In some embodiments, the antibodies or antigen-binding fragments thereof that specifically bind mesothelin (e.g., human mesothelin) provided herein include a VL that has at least 80%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the amino acid sequence set forth in SEQ ID No. 96. In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof has a VL that has at least 85% sequence identity to the sequence set forth in SEQ ID No. 96. In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof has a VL that has at least 90% sequence identity to the sequence set forth in SEQ ID No. 96. In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof has a VL that has at least 95% sequence identity to the sequence set forth in SEQ ID NO: 96. In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof has a VL that has at least 98% sequence identity to the sequence set forth in SEQ ID No. 96. In some embodiments, an antibody or antigen-binding fragment thereof that specifically binds mesothelin (e.g., human mesothelin) provided herein comprises a VL having an amino acid sequence set forth in SEQ ID NO: 96.

In some embodiments, the antibodies or antigen-binding fragments thereof that specifically bind mesothelin (e.g., human mesothelin) provided herein include a VL that has at least 80%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the amino acid sequence set forth in SEQ ID No. 97. In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof has a VL that has at least 85% sequence identity to the sequence set forth in SEQ ID No. 97. In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof has a VL that has at least 90% sequence identity to the sequence set forth in SEQ ID No. 97. In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof has a VL that has at least 95% sequence identity to the sequence set forth in SEQ ID NO: 97. In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof has a VL that has at least 98% sequence identity to the sequence set forth in SEQ ID NO: 97. In some embodiments, an antibody or antigen-binding fragment thereof that specifically binds mesothelin (e.g., human mesothelin) provided herein comprises a VL having an amino acid sequence set forth in SEQ ID NO: 97.

In some embodiments, the antibodies or antigen-binding fragments thereof that specifically bind mesothelin (e.g., human mesothelin) provided herein include a VL that has at least 80%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the amino acid sequence set forth in SEQ ID NO: 98. In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof has a VL that has at least 85% sequence identity to the sequence set forth in SEQ ID NO: 98. In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof has a VL that has at least 90% sequence identity to the sequence set forth in SEQ ID NO: 98. In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof has a VL that has at least 95% sequence identity to the sequence set forth in SEQ ID NO: 98. In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof has a VL that has at least 98% sequence identity to the sequence set forth in SEQ ID NO: 98. In some embodiments, the antibodies or antigen-binding fragments thereof that specifically bind mesothelin (e.g., human mesothelin) provided herein include a VL having the amino acid sequence set forth in SEQ ID NO 98.

In some embodiments, the antibodies or antigen-binding fragments thereof that specifically bind mesothelin (e.g., human mesothelin) provided herein include a VL that has at least 80%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the amino acid sequence set forth in SEQ ID No. 99. In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof has a VL that has at least 85% sequence identity to the sequence set forth in SEQ ID No. 99. In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof has a VL that has at least 90% sequence identity to the sequence set forth in SEQ ID No. 99. In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof has a VL that has at least 95% sequence identity to the sequence set forth in SEQ ID No. 99. In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof has a VL that has at least 98% sequence identity to the sequence set forth in SEQ ID No. 99. In some embodiments, an antibody or antigen-binding fragment thereof that specifically binds mesothelin (e.g., human mesothelin) provided herein comprises a VL having an amino acid sequence set forth in SEQ ID NO: 99.

In some embodiments, the antibodies or antigen-binding fragments thereof that specifically bind mesothelin (e.g., human mesothelin) provided herein include a VL that has at least 80%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the amino acid sequence set forth in SEQ ID No. 100. In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof has a VL that has at least 85% sequence identity to the sequence set forth in SEQ ID No. 100. In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof has a VL that has at least 90% sequence identity to the sequence set forth in SEQ ID No. 100. In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof has a VL that has at least 95% sequence identity to the sequence set forth in SEQ ID No. 100. In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof has a VL that has at least 98% sequence identity to the sequence set forth in SEQ ID No. 100. In some embodiments, an antibody or antigen-binding fragment thereof that specifically binds mesothelin (e.g., human mesothelin) provided herein comprises a VL having an amino acid sequence set forth in SEQ ID NO: 100.

In some embodiments, the antibodies or antigen-binding fragments thereof that specifically bind mesothelin (e.g., human mesothelin) provided herein include a VH having at least 80%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the amino acid sequence set forth in SEQ ID No. 101. In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof has a VH with at least 85% sequence identity to the sequence set forth in SEQ ID No. 101. In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof has a VH with at least 90% sequence identity to the sequence set forth in SEQ ID No. 101. In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof has a VH with at least 95% sequence identity to the sequence set forth in SEQ ID No. 101. In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof has a VH with at least 98% sequence identity to the sequence set forth in SEQ ID No. 101. In some embodiments, the antibodies or antigen-binding fragments thereof that specifically bind mesothelin (e.g., human mesothelin) provided herein comprise a VH having an amino acid sequence set forth in SEQ ID NO: 101.

In some embodiments, the antibodies or antigen-binding fragments thereof that specifically bind mesothelin (e.g., human mesothelin) provided herein include a VH having at least 80%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the amino acid sequence set forth in SEQ ID No. 102. In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof has a VH with at least 85% sequence identity to the sequence set forth in SEQ ID No. 102. In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof has a VH with at least 90% sequence identity to the sequence set forth in SEQ ID No. 102. In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof has a VH with at least 95% sequence identity to the sequence set forth in SEQ ID NO: 102. In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof has a VH with at least 98% sequence identity to the sequence set forth in SEQ ID NO: 102. In some embodiments, an antibody or antigen-binding fragment thereof that specifically binds mesothelin (e.g., human mesothelin) provided herein comprises a VH having an amino acid sequence set forth in SEQ ID NO: 102.

In some embodiments, the antibodies or antigen-binding fragments thereof that specifically bind mesothelin (e.g., human mesothelin) provided herein include a VH having at least 80%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the amino acid sequence set forth in SEQ ID No. 103. In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof has a VH with at least 85% sequence identity to the sequence set forth in SEQ ID No. 103. In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof has a VH with at least 90% sequence identity to the sequence set forth in SEQ ID No. 103. In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof has a VH with at least 95% sequence identity to the sequence set forth in SEQ ID No. 103. In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof has a VH with at least 98% sequence identity to the sequence set forth in SEQ ID No. 103. In some embodiments, an antibody or antigen-binding fragment thereof that specifically binds mesothelin (e.g., human mesothelin) provided herein comprises a VH having an amino acid sequence set forth in SEQ ID NO: 103.

In some embodiments, the antibodies or antigen-binding fragments thereof that specifically bind mesothelin (e.g., human mesothelin) provided herein include a VH having at least 80%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the amino acid sequence set forth in SEQ ID No. 104. In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof has a VH with at least 85% sequence identity to the sequence set forth in SEQ ID NO: 104. In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof has a VH with at least 90% sequence identity to the sequence set forth in SEQ ID NO: 104. In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof has a VH with at least 95% sequence identity to the sequence set forth in SEQ ID NO: 104. In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof has a VH with at least 98% sequence identity to the sequence set forth in SEQ ID NO: 104. In some embodiments, the antibodies or antigen-binding fragments thereof that specifically bind mesothelin (e.g., human mesothelin) provided herein comprise a VH having an amino acid sequence set forth in SEQ ID NO: 104.

In some embodiments, the antibodies or antigen-binding fragments thereof that specifically bind mesothelin (e.g., human mesothelin) provided herein include a VH having at least 80%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the amino acid sequence set forth in SEQ ID No. 105. In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof has a VH with at least 85% sequence identity to the sequence set forth in SEQ ID NO: 105. In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof has a VH with at least 90% sequence identity to the sequence set forth in SEQ ID NO: 105. In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof has a VH with at least 95% sequence identity to the sequence set forth in SEQ ID NO: 105. In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof has a VH with at least 98% sequence identity to the sequence set forth in SEQ ID NO: 105. In some embodiments, an antibody or antigen-binding fragment thereof that specifically binds mesothelin (e.g., human mesothelin) provided herein comprises a VH having an amino acid sequence set forth in SEQ ID NO: 105.

In some embodiments, the antibodies or antigen-binding fragments thereof that specifically bind mesothelin (e.g., human mesothelin) provided herein include a VH having at least 80%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the amino acid sequence set forth in SEQ ID No. 106. In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof has a VH with at least 85% sequence identity to the sequence set forth in SEQ ID NO: 106. In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof has a VH with at least 90% sequence identity to the sequence set forth in SEQ ID NO: 106. In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof has a VH with at least 95% sequence identity to the sequence set forth in SEQ ID NO: 106. In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof has a VH with at least 98% sequence identity to the sequence set forth in SEQ ID NO: 106. In some embodiments, an antibody or antigen-binding fragment thereof that specifically binds mesothelin (e.g., human mesothelin) provided herein comprises a VH having an amino acid sequence set forth in SEQ ID NO: 106.

In some embodiments, the antibodies or antigen-binding fragments thereof that specifically bind mesothelin (e.g., human mesothelin) provided herein include a VH having at least 80%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the amino acid sequence set forth in SEQ ID No. 107. In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof has a VH with at least 85% sequence identity to the sequence set forth in SEQ ID NO: 107. In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof has a VH with at least 90% sequence identity to the sequence set forth in SEQ ID NO: 107. In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof has a VH with at least 95% sequence identity to the sequence set forth in SEQ ID NO: 107. In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof has a VH with at least 98% sequence identity to the sequence set forth in SEQ ID NO: 107. In some embodiments, an antibody or antigen-binding fragment thereof that specifically binds mesothelin (e.g., human mesothelin) provided herein comprises a VH having an amino acid sequence set forth in SEQ ID NO: 107.

In some embodiments, the antibodies or antigen-binding fragments thereof that specifically bind mesothelin (e.g., human mesothelin) provided herein include a VH having at least 80%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the amino acid sequence set forth in SEQ ID No. 108. In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof has a VH with at least 85% sequence identity to the sequence set forth in SEQ ID NO: 108. In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof has a VH with at least 90% sequence identity to the sequence set forth in SEQ ID NO: 108. In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof has a VH with at least 95% sequence identity to the sequence set forth in SEQ ID NO: 108. In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof has a VH with at least 98% sequence identity to the sequence set forth in SEQ ID NO: 108. In some embodiments, the antibodies or antigen-binding fragments thereof that specifically bind mesothelin (e.g., human mesothelin) provided herein comprise a VH having the amino acid sequence set forth in SEQ ID NO: 108.

In some embodiments, the antibodies or antigen-binding fragments thereof that specifically bind mesothelin (e.g., human mesothelin) provided herein include a VH having at least 80%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the amino acid sequence set forth in SEQ ID No. 109. In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof has a VH with at least 85% sequence identity to the sequence set forth in SEQ ID NO: 109. In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof has a VH with at least 90% sequence identity to the sequence set forth in SEQ ID NO: 109. In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof has a VH with at least 95% sequence identity to the sequence set forth in SEQ ID NO: 109. In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof has a VH with at least 98% sequence identity to the sequence set forth in SEQ ID NO: 109. In some embodiments, an antibody or antigen-binding fragment thereof that specifically binds mesothelin (e.g., human mesothelin) provided herein comprises a VH having an amino acid sequence set forth in SEQ ID NO: 109.

In some embodiments, the antibodies or antigen-binding fragments thereof that specifically bind mesothelin (e.g., human mesothelin) provided herein include a VH having at least 80%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the amino acid sequence set forth in SEQ ID No. 110. In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof has a VH with at least 85% sequence identity to the sequence set forth in SEQ ID No. 110. In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof has a VH with at least 90% sequence identity to the sequence set forth in SEQ ID No. 110. In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof has a VH with at least 95% sequence identity to the sequence set forth in SEQ ID NO: 110. In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof has a VH with at least 98% sequence identity to the sequence set forth in SEQ ID No. 110. In some embodiments, an antibody or antigen-binding fragment thereof that specifically binds mesothelin (e.g., human mesothelin) provided herein comprises a VH having an amino acid sequence set forth in SEQ ID NO: 110.

In some embodiments, the antibodies or antigen-binding fragments thereof that specifically bind mesothelin (e.g., human mesothelin) provided herein include a VH having at least 80%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the amino acid sequence set forth in SEQ ID No. 111. In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof has a VH with at least 85% sequence identity to the sequence set forth in SEQ ID NO: 111. In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof has a VH with at least 90% sequence identity to the sequence set forth in SEQ ID NO: 111. In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof has a VH with at least 95% sequence identity to the sequence set forth in SEQ ID NO: 111. In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof has a VH with at least 98% sequence identity to the sequence set forth in SEQ ID NO: 111. In some embodiments, an antibody or antigen-binding fragment thereof that specifically binds mesothelin (e.g., human mesothelin) provided herein comprises a VH having an amino acid sequence set forth in SEQ ID NO: 111.

In some embodiments, the antibodies or antigen-binding fragments thereof that specifically bind mesothelin (e.g., human mesothelin) provided herein include a VH having at least 80%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the amino acid sequence set forth in SEQ ID No. 112. In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof has a VH with at least 85% sequence identity to the sequence set forth in SEQ ID NO: 112. In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof has a VH with at least 90% sequence identity to the sequence set forth in SEQ ID NO: 112. In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof has a VH with at least 95% sequence identity to the sequence set forth in SEQ ID No. 112. In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof has a VH with at least 98% sequence identity to the sequence set forth in SEQ ID NO: 112. In some embodiments, an antibody or antigen-binding fragment thereof that specifically binds mesothelin (e.g., human mesothelin) provided herein comprises a VH having the amino acid sequence set forth in SEQ ID NO: 112.

In some embodiments, the antibodies or antigen-binding fragments thereof that specifically bind mesothelin (e.g., human mesothelin) provided herein include a VH having at least 80%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the amino acid sequence set forth in SEQ ID No. 113. In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof has a VH with at least 85% sequence identity to the sequence set forth in SEQ ID No. 113. In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof has a VH with at least 90% sequence identity to the sequence set forth in SEQ ID No. 113. In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof has a VH with at least 95% sequence identity to the sequence set forth in SEQ ID No. 113. In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof has a VH with at least 98% sequence identity to the sequence set forth in SEQ ID No. 113. In some embodiments, an antibody or antigen-binding fragment thereof that specifically binds mesothelin (e.g., human mesothelin) provided herein comprises a VH having an amino acid sequence set forth in SEQ ID NO: 113.

In some embodiments, the antibodies or antigen-binding fragments thereof that specifically bind mesothelin (e.g., human mesothelin) provided herein include a VH having at least 80%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the amino acid sequence set forth in SEQ ID NO: 114. In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof has a VH with at least 85% sequence identity to the sequence set forth in SEQ ID NO: 114. In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof has a VH with at least 90% sequence identity to the sequence set forth in SEQ ID NO: 114. In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof has a VH with at least 95% sequence identity to the sequence set forth in SEQ ID NO: 114. In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof has a VH with at least 98% sequence identity to the sequence set forth in SEQ ID NO: 114. In some embodiments, an antibody or antigen-binding fragment thereof that specifically binds mesothelin (e.g., human mesothelin) provided herein comprises a VH having an amino acid sequence set forth in SEQ ID NO: 114.

In some embodiments, the antibodies or antigen-binding fragments thereof that specifically bind mesothelin (e.g., human mesothelin) provided herein comprise a VH having at least 80%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the amino acid sequence set forth in SEQ ID No. 115. In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof has a VH with at least 85% sequence identity to the sequence set forth in SEQ ID NO: 115. In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof has a VH with at least 90% sequence identity to the sequence set forth in SEQ ID NO: 115. In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof has a VH with at least 95% sequence identity to the sequence set forth in SEQ ID No. 115. In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof has a VH with at least 98% sequence identity to the sequence set forth in SEQ ID NO: 115. In some embodiments, an antibody or antigen-binding fragment thereof that specifically binds mesothelin (e.g., human mesothelin) provided herein comprises a VH having an amino acid sequence set forth in SEQ ID NO: 115.

The anti-mesothelin antibody or antigen-binding fragment thereof may comprise a combination of any VL disclosed herein and any VH disclosed herein. In some embodiments, the VL and VH are connected by a linker. The linker may be a flexible linker or a rigid linker. In some embodiments, the linker has an amino acid sequence set forth as (GGGGS) n, n =1, 2, 3, 4, or 5 (SEQ ID NO: 191). In some embodiments, the linker has an amino acid sequence set forth as (EAAAK) n, n =1, 2, 3, 4, or 5 (SEQ ID NO: 192). In some embodiments, the linker has an amino acid sequence set forth as (PA) nP, n =1, 2, 3, 4, or 5 (SEQ ID NO: 193). In some embodiments, the linker has an amino acid sequence shown as GGGGSGGGGSGGGS (SEQ ID NO: 194).

In some embodiments, the antibodies or antigen-binding fragments thereof that specifically bind mesothelin (e.g., human mesothelin) provided herein include a VL and a VH, wherein the VL has the amino acid sequence shown as SEQ ID NO 86 and the VH has an amino acid sequence selected from the group consisting of SEQ ID NOS: 101-115. In some embodiments, the VL has the amino acid sequence set forth in SEQ ID NO:87 and the VH has an amino acid sequence selected from the group consisting of SEQ ID NO: 101-115. In some embodiments, the VL has the amino acid sequence set forth in SEQ ID NO:88 and the VH has an amino acid sequence selected from the group consisting of SEQ ID NO: 101-115. In some embodiments, the VL has the amino acid sequence set forth in SEQ ID NO. 89 and the VH has an amino acid sequence selected from the group consisting of SEQ ID NO. 101-115. In some embodiments, the VL has the amino acid sequence set forth in SEQ ID NO:90 and the VH has an amino acid sequence selected from the group consisting of SEQ ID NO: 101-115. In some embodiments, the VL has the amino acid sequence set forth in SEQ ID NO:91 and the VH has an amino acid sequence selected from the group consisting of SEQ ID NO: 101-115. In some embodiments, the VL has the amino acid sequence set forth in SEQ ID NO:92 and the VH has an amino acid sequence selected from the group consisting of SEQ ID NO: 101-115. In some embodiments, the VL has the amino acid sequence set forth in SEQ ID NO:93 and the VH has an amino acid sequence selected from the group consisting of SEQ ID NO: 101-115. In some embodiments, the VL has the amino acid sequence set forth in SEQ ID NO:94 and the VH has an amino acid sequence selected from the group consisting of SEQ ID NO: 101-115. In some embodiments, the VL has the amino acid sequence set forth in SEQ ID NO. 95 and the VH has an amino acid sequence selected from the group consisting of SEQ ID NO. 101-115. In some embodiments, the VL has the amino acid sequence set forth in SEQ ID NO:96 and the VH has an amino acid sequence selected from the group consisting of SEQ ID NO: 101-115. In some embodiments, the VL has the amino acid sequence set forth in SEQ ID NO:97 and the VH has an amino acid sequence selected from the group consisting of SEQ ID NO: 101-115. In some embodiments, the VL has the amino acid sequence set forth in SEQ ID NO. 98 and the VH has an amino acid sequence selected from the group consisting of SEQ ID NO. 101-115. In some embodiments, the VL has the amino acid sequence set forth in SEQ ID NO. 99 and the VH has an amino acid sequence selected from the group consisting of SEQ ID NO. 101-115. In some embodiments, the VL has the amino acid sequence set forth in SEQ ID NO 100 and the VH has an amino acid sequence selected from the group consisting of SEQ ID NO 101-115.

In some embodiments, the antibodies or antigen-binding fragments thereof that specifically bind mesothelin (e.g., human mesothelin) provided herein include a VL and a VH, wherein the VL has an amino acid sequence selected from the group consisting of SEQ ID NOs 86-100 and the VH has an amino acid sequence set forth in SEQ ID NO 101. In some embodiments, the VL has an amino acid sequence selected from the group consisting of SEQ ID NOS 86-100 and the VH has an amino acid sequence set forth in SEQ ID NO 102. In some embodiments, the VL has an amino acid sequence selected from the group consisting of SEQ ID NOS 86-100 and the VH has an amino acid sequence set forth in SEQ ID NO 103. In some embodiments, the VL has an amino acid sequence selected from the group consisting of SEQ ID NOS 86-100 and the VH has an amino acid sequence set forth in SEQ ID NO 104. In some embodiments, the VL has an amino acid sequence selected from the group consisting of SEQ ID NOS 86-100 and the VH has an amino acid sequence set forth in SEQ ID NO 105. In some embodiments, the VL has an amino acid sequence selected from the group consisting of SEQ ID NOS 86-100 and the VH has an amino acid sequence set forth in SEQ ID NO 106. In some embodiments, the VL has an amino acid sequence selected from the group consisting of SEQ ID NOS 86-100 and the VH has an amino acid sequence set forth in SEQ ID NO 107. In some embodiments, the VL has an amino acid sequence selected from the group consisting of SEQ ID NOS 86-100 and the VH has the amino acid sequence set forth in SEQ ID NO 108. In some embodiments, the VL has an amino acid sequence selected from the group consisting of SEQ ID NOS 86-100 and the VH has the amino acid sequence set forth in SEQ ID NO 109. In some embodiments, the VL has an amino acid sequence selected from the group consisting of SEQ ID NOS 86-100 and the VH has an amino acid sequence shown in SEQ ID NO 110. In some embodiments, the VL has an amino acid sequence selected from the group consisting of SEQ ID NO 86-100 and the VH has an amino acid sequence shown as SEQ ID NO 111. In some embodiments, the VL has an amino acid sequence selected from the group consisting of SEQ ID NO 86-100 and the VH has an amino acid sequence shown as SEQ ID NO 112. In some embodiments, the VL has an amino acid sequence selected from the group consisting of SEQ ID NOS 86-100 and the VH has an amino acid sequence set forth in SEQ ID NO 113. In some embodiments, the VL has an amino acid sequence selected from the group consisting of SEQ ID NOS 86-100 and the VH has an amino acid sequence set forth in SEQ ID NO 114. In some embodiments, the VL has an amino acid sequence selected from the group consisting of SEQ ID NO 86-100 and the VH has an amino acid sequence shown as SEQ ID NO 115.

In some embodiments, the antibodies or antigen-binding fragments thereof that specifically bind mesothelin (e.g., human mesothelin) provided herein include a VL and a VH, wherein the VL and VH have the amino acid sequences set forth in SEQ ID NOs 86 and 101, respectively. In some embodiments, the VL and VH have the amino acid sequences shown in SEQ ID NOS: 87 and 102, respectively. In some embodiments, the VL and VH have the amino acid sequences shown in SEQ ID NOS: 88 and 103, respectively. In some embodiments, the VL and VH have the amino acid sequences shown in SEQ ID NOs 89 and 104, respectively. In some embodiments, the VL and VH have the amino acid sequences shown in SEQ ID NOS: 90 and 105, respectively. In some embodiments, the VL and VH have the amino acid sequences shown in SEQ ID NO 91 and 106, respectively. In some embodiments, the VL and VH have the amino acid sequences shown in SEQ ID NOS: 92 and 107, respectively. In some embodiments, the VL and VH have the amino acid sequences shown in SEQ ID NOs 93 and 108, respectively. In some embodiments, the VL and VH have the amino acid sequences shown in SEQ ID NOs 94 and 109, respectively. In some embodiments, the VL and VH have the amino acid sequences shown in SEQ ID NOS 95 and 110, respectively. In some embodiments, the VL and VH have the amino acid sequences shown in SEQ ID NOS 96 and 111, respectively. In some embodiments, the VL and VH have the amino acid sequences shown in SEQ ID NOS: 97 and 112, respectively. In some embodiments, the VL and VH have the amino acid sequences shown in SEQ ID NOS 98 and 113, respectively. In some embodiments, the VL and VH have the amino acid sequences shown in SEQ ID NOs 99 and 114, respectively. In some embodiments, the VL and VH have the amino acid sequences shown in SEQ ID NOs 100 and 115, respectively.

In some embodiments, the antibodies or antigen-binding fragments thereof that specifically bind mesothelin (e.g., human mesothelin) provided herein include (a) a VL comprising

VL CDRs

1, 2 and 3, said

VL CDRs

1, 2 and 3 being derived from a VL having an amino acid sequence selected from the group consisting of SEQ ID NOs 86-100; and/or (b) a VH comprising

VH CDRs

1, 2 and 3, said

VH CDRs

1, 2 and 3 being derived from a VH having an amino acid sequence selected from the group consisting of SEQ ID NOS 101-115.

In some embodiments, the invention provides an antibody or antigen-binding fragment thereof that specifically binds mesothelin (e.g., human mesothelin) comprising a VL, wherein said VL comprises

VL CDRs

1, 2 and 3, said

VL CDRs

1, 2 and 3 being derived from a VL having the amino acid sequence set forth in SEQ ID No. 86. In some embodiments, the VL comprises

VL CDRs

1, 2, and 3, and the

VL CDRs

1, 2, and 3 are derived from a VL having an amino acid sequence set forth in SEQ ID No. 87. In some embodiments, the VL comprises

VL CDRs

1, 2, and 3, and the

VL CDRs

1, 2, and 3 are derived from a VL having an amino acid sequence set forth in SEQ ID NO: 88. In some embodiments, the VL comprises

VL CDRs

1, 2, and 3, and the

VL CDRs

1, 2, and 3 are derived from a VL having an amino acid sequence set forth in SEQ ID No. 89. In some embodiments, the VL comprises

VL CDRs

1, 2, and 3, and the

VL CDRs

1, 2, and 3 are derived from a VL having an amino acid sequence set forth in SEQ ID No. 90. In some embodiments, the VL comprises

VL CDRs

1, 2 and 3, and the

VL CDRs

1, 2 and 3 are derived from a VL having an amino acid sequence shown in SEQ ID NO 91. In some embodiments, the VL comprises

VL CDRs

1, 2, and 3, and the

VL CDRs

1, 2, and 3 are derived from a VL having an amino acid sequence set forth in SEQ ID No. 92. In some embodiments, the VL comprises

VL CDRs

1, 2, and 3, and the

VL CDRs

1, 2, and 3 are derived from a VL having an amino acid sequence set forth in SEQ ID No. 93. In some embodiments, the VL includes

VL CDRs

1, 2, and 3, and the

VL CDRs

1, 2, and 3 are derived from a VL having an amino acid sequence set forth in SEQ ID No. 94. In some embodiments, the VL comprises

VL CDRs

1, 2, and 3, and the

VL CDRs

1, 2, and 3 are derived from a VL having an amino acid sequence set forth in SEQ ID No. 95. In some embodiments, the VL comprises

VL CDRs

1, 2, and 3, and the

VL CDRs

1, 2, and 3 are derived from a VL having an amino acid sequence set forth in SEQ ID No. 96. In some embodiments, the VL comprises

VL CDRs

1, 2, and 3, and the

VL CDRs

1, 2, and 3 are derived from a VL having an amino acid sequence set forth in SEQ ID No. 97. In some embodiments, the VL comprises

VL CDRs

1, 2, and 3, and the

VL CDRs

1, 2, and 3 are derived from a VL having an amino acid sequence set forth in SEQ ID NO: 98. In some embodiments, the VL comprises

VL CDRs

1, 2, and 3, and the

VL CDRs

1, 2, and 3 are derived from a VL having an amino acid sequence set forth in SEQ ID No. 99. In some embodiments, the VL comprises

VL CDRs

1, 2, and 3, and the

VL CDRs

1, 2, and 3 are derived from a VL having an amino acid sequence set forth in SEQ ID No. 100.

In some embodiments, the invention provides an antibody or antigen-binding fragment thereof that specifically binds mesothelin (e.g., human mesothelin), comprising a VH, wherein said VH comprises

VH CDRs

1, 2 and 3, said

VH CDRs

1, 2 and 3 being derived from a VH having the amino acid sequence set forth in SEQ ID NO: 101. In some embodiments, the VH comprises

VH CDRs

1, 2, and 3, and the

VH CDRs

1, 2, and 3 are derived from a VH having the amino acid sequence set forth in SEQ ID NO: 102. In some embodiments, the VH comprises

VH CDRs

1, 2, and 3, and the

VH CDRs

1, 2, and 3 are derived from a VH having an amino acid sequence shown in SEQ ID NO: 103. In some embodiments, the VH comprises

VH CDRs

1, 2, and 3, and the

VH CDRs

1, 2, and 3 are derived from a VH having the amino acid sequence set forth in SEQ ID NO: 104. In some embodiments, the VH comprises

VH CDRs

1, 2, and 3, and the

VH CDRs

1, 2, and 3 are derived from a VH having the amino acid sequence shown in SEQ ID NO: 105. In some embodiments, the VH comprises

VH CDRs

1, 2, and 3, the

VH CDRs

1, 2, and 3 being derived from a VH having the amino acid sequence shown in SEQ ID No. 106. In some embodiments, the VH comprises

VH CDRs

1, 2, and 3, and the

VH CDRs

1, 2, and 3 are derived from a VH having an amino acid sequence shown in SEQ ID NO: 107. In some embodiments, the VH comprises

VH CDRs

1, 2, and 3, the

VH CDRs

1, 2, and 3 being derived from a VH having the amino acid sequence set forth in SEQ ID NO: 108. In some embodiments, the VH comprises

VH CDRs

1, 2, and 3, and the

VH CDRs

1, 2, and 3 are derived from a VH having the amino acid sequence set forth in SEQ ID NO: 109. In some embodiments, the VH comprises

VH CDRs

1, 2, and 3, and the

VH CDRs

1, 2, and 3 are derived from a VH having the amino acid sequence set forth in SEQ ID NO: 110. In some embodiments, the VH comprises

VH CDRs

1, 2, and 3, and the

VH CDRs

1, 2, and 3 are derived from a VH having the amino acid sequence shown in SEQ ID NO: 111. In some embodiments, the VH comprises

VH CDRs

1, 2, and 3, and the

VH CDRs

1, 2, and 3 are derived from a VH having the amino acid sequence shown in SEQ ID NO: 112. In some embodiments, the VH comprises

VH CDRs

1, 2, and 3, and the

VH CDRs

1, 2, and 3 are derived from a VH having an amino acid sequence shown in SEQ ID NO: 113. In some embodiments, the VH comprises

VH CDRs

1, 2, and 3, and the

VH CDRs

1, 2, and 3 are derived from a VH having the amino acid sequence set forth in SEQ ID NO: 114. In some embodiments, the VH comprises

VH CDRs

1, 2, and 3, and the

VH CDRs

1, 2, and 3 are derived from a VH having the amino acid sequence shown in SEQ ID NO: 115.

In some embodiments, the invention provides an antibody or antigen-binding fragment thereof that specifically binds mesothelin (e.g., human mesothelin) comprising a VL and a VH, wherein the VL comprises a VL CDR1, CDR2 and CDR3, the VL CDR1, CDR2 and CDR3 are derived from a VL having the amino acid sequence set forth in SEQ ID No. 86, and the VH comprises a VH CDR1, CDR2 and CDR3, the VH CDR1, CDR2 and CDR3 are derived from a VH having the amino acid sequence set forth in SEQ ID No. 101. In some embodiments, the VL comprises VL CDR1, CDR2 and CDR3, the VL CDR1, CDR2 and CDR3 are derived from a VL having the amino acid sequence shown in SEQ ID NO. 87, and the VH comprises VH CDR1, CDR2 and CDR3, the VH CDR1, CDR2 and CDR3 are derived from a VH having the amino acid sequence shown in SEQ ID NO. 102. In some embodiments, the VL comprises VL CDR1, CDR2 and CDR3, the VL CDR1, CDR2 and CDR3 are derived from a VL having the amino acid sequence set forth in SEQ ID NO. 88, and the VH comprises VH CDR1, CDR2 and CDR3, the VH CDR1, CDR2 and CDR3 are derived from a VH having the amino acid sequence set forth in SEQ ID NO. 103. In some embodiments, the VL comprises VL CDR1, CDR2 and CDR3, the VL CDR1, CDR2 and CDR3 are derived from a VL having the amino acid sequence shown in SEQ ID NO. 89, and the VH comprises VH CDR1, CDR2 and CDR3, the VH CDR1, CDR2 and CDR3 are derived from a VH having the amino acid sequence shown in SEQ ID NO. 104. In some embodiments, the VL comprises VL CDR1, CDR2, and CDR3, wherein VL CDR1, CDR2, and CDR3 are derived from a VL having the amino acid sequence set forth in SEQ ID No. 90, and the VH comprises VH CDR1, CDR2, and CDR3, wherein VH CDR1, CDR2, and CDR3 are derived from a VH having the amino acid sequence set forth in SEQ ID No. 105. In some embodiments, the VL comprises VL CDR1, CDR2 and CDR3, the VL CDR1, CDR2 and CDR3 are derived from a VL having the amino acid sequence shown in SEQ ID NO. 91, and the VH comprises VH CDR1, CDR2 and CDR3, the VH CDR1, CDR2 and CDR3 are derived from a VH having the amino acid sequence shown in SEQ ID NO. 106. In some embodiments, the VL comprises VL CDR1, CDR2 and CDR3, the VL CDR1, CDR2 and CDR3 are derived from VL having the amino acid sequence set forth in SEQ ID NO:92, and the VH comprises VH CDR1, CDR2 and CDR3, the VH CDR1, CDR2 and CDR3 are derived from VH having the amino acid sequence set forth in SEQ ID NO: 107. In some embodiments, the VL comprises VL CDR1, CDR2, and CDR3, wherein VL CDR1, CDR2, and CDR3 are derived from a VL having the amino acid sequence set forth in SEQ ID No. 93, and the VH comprises VH CDR1, CDR2, and CDR3, wherein VH CDR1, CDR2, and CDR3 are derived from a VH having the amino acid sequence set forth in SEQ ID No. 108. In some embodiments, the VL comprises VL CDR1, CDR2 and CDR3, the VL CDR1, CDR2 and CDR3 are derived from VL having the amino acid sequence set forth in SEQ ID NO. 94, and the VH comprises VH CDR1, CDR2 and CDR3, the VH CDR1, CDR2 and CDR3 are derived from VH having the amino acid sequence set forth in SEQ ID NO. 109. In some embodiments, the VL comprises VL CDR1, CDR2 and CDR3, the VL CDR1, CDR2 and CDR3 are derived from a VL having the amino acid sequence set forth in SEQ ID No. 95, and the VH comprises VH CDR1, CDR2 and CDR3, the VH CDR1, CDR2 and CDR3 are derived from a VH having the amino acid sequence set forth in SEQ ID No. 110. In some embodiments, the VL comprises VL CDR1, CDR2 and CDR3, the VL CDR1, CDR2 and CDR3 are derived from VL having the amino acid sequence set forth in SEQ ID NO. 96, and the VH comprises VH CDR1, CDR2 and CDR3, the VH CDR1, CDR2 and CDR3 are derived from VH having the amino acid sequence set forth in SEQ ID NO. 111. In some embodiments, the VL comprises VL CDR1, CDR2 and CDR3, the VL CDR1, CDR2 and CDR3 are derived from a VL having the amino acid sequence shown in SEQ ID NO. 97, and the VH comprises VH CDR1, CDR2 and CDR3, the VH CDR1, CDR2 and CDR3 are derived from a VH having the amino acid sequence shown in SEQ ID NO. 112. In some embodiments, the VL comprises VL CDR1, CDR2 and CDR3, the VL CDR1, CDR2 and CDR3 are derived from VL having the amino acid sequence set forth in SEQ ID NO. 98, and the VH comprises VH CDR1, CDR2 and CDR3, the VH CDR1, CDR2 and CDR3 are derived from VH having the amino acid sequence set forth in SEQ ID NO. 113. In some embodiments, the VL comprises VL CDR1, CDR2, and CDR3, wherein VL CDR1, CDR2, and CDR3 are derived from a VL having the amino acid sequence set forth in SEQ ID No. 99, and the VH comprises VH CDR1, CDR2, and CDR3, wherein VH CDR1, CDR2, and CDR3 are derived from a VH having the amino acid sequence set forth in SEQ ID No. 114. In some embodiments, the VL comprises VL CDR1, CDR2, and CDR3, wherein VL CDR1, CDR2, and CDR3 are derived from a VL having the amino acid sequence set forth in SEQ ID No. 100, and the VH comprises VH CDR1, CDR2, and CDR3, wherein VH CDR1, CDR2, and CDR3 are derived from a VH having the amino acid sequence set forth in SEQ ID No. 115.

In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof provided herein is an scFv labeled M6 (SEQ ID NO: 146). In some embodiments, the anti-mesothelin antibodies or antigen-binding fragments thereof provided herein have an amino acid sequence that has at least about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% sequence identity to the sequence set forth in SEQ ID No. 146. In some embodiments, the invention provides anti-mesothelin antibodies or antigen-binding fragments thereof that have a VL derived from M6 (SEQ ID NO: 86). In some embodiments, the invention provides an anti-mesothelin antibody or antigen-binding fragment thereof having a VH derived from M6 (SEQ ID NO: 101). The anti-mesothelin antibody or antigen-binding fragment thereof provided by the present invention may have both VL and VH derived from M6. In some embodiments, the anti-mesothelin antibodies or antigen-binding fragments thereof provided herein have a VL comprising

VL CDRs

1, 2 and 3, said

VL CDRs

1, 2 and 3 being derived from a VL from M6 (SEQ ID NO: 86). In some embodiments, the anti-mesothelin antibodies or antigen-binding fragments thereof provided herein have a VH comprising

VH CDRs

1, 2 and 3, said

VH CDRs

1, 2 and 3 being derived from the VH from M6 (SEQ ID NO: 101). The anti-mesothelin antibody or antigen-binding fragment thereof provided by the present invention has a VL comprising

VL CDRs

1, 2 and 3, and a VH comprising

VH CDRs

1, 2 and 3, wherein the

VL CDRs

1, 2 and 3, and the

VH CDRs

1, 2 and 3 may be derived from a VL and a VH from M6, respectively. In some embodiments, an anti-mesothelin antibody or antigen-binding fragment thereof provided by the present invention is a variant of M6. The M6 variant may have a VL that is a variant of M6 VL having up to about 5 amino acid substitutions, additions and/or deletions in the sequence shown in SEQ ID No. 86. The M6 variants may have a VH that is a variant of the M6 VH having up to about 5 amino acid substitutions, additions and/or deletions in the sequence shown in SEQ ID No. 101. The amino acid substitution, addition and/or deletion may occur in a VH CDR or a VL CDR. In some embodiments, the amino acid substitutions, additions, and/or deletions are not in a CDR. In some embodiments, variants of M6 have up to about 5 conservative amino acid substitutions. In some embodiments, the variant of M6 has up to 3 conservative amino acid substitutions.

In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof provided herein is an scFv labeled M7 (SEQ ID NO: 147). In some embodiments, the present invention provides an anti-mesothelin antibody, or antigen-binding fragment thereof, having an amino acid sequence that has at least about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% sequence identity to the sequence set forth in SEQ ID No. 147. In some embodiments, the anti-mesothelin antibodies or antigen-binding fragments thereof provided by the present invention have a VL derived from M7 (SEQ ID NO: 87). In some embodiments, the invention provides an anti-mesothelin antibody or antigen-binding fragment thereof having a VH derived from M7 (SEQ ID NO: 102). The anti-mesothelin antibody or antigen-binding fragment thereof provided by the present invention may have both VL and VH derived from M7. In some embodiments, the anti-mesothelin antibodies or antigen-binding fragments thereof provided herein have a VL comprising

VL CDRs

1, 2 and 3, said

VL CDRs

1, 2 and 3 being derived from the VL from M7 (SEQ ID NO: 87). In some embodiments, the anti-mesothelin antibodies or antigen-binding fragments thereof provided herein have a VH comprising

VH CDRs

1, 2 and 3, said

VH CDRs

1, 2 and 3 being derived from the VH from M7 (SEQ ID NO: 102). The anti-mesothelin antibody or antigen-binding fragment thereof provided by the present invention has a VL comprising

VL CDRs

1, 2 and 3, and a VH comprising

VH CDRs

1, 2 and 3, wherein the

VL CDRs

1, 2 and 3, and the

VH CDRs

1, 2 and 3 may be derived from a VL and a VH from M7, respectively. In some embodiments, an anti-mesothelin antibody or antigen-binding fragment thereof provided by the present invention is a variant of M7. The M7 variant may have a VL that is a variant of M7 VL having up to about 5 amino acid substitutions, additions and/or deletions in the sequence shown in SEQ ID NO: 87. The M7 variants may have a VH that is a variant of the M7 VH having up to about 5 amino acid substitutions, additions and/or deletions in the sequence shown in SEQ ID No. 102. The amino acid substitution, addition and/or deletion may occur in a VH CDR or a VL CDR. In some embodiments, the amino acid substitutions, additions and/or deletions are not in a CDR. In some embodiments, the variant of M7 has up to about 5 conservative amino acid substitutions. In some embodiments, the variant of M7 has up to 3 conservative amino acid substitutions.

In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof provided herein is an scFv labeled M8 (SEQ ID NO: 148). In some embodiments, the present invention provides an anti-mesothelin antibody, or antigen-binding fragment thereof, having an amino acid sequence that has at least about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% sequence identity to the sequence set forth in SEQ ID No. 148. In some embodiments, the anti-mesothelin antibodies or antigen-binding fragments thereof provided by the present invention have a VL derived from M8 (SEQ ID NO: 88). In some embodiments, the invention provides anti-mesothelin antibodies or antigen-binding fragments thereof that have a VH derived from M8 (SEQ ID NO: 103). The anti-mesothelin antibody or antigen-binding fragment thereof provided by the present invention may have both VL and VH derived from M8. In some embodiments, the anti-mesothelin antibodies or antigen-binding fragments thereof provided herein have a VL comprising

VL CDRs

1, 2 and 3, said

VL CDRs

1, 2 and 3 being derived from the VL from M8 (SEQ ID NO: 88). In some embodiments, the anti-mesothelin antibodies or antigen-binding fragments thereof provided herein have a VH comprising

VH CDRs

1, 2 and 3, said

VH CDRs

1, 2 and 3 being derived from the VH from M8 (SEQ ID NO: 103). The anti-mesothelin antibody or antigen-binding fragment thereof provided by the present invention has a VL comprising

VL CDRs

1, 2 and 3, and a VH comprising

VH CDRs

1, 2 and 3, wherein the

VL CDRs

1, 2 and 3, and the

VH CDRs

1, 2 and 3 may be derived from a VL and a VH from M8, respectively. In some embodiments, an anti-mesothelin antibody or antigen-binding fragment thereof provided by the present invention is a variant of M8. The M8 variant may have a VL that is a variant of M8 VL having up to about 5 amino acid substitutions, additions and/or deletions in the sequence shown in SEQ ID NO: 88. The M8 variants may have a VH that is a variant of the M8 VH having up to about 5 amino acid substitutions, additions and/or deletions in the sequence shown in SEQ ID No. 103. The amino acid substitution, addition and/or deletion may occur in a VH CDR or a VL CDR. In some embodiments, the amino acid substitutions, additions, and/or deletions are not in a CDR. In some embodiments, variants of M8 have up to about 5 conservative amino acid substitutions. In some embodiments, the variant of M8 has up to 3 conservative amino acid substitutions.

In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof provided herein is an scFv labeled M10 (SEQ ID NO: 149). In some embodiments, the anti-mesothelin antibodies or antigen-binding fragments thereof provided herein have an amino acid sequence that has at least about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% sequence identity to the sequence set forth in SEQ ID NO: 149. In some embodiments, the anti-mesothelin antibodies or antigen-binding fragments thereof provided by the present invention have a VL derived from M10 (SEQ ID NO: 89). In some embodiments, the invention provides an anti-mesothelin antibody or antigen-binding fragment thereof having a VH derived from M10 (SEQ ID NO: 104). The anti-mesothelin antibody or antigen-binding fragment thereof provided by the present invention may have both VL and VH derived from M10. In some embodiments, the invention provides an anti-mesothelin antibody or antigen-binding fragment thereof has a VL comprising

VL CDRs

1, 2 and 3, the

VL CDRs

1, 2 and 3 derived from VL from M10 (SEQ ID NO: 89). In some embodiments, the anti-mesothelin antibodies or antigen-binding fragments thereof provided herein have a VH comprising

VH CDRs

1, 2 and 3, said

VH CDRs

1, 2 and 3 being derived from the VH from M10 (SEQ ID NO: 104). The anti-mesothelin antibody or antigen-binding fragment thereof provided by the present invention has a VL comprising

VL CDRs

1, 2 and 3, and a VH comprising

VH CDRs

1, 2 and 3, wherein the

VL CDRs

1, 2 and 3, and the

VH CDRs

1, 2 and 3 may be derived from a VL and a VH from M10, respectively. In some embodiments, an anti-mesothelin antibody or antigen-binding fragment thereof provided by the present invention is a variant of M10. The M10 variant may have a VL that is a variant of M10 VL having up to about 5 amino acid substitutions, additions and/or deletions in the sequence shown in SEQ ID NO. 89. The M10 variants may have a VH that is a variant of the M10 VH having up to about 5 amino acid substitutions, additions and/or deletions in the sequence shown in SEQ ID No. 104. The amino acid substitution, addition and/or deletion may occur in a VH CDR or a VL CDR. In some embodiments, the amino acid substitutions, additions and/or deletions are not in a CDR. In some embodiments, the variant of M10 has up to about 5 conservative amino acid substitutions. In some embodiments, the variant of M10 has up to 3 conservative amino acid substitutions.

In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof provided herein is an scFv labeled M12 (SEQ ID NO: 150). In some embodiments, the anti-mesothelin antibodies or antigen-binding fragments thereof provided herein have an amino acid sequence that has at least about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% sequence identity to the sequence set forth in SEQ ID No. 150. In some embodiments, the invention provides anti-mesothelin antibodies or antigen-binding fragments thereof that have a VL derived from M12 (SEQ ID NO: 90). In some embodiments, the invention provides an anti-mesothelin antibody or antigen-binding fragment thereof having a VH derived from M12 (SEQ ID NO: 105). The anti-mesothelin antibody or antigen-binding fragment thereof provided by the present invention may have both VL and VH derived from M12. In some embodiments, the anti-mesothelin antibodies or antigen-binding fragments thereof provided herein have a VL comprising

VL CDRs

1, 2 and 3, said

VL CDRs

1, 2 and 3 being derived from the VL from M12 (SEQ ID NO: 90). In some embodiments, the anti-mesothelin antibodies or antigen-binding fragments thereof provided herein have a VH comprising

VH CDRs

1, 2 and 3, said

VH CDRs

1, 2 and 3 being derived from the VH from M12 (SEQ ID NO: 105). The anti-mesothelin antibody or antigen-binding fragment thereof provided by the present invention has a VL comprising

VL CDRs

1, 2 and 3, and a VH comprising

VH CDRs

1, 2 and 3, wherein the

VL CDRs

1, 2 and 3, and the

VH CDRs

1, 2 and 3 may be derived from a VL and a VH from M12, respectively. In some embodiments, an anti-mesothelin antibody or antigen-binding fragment thereof provided by the present invention is a variant of M12. The M12 variant may have a VL that is a variant of M12 VL having up to about 5 amino acid substitutions, additions and/or deletions in the sequence shown in SEQ ID No. 90. The M12 variants may have a VH that is a variant of the M12 VH having up to about 5 amino acid substitutions, additions and/or deletions in the sequence shown in SEQ ID No. 105. The amino acid substitution, addition and/or deletion may occur in a VH CDR or a VL CDR. In some embodiments, the amino acid substitutions, additions, and/or deletions are not in a CDR. In some embodiments, the variant of M12 has up to about 5 conservative amino acid substitutions. In some embodiments, the variant of M12 has up to 3 conservative amino acid substitutions.

In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof provided herein is an scFv labeled M13 (SEQ ID NO: 151). In some embodiments, the invention provides an anti-mesothelin antibody, or antigen-binding fragment thereof, having an amino acid sequence that has at least about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% sequence identity to the sequence set forth in SEQ ID No. 151. In some embodiments, the invention provides an anti-mesothelin antibody or antigen-binding fragment thereof having a VL derived from M13 (SEQ ID NO: 91). In some embodiments, the invention provides an anti-mesothelin antibody or antigen-binding fragment thereof having a VH derived from M13 (SEQ ID NO: 106). The anti-mesothelin antibody or antigen-binding fragment thereof provided by the present invention may have both VL and VH derived from M13. In some embodiments, the anti-mesothelin antibodies or antigen-binding fragments thereof provided herein have a VL comprising

VL CDRs

1, 2 and 3, said

VL CDRs

1, 2 and 3 being derived from VL from M13 (SEQ ID NO: 91). In some embodiments, the anti-mesothelin antibodies or antigen-binding fragments thereof provided herein have a VH comprising

VH CDRs

1, 2 and 3, said

VH CDRs

1, 2 and 3 being derived from the VH from M13 (SEQ ID NO: 106). The anti-mesothelin antibody or antigen-binding fragment thereof provided by the present invention has a VL comprising

VL CDRs

1, 2 and 3, and a VH comprising

VH CDRs

1, 2 and 3, wherein the

VL CDRs

1, 2 and 3, and the

VH CDRs

1, 2 and 3 may be derived from a VL and a VH from M13, respectively. In some embodiments, an anti-mesothelin antibody or antigen-binding fragment thereof provided by the present invention is a variant of M13. The M13 variants may have a VL that is a variant of M13 VL having up to about 5 amino acid substitutions, additions and/or deletions in the sequence set forth in SEQ ID NO. 91. The M13 variants may have a VH that is a variant of the M13 VH having up to about 5 amino acid substitutions, additions and/or deletions in the sequence shown in SEQ ID No. 106. The amino acid substitution, addition and/or deletion may occur in a VH CDR or a VL CDR. In some embodiments, the amino acid substitutions, additions, and/or deletions are not in a CDR. In some embodiments, the variant of M13 has up to about 5 conservative amino acid substitutions. In some embodiments, the variant of M13 has up to 3 conservative amino acid substitutions.

In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof provided herein is an scFv labeled M15 (SEQ ID NO: 152). In some embodiments, the present invention provides an anti-mesothelin antibody, or antigen-binding fragment thereof, having an amino acid sequence that has at least about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% sequence identity to the sequence set forth in SEQ ID No. 152. In some embodiments, the invention provides an anti-mesothelin antibody or antigen-binding fragment thereof having a VL derived from M15 (SEQ ID NO: 92). In some embodiments, the invention provides an anti-mesothelin antibody or antigen-binding fragment thereof having a VH derived from M15 (SEQ ID NO: 107). The anti-mesothelin antibody or antigen-binding fragment thereof provided by the present invention may have both VL and VH derived from M15. In some embodiments, the invention provides an anti-mesothelin antibody or antigen-binding fragment thereof has a VL comprising

VL CDRs

1, 2 and 3, the

VL CDRs

1, 2 and 3 derived from VL from M15 (SEQ ID NO: 92). In some embodiments, the anti-mesothelin antibodies or antigen-binding fragments thereof provided herein have a VH comprising

VH CDRs

1, 2 and 3, said

VH CDRs

1, 2 and 3 being derived from the VH from M15 (SEQ ID NO: 107). The anti-mesothelin antibody or antigen-binding fragment thereof provided by the present invention has a VL comprising

VL CDRs

1, 2 and 3, and a VH comprising

VH CDRs

1, 2 and 3, wherein the

VL CDRs

1, 2 and 3, and the

VH CDRs

1, 2 and 3 may be derived from a VL and a VH from M15, respectively. In some embodiments, an anti-mesothelin antibody or antigen-binding fragment thereof provided by the present invention is a variant of M15. The M15 variant may have a VL that is a variant of M15 VL having up to about 5 amino acid substitutions, additions and/or deletions in the sequence shown in SEQ ID NO: 92. The M15 variants may have a VH that is a variant of the M15 VH having up to about 5 amino acid substitutions, additions and/or deletions in the sequence shown in SEQ ID NO: 107. The amino acid substitution, addition and/or deletion may occur in a VH CDR or a VL CDR. In some embodiments, the amino acid substitutions, additions, and/or deletions are not in a CDR. In some embodiments, the variant of M15 has up to about 5 conservative amino acid substitutions. In some embodiments, the variant of M15 has up to 3 conservative amino acid substitutions.

In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof provided herein is an scFv labeled M20 (SEQ ID NO: 153). In some embodiments, the anti-mesothelin antibodies or antigen-binding fragments thereof provided herein have an amino acid sequence that has at least about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% sequence identity to the sequence set forth in SEQ ID No. 153. In some embodiments, the invention provides anti-mesothelin antibodies or antigen binding fragments thereof having a VL derived from M20 (SEQ ID NO: 93). In some embodiments, the invention provides anti-mesothelin antibodies or antigen-binding fragments thereof having a VH derived from M20 (SEQ ID NO: 108). The anti-mesothelin antibody or antigen-binding fragment thereof provided by the present invention may have both VL and VH derived from M20. In some embodiments, the anti-mesothelin antibodies or antigen-binding fragments thereof provided herein have a VL comprising

VL CDRs

1, 2 and 3, said

VL CDRs

1, 2 and 3 being derived from a VL from M20 (SEQ ID NO: 93). In some embodiments, the anti-mesothelin antibodies or antigen-binding fragments thereof provided herein have a VH comprising

VH CDRs

1, 2 and 3, said

VH CDRs

1, 2 and 3 being derived from the VH from M20 (SEQ ID NO: 108). The anti-mesothelin antibody or antigen-binding fragment thereof provided by the present invention has a VL comprising

VL CDRs

1, 2 and 3, and a VH comprising

VH CDRs

1, 2 and 3, wherein the

VL CDRs

1, 2 and 3, and the

VH CDRs

1, 2 and 3 may be derived from a VL and a VH from M20, respectively. In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof is a variant of M20 the M20 variant may have a VL that is a variant of M20 VL having up to about 5 amino acid substitutions, additions and/or deletions in the sequence set forth in SEQ ID No. 93. The M20 variants may have a VH that is a variant of the M20 VH having up to about 5 amino acid substitutions, additions and/or deletions in the sequence shown in SEQ ID NO: 108. The amino acid substitution, addition and/or deletion may occur in a VH CDR or a VL CDR. In some embodiments, the amino acid substitutions, additions, and/or deletions are not in a CDR. In some embodiments, the variant of M20 has up to about 5 conservative amino acid substitutions. In some embodiments, the variant of M20 has up to 3 conservative amino acid substitutions.

In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof provided herein is an scFv labeled M22 (SEQ ID NO: 154). In some embodiments, the anti-mesothelin antibodies or antigen-binding fragments thereof provided herein have an amino acid sequence that has at least about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% sequence identity to the sequence set forth in SEQ ID No. 154. In some embodiments, the anti-mesothelin antibodies or antigen-binding fragments thereof provided by the present invention have a VL derived from M22 (SEQ ID NO: 94). In some embodiments, the invention provides anti-mesothelin antibodies or antigen-binding fragments thereof that have a VH derived from M22 (SEQ ID NO: 109). The anti-mesothelin antibody or antigen-binding fragment thereof provided by the present invention may have both VL and VH derived from M22. In some embodiments, the anti-mesothelin antibodies or antigen-binding fragments thereof provided herein have a VL comprising

VL CDRs

1, 2 and 3, said

VL CDRs

1, 2 and 3 being derived from VL from M22 (SEQ ID NO: 94). In some embodiments, the anti-mesothelin antibodies or antigen-binding fragments thereof provided herein have a VH comprising

VH CDRs

1, 2 and 3, said

VH CDRs

1, 2 and 3 being derived from the VH from M22 (SEQ ID NO: 109). The anti-mesothelin antibody or antigen-binding fragment thereof provided by the present invention has a VL comprising

VL CDRs

1, 2 and 3, and a VH comprising

VH CDRs

1, 2 and 3, wherein the

VL CDRs

1, 2 and 3, and

VH CDRs

1, 2 and 3 may be derived from a VL and VH from M22, respectively. In some embodiments, an anti-mesothelin antibody or antigen-binding fragment thereof provided by the present invention is a variant of M22. The variant of M22 may have a VL that is a variant of M22 VL having up to about 5 amino acid substitutions, additions and/or deletions in the sequence set forth in SEQ ID NO. 94. The variant of M22 may have a VH that is a variant of the M22 VH having up to about 5 amino acid substitutions, additions and/or deletions in the sequence shown in SEQ ID NO: 109. The amino acid substitution, addition and/or deletion may occur in a VH CDR or a VL CDR. In some embodiments, the amino acid substitutions, additions, and/or deletions are not in a CDR. In some embodiments, the variant of M22 has up to about 5 conservative amino acid substitutions. In some embodiments, the variant of M22 has up to 3 conservative amino acid substitutions.

In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof provided by the present invention is an scFv labeled M24 (SEQ ID NO: 155). In some embodiments, the anti-mesothelin antibodies or antigen-binding fragments thereof provided herein have an amino acid sequence that has at least about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% sequence identity to the sequence set forth in SEQ ID No. 155. In some embodiments, the invention provides an anti-mesothelin antibody or antigen-binding fragment thereof having a VL derived from M24 (SEQ ID NO: 95). In some embodiments, the invention provides anti-mesothelin antibodies or antigen-binding fragments thereof having a VH derived from M24 (SEQ ID NO: 110). The anti-mesothelin antibody or antigen-binding fragment thereof provided by the present invention may have both VL and VH derived from M24. In some embodiments, the anti-mesothelin antibodies or antigen-binding fragments thereof provided herein have a VL comprising

VL CDRs

1, 2 and 3, said

VL CDRs

1, 2 and 3 being derived from a VL from M24 (SEQ ID NO: 95). In some embodiments, the invention provides an anti-mesothelin antibody or antigen-binding fragment thereof having a VH comprising

VH CDRs

1, 2 and 3, the

VH CDRs

1, 2 and 3 being derived from a VH from M24 (SEQ ID NO: 110). The anti-mesothelin antibody or antigen-binding fragment thereof provided by the present invention has a VL comprising

VL CDRs

1, 2 and 3, and a VH comprising

VH CDRs

1, 2 and 3, wherein the

VL CDRs

1, 2 and 3, and the

VH CDRs

1, 2 and 3 may be derived from a VL and a VH from M24, respectively. In some embodiments, an anti-mesothelin antibody or antigen-binding fragment thereof provided by the present invention is a variant of M24. The variant of M24 may have a VL that is a variant of M24 VL having up to about 5 amino acid substitutions, additions and/or deletions in the sequence set forth in SEQ ID No. 95. The variant of M24 may have a VH that is a variant of the M24 VH having up to about 5 amino acid substitutions, additions and/or deletions in the sequence shown in SEQ ID No. 110. The amino acid substitution, addition and/or deletion may occur in a VH CDR or a VL CDR. In some embodiments, the amino acid substitutions, additions, and/or deletions are not in a CDR. In some embodiments, the variant of M24 has up to about 5 conservative amino acid substitutions. In some embodiments, the variant of M24 has up to 3 conservative amino acid substitutions.

In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof provided herein is an scFv labeled M27 (SEQ ID NO: 156). In some embodiments, the present invention provides an anti-mesothelin antibody, or antigen-binding fragment thereof, having an amino acid sequence that has at least about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% sequence identity to the sequence set forth in SEQ ID No. 156. In some embodiments, the invention provides an anti-mesothelin antibody or antigen-binding fragment thereof having a VL derived from M27 (SEQ ID NO: 96). In some embodiments, the invention provides an anti-mesothelin antibody or antigen-binding fragment thereof having a VH derived from M27 (SEQ ID NO: 111). The anti-mesothelin antibody or antigen-binding fragment thereof provided by the present invention may have both VL and VH derived from M27. In some embodiments, the anti-mesothelin antibodies or antigen-binding fragments thereof provided herein have a VL comprising

VL CDRs

1, 2 and 3, said

VL CDRs

1, 2 and 3 being derived from VL from M27 (SEQ ID NO: 96). In some embodiments, the invention provides an anti-mesothelin antibody or antigen-binding fragment thereof having a VH comprising

VH CDRs

1, 2 and 3, the

VH CDRs

1, 2 and 3 being derived from a VH from M27 (SEQ ID NO: 111). The anti-mesothelin antibody or antigen-binding fragment thereof provided by the present invention has a VL comprising

VL CDRs

1, 2 and 3, and a VH comprising

VH CDRs

1, 2 and 3, wherein the

VL CDRs

1, 2 and 3, and

VH CDRs

1, 2 and 3 may be derived from a VL and VH from M27, respectively. In some embodiments, an anti-mesothelin antibody or antigen-binding fragment thereof provided by the present invention is a variant of M27. The variant of M27 may have a VL that is a variant of M27 VL having up to about 5 amino acid substitutions, additions and/or deletions in the sequence shown in SEQ ID NO. 96. The variant of M27 may have a VH that is a variant of the M27 VH having up to about 5 amino acid substitutions, additions and/or deletions in the sequence shown in SEQ ID No. 111. The amino acid substitution, addition and/or deletion may occur in a VH CDR or a VL CDR. In some embodiments, the amino acid substitutions, additions and/or deletions are not in a CDR. In some embodiments, the variant of M27 has up to about 5 conservative amino acid substitutions. In some embodiments, the variant of M27 has up to 3 conservative amino acid substitutions.

In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof provided herein is an scFv labeled M28 (SEQ ID NO: 157). In some embodiments, the anti-mesothelin antibodies or antigen-binding fragments thereof provided herein have an amino acid sequence that has at least about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% sequence identity to the sequence set forth in SEQ ID No. 157. In some embodiments, the invention provides anti-mesothelin antibodies or antigen-binding fragments thereof that have a VL derived from M28 (SEQ ID NO: 97). In some embodiments, the invention provides an anti-mesothelin antibody or antigen-binding fragment thereof having a VH derived from M28 (SEQ ID NO: 112). The anti-mesothelin antibody or antigen-binding fragment thereof provided by the present invention may have both VL and VH derived from M28. In some embodiments, the anti-mesothelin antibodies or antigen-binding fragments thereof provided herein have a VL comprising

VL CDRs

1, 2 and 3, said

VL CDRs

1, 2 and 3 being derived from VL from M28 (SEQ ID NO: 97). In some embodiments, the anti-mesothelin antibodies or antigen-binding fragments thereof provided herein have a VH comprising

VH CDRs

1, 2 and 3, said

VH CDRs

1, 2 and 3 being derived from the VH from M28 (SEQ ID NO: 112). The anti-mesothelin antibody or antigen-binding fragment thereof provided by the present invention has a VL comprising

VL CDRs

1, 2 and 3, and a VH comprising

VH CDRs

1, 2 and 3, wherein the

VL CDRs

1, 2 and 3, and the

VH CDRs

1, 2 and 3 may be derived from a VL and a VH from M28, respectively. In some embodiments, an anti-mesothelin antibody or antigen-binding fragment thereof provided by the present invention is a variant of M28. The variant of M28 may have a VL that is a variant of M28 VL having up to about 5 amino acid substitutions, additions and/or deletions in the sequence shown in SEQ ID NO: 97. The variant of M28 may have a VH that is a variant of the M28 VH having up to about 5 amino acid substitutions, additions and/or deletions in the sequence shown in SEQ ID NO: 112. The amino acid substitution, addition and/or deletion may occur in a VH CDR or a VL CDR. In some embodiments, the amino acid substitutions, additions, and/or deletions are not in a CDR. In some embodiments, the variant of M28 has up to about 5 conservative amino acid substitutions. In some embodiments, the variant of M28 has up to 3 conservative amino acid substitutions.

In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof provided herein is an scFv labeled M31 (SEQ ID NO: 158). In some embodiments, the present invention provides an anti-mesothelin antibody, or antigen-binding fragment thereof, having an amino acid sequence that has at least about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% sequence identity to the sequence set forth in SEQ ID No. 158. In some embodiments, the anti-mesothelin antibodies or antigen-binding fragments thereof provided by the present invention have a VL derived from M31 (SEQ ID NO: 98). In some embodiments, the invention provides an anti-mesothelin antibody or antigen-binding fragment thereof having a VH derived from M31 (SEQ ID NO: 113). The anti-mesothelin antibody or antigen-binding fragment thereof provided by the present invention may have both VL and VH derived from M31. In some embodiments, the anti-mesothelin antibodies or antigen-binding fragments thereof provided herein have a VL comprising

VL CDRs

1, 2 and 3, said

VL CDRs

1, 2 and 3 being derived from a VL from M31 (SEQ ID NO: 98). In some embodiments, the anti-mesothelin antibodies or antigen-binding fragments thereof provided herein have a VH comprising

VH CDRs

1, 2 and 3, said

VH CDRs

1, 2 and 3 being derived from the VH from M31 (SEQ ID NO: 113). The anti-mesothelin antibody or antigen-binding fragment thereof provided by the present invention has a VL comprising

VL CDRs

1, 2 and 3, and a VH comprising

VH CDRs

1, 2 and 3, wherein the

VL CDRs

1, 2 and 3, and the

VH CDRs

1, 2 and 3 may be derived from a VL and a VH from M31, respectively. In some embodiments, an anti-mesothelin antibody or antigen-binding fragment thereof provided by the present invention is a variant of M31. The variant of M31 may have a VL that is a variant of M31 VL having up to about 5 amino acid substitutions, additions and/or deletions in the sequence shown in SEQ ID NO: 98. The variant of M31 may have a VH that is a variant of the M31 VH having up to about 5 amino acid substitutions, additions and/or deletions in the sequence shown in SEQ ID No. 113. The amino acid substitution, addition and/or deletion may occur in a VH CDR or a VL CDR. In some embodiments, the amino acid substitutions, additions, and/or deletions are not in a CDR. In some embodiments, the variant of M31 has up to about 5 conservative amino acid substitutions. In some embodiments, the variant of M31 has up to 3 conservative amino acid substitutions.

In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof provided herein is an scFv labeled M32 (SEQ ID NO: 159). In some embodiments, the anti-mesothelin antibodies or antigen-binding fragments thereof provided herein have an amino acid sequence that has at least about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% sequence identity to the sequence set forth in SEQ ID No. 159. In some embodiments, the invention provides anti-mesothelin antibodies or antigen-binding fragments thereof having a VL derived from M32 (SEQ ID NO: 99). In some embodiments, the invention provides an anti-mesothelin antibody or antigen-binding fragment thereof having a VH derived from M32 (SEQ ID NO: 114). The anti-mesothelin antibody or antigen-binding fragment thereof provided by the present invention may have both VL and VH derived from M32. In some embodiments, the anti-mesothelin antibodies or antigen-binding fragments thereof provided herein have a VL comprising

VL CDRs

1, 2 and 3, said

VL CDRs

1, 2 and 3 being derived from VL from M32 (SEQ ID NO: 99). In some embodiments, the anti-mesothelin antibodies or antigen-binding fragments thereof provided herein have a VH comprising

VH CDRs

1, 2 and 3, said

VH CDRs

1, 2 and 3 being derived from the VH from M32 (SEQ ID NO: 114). The anti-mesothelin antibody or antigen-binding fragment thereof provided by the present invention has a VL comprising

VL CDRs

1, 2 and 3, and a VH comprising

VH CDRs

1, 2 and 3, wherein the

VL CDRs

1, 2 and 3, and the

VH CDRs

1, 2 and 3 may be derived from a VL and a VH from M32, respectively. In some embodiments, an anti-mesothelin antibody or antigen-binding fragment thereof provided by the present invention is a variant of M32. The variant of M32 may have a VL that is a variant of M32 VL having up to about 5 amino acid substitutions, additions and/or deletions in the sequence set forth in SEQ ID No. 99. The variant of M32 may have a VH that is a variant of the M32 VH having up to about 5 amino acid substitutions, additions and/or deletions in the sequence shown in SEQ ID No. 114. The amino acid substitution, addition and/or deletion may occur in a VH CDR or a VL CDR. In some embodiments, the amino acid substitutions, additions, and/or deletions are not in a CDR. In some embodiments, the variant of M32 has up to about 5 conservative amino acid substitutions. In some embodiments, the variant of M32 has up to 3 conservative amino acid substitutions.

In some embodiments, the anti-mesothelin antibody or antigen-binding fragment thereof provided herein is an scFv labeled M37 (SEQ ID NO: 160). In some embodiments, the present invention provides an anti-mesothelin antibody, or antigen-binding fragment thereof, having an amino acid sequence that has at least about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% sequence identity to the sequence set forth in SEQ ID No. 160. In some embodiments, the anti-mesothelin antibodies or antigen-binding fragments thereof provided by the present invention have a VL derived from M37 (SEQ ID NO: 100). In some embodiments, the invention provides anti-mesothelin antibodies or antigen-binding fragments thereof that have a VH derived from M37 (SEQ ID NO: 115). The anti-mesothelin antibody or antigen-binding fragment thereof provided by the present invention may have both VL and VH derived from M37. In some embodiments, the anti-mesothelin antibodies or antigen-binding fragments thereof provided herein have a VL comprising

VL CDRs

1, 2 and 3, said

VL CDRs

1, 2 and 3 being derived from VL from M37 (SEQ ID NO: 100). In some embodiments, the invention provides an anti-mesothelin antibody or antigen-binding fragment thereof having a VH comprising

VH CDRs

1, 2 and 3, the

VH CDRs

1, 2 and 3 being derived from a VH from M37 (SEQ ID NO: 115). The anti-mesothelin antibody or antigen-binding fragment thereof provided by the present invention has a VL comprising

VL CDRs

1, 2 and 3, and a VH comprising

VH CDRs

1, 2 and 3, wherein the

VL CDRs

1, 2 and 3, and the

VH CDRs

1, 2 and 3 may be derived from a VL and a VH from M37, respectively. In some embodiments, an anti-mesothelin antibody or antigen-binding fragment thereof provided by the present invention is a variant of M37. The variant of M37 may have a VL that is a variant of M37 VL having up to about 5 amino acid substitutions, additions and/or deletions in the sequence shown in SEQ ID NO. 100. The variant of M37 may have a VH that is a variant of the M37 VH having up to about 5 amino acid substitutions, additions and/or deletions in the sequence shown in SEQ ID No. 115. The amino acid substitution, addition and/or deletion may occur in a VH CDR or a VL CDR. In some embodiments, the amino acid substitutions, additions, and/or deletions are not in a CDR. In some embodiments, the variant of M37 has up to about 5 conservative amino acid substitutions. In some embodiments, the variant of M37 has up to 3 conservative amino acid substitutions.

In some embodiments, the invention also provides antibodies or antigen-binding fragments that compete for binding to mesothelin (e.g., human mesothelin) with the antibodies or antigen-binding fragments provided above. An antibody that "competes with another antibody for binding to a target" refers to an antibody that inhibits (partially or completely) the binding of another antibody to the target. Whether two antibodies compete with each other for binding to the target, i.e., whether and to what extent one antibody inhibits the binding of the other antibody to the target, can be determined using known competition assays (e.g.,

surface Plasmon Resonance (SPR) analysis). In some embodiments, an anti-mesothelin antibody or antigen-binding fragment competes for at least 50%, 60%, 70%, 80%, 90%, or 100% with another antibody or antigen-binding fragment and inhibits binding of the other antibody or antigen-binding fragment to mesothelin. Competition assays can be performed as described, for example, in Ed Harlow and David Lane, cold Spring Harb protocol; 2006; doi 0.H0l/pdb.prot4277 or "Using Antibodies" Chapter 11, cold Spring Harbor Laboratory Press, cold Spring Harbor, NY, USA 1999, written by Ed Harlow and David Lane.

In some embodiments, the invention provides an antibody or antigen-binding fragment that competes with M6 for binding to mesothelin. In some embodiments, the invention provides an antibody or antigen-binding fragment that competes with M7 for binding to mesothelin. In some embodiments, the invention provides an antibody or antigen-binding fragment that competes with M8 for binding to mesothelin. In some embodiments, the invention provides an antibody or antigen-binding fragment that competes with M10 for binding to mesothelin. In some embodiments, the invention provides antibodies or antigen binding fragments that compete with M12 for binding to mesothelin. In some embodiments, the invention provides an antibody or antigen-binding fragment that competes with M13 for binding to mesothelin. In some embodiments, the invention provides antibodies or antigen binding fragments that compete with M15 for binding to mesothelin. In some embodiments, the invention provides antibodies or antigen binding fragments that compete with M20 for binding to mesothelin. In some embodiments, the invention provides an antibody or antigen-binding fragment that competes with M22 for binding to mesothelin. In some embodiments, the invention provides antibodies or antigen binding fragments that compete with M24 for binding to mesothelin. In some embodiments, the invention provides an antibody or antigen-binding fragment that competes with M27 for binding to mesothelin. In some embodiments, the invention provides antibodies or antigen binding fragments that compete with M28 for binding to mesothelin. In some embodiments, the invention provides an antibody or antigen-binding fragment that competes with M31 for binding to mesothelin. In some embodiments, the invention provides antibodies or antigen binding fragments that compete with M32 for binding to mesothelin. In some embodiments, the invention provides an antibody or antigen-binding fragment that competes with M37 for binding to mesothelin.

The invention further contemplates other variants and equivalents that are substantially homologous to the recombinant, monoclonal, chimeric, humanized and human antibodies or antibody fragments thereof described herein. In some embodiments, it is desirable to increase the binding affinity of an antibody. In some embodiments, it is desirable to modulate a biological property of an antibody, including but not limited to specificity, thermostability, expression level, effector function, glycosylation, immunogenicity, and/or solubility. One skilled in the art will appreciate that amino acid changes can alter post-translational processes of the antibody, such as altering the number or position of glycosylation sites or altering membrane anchoring properties.

A variation may be a substitution, deletion or insertion of one or more nucleotides encoding an antibody or polypeptide that results in a change in the amino acid sequence relative to the native antibody or polypeptide sequence. In some embodiments, the amino acid substitution is the result of replacing one amino acid with another amino acid having similar structural and/or chemical properties, such as a substitution of a leucine with a serine, e.g., a conservative amino acid substitution. Insertions or deletions may be in the range of about 1 to 5 amino acids. In some embodiments, the substitution, deletion, or insertion comprises less than 25 amino acid substitutions, less than 20 amino acid substitutions, less than 15 amino acid substitutions, less than 10 amino acid substitutions, less than 5 amino acid substitutions, less than 4 amino acid substitutions, less than 3 amino acid substitutions, or less than 2 amino acid substitutions relative to the parent molecule. In some embodiments, variations in biologically useful and/or related amino acid sequences can be determined by systematically making insertions, deletions, or substitutions in the sequence, and testing the resulting variant protein for activity as compared to the parent protein.

It is known in the art that the constant regions of antibodies mediate a number of effector functions, and these effector functions may vary depending on the isotype of the antibody. For example, the C1 region of complement binds to the Fc region of IgG or IgM antibodies (binds to antigen) to activate the complement system. Complement activation plays an important role in the opsonization and lysis of cellular pathogens. Activation of the complement can also stimulate inflammatory responses and participate in autoimmune hypersensitivity reactions. In addition, the Fc region of an antibody can bind to cells that express Fc receptors (fcrs). There are many Fc receptors specific for different classes of antibodies, including IgG (gamma receptor), igE (epsilon receptor), igA (alpha receptor), and IgM (mu receptor). Binding of antibodies to cell surface Fc receptors triggers a number of important and diverse biological responses, including phagocytosis and destruction of antibody-coated particles, clearance of immune complexes, killing of cells to lyse antibody-coated target cells (known as antibody-dependent cellular cytotoxicity or ADCC), release of inflammatory mediators, placental transfer, and control of immunoglobulin production. In some embodiments, an anti-mesothelin antibody or antigen-binding fragment described herein comprises at least the constant region of a human IgA antibody. In some embodiments, an anti-mesothelin antibody or antigen-binding fragment described herein comprises at least the constant region of a human IgD antibody. In some embodiments, an anti-mesothelin antibody or antigen-binding fragment described herein comprises at least the constant region of a human IgE antibody. In some embodiments, an anti-mesothelin antibody or antigen binding fragment described herein comprises at least the constant region of a human IgG antibody. In some embodiments, an anti-mesothelin antibody or antigen-binding fragment described herein comprises at least the constant region of a human IgM antibody. In some embodiments, an anti-mesothelin antibody or antigen-binding fragment described herein comprises at least the constant region of a human IgG1 antibody. In some embodiments, an anti-mesothelin antibody or antigen-binding fragment described herein comprises at least the constant region of a human IgG2 antibody. In some embodiments, an anti-mesothelin antibody or antigen-binding fragment described herein comprises at least the constant region of a human IgG3 antibody. In some embodiments, an anti-mesothelin antibody or antigen-binding fragment described herein comprises at least the constant region of a human IgG4 antibody.

In some embodiments, at least one or more constant regions in an anti-mesothelin antibody or antigen binding fragment described herein have been modified or deleted. In some embodiments, the antibody comprises a modification of one or more of the three heavy chain constant regions (CH 1, CH2, or CH 3), and/or a modification of the light chain constant region (CL). In some embodiments, the heavy chain constant region of the modified antibody comprises at least one human constant region. In some embodiments, the heavy chain constant region of the modified antibody comprises more than one human constant region. In some embodiments, the modification to the constant region comprises an addition, deletion or substitution of one or more amino acids in one or more domains. In some embodiments, one or more domains are partially or completely deleted from the constant region of the modified antibody. In some embodiments, the entire CH2 domain is removed from the antibody (Δ CH2 construct). In some embodiments, the deleted constant region is replaced with a short amino acid spacer to provide some of the molecular flexibility normally provided by the deleted constant region. In some embodiments, the modified antibody comprises a CH3 domain fused directly to the hinge region of the antibody. In some embodiments, the modified antibody comprises a peptide spacer interposed between the hinge region and the modified CH2 and/or CH3 domain.

In some embodiments, the anti-mesothelin antibody or antigen binding fragment comprises an Fc region. In some embodiments, the Fc region is fused by a hinge. The hinge may be an IgG1 hinge, an IgG2 hinge, or an IgG3 hinge. The amino acid sequences of the Fc region of human IgG1, igG2, igG3, and IgG4 are known to those of ordinary skill in the art. In some cases, fc regions with amino acid variations are found in native antibodies. In some embodiments, a modified antibody (e.g., a modified Fc region) provides altered effector function, which in turn affects the biological properties of the antibody. For example, in some embodiments, deletion or inactivation of the constant region (by point mutation or other means) reduces binding of the modified antibody to Fc receptors while circulating. In some embodiments, the constant region modification reduces the immunogenicity of the antibody. In some embodiments, the constant region modification increases the serum half-life of the antibody. In some embodiments, the constant region modification reduces the serum half-life of the antibody. In some embodiments, the constant region modification reduces or removes ADCC and/or Complement Dependent Cytotoxicity (CDC) of the antibody. In some embodiments, replacement of specific amino acids in the human IgG1 Fc region with corresponding IgG2 or IgG4 residues reduces effector functions (e.g., ADCC and CDC) in the modified antibody. In some embodiments, the antibody does not have one or more effector functions (e.g., a "non-effector" antibody). In some embodiments, the antibody has no ADCC activity and/or no CDC activity. In some embodiments, the antibody does not bind Fc receptors and/or complement factors. In some embodiments, the antibody has no effector function. In some embodiments, the constant region modification increases or enhances ADCC and/or CDC of the antibody. In some embodiments, the constant region is modified to eliminate disulfide bonds or oligosaccharide moieties. In some embodiments, the constant region is modified to add/replace one or more amino acids, thereby providing one or more cytotoxic, oligosaccharide or carbohydrate attachment sites. In some embodiments, the anti-mesothelin antibody or antigen binding fragment comprises a variant Fc region that is genetically engineered by substitution at a specific amino acid position as compared to the native Fc region. In some embodiments, the anti-mesothelin antibody or antigen-binding fragment described herein comprises an IgG1 heavy chain constant region comprising one or more amino acid substitutions selected from the group consisting of K214R, L234A, L235E, G237A, D356E, and L358M (EU numbering). In some embodiments, the IgG1 heavy chain constant region comprises one or more amino acid substitutions selected from the group consisting of K214R, L234A, L235E, G237A, a330S, P331S, D356E, and L358M (EU numbering). In some embodiments, the IgG1 heavy chain constant region comprises one or more amino acid substitutions selected from the group consisting of K214R, C226S, C229S, and P238S (EU numbering). In some embodiments, the IgG1 heavy chain constant region comprises one or more amino acid substitutions selected from the group consisting of K214R, D356E, and L358M (EU numbering). In some embodiments, the IgG1 heavy chain constant region comprises one or more amino acid substitutions selected from the group consisting of S131C, K133R, G137E, G138S, Q196K, I199T, N203D, K214R, C226S, C229S, and P238S (EU numbering).

In some embodiments, a variant may comprise the addition of amino acid residues at the amino and/or carboxy terminus of an antibody or polypeptide. The length of the added amino acid residues can range from one to one hundred or more residues. In some embodiments, the variant comprises an N-terminal methionyl residue. In some embodiments, the variant comprises additional polypeptides/proteins (e.g., fc regions) to produce a fusion protein. In some embodiments, the variant is designed to be detectable, and may include a detectable label and/or protein (e.g., a fluorescent label or an enzyme).

The variant antibodies or antigen-binding fragments of the present invention can be generated using methods known in the art, including but not limited to site-directed mutagenesis, alanine scanning mutagenesis, and PCR mutagenesis.

In some embodiments, variants of the anti-mesothelin antibodies or antigen-binding fragments disclosed herein may retain mesothelin binding capacity to a similar degree, the same degree, or a higher degree as the parental antibody or antigen-binding fragment. In some embodiments, the variant may have at least about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99% or more identity in amino acid sequence to the parent antibody or antigen binding fragment. In some embodiments, the variant of an anti-mesothelin antibody or antigen-binding fragment comprises the amino acid sequence of a parent anti-mesothelin antibody or antigen-binding fragment with one or more conservative amino acid substitutions. Conservative amino acid substitutions are known in the art, including where one amino acid having a particular physical and/or chemical property is replaced with another amino acid having the same or similar chemical or physical property.

In some embodiments, a variant of an anti-mesothelin antibody or antigen-binding fragment comprises the amino acid sequence of a parent antibody or antigen-binding fragment with one or more non-conservative amino acid substitutions. In some embodiments, a variant of an anti-mesothelin antibody or antigen-binding fragment comprises the amino acid sequence of a parent binding antibody or antigen-binding fragment with one or more non-conservative amino acid substitutions, wherein the one or more non-conservative amino acid substitutions do not interfere with or inhibit one or more biological activities (e.g., mesothelin binding) of the variant. In certain embodiments, the one or more conservative amino acid substitutions, and/or the one or more non-conservative amino acid substitutions may enhance the biological activity of the variant, such that the biological activity of the functional variant is increased as compared to the parent binding moiety.

In some embodiments, the variant can have 1, 2, 3, 4, or 5 amino acid substitutions in the binding portion of the CDR (e.g., VH CDR1, VH CDR2, VH CDR3, VL CDR1, VL CDR2, and VL CDR 3).

In some embodiments, the anti-mesothelin antibody or antigen binding fragment described herein is chemically modified either naturally or by intervention. In some embodiments, the anti-mesothelin antibody or antigen-binding fragment is chemically modified by glycosylation, acetylation, pegylation, phosphorylation, amidation, derivatization by known protecting/blocking groups, proteolytic cleavage, and/or attachment to cellular ligands or other proteins. Any of a number of chemical modifications can be made by known techniques. The anti-mesothelin antibody or antigen binding fragment may comprise one or more amino acid analogs (including, for example, unnatural amino acids), as well as other modifying groups known in the art.

In some embodiments, an anti-mesothelin antibody or antigen-binding fragment (e.g., antibody) has a dissociation constant (K.sub.m) of about 1 μ M or less, about 100nM or less, about 40nM or less, about 20nM or less, about 10nM or less, about 1nM or less, about 0.1nM or less, about 50pM or less, about 10pM or less, or, about 1pM or less _D ) Binds mesothelin (e.g., human mesothelin). In some embodiments, the anti-mesothelin antibody or antigen-binding fragment has a K of about 20nM or less _D Binds mesothelin (e.g., human mesothelin). In some embodiments, the anti-mesothelin antibody or antigen-binding fragment has a K of about 10nM or less _D Binds mesothelin (e.g., human mesothelin). In some embodiments, the anti-mesothelin antibody or antigen-binding fragment has a K of about 1nM or less _D Binds mesothelin (e.g., human mesothelin). In some embodiments, the anti-mesothelin antibody or antigen-binding fragment has a K of about 0.5nM or less _D Binds mesothelin (e.g., human mesothelin). In some embodiments, the anti-mesothelin antibody or antigen-binding fragment has a K of about 0.1nM or less _D Binds mesothelin (e.g., human mesothelin). In some embodiments, the anti-mesothelin antibody or antigen-binding fragment has a K of about 50pM or less _D Binds mesothelin (e.g., human mesothelin). In some embodiments, the anti-mesothelin antibody or antigen bindingThe fragment has a K of about 25pM or less _D Binds mesothelin (e.g., human mesothelin). In some embodiments, the anti-mesothelin antibody or antigen-binding fragment has a K of about 10pM or less _D Binds mesothelin (e.g., human mesothelin). In some embodiments, the anti-mesothelin antibody or antigen-binding fragment has a K of about 1pM or less _D Binds mesothelin (e.g., human mesothelin). In some embodiments, the dissociation constant of a binding agent (e.g., an antibody) for mesothelin is a dissociation constant determined using an internalin immobilized on a Biacore chip and a binding agent flowing through the chip. In some embodiments, the dissociation constant of a binding agent (e.g., antibody) for mesothelin is a dissociation constant determined using a binding agent captured with an anti-human IgG antibody on a Biacore chip and soluble mesothelin flowing through the chip.

The anti-mesothelin antibodies or antigen-binding fragments of the present invention may be analyzed for physical, chemical, and/or biological properties by a variety of methods known in the art. In some embodiments, an anti-mesothelin antibody is tested for its ability to bind mesothelin (e.g., human mesothelin). Binding assays include, but are not limited to, SPR (e.g., biacore), ELISA, and FACS. In addition, antibodies can be evaluated in terms of solubility, stability, thermostability, viscosity, expression level, expression quality, and/or purification efficiency.

Epitope identification is a method of identifying a binding site, region or epitope on a target protein to which an antibody binds. Various methods are known in the art for mapping epitopes to target proteins. These methods include mutations, including but not limited to shotgun mutations, site-directed mutagenesis, and alanine scanning; these methods also include domain or fragment scanning; peptide scanning (e.g., pepscan technique); display methods (e.g., phage display, microbial display, and ribosome/mRNA display); methods involving proteolysis and mass spectrometry; structural determination (e.g., X-ray crystallography and NMR). In some embodiments, the anti-mesothelin antibodies or antigen binding fragments described herein are characterized by assays that include, but are not limited to, N-terminal sequencing, amino acid analysis, HPLC, mass spectrometry, ion exchange chromatography, and papain digestion.

In some embodiments, the anti-mesothelin antibody or antigen binding fragment is conjugated to a cytotoxic agent or cytotoxic moiety. In some embodiments, the anti-mesothelin antibody or antigen-binding fragment is conjugated to a cytotoxic agent to form an ADC (antibody-drug conjugate). In some embodiments, the cytotoxic moiety is a chemotherapeutic agent, including but not limited to methotrexate, doxorubicin (adriamycin/doxorubicin), melphalan, mitomycin C, chlorambucil, duocarmycin (duocarmycin), daunomycin, pyrrolobenzodiazepines (PBDs), or other intercalating agents. In some embodiments, the cytotoxic moiety is a microtubule inhibitor, including but not limited to auristatins, maytansinoids (e.g., DM1 and DM 4), and tubulysins. In some embodiments, the cytotoxic moiety is an enzymatically active toxin or fragment thereof of bacterial, fungal, plant or animal origin, including, but not limited to diphtheria a chain, non-binding active fragments of diphtheria toxin, exotoxin a chain, ricin a chain, abrin a chain, modeccin a chain, alpha-sarcin, aleuridin, dianthin, pokeweed protein (PAPI, PAPII and PAP-S), momordica charantia inhibitor, curcin (curcin), crotin (crotin), saponaria officinalis (Sapaonaria officinalis) inhibitor, gelonin, serinemycin, restrictocin, phenomycin, enomycin and trichothecene compounds (tricothecenes). In some embodiments, the antibody binds to one or more small molecule toxins, such as calicheamicin, maytansinoids, trichothenes, and CC1065.

In some embodiments, the anti-mesothelin antibody or antigen binding fragment of the present invention is conjugated to a detectable substance or molecule that enables the agent to be used for diagnosis and/or detection. Detectable substances may include, but are not limited to, enzymes such as horseradish peroxidase, alkaline phosphatase, beta-galactosidase, and acetylcholinesterase; also included are prosthetic groups such as biotin and flavin; fluorescent substances, e.g. umbelliferone, fluorescein Isothiocyanate (FITC), rhodamine, tetramethylrhodamine isothiocyanate (TRITC), dichlorotriazinylamine fluorescein, dansylChlorine, anthocyanins (Cy 3) and phycoerythrin; bioluminescent materials, such as luciferase; radioactive materials, e.g. ²¹² Bi、 ¹⁴ C、 ⁵⁷ Co、 ⁵¹ Cr、 ⁶⁷ Cu、 ¹⁸ F、 ⁶⁸ Ga、 ⁶⁷ Ga、 ¹⁵³ Gd、 ¹⁵⁹ Gd、 ⁶⁸ Ge、 ³ H、 ¹⁶⁶ Ho、 ¹³¹ I、 ¹²⁵ I、 ¹²³ I、 ¹²¹ I、 ¹¹⁵ In、 ¹¹³ In、 ¹¹² In、 ¹¹¹ In、 ¹⁴⁰ La、 ¹⁷⁷ Lu、 ⁵⁴ Mn、 ⁹⁹ Mo、 ³² P、 ¹⁰³ Pd、 ¹⁴⁹ Pm、 ¹⁴² Pr、 ¹⁸⁶ Re、 ¹⁸⁸ Re、 ¹⁰⁵ Rh、 ⁹⁷ Ru、 ³⁵ S、 ⁴⁷ Sc、 ⁷⁵ Se、 ¹⁵³ Sm、 ¹¹³ Sn、 ¹¹⁷ Sn、 ⁸⁵ Sr、 ^99m Tc、 ²⁰¹ Ti、 ¹³³ XE、 ⁹⁰ Y、 ⁶⁹ Yb、 ¹⁷⁵ Yb、 ⁶⁵ Zn; a positron emitting metal; and a magnetic metal ion positron emitting metal; and magnetic metal ions.

The anti-mesothelin antibody or antigen binding fragment described herein may be linked to a solid support. Such solid supports include, but are not limited to, glass, cellulose, polyacrylamide, nylon, polystyrene, polyvinyl chloride, or polypropylene. In some embodiments, the immobilized anti-mesothelin antibody or antigen-binding fragment is used in an immunoassay. In some embodiments, the immobilized anti-mesothelin antibody or antigen-binding fragment is used to purify an antigen of interest (e.g., human mesothelin).

5.3CAR, TCR and genetically engineered immune effector cells

The anti-mesothelin antibodies or antigen-binding fragments described herein may be used as part of a Chimeric Antigen Receptor (CAR) or T Cell Receptor (TCR), which may be expressed in immune effector cells for the treatment of cancer. As such, the invention also provides CARs and TCRs that specifically bind mesothelin (e.g., human mesothelin), immune effector cells expressing such CARs or TCRs, and uses of such cells.

5.3.1 TCRs

The present invention provides T Cell Receptors (TCRs) that specifically bind mesothelin ("mesothelin TCRs"). TCRs are antigen-specific molecules responsible for recognizing antigenic peptides present in the context of MHC products on the surface of APCs or on the surface of any nucleated cell. This system confers on T cells, via their TCRs, the potential ability to recognize an array of whole intracellular antigens (including viral proteins) expressed by the cells, which are processed into short peptides, bound to intracellular MHC molecules, and delivered to the surface as peptide-MHC complexes. This system allows foreign proteins (such as variant cancer antigens or viral proteins) or aberrantly expressed proteins to be targeted by T cells (e.g., davis and Bjorkman (1988) Nature,334,395-402 Davis et al (1998) Immunol,16, 523-544).

The interaction of the TCR and peptide-MHC complexes can drive T cells into different activation states, depending on the affinity (or off-rate) of binding. The TCR recognition process allows T cells to distinguish between normal, healthy cells and cells transformed, for example, by viruses or malignancies, by providing a diverse pool of TCRs, where it is likely that one or more TCRs are present whose binding affinity to foreign peptides bound to MHC molecules is above the threshold for stimulating T cell activity (Manning and Kranz (1999) Immunology Today,20, 417-422).

Wild-type TCRs isolated from human or mouse T cell clones identified by in vitro culture have been shown to have relatively low binding affinity (K) _D =1-300 μm) (Davis et al (1998) Immunol,16, 523-544). This is due in part to the fact that T cells developing in the thymus are negatively selected for self peptide-MHC ligands (tolerance induction) and thus allow the clearance of over-avidity T cells. (Starr et al, (2003) Immunol,21, 139-76). To compensate for these relatively low affinities, T cells have evolved a co-receptor system in which the cell surface molecules CD4 and CD8 bind to MHC molecules (class II and class I, respectively) and cooperate with TCRs to mediate signaling activity. CD8 is particularly effective in this process, allowing TCRs with very low affinity (e.g., K) _D =300 μ M) mediates potent antigen-specific activity.

Directed evolution can be used to generate TCRs with higher affinity for a particular peptide-MHC complex. Methods that can be used include yeast display (Holler et al, (2003) Nat Immunol,4,55-62, (2000) Proc Natl Acad Sci U S A,97, 5387-92), phage display (Li et al, (2005) Nat Biotechnol,23, 349-54) and T cell display (Chervin et al, (2008) J Immunol Methods,339, 175-84). All three approaches involve engineering or modifying TCRs that exhibit the normal, low affinity of the wild-type TCR to increase affinity for the cognate peptide-MHC complex (the original antigen specific for T cells).

Also, in some embodiments, the TCRs provided herein comprise an anti-mesothelin antibody or antigen-binding fragment described herein. The anti-mesothelin antibody or antigen binding fragment may be any anti-mesothelin antibody or antigen binding fragment described herein. In some embodiments, the anti-mesothelin antibody or antigen-binding fragment is an scFv provided herein labeled as M6, M7, M8, M10, M12, M13, M15, M20, M22, M24, M27, M28, M31, M32 or M37. For exemplary purposes, in some embodiments, the TCRs provided herein can include an anti-mesothelin antibody or antigen-binding fragment having a VL and a VH, wherein the VL includes a VL CDR1, CDR2, and CDR3, and the VH includes a VH CDR1, CDR2, and CDR3, and wherein the VL CDR1, VL CDR2, VL CDR3, VH CDR1, VH CDR2, and VH CDR3 have the amino acid sequences shown in (1) SEQ ID NOs 1, 16, 30, 45, 58, and 71, respectively; (2) The amino acid sequences shown as SEQ ID NOs 2, 17, 31, 46, 59 and 72; (3) 3, 18, 32, 47, 60 and 73; (4) 4, 19, 33, 48, 61 and 74; (5) 5, 20, 34, 49, 62 and 75; (6) 6, 21, 35, 50, 63 and 76 of SEQ ID NO; (7) Amino acid sequences shown as SEQ ID NOS 7, 22, 36, 51, 64 and 77; (8) The amino acid sequences shown as SEQ ID NOS: 8, 23, 37, 52, 65 and 78; (9) 9, 24, 38, 53, 66 and 79; (10) Amino acid sequences shown as SEQ ID NOs 10, 25, 39, 48, 61 and 80; (11) 11, 26, 40, 54, 67 and 81; (12) 12, 27, 41, 53, 66 and 82; (13) 13, 28, 42, 55, 68 and 83 of SEQ ID NO; (14) 14, 29, 43, 56, 69 and 84; or (15) the amino acid sequences shown in SEQ ID NOS: 15, 18, 44, 57, 70 and 85. In some embodiments, the TCRs provided herein can include an scFv provided herein labeled as M6, M7, M8, M10, M12, M13, M15, M20, M22, M24, M27, M28, M31, M32, or M37. In some embodiments, the TCRs provided herein can include an scFv labeled as M12. In some embodiments, the TCRs provided herein can include an scFv labeled as M24. In some embodiments, the TCRs provided herein can include an scFv labeled as M37.

In some embodiments, the TCRs provided herein comprise an alpha chain and a beta chain. The constant regions of the α and β chains of the TCR are encoded by TRAC and TRBC, respectively. Human TRAC may have a numbering corresponding to UniProtKB/Swiss-Prot: p01848.2 (accession number: P01848.2 GI: 1431906459). Human TRBC may have an amino acid sequence corresponding to the GenBank sequence (accession number: ALC78509.1 GI: 924924895). In some embodiments, the TCRs provided herein comprise TCR α chains comprising an anti-mesothelin antibody or antigen binding fragment provided herein. In some embodiments, the TCRs provided herein comprise TCR β chains comprising an anti-mesothelin antibody or antigen binding fragment provided herein. In some embodiments, the TCR comprises a gamma chain (γ) and a delta chain (δ). The constant regions of the TCR γ and β chains are encoded by TRGC and TRDC, respectively. Human TRGC may have a sequence corresponding to UniProtKB/Swiss-Prot: P0CF51.1 (accession number: P0CF51.1 GI: 294863156), or an amino acid sequence corresponding to UniProtKB/Swiss-Prot: p03986.2 (accession number: P03986.2 GI: 1531253869). Human TRDC may have a base sequence corresponding to UniProtKB/Swiss-Prot: an amino acid sequence of B7Z8K6.2 (accession number: B7Z8K6.2 GI: 294863191). In some embodiments, the TCRs provided herein comprise TCR γ chains comprising an anti-mesothelin antibody or antigen binding fragment provided herein. In some embodiments, the TCRs provided herein comprise TCR delta chains comprising an anti-mesothelin antibody or antigen binding fragment provided herein.

5.3.2 CARs

CARs are engineered receptors that provide antigen binding and immune effector cell activation functions. The CARs can be used to transplant the specificity of an antibody (e.g., a monoclonal antibody) onto an immune effector cell (e.g., a T cell, NK cell, or macrophage). CAR retards immune effector cells (e.g., T cells) to tumor surface antigens in an HLA-independent manner (Sadelain et al, nat. Rev. Cancer.3 (1): 35-45 (2003); sadelain et al, cancer Discovery 3 (4): 388-398 (2013); rafiq and Brentjens (2016). Nat Rev Clin Oncol 13 (6): 370-383). Typical structures of CAR molecules include extracellular antigen-binding domains (e.g., scFv), transmembrane domains (TM), and intracellular signaling domains. The extracellular antigen-binding domain of a CAR is typically derived from a monoclonal antibody (mAb) or a receptor or ligand thereof. Antigen binding of CARs triggers phosphorylation of Immunoreceptor Tyrosine Activation Motifs (ITAMs) within the intracellular domain, initiating the signaling cascade required for cytolytic induction, cytokine secretion and proliferation. Based on the presence of intracellular costimulatory signals, CAR-expressing T Cells (CART) can be classified into three generations.

In some embodiments, the invention provides a CAR that specifically binds mesothelin ("mesothelin CAR"). In some embodiments, the CAR can be a "first generation", "second generation", or "third generation" CAR (see, e.g., sadelain et al, cancer Discov.3 (4): 388-398 (2013); jensen et al, immunol. Rev.257:127-133 (2014); sharpe et al, dis. Model Mech.8 (4): 337-350 (2015); june et al (2018), science 359 (6382): 1361-1365).

"first generation" CARs typically consist of an extracellular antigen-binding domain, e.g., a single chain variable fragment (scFv), fused to a transmembrane domain, fused to the cytoplasmic/intracellular domain of a T cell receptor chain. "first generation" CARs typically have an intracellular domain from the CD3 zeta-chain, which is the primary transmitter of endogenous T Cell Receptor (TCRs) signals. "first generation" CARs provide de novo antigen recognition and through CD in a single fusion molecule3 zeta chain signaling domain causes CD4 ⁺ T cells and CD8 ⁺ T cell activation without relying on HLA-mediated antigen presentation. "second generation" CARs include a Cancer antigen-binding domain fused to an intracellular signaling domain capable of activating immune effector cells (e.g., T cells) and a costimulatory domain intended to enhance immune effector cell (e.g., T cell) potency and persistence (Sadelain et al, cancer discov.3:388-398 (2013)). Thus, CAR design can combine antigen recognition and signal transduction, both functions being physiologically assumed by two independent complexes (TCR heterodimer and CD3 complex). "second generation" CARs include intracellular domains from various costimulatory receptors, such as CD28, 4-1BB, ICOS, OX40, etc., located in the cytoplasmic tail of the CAR to provide additional signals to the cell. "second generation" CARs provide both co-stimulation (e.g., through the CD28 or 4-1BB domain) and activation (e.g., through the CD3 zeta signaling domain). Studies have shown that "second generation" CARs can increase the anti-tumor activity of T cells. In 2017, the FDA approved two anti-CD 19 CAR T cell products for the treatment of relapsed B-cell precursor acute lymphoblastic leukemia (B-ALL) and B-cell non-hodgkin's lymphoma. "third generation" CARs provide multiple co-stimulations (e.g., by containing both the domains of CD28 and 4-1 BB), as well as activation (e.g., by containing the CD3 δ activation domain).

Thus, the invention provides a CAR that specifically binds mesothelin, comprising from N-terminus to C-terminus: (a) A mesothelin binding domain comprising an anti-mesothelin antibody or antigen binding fragment provided by the present invention; (b) a transmembrane domain; and (c) a cytoplasmic domain. The anti-mesothelin antibody or antigen-binding fragment may be any anti-mesothelin antibody or antigen-binding fragment described herein. For exemplary purposes, in some embodiments, the CARs provided herein can include an anti-mesothelin antibody or antigen-binding fragment having a VL and a VH, wherein the VL includes a VL CDR1, CDR2, and CDR3, and the VH includes a VH CDR1, CDR2, and CDR3, and wherein the VL CDR1, VL CDR2, VL CDR3, VH CDR1, VH CDR2, and VH CDR3 have the amino acid sequences shown in (1) SEQ ID NOs 1, 16, 30, 45, 58, and 71, respectively; (2) The amino acid sequences shown as SEQ ID NOs 2, 17, 31, 46, 59 and 72; (3) 3, 18, 32, 47, 60 and 73; (4) Amino acid sequences shown as SEQ ID NOS 4, 19, 33, 48, 61 and 74; (5) Amino acid sequences shown as SEQ ID NOS 5, 20, 34, 49, 62 and 75; (6) 6, 21, 35, 50, 63 and 76 of SEQ ID NO; (7) 7, 22, 36, 51, 64 and 77; (8) 8, 23, 37, 52, 65 and 78; (9) 9, 24, 38, 53, 66 and 79; (10) 10, 25, 39, 48, 61 and 80; (11) 11, 26, 40, 54, 67 and 81; (12) 12, 27, 41, 53, 66 and 82; (13) 13, 28, 42, 55, 68 and 83 of SEQ ID NO; (14) 14, 29, 43, 56, 69 and 84; or (15) the amino acid sequences shown in SEQ ID NOS: 15, 18, 44, 57, 70 and 85. In some embodiments, a CAR provided herein can include a scFv provided herein labeled as M6, M7, M8, M10, M12, M13, M15, M20, M22, M24, M27, M28, M31, M32, or M37. In some embodiments, a CAR of the invention can include M12. In some embodiments, a CAR described herein can include M24. In some embodiments, a CAR of the invention can comprise M32.

In some embodiments, the TCRs provided herein can include an anti-mesothelin antibody or antigen-binding fragment that is an scFv provided herein labeled as M6, M7, M8, M10, M12, M13, M15, M20, M22, M24, M27, M28, M31, M32, or M37.

In some embodiments, the transmembrane domain of a CAR provided herein comprises a hydrophobic alpha helix spanning at least a portion of the membrane. Different transmembrane domains lead to different receptor stabilities. Upon antigen recognition, the receptor aggregates and transmits a signal to the cell. In some embodiments, the transmembrane domain of a CAR provided herein can be derived from a protein or polypeptide naturally expressed in an immune effector cell. By transmembrane domain derived from a protein or polypeptide is meant that the transmembrane domain includes the entire transmembrane region of the protein or polypeptide or a fragment thereof. In some embodiments, the CAR provided herein can have a transmembrane domain derived from CD8, CD28, CD3 ζ, CD4, 4-1BB, OX40, ICOS, CTLA-4, PD-1, LAG-3, 2B4, BTLA, T-cell receptor (TCR) α chain, TCR β chain, or TCR ζ chain, CD3 epsilon, CD45, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, CD154, or other polypeptide expressed in an immune effector cell. In some embodiments, the transmembrane domain of a CAR provided herein comprises a transmembrane region of CD8, CD28, CD3 ζ, CD4, 4-1BB, OX40, ICOS, CTLA-4, PD-1, LAG-3, 2B4, BTLA, T-cell receptor (TCR) α chain, TCR β chain, or TCR ζ chain, CD3 epsilon, CD45, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, CD154, or other polypeptide expressed in an immune effector cell.

In some embodiments, the transmembrane domain of a CAR provided herein is derived from CD8. In some embodiments, the transmembrane domain comprises the transmembrane region of CD8. In some embodiments, the transmembrane domain is derived from CD28. In some embodiments, the transmembrane domain comprises the transmembrane region of CD28. In some embodiments, the transmembrane domain is derived from CD3 ζ. In some embodiments, the transmembrane domain comprises the transmembrane region of CD3 ζ. In some embodiments, the transmembrane domain is derived from CD4. In some embodiments, the transmembrane domain comprises the transmembrane region of CD4. In some embodiments, the transmembrane domain is derived from 4-1BB. In some embodiments, the transmembrane domain comprises the transmembrane region of 4-1BB. In some embodiments, the transmembrane domain is derived from OX40. In some embodiments, the transmembrane domain comprises a transmembrane region of OX40. In some embodiments, the transmembrane domain is derived from ICOS. In some embodiments, the transmembrane domain comprises the transmembrane region of ICOS. In some embodiments, the transmembrane domain is derived from CTLA-4. In some embodiments, the transmembrane domain comprises a transmembrane region of CTLA-4. In some embodiments, the transmembrane domain is derived from PD-1. In some embodiments, the transmembrane domain comprises the transmembrane region of PD-1. In some embodiments, the transmembrane domain is derived from LAG-3. In some embodiments, the transmembrane domain comprises the transmembrane region of LAG-3. In some embodiments, the transmembrane domain is derived from 2B4. In some embodiments, the transmembrane domain comprises the transmembrane region of 2B4. In some embodiments, the transmembrane domain is derived from BTLA. In some embodiments, the transmembrane domain comprises the transmembrane region of BTLA. In some embodiments, the transmembrane domain is derived from a TCR a chain. In some embodiments, the transmembrane domain comprises a transmembrane region of a TCR α chain. In some embodiments, the transmembrane domain is derived from a TCR β chain. In some embodiments, the transmembrane domain comprises a transmembrane region of a TCR β chain. In some embodiments, the transmembrane domain is derived from a TCR zeta chain. In some embodiments, the transmembrane domain comprises a transmembrane region of a TCR zeta chain. In some embodiments, the transmembrane domain is derived from CD3 epsilon. In some embodiments, the transmembrane domain comprises the transmembrane region of CD3 epsilon. In some embodiments, the transmembrane domain is derived from CD45. In some embodiments, the transmembrane domain comprises the transmembrane region of CD45. In some embodiments, the transmembrane domain is derived from CD5. In some embodiments, the transmembrane domain comprises the transmembrane region of CD5. In some embodiments, the transmembrane domain is derived from CD8. In some embodiments, the transmembrane domain comprises the transmembrane region of CD8. In some embodiments, the transmembrane domain is derived from CD9. In some embodiments, the transmembrane domain comprises the transmembrane region of CD9. In some embodiments, the transmembrane domain is derived from CD16. In some embodiments, the transmembrane domain comprises the transmembrane region of CD16. In some embodiments, the transmembrane domain is derived from CD22. In some embodiments, the transmembrane domain comprises the transmembrane region of CD22. In some embodiments, the transmembrane domain is derived from CD33. In some embodiments, the transmembrane domain comprises the transmembrane region of CD33. In some embodiments, the transmembrane domain is derived from CD37. In some embodiments, the transmembrane domain comprises the transmembrane region of CD37. In some embodiments, the transmembrane domain is derived from CD64. In some embodiments, the transmembrane domain comprises the transmembrane region of CD64. In some embodiments, the transmembrane domain is derived from CD80. In some embodiments, the transmembrane domain comprises the transmembrane region of CD80. In some embodiments, the transmembrane domain is derived from CD86. In some embodiments, the transmembrane domain comprises the transmembrane region of CD86. In some embodiments, the transmembrane domain is derived from CD134. In some embodiments, the transmembrane domain comprises the transmembrane region of CD134. In some embodiments, the transmembrane domain is derived from CD154. In some embodiments, the transmembrane domain comprises the transmembrane region of CD154. Exemplary transmembrane domains are described in more detail below.

In some embodiments, the transmembrane domain may be artificially synthesized, in which case it consists essentially of hydrophobic residues, such as leucine and valine. Optionally, the transmembrane domain may be derived from a polypeptide that is not naturally expressed in the immune effector cell, so long as the transmembrane domain is capable of transducing a signal from an antigen bound to the CAR to the intracellular signaling domain and/or the co-stimulatory domain. In some embodiments, the transmembrane domain may include a triplet of phenylalanine, tryptophan, and valine at each end. Optionally, a short oligopeptide or polypeptide linker, preferably between 2 and 10 amino acids in length, can form a link between the transmembrane domain and the cytoplasmic signaling domain of the CAR. Glycine-serine conjugates provide particularly suitable linkers.

The cytoplasmic domain of the CAR provided by the invention further comprises a signaling domain that functions in an immune effector cell expressing the CAR. Such signaling domains may, for example, be derived from CD3 ζ, fc receptor γ, fc γ RIIa, fcR β (fcepsilonr 1 b), CD3 γ, CD3 δ, CD3 epsilon, CD79a, CD79b, DAP10, or DAP12. The signaling domain can also be a combination of signaling domains derived from molecules selected from the group consisting of CD3 ζ, fc receptor γ, fc γ RIIa, fcR β (fcepsilonr 1 b), CD3 γ, CD3 δ, CD3 epsilon, CD79a, CD79b, DAP10, and DAP12. A signaling domain derived from a protein or polypeptide refers to a domain of the protein or polypeptide that is responsible for activating immune effector cells (e.g., T cells), or a fragment thereof that retains its activating function. Generally, the signaling domain induces persistence, transport and/or effector functions in transduced immune effector cells (e.g., T cells) (Sharpe et al, dis. Model Mech.8:337-350 (2015); finney et al, J.Immunol.161:2791-2797 (1998); krause et al, J.exp. Med.188:619-626 (1998)). The signaling domain of a protein or polypeptide can be an intracellular domain of the protein or polypeptide. In some embodiments, the signaling domain comprises an intracellular domain of CD3 ζ, fcR γ, fcyriia, fcR β, CD3 γ, CD3 δ, CD3 epsilon, CD5, CD22, CD79a, CD79b, DAP10, DAP12, or any combination thereof.

In some embodiments, the cytoplasmic domain of a CAR provided herein comprises a signaling domain derived from CD3 ζ. In some embodiments, the signaling domain comprises the intracellular domain of CD3 ζ. In some embodiments, the cytoplasmic domain comprises a signaling domain derived from FcR γ. In some embodiments, the signaling domain comprises an intracellular domain of FcR γ. In some embodiments, the cytoplasmic domain comprises a signaling domain derived from Fc γ RIIa. In some embodiments, the signaling domain comprises an intracellular domain of Fc γ RIIa. In some embodiments, the cytoplasmic domain comprises a signaling domain derived from FcR β. In some embodiments, the signaling domain comprises an intracellular domain of FcR β. In some embodiments, the cytoplasmic domain comprises a signaling domain derived from CD3 γ. In some embodiments, the signaling domain comprises the intracellular domain of CD3 γ. In some embodiments, the cytoplasmic domain comprises a signaling domain derived from CD3 δ. In some embodiments, the signaling domain comprises the intracellular domain of CD3 δ. In some embodiments, the cytoplasmic domain comprises a signaling domain derived from CD3 epsilon. In some embodiments, the signaling domain comprises an intracellular domain of CD3 epsilon. In some embodiments, the cytoplasmic domain comprises a signaling domain derived from CD 5. In some embodiments, the signaling domain comprises the intracellular domain of CD 5. In some embodiments, the cytoplasmic domain comprises a signaling domain derived from CD 22. In some embodiments, the signaling domain comprises the intracellular domain of CD 22. In some embodiments, the cytoplasmic domain comprises a signaling domain derived from CD79 a. In some embodiments, the signaling domain comprises the intracellular domain of CD79 a. In some embodiments, the cytoplasmic domain comprises a signaling domain derived from CD79 b. In some embodiments, the signaling domain comprises the intracellular domain of CD79 b. In some embodiments, the cytoplasmic domain comprises a signaling domain derived from DAP 10. In some embodiments, the signaling domain comprises an intracellular domain of DAP 10. In some embodiments, the cytoplasmic domain includes a signaling domain derived from DAP 12. In some embodiments, the signaling domain comprises the intracellular domain of DAP 12. Exemplary signaling domains are described in more detail below.

In some embodiments, the cytoplasmic domain of a CAR provided herein further comprises a costimulatory domain. In some embodiments, the cytoplasmic domain of a CAR provided herein further comprises two co-stimulatory domains. Such co-stimulatory domains may provide enhanced activation of immune effector cells (e.g., T cells). The co-stimulatory signaling domain may be derived from, for example, CD28, 4-1BB (CD 137), OX40, ICOS, DAP10, 2B4, CD27, CD30, CD40, CD2, CD7, LIGHT, TIGIT, GITR, TLR, DR3, or CD43. A co-stimulatory domain derived from a protein or polypeptide refers to a domain of the protein or polypeptide that is responsible for providing enhanced activation of immune effector cells (e.g., T cells), or a fragment that retains its activation function. In some embodiments, the co-stimulatory domain of a CAR provided herein comprises the intracellular domain of CD28, 4-1BB (CD 137), OX40, ICOS, DAP10, 2B4, CD27, CD30, CD40, CD2, CD7, LIGHT, TIGIT, GITR, TLR, DR3, or CD43. In some embodiments, the cytoplasmic domain of a CAR provided herein comprises a co-stimulatory domain derived from CD 28. In some embodiments, the co-stimulatory domain comprises the intracellular domain of CD 28. In some embodiments, the cytoplasmic domain comprises a co-stimulatory domain derived from 4-1 BB. In some embodiments, the co-stimulatory domain comprises the intracellular domain of 4-1 BB. In some embodiments, the cytoplasmic domain comprises a costimulatory domain derived from XO 40. In some embodiments, the co-stimulatory domain comprises an intracellular domain of OX 40. In some embodiments, the cytoplasmic domain comprises a costimulatory domain derived from ICOS. In some embodiments, the co-stimulatory domain comprises the intracellular domain of ICOS. In some embodiments, the cytoplasmic domain includes a costimulatory domain derived from DAP 10. In some embodiments, the co-stimulatory domain comprises the intracellular domain of DAP 10. In some embodiments, the cytoplasmic domain includes a costimulatory domain derived from 2B 4. In some embodiments, the co-stimulatory domain comprises the intracellular domain of 2B 4. In some embodiments, the cytoplasmic domain comprises a costimulatory domain derived from CD 27. In some embodiments, the co-stimulatory domain comprises the intracellular domain of CD 27. In some embodiments, the cytoplasmic domain comprises a co-stimulatory domain derived from CD 30. In some embodiments, the co-stimulatory domain comprises the intracellular domain of CD 30. In some embodiments, the cytoplasmic domain comprises a co-stimulatory domain derived from CD 40. In some embodiments, the co-stimulatory domain comprises the intracellular domain of CD 40. In some embodiments, the cytoplasmic domain comprises a co-stimulatory domain derived from CD 2. In some embodiments, the co-stimulatory domain comprises the intracellular domain of CD 2. In some embodiments, the cytoplasmic domain comprises a costimulatory domain derived from CD 7. In some embodiments, the co-stimulatory domain comprises the intracellular domain of CD 7. In some embodiments, the cytoplasmic domain comprises a co-stimulatory domain derived from LIGHT. In some embodiments, the co-stimulatory domain comprises the intracellular domain of LIGHT. In some embodiments, the cytoplasmic domain comprises a costimulatory domain derived from TIGIT. In some embodiments, the co-stimulatory domain comprises the intracellular domain of TIGIT. In some embodiments, the cytoplasmic domain comprises a costimulatory domain derived from GITR. In some embodiments, the co-stimulatory domain comprises an intracellular domain of GITR. In some embodiments, the cytoplasmic domain comprises a co-stimulatory domain derived from a TLR. In some embodiments, the co-stimulatory domain comprises an intracellular domain of a TLR. In some embodiments, the cytoplasmic domain includes a co-stimulatory domain derived from DR 3. In some embodiments, the co-stimulatory domain comprises an intracellular domain of DR 3. In some embodiments, the cytoplasmic domain comprises a co-stimulatory domain derived from CD43. In some embodiments, the co-stimulatory domain comprises the intracellular domain of CD43. Exemplary co-stimulatory domains are described in more detail below.

CARs comprising an intracellular domain comprising a co-stimulatory domain derived from 4-1BB, ICOS, or DAP-10 have been previously described (see U.S.7,446,190, which is incorporated herein by reference, which also describes representative sequences of 4-1BB, ICOS, and DAP-10). In some embodiments, the cytoplasmic domain of the CAR can include two costimulatory domains derived from two costimulatory receptors, e.g., CD28 and 4-1BB (see, sadelain et al, cancer discov.3 (4): 388-398 (2013)), or CD28 and OX40, or a combination of other costimulatory ligands disclosed herein.

The extracellular domain of the CAR can be fused to a leader peptide or signal peptide that directs the nascent protein into the endoplasmic reticulum and subsequent transport to the cell surface. It will be appreciated that once a polypeptide containing a signal peptide is expressed on the cell surface, the signal peptide will generally have been proteolytically removed during processing and transport of the polypeptide in the endoplasmic reticulum to the cell surface. Thus, a polypeptide, such as a CAR, is typically expressed on the cell surface as a mature protein lacking a signal peptide, while the precursor form of the polypeptide includes the signal peptide. If the CAR is to be glycosylated and/or anchored in the cell membrane, a signal peptide or a leader peptide may be necessary. The signal sequence or leader sequence is a peptide sequence, usually present at the N-terminus of the newly synthesized protein, that directs the protein into the secretory pathway. The signal peptide is covalently linked to the N-terminus of the extracellular antigen-binding domain of the CAR to form a fusion protein. Any suitable signal peptide, as is well known in the art, may be applied to the CAR to provide cell surface expression in immune cells (see, gierasch biochem.28:923-930 (1989); von Heijne, J.mol.biol.184 (1): 99-105 (1985)). Particularly useful signal peptides can be derived from cell surface proteins provided by the invention that are naturally expressed in immune cells, including any signal peptide of the polypeptides disclosed herein. Thus, any suitable signal peptide may be utilized to direct the expression of the CAR on the cell surface of the immune effector cells provided by the present invention.

In some embodiments, the CAR may further comprise a spacer or sequence that interconnects the domains of the CAR. For example, a spacer can be included between the signal peptide and the antigen binding domain, between the antigen binding domain and the transmembrane domain, between the transmembrane domain and the endodomain, and/or between domains within the endodomain, such as between the stimulatory domain and the costimulatory domain. The spacer may be flexible enough to allow interaction of the various domains with other polypeptides, e.g., to allow flexibility in the orientation of the antigen binding domain to facilitate antigen recognition. The spacer may be, for example, from the hinge region of IgG, CH of an immunoglobulin ₂ CH ₃ (constant) region, and/or a portion of CD3 (cluster of differentiation 3) or some other sequence suitable as a spacer. In some embodiments, the disclosed CARs include a hinge domain that connects the mesothelin binding domain and the transmembrane domain. In some embodiments, the hinge domain comprises a CD8 hinge structure. In some embodiments, the hinge domain comprises a CD28 hinge structure.

Some exemplary molecules are provided below from which the domains of the CARs provided by the invention can be derived.

CD 3ζCD3 ζ contains 3 immunoreceptor tyrosine-based activation motifs (ITAMs) and transmits activation signals to cells, e.g., cells of the lymphoid lineage, such as T cells, upon antigen binding. The CD3 ζ polypeptide may have an amino acid sequence corresponding to the sequence of GenBank accession number NP-932170.1 (NP-932170.1, GI 37595565; shown below) or a fragment thereof. In some embodiments, the CD3 zeta signaling domain has the sequence of amino acids 52 to 164 of the CD3 zeta polypeptide sequence provided below, or a fragment thereof sufficient for signaling activity. See GenBank NP _932170 for reference to domains within CD3 ζ, such as signal peptides of amino acids 1-21; an extracellular domain of amino acids 22-30; a transmembrane region of amino acids 31 to 51; an intracellular domain of amino acids 52-164. In some embodiments, the CAR can have a transmembrane domain derived from CD3 ζ. The transmembrane domain may include a transmembrane region of CD3 ζ (e.g., amino acids 31 to 51 of the following sequence) or a fragment thereof. In some embodiments, the CAR cytoplasmic domain can include a signaling domain derived from CD3 ζ. In some embodiments, the signaling domain of CD3 ζ may include an intracellular domain of CD3 ζ (e.g., amino acids 52 to 164 of the following sequence), or a fragment thereof. It is understood that a CD3 zeta sequence that is shorter or longer than a particular described domain may be included in the CAR, if desired.

1 MKWKALFTAA ILQAQLPITE AQSFGLLDPK LCYLLDGILF IYGVILTALF LRVKFSRSAD

61 APAYQQGQNQ LYNELNLGRR EEYDVLDKRR GRDPEMGGKP QRRKNPQEGL YNELQKDKMA

121 EAYSEIGMKG ERRRGKGHDG LYQGLSTATK DTYDALHMQA LPPR(SEQ ID NO:195)

FcRγ，The activation type of IgG receptor Fc γ R forms multimeric complexes comprising Fc receptor γ chains (FcR γ) containing Intracellular Tyrosine Activation Motifs (ITAMs), the activation of which triggers burst of active oxygen, cytokine release, phagocytosis, antibody-dependent cell-mediated cytotoxicity, and degranulation. FcR gamma polypeptides may have an amino acid sequence corresponding toHaving the amino acid sequence of NCBI reference sequence NP-004097.1 (GI: 4758344) (shown below) or a fragment thereof. See GenBank NP _004097 for reference to domains within FcR γ, e.g., such as a signal peptide of amino acids 1-18; an extracellular domain of amino acids 19-23; a transmembrane domain of amino acids 24-44; an intracellular domain of amino acids 45-86. In some embodiments, the CAR may comprise a transmembrane domain derived from FcR γ. In some embodiments, the CAR transmembrane domain comprises the transmembrane region of FcR γ (e.g., amino acids 24 to 44 of the following sequence), or a fragment thereof. In some embodiments, the CAR cytoplasmic domain can include a signaling domain derived from FcR γ. In some embodiments, the signaling domain comprises an intracellular domain of FcR γ (e.g., amino acids 45 to 86 of the following sequence) or a fragment thereof. It is understood that FcR γ sequences shorter or longer than the particular described domain may be included in the CAR if desired.

1 MIPAVVLLLL LLVEQAAALG EPQLCYILDA ILFLYGIVLT LLYCRLKIQV RKAAITSYEK

61 SDGVYTGLST RNQETYETLK HEKPPQ(SEQ ID NO:196)

FcγRIIaAre cell surface receptors found on phagocytic cells such as macrophages and neutrophils, which are involved in the phagocytosis and clearance of immune complexes. By binding to IgG, it initiates a cellular response to pathogens and soluble antigens. Fc γ RIIa also promotes phagocytosis of regulatory antigens. The Fc γ RIIa polypeptide can have an amino acid sequence that corresponds to a sequence having NCBI reference sequence NP _001129691.1 (shown below) or a fragment thereof. See NCBI reference sequence NP _001129691.1 for domains within Fc γ RIIa, e.g., signal peptides of amino acids 1-33; an extracellular domain of amino acids 34-217; a transmembrane domain of amino acids 218-240; an intracellular domain of amino acids 241-317. In some embodiments, the CAR may comprise a transmembrane domain derived from Fc γ RIIa. In some embodiments, the CAR transmembrane domain comprises the transmembrane region of Fc γ RIIa (e.g., amino acids 218 to 240 of the following sequence), or a fragment thereof. In some embodiments, the CAR cytoplasmic domain can include a signaling domain derived from Fc γ RIIa. In some casesIn embodiments, the signaling domain comprises the intracellular domain of Fc γ RIIa (e.g., amino acids 241 to 317 of the following sequence) or a fragment thereof. It is understood that Fc γ RIIa sequences shorter or longer than the particular described domain may be included in the CAR if desired.

MTMETQMSQN VCPRNLWLLQ PLTVLLLLAS ADSQAAAPPK AVLKLEPPWI NVLQEDSVTL

TCQGARSPES DSIQWFHNGN LIPTHTQPSY RFKANNNDSG EYTCQTGQTS LSDPVHLTVL

SEWLVLQTPH LEFQEGETIM LRCHSWKDKP LVKVTFFQNG KSQKFSHLDP TFSIPQANHS

HSGDYHCTGN IGYTLFSSKP VTITVQVPSM GSSSPMGIIV AVVIATAVAA IVAAVVALIY

CRKKRISANS TDPVKAAQFE PPGRQMIAIR KRQLEETNND YETADGGYMT LNPRAPTDDD

KNIYLTLPPN DHVNSNN(SEQ ID NO:197)

FcRβ(FcεR1b)Is a high affinity receptor that binds to the Fc region of immunoglobulin epsilon. Intact mast cell responses require aggregation of the FcR β by multivalent antigens, including de novo production by degranulation to release preformed mediators (such as histamine) as well as lipid mediators and cytokines. FcR β also mediates secretion of important lymphokines. Binding of allergens to receptor-bound IgE results in cell activation and release of mediators responsible for the manifestation of allergy. The FcR β polypeptide may have an amino acid sequence corresponding to an amino acid sequence having a NCBI reference sequence (NP _000130.1, shown below) or a fragment thereof. See NCBI reference sequence: NP-000130.1 for reference to domains within FcR β, such as the intracellular domains at amino acids 1-59, 118-130, and 201-244; a transmembrane domain of amino acids 60-79, 98-117, 131-150 and 181-200; an extracellular domain of amino acids 80-97 and 151-180. In some embodiments, the CAR cytoplasmic domain can include a signaling domain derived from FcR β. In some embodiments, the signaling domain comprises an intracellular domain of FcR β (e.g., amino acids 1 to 59, 118 to 130, or 201 to 244 of the following sequence, or a combination thereof), or a fragment thereof. It is understood that FcR β sequences shorter or longer than the particular described domain may be included in the CAR if desired.

1 MDTESNRRAN LALPQEPSSV PAFEVLEISP QEVSSGRLLK SASSPPLHTW LTVLKKEQEF

61 LGVTQILTAM ICLCFGTVVC SVLDISHIEG DIFSSFKAGY PFWGAIFFSI SGMLSIISER

121 RNATYLVRGS LGANTASSIA GGTGITILII NLKKSLAYIH IHSCQKFFET KCFMASFSTE

181 IVVMMLFLTI LGLGSAVSLT ICGAGEELKG NKVPEDRVYE ELNIYSATYS ELEDPGEMSP

241 PIDL(SEQ ID NO:198)

CD3 gamma (T cell surface glycoprotein CD3 gamma chain)Is part of the TCR-CD3 complex present on the surface of T lymphocytes and plays an important role in adaptive immune responses. The cytoplasmic domain of CD3 γ contains Immunoreceptor Tyrosine Activation Motifs (ITAMs). In addition to the role of signal transduction in T cell activation, CD3 γ also plays an important role in the dynamic regulation of TCR expression on cell surfaces. The CD3 γ polypeptide may have an amino acid sequence corresponding to a polypeptide having the NCBI reference sequence: NP-004097.1 (GI: 4758344) (shown below) or a fragment thereof. See GenBank NP _004097 for reference to domains within CD3 γ, such as signal peptides of amino acids 1-22; an extracellular domain of amino acids 23-116; a transmembrane region of amino acids 117 to 137; an intracellular domain of amino acids 138-182. In some embodiments, the CAR may comprise a transmembrane domain derived from CD3 γ. In some embodiments, the CAR transmembrane domain comprises the transmembrane region of CD3 γ (e.g., amino acids 117 to 137 of the following sequence), or a fragment thereof. In some embodiments, the CAR cytoplasmic domain can include a signaling domain derived from CD3 γ. In some embodiments, the signaling domain comprises the intracellular domain of CD3 γ (e.g., amino acids 138 to 182 of the following sequence) or a fragment thereof. It is understood that CD3 γ sequences shorter or longer than the particular described domain may be included in the CAR if desired.

1 MEQGKGLAVL ILAIILLQGT LAQSIKGNHL VKVYDYQEDG SVLLTCDAEA KNITWFKDGK

61 MIGFLTEDKK KWNLGSNAKD PRGMYQCKGS QNKSKPLQVY YRMCQNCIEL NAATISGFLF

121 AEIVSIFVLA VGVYFIAGQD GVRQSRASDK QTLLPNDQLY QPLKDREDDQ YSHLQGNQLR

181 RN(SEQ ID NO:199)

CD3 delta (T cell surface glycoprotein CD3 delta chain)Is part of the TCR-CD3 complex on the surface of T lymphocytes and plays an important role in adaptive immune responses. The cytoplasmic domain of CD3 δ contains Immunoreceptor Tyrosine Activation Motifs (ITAMs). In addition to the signal transduction role in T cell activation, CD3 δ plays an important role in thymocyte differentiation and is involved in the proper assembly and surface expression of the TCR-CD3 complex within cells. CD3 δ interacts with CD4 and CD8 and thus serves to establish a functional link between TCR and CD4 and CD8 co-receptors, which is required for CD4 or CD 8T cell activation and positive selection. The CD3 δ polypeptide may have an amino acid sequence corresponding to the amino acid sequence having NCBI reference sequence NP — 000723.1 (shown below) or a fragment thereof. See BCBI reference sequence: NP-000723.1 to refer to the domain within CD 3. Delta. Such as the signal peptide of amino acids 1-21; an extracellular domain of amino acids 22-105; a transmembrane region of amino acids 106 to 126; an intracellular domain of amino acids 127-171. In some embodiments, the CAR may include a transmembrane domain derived from CD3 δ. In some embodiments, the CAR transmembrane domain comprises the transmembrane region of CD3 δ (e.g., amino acids 106 to 126 of the following sequence), or a fragment thereof. In some embodiments, the CAR cytoplasmic domain can include a signaling domain derived from CD3 δ. In some embodiments, the signaling domain comprises an intracellular domain of CD3 δ (e.g., amino acids 127 to 171 of the following sequence) or a fragment thereof. It is understood that a CD3 δ sequence that is shorter or longer than a particular described domain may be included in a CAR if desired.

1 MEHSTFLSGL VLATLLSQVS PFKIPIEELE DRVFVNCNTS ITWVEGTVGT LLSDITRLDL

61 GKRILDPRGI YRCNGTDIYK DKESTVQVHY RMCQSCVELD PATVAGIIVT DVIATLLLAL

121 GVFCFAGHET GRLSGAADTQ ALLRNDQVYQ PLRDRDDAQY SHLGGNWARN K(SEQ ID NO:200)

CD3 epsilon (T cell surface glycoprotein CD3 epsilon chain)Is part of the TCR-CD3 complex present on the surface of T lymphocytes and plays an important role in adaptive immune responses. Cytoplasmic domain of CD3 epsilon contains immunoreceptorsTyrosine Activating Motifs (ITAMs). In addition to the role of signal transduction in T cell activation, CD3 epsilon plays an important role in the proper development of T cells. CD3 epsilon triggers the assembly of the TCR-CD3 complex by forming two heterodimers, CD3 delta/CD 3 gamma and CD3 gamma/CD 3 gamma. The CD3 epsilon polypeptide may have an amino acid sequence corresponding to the amino acid sequence having NCBI reference sequence NP _000724.1 (shown below) or a fragment thereof. See BCBI reference sequence: NP-000724.1 to refer to a domain within CD3 ε, such as the signal peptide of amino acids 1-22; an extracellular domain of amino acids 23-126; a transmembrane region of amino acids 127 to 152; an intracellular domain of amino acids 153-207. In some embodiments, the CAR can include a transmembrane domain derived from CD3 epsilon. In some embodiments, the CAR transmembrane domain comprises the transmembrane region of CD3 epsilon (e.g., amino acids 127 to 152 of the following sequence), or a fragment thereof. In some embodiments, the CAR cytoplasmic domain can include a signaling domain derived from CD3 epsilon. In some embodiments, the signaling domain comprises an intracellular domain of CD3 epsilon (e.g., amino acids 153 to 207 of the following sequence) or a fragment thereof. It is understood that a CD3 epsilon sequence that is shorter or longer than the particular described domain may be included in the CAR, if desired.

1 MQSGTHWRVL GLCLLSVGVW GQDGNEEMGG ITQTPYKVSI SGTTVILTCP QYPGSEILWQ

61 HNDKNIGGDE DDKNIGSDED HLSLKEFSEL EQSGYYVCYP RGSKPEDANF YLYLRARVCE

121 NCMEMDVMSV ATIVIVDICI TGGLLLLVYY WSKNRKAKAK PVTRGAGAGG RQRGQNKERP

181 PPVPNPDYEP IRKGQRDLYS GLNQRRI(SEQ ID NO:201)

CD79a (B-cell antigen receptor complex associated protein alpha chain)Required for the following process: in concert with CD79B, a signaling cascade is initiated, activated by binding of antigen to the B-cell antigen receptor complex (BCR), which results in complex internalization, translocation into the endosome and antigen presentation. CD79a stimulates SYK autophosphorylation and activation. CD79a also binds to BLNK, brings BLNK into proximity with SYK and phosphorylates BLNK with SYK, and interacts with some Src family tyrosine kinases, increasing its activity. The CD79a polypeptide has an amino acid sequenceCorresponding to an amino acid sequence having the NCBI reference sequence NP _001774.1 (shown below) or a fragment thereof. See NCBI reference sequence: NP _001774.1 to refer to a domain within CD79a, e.g., a signal peptide of amino acids 1-32; an extracellular domain of amino acids 33-143; a transmembrane region of amino acids 144-165; an intracellular domain of amino acids 166-226. In some embodiments, the CAR may comprise a transmembrane domain derived from CD79 a. In some embodiments, the CAR transmembrane domain comprises the transmembrane region of CD79a (e.g., amino acids 144 to 165 of the following sequence) or a fragment thereof. In some embodiments, the CAR cytoplasmic domain can include a signaling domain derived from CD79 a. In some embodiments, the signaling domain comprises the intracellular domain of CD79a (e.g., amino acids 166-226 of the following sequence) or a fragment thereof. It is understood that a CD79a sequence that is shorter or longer than a particular described domain may be included in a CAR, if desired.

1 MPGGPGVLQA LPATIFLLFL LSAVYLGPGC QALWMHKVPA SLMVSLGEDA HFQCPHNSSN

61 NANVTWWRVL HGNYTWPPEF LGPGEDPNGT LIIQNVNKSH GGIYVCRVQE GNESYQQSCG

121 TYLRVRQPPP RPFLDMGEGT KNRIITAEGI ILLFCAVVPG TLLLFRKRWQ NEKLGLDAGD

181 EYEDENLYEG LNLDDCSMYE DISRGLQGTY QDVGSLNIGD VQLEKP(SEQ ID NO:202)

CD79B (B-cell antigen receptor complex associated protein beta chain)Required for the following process: in concert with CD79a, a signaling cascade is initiated that is activated by binding of antigen to the B-cell antigen receptor complex (BCR), which results in complex internalization, transport to endosomes (late endosomes), and antigen presentation. CD79b promotes phosphorylation of CD79 a. The CD79b polypeptide may have an amino acid sequence corresponding to an amino acid sequence having the NCBI reference sequence NP _000617.1 (shown below) or a fragment thereof. See NCBI reference sequence: NP-000617.1 for reference to a domain within CD79b, e.g., a signal peptide of amino acids 1-28; an extracellular domain of amino acids 29-159; a transmembrane region of amino acids 160 to 180; an intracellular domain of amino acids 181-229. In some embodiments, the CAR may comprise a CD 7-derived source9b, and a transmembrane domain. In some embodiments, the CAR transmembrane domain comprises the transmembrane region of CD79b (e.g., amino acids 160 to 180 of the following sequence), or a fragment thereof. In some embodiments, the CAR cytoplasmic domain can include a signaling domain derived from CD79 b. In some embodiments, the signaling domain comprises an intracellular domain of CD79b (e.g., amino acids 181 to 229 of the following sequence), or a fragment thereof. It is understood that CD79b sequences shorter or longer than the particular described domain may be included in the CAR if desired.

1 MARLALSPVP SHWMVALLLL LSAEPVPAAR SEDRYRNPKG SACSRIWQSP RFIARKRGFT

61 VKMHCYMNSA SGNVSWLWKQ EMDENPQQLK LEKGRMEESQ NESLATLTIQ GIRFEDNGIY

121 FCQQKCNNTS EVYQGCGTEL RVMGFSTLAQ LKQRNTLKDG IIMIQTLLII LFIIVPIFLL

181 LDKDDSKAGM EEDHTYEGLD IDQTATYEDI VTLRTGEVKW SVGEHPGQE(SEQ ID NO:203)

DAP10DAP10, also known as a hematopoietic cell signal transducer, is a signal subunit associated with a large family of receptors in hematopoietic cells. The DAP10 polypeptide may have an amino acid sequence corresponding to the sequence provided below with GenBank No. NP-055081.1 (GI: 15826850), or a fragment thereof. See GenBank NP _055081 for reference to the domain within DAP10, such as the signal peptide at amino acids 1-18; an extracellular domain of amino acids 19-48; a transmembrane region of amino acids 49-69; an intracellular domain of amino acids 70-93. In some embodiments, the CAR cytoplasmic domain can include a signaling domain derived from DAP 10. In some embodiments, the signaling domain comprises the intracellular domain of DAP10 (e.g., amino acids 70 to 93 of the following sequence) or a fragment thereof. In some embodiments, the cytoplasmic domain includes a costimulatory domain derived from DAP 10. In some embodiments, the co-stimulatory domain comprises the intracellular domain of DAP10 (e.g., amino acids 70 to 93 of the following sequence), or a fragment thereof. It is understood that DAP10 sequences shorter or longer than the particular described domain may be included in the CAR if desired.

1 MIHLGHILFL LLLPVAAAQT TPGERSSLPA FYPGTSGSCS GCGSLSLPLL AGLVAADAVA

61 SLLIVGAVFL CARPRRSPAQ EDGKVYINMP GRG(SEQ ID NO:204)

DAP12，DAP12 is present in myeloid lineage cells, such as macrophages and granulocytes, where it is associated with, for example, a trigger receptor expressed on myeloid lineage cell members (TREMs) and MDL1 (myeloid DAP 12-related lectin 1/CLEC 5A), both of which are involved in inflammatory responses against pathogens, such as viruses and bacteria. In lymphoid lineage cells, DAP12 is expressed in NK cells and is associated with activating receptors (e.g., C-type lectin receptor NKG 2C), natural cytotoxicity receptor NKp44, brachyury-type KIR3DS1 and KIR2DS1/2/5, respectively. In particular, NGK2C is the major activating NK cell receptor used to control CMV infection in humans and mice. It was found that sufficient activation signal was generated in NK cells after cross-linking the DAP 12-containing CAR with its Ag.

et al, J Immunol 194. The DAP12 polypeptide may have an amino acid sequence corresponding to a sequence having GenBank No. AAD09437.1 (GI: 2905996) provided below or a fragment thereof. See GenBank No. aad09437.1 for reference to domains within DAP12, such as a signal peptide of amino acids 1-21; an extracellular domain of amino acids 22-40; a transmembrane region of amino acids 41-61; an intracellular domain of amino acids 62-113. In some embodiments, the CAR cytoplasmic domain can include a signaling domain derived from DAP 12. In some embodiments, the signaling domain comprises the intracellular domain of DAP12 (e.g., amino acids 62 to 113 of the following sequence) or a fragment thereof. In some embodiments, the cytoplasmic domain includes a costimulatory domain derived from DAP 12. In some embodiments, the co-stimulatory domain comprises the intracellular domain of DAP12 (e.g., amino acids 62 to 113 of the following sequence) or a fragment thereof. It is understood that DAP12 sequences shorter or longer than a particular described domain may be included in a CAR if desired.

1 MGGLEPCSRL LLLPLLLAVS GLRPVQAQAQ SDCSCSTVSP GVLAGIVMGD LVLTVLIALA

61 VYFLGRLVPR GRGAAEAATR KQRITETESP YQELQGQRSD VYSDLNTQRP YYK(SEQ ID NO:205)

CD28，Cluster of differentiation 28 (CD 28) is a protein expressed on T cells that provides a costimulatory signal for T cell activation and survival. CD28 is a receptor for the CD80 (B7.1) and CD86 (B7.2) proteins. The CD28 polypeptide may have an amino acid sequence corresponding to a sequence having GenBank No. P10747 (P10747.1, GI: 115973) or NP 006130 (NP 006130.1, GI 5453611) or a fragment thereof as described below. See GenBank NP _006130 for reference to domains within CD28, e.g., signal peptides of amino acids 1 to 18; an extracellular domain of amino acids 19 to 152; a transmembrane domain of amino acids 153 to 179; an intracellular domain of amino acids 180-220. In some embodiments, the CAR may comprise a hinge domain derived from CD28 (e.g., amino acids 114 to 152 of the lower sequence), or a fragment thereof. In some embodiments, the CAR may comprise a transmembrane domain derived from CD 28. In some embodiments, the CAR transmembrane domain comprises the transmembrane region of CD28 (e.g., amino acids 153 to 179 of the following sequence), or a fragment thereof. In some embodiments, the CAR cytoplasmic domain can include a co-stimulatory domain derived from CD 28. In some embodiments, the co-stimulatory domain comprises the intracellular domain of CD28 (e.g., amino acids 180 to 220 of the following sequence) or a fragment thereof. In some embodiments, the CAR may include two domains derived from CD28, a costimulatory signaling domain and a transmembrane domain. In some embodiments, the CAR has an amino acid sequence that includes a transmembrane domain and an intracellular domain of CD28, and the CAR includes amino acids 153 to 220 of CD 28. In some embodiments, the CAR may comprise three domains derived from CD28, a transmembrane domain, a hinge domain, and a costimulatory signaling domain. In another embodiment, the CAR comprises amino acids 114 to 220 of CD 28. It is understood that a CD28 sequence that is shorter or longer than a particular described domain may be included in a CAR, if desired.

1 MLRLLLALNL FPSIQVTGNK ILVKQSPMLV AYDNAVNLSC KYSYNLFSRE FRASLHKGLD

61 SAVEVCVVYG NYSQQLQVYS KTGFNCDGKL GNESVTFYLQ NLYVNQTDIY FCKIEVMYPP

121 PYLDNEKSNG TIIHVKGKHL CPSPLFPGPS KPFWVLVVVG GVLACYSLLV TVAFIIFWVR

181 SKRSRLLHSD YMNMTPRRPG PTRKHYQPYA PPRDFAAYRS(SEQ ID NO:206)

4-1BB，4-1BB, also known as TNF receptor superfamily member 9, can act as a TNF ligand and has stimulatory activity. The 4-1BB polypeptide may have an amino acid sequence corresponding to a sequence having GenBank No. P41273 (P41273.1, GI: 728739) or NP 001552 (NP 001552.2, GI 5730095) or a fragment thereof. See GenBank NP-001552 for reference to a domain within 4-1BB, e.g., the signal peptide at amino acids 1-17; an extracellular domain of amino acids 18-186; a transmembrane domain of amino acids 187 to 213; an intracellular domain of amino acids 214-255. In some embodiments, the CAR can include a transmembrane domain derived from 4-1 BB. In some embodiments, the CAR transmembrane domain comprises the transmembrane region of 4-1BB (e.g., amino acids 187 to 213 of the following sequence), or a fragment thereof. In some embodiments, the CAR cytoplasmic domain can include a costimulatory domain derived from 4-1 BB. In some embodiments, the co-stimulatory domain comprises the intracellular domain of 4-1BB (e.g., amino acids 214 to 255 of the following sequence), or a fragment thereof. In some embodiments, the CAR may comprise two domains derived from 4-1BB, a costimulatory signaling domain and a transmembrane domain. In some embodiments, the CAR has an amino acid sequence comprising the transmembrane domain and the intracellular domain of 4-1BB, and the CAR comprises amino acids 187 to 255 of 4-1 BB. It is understood that 4-1BB sequences shorter or longer than the particular described domain can be included in the CAR, if desired.

1 MGNSCYNIVA TLLLVLNFER TRSLQDPCSN CPAGTFCDNN RNQICSPCPP NSFSSAGGQR

61 TCDICRQCKG VFRTRKECSS TSNAECDCTP GFHCLGAGCS MCEQDCKQGQ ELTKKGCKDC

121 CFGTFNDQKR GICRPWTNCS LDGKSVLVNG TKERDVVCGP SPADLSPGAS SVTPPAPARE

181 PGHSPQIISF FLALTSTALL FLLFFLTLRF SVVKRGRKKL LYIFKQPFMR PVQTTQEEDG

241 CSCRFPEEEE GGCEL(SEQ ID NO:207)

OX40，OX40, also known as tumor necrosis factor receptor superfamily member 4 precursor or CD134, is a member of the TNFR-receptor superfamily. OX40 polypeptide can have an amino acid sequence corresponding to the sequence provided below with GenBank No. P43489 (P43489.1, GI: 1171933) or NP 003318 (NP 003318.1, GI 4507579), or a fragment thereof. See GenBank NP _003318 for reference to domains in OX40, e.g., signal peptides of amino acids 1-28; an extracellular domain of amino acids 29-214; a transmembrane domain of amino acids 215-235; an intracellular domain of amino acids 236-277. It is understood that OX40 sequences shorter or longer than the particular described domain can be included in the CAR if desired. In some embodiments, the CAR can include a transmembrane domain derived from OX 40. In some embodiments, the CAR transmembrane domain comprises a transmembrane region of OX40 (e.g., amino acids 215 to 235 of the following sequence), or a fragment thereof. In some embodiments, the CAR cytoplasmic domain can include a co-stimulatory domain derived from OX 40. In some embodiments, the co-stimulatory domain comprises an intracellular domain of OX40 (e.g., amino acids 236 to 277 of the following sequence), or a fragment thereof. In some embodiments, the CAR may comprise two domains derived from OX40, a costimulatory signaling domain and a transmembrane domain. In some embodiments, the CAR has an amino acid sequence comprising a transmembrane domain and an intracellular domain of OX40, and the CAR comprises

1 MCVGARRLGR GPCAALLLLG LGLSTVTGLH CVGDTYPSND RCCHECRPGN GMVSRCSRSQ

61 NTVCRPCGPG FYNDVVSSKP CKPCTWCNLR SGSERKQLCT ATQDTVCRCR AGTQPLDSYK

121 PGVDCAPCPP GHFSPGDNQA CKPWTNCTLA GKHTLQPASN SSDAICEDRD PPATQPQETQ

181 GPPARPITVQ PTEAWPRTSQ GPSTRPVEVP GGRAVAAILG LGLVLGLLGP LAILLALYLL

241 RRDQRLPPDA HKPPGGGSFR TPIQEEQADA HSTLAKI(SEQ ID NO:208)

ICOS，Inducible T cell costimulatory precursor (ICOS), also known as CD278, is expressed onActivating the CD28 superfamily costimulatory receptors on T cells. The ICOS polypeptide may have an amino acid sequence corresponding to a sequence provided below having GenBank No. NP _036224 (NP _036224.1, gi 15029518), or a fragment thereof. See GenBank NP 036224 for reference to domains within ICOS, such as signal peptides of amino acids 1-20; an extracellular domain of amino acids 21-140; a transmembrane domain of amino acids 141-161; an intracellular domain of amino acids 162-199. In some embodiments, the CAR can include a transmembrane domain derived from ICOS. In some embodiments, the CAR transmembrane domain comprises the transmembrane region of ICOS (e.g., amino acids 141 to 161 of the following sequence), or a fragment thereof. In some embodiments, the CAR cytoplasmic domain can include a costimulatory domain derived from ICOS. In some embodiments, the co-stimulatory domain comprises the intracellular domain of ICOS (e.g., amino acids 162 to 199 of the following sequence) or a fragment thereof. In some embodiments, the CAR may comprise two domains derived from ICOS, a costimulatory signaling domain and a transmembrane domain. In some embodiments, the CAR has an amino acid sequence that includes a transmembrane domain and an intracellular domain of ICOS, and the CAR includes amino acids 141 to 199 of ICOS. It is understood that ICOS sequences shorter or longer than the particular described domain may be included in the CAR if desired.

1 MKSGLWYFFL FCLRIKVLTG EINGSANYEM FIFHNGGVQI LCKYPDIVQQ FKMQLLKGGQ

61 ILCDLTKTKG SGNTVSIKSL KFCHSQLSNN SVSFFLYNLD HSHANYYFCN LSIFDPPPFK

121 VTLTGGYLHI YESQLCCQLK FWLPIGCAAF VVVCILGCIL ICWLTKKKYS SSVHDPNGEY

181 MFMRAVNTAK KSRLTDVTL(SEQ ID NO:209)

2B42B4 (CD 244) is a co-stimulatory receptor expressed on both NK cells and CD8+ T cells. Their target is hematopoietic cells (including B cells and T cells) and non-MHC-like molecules expressed on activated monocytes and granulocytes (CD 48). 2B4 is activated by binding of its ligand to the target cell, resulting in NK (or T cell) activation and killing of the target cell. The 2B4 polypeptide may have an amino acid sequence corresponding to a polypeptide having a sequence as shown inThe sequence of accession number q9bzw8.2 (NP _ 001160135.1. See GenBank NP _001160135.1 for reference to a domain within 2B4, e.g., a signal peptide of amino acids 1-21; an extracellular domain of amino acids 22-229; a transmembrane domain of amino acids 230 to 250; an intracellular domain of amino acids 251-370. In some embodiments, the CAR can include a transmembrane domain derived from 2B 4. In some embodiments, the CAR transmembrane domain comprises the transmembrane region of 2B4 (e.g., amino acids 230 to 250 of the following sequence), or a fragment thereof. In some embodiments, the CAR cytoplasmic domain can include a costimulatory domain derived from 2B 4. In some embodiments, the co-stimulatory domain comprises the intracellular domain of 2B4 (e.g., amino acids 251 to 370 of the following sequence) or a fragment thereof. In some embodiments, the CAR may include two domains derived from 2B4, a costimulatory signaling domain and a transmembrane domain. In some embodiments, the CAR has an amino acid sequence that includes the transmembrane domain and the intracellular domain of 2B4, and the CAR includes amino acids 230 to 370 of 2B 4. It is understood that 2B4 sequences shorter or longer than the particular described domain can be included in the CAR if desired.

MLGQVVTLIL LLLLKVYQGK GCQGSADHVV SISGVPLQLQ PNSIQTKVDS IAWKKLLPSQ

NGFHHILKWE NGSLPSNTSN DRFSFIVKNL SLLIKAAQQQ DSGLYCLEVT SISGKVQTAT

FQVFVFESLL PDKVEKPRLQ GQGKILDRGR CQVALSCLVS RDGNVSYAWY RGSKLIQTAG

NLTYLDEEVD INGTHTYTCN VSNPVSWESH TLNLTQDCQN AHQEFRFWPF LVIIVILSAL

FLGTLACFCV WRRKRKEKQS ETSPKEFLTI YEDVKDLKTR RNHEQEQTFP GGGSTIYSMI

QSQSSAPTSQ EPAYTLYSLI QPSRKSGSRK RNHSPSFNST IYEVIGKSQP KAQNPARLSR

KELENFDVYS(SEQ ID NO:210)

CD27: CD27 (TNFRSF 7) is a transmembrane receptor, expressed on human CD8+, CD4+ T cell subsets, NKT cells, NK cell subsets and hematopoietic progenitor cells, and induced in FOXP3+ CD4T cells and B cell subsets. Previous studies found that CD27 can actively provide co-stimulation in vivoStimulating signal, increasing human T cell survival rate and anti-tumor activity. (see Song and Powell; oncoimmunology 1, no.4 (2012): 547-549). The CD27 polypeptide may have an amino acid sequence corresponding to the sequence provided below with UniProtKB/Swiss-Prot No.: P26842.2 (GenBank NP _001233.1 gi. See GenBank NP _001233 for reference to domains within CD27, e.g., signal peptide of amino acids 1-19; an extracellular domain of amino acids 20-191; a transmembrane domain of amino acids 192-212; an intracellular domain of amino acids 213-260. In some embodiments, the CAR can include a transmembrane domain derived from CD 27. In some embodiments, the CAR transmembrane domain comprises the transmembrane region of CD27 (e.g., amino acids 192 to 212 of the following sequence), or a fragment thereof. In some embodiments, the CAR cytoplasmic domain can include a costimulatory domain derived from CD 27. In some embodiments, the co-stimulatory domain comprises the intracellular domain of CD27 (e.g., amino acids 213 to 260 of the following sequence) or a fragment thereof. In some embodiments, the CAR may include two domains derived from CD27, a costimulatory signaling domain and a transmembrane domain. In some embodiments, the CAR has an amino acid sequence that includes a transmembrane domain and an intracellular domain of CD27, and the CAR includes amino acids 192 to 260 of CD 27. It is understood that CD27 sequences shorter or longer than the particular described domain may be included in the CAR if desired.

1 MARPHPWWLC VLGTLVGLSA TPAPKSCPER HYWAQGKLCC QMCEPGTFLV KDCDQHRKAA

61 QCDPCIPGVS FSPDHHTRPH CESCRHCNSG LLVRNCTITA NAECACRNGW QCRDKECTEC

121 DPLPNPSLTA RSSQALSPHP QPTHLPYVSE MLEARTAGHM QTLADFRQLP ARTLSTHWPP

181 QRSLCSSDFI RILVIFSGMF LVFTLAGALF LHQRRKYRSN KGESPVEPAE PCHYSCPREE

241 EGSTIPIQED YRKPEPACSP(SEQ ID NO:211)

CD30: CD30 and its ligand (CD 30L) belong to the Tumor Necrosis Factor Receptor (TNFR) and Tumor Necrosis Factor (TNF) superfamily, respectively. CD30 behaves in many ways like OX40 and enhances its ability to bind to TCR stimulates induced proliferation and cytokine production. (Goronzy and Weyand, arthritis research)&therapy 10, no. S1 (2008): S3). The CD30 polypeptide may have an amino acid sequence corresponding to a sequence having GenBank No.: AAA51947.1 (GenBank NP _001234.3 gi. See GenBank NP _001234.3 for reference to domains within CD30, e.g., signal peptides of amino acids 1-18; an extracellular domain of amino acids 19-385; a transmembrane domain of amino acids 386 to 406; an intracellular domain of amino acids 407-595. In some embodiments, the CAR may comprise a transmembrane domain derived from CD 30. In some embodiments, the CAR transmembrane domain comprises the transmembrane region of CD30 (e.g., amino acids 386 to 406 of the following sequence) or a fragment thereof. In some embodiments, the CAR cytoplasmic domain can include a co-stimulatory domain derived from CD 30. In some embodiments, the co-stimulatory domain comprises the intracellular domain of CD30 (e.g., amino acids 3407 to 595 of the following sequence) or a fragment thereof. In some embodiments, the CAR may include two domains derived from CD30, a costimulatory signaling domain and a transmembrane domain. In some embodiments, the CAR has an amino acid sequence that includes the transmembrane domain and the intracellular domain of CD30, and the CAR includes amino acids 386 to 595 of CD 30. It is understood that CD30 sequences shorter or longer than the particular described domain may be included in the CAR if desired.

1 MRVLLAALGL LFLGALRAFP QDRPFEDTCH GNPSHYYDKA VRRCCYRCPM GLFPTQQCPQ

61 RPTDCRKQCE PDYYLDEADR CTACVTCSRD DLVEKTPCAW NSSRVCECRP GMFCSTSAVN

121 SCARCFFHSV CPAGMIVKFP GTAQKNTVCE PASPGVSPAC ASPENCKEPS SGTIPQAKPT

181 PVSPATSSAS TMPVRGGTRL AQEAASKLTR APDSPSSVGR PSSDPGLSPT QPCPEGSGDC

241 RKQCEPDYYL DEAGRCTACV SCSRDDLVEK TPCAWNSSRT CECRPGMICA TSATNSCARC

301 VPYPICAAET VTKPQDMAEK DTTFEAPPLG TQPDCNPTPE NGEAPASTSP TQSLLVDSQA

361 SKTLPIPTSA PVALSSTGKP VLDAGPVLFW VILVLVVVVG SSAFLLCHRR ACRKRIRQKL

421 HLCYPVQTSQ PKLELVDSRP RRSSTQLRSG ASVTEPVAEE RGLMSQPLME TCHSVGAAYL

481 ESLPLQDASP AGGPSSPRDL PEPRVSTEHT NNKIEKIYIM KADTVIVGTV KAELPEGRGL

541 AGPAEPELEE ELEADHTPHY PEQETEPPLG SCSDVMLSVE EEGKEDPLPT AASGK(SEQ ID NO:212)

CD40: CD40 is a 48kD transmembrane glycoprotein surface receptor and is one of the members of the Tumor Necrosis Factor Receptor Superfamily (TNFRSF). Exemplary amino acid sequences of human CD40 are described below (see, e.g., accession number ALQ33424.1, genBank NP-001241.1, GI 957949089), CD40 was originally thought to be a costimulatory receptor expressed on APC, playing a central role in B-and T-cell activation. The ligand CD154 of CD40 (also known as TRAP, T-BAM, CD40 ligand or CD 40L) is a type II integral membrane protein. See GenBank NP _001241.1 for reference to domains within CD40, e.g., signal peptide of amino acids 1-20; an extracellular domain of amino acids 21-193; a transmembrane domain of amino acids 194 to 215; an intracellular domain of amino acids 216-277. In some embodiments, the CAR can include a transmembrane domain derived from CD 40. In some embodiments, the CAR transmembrane domain comprises a transmembrane region of CD40 (e.g., amino acids 194 to 215 of the following sequence), or a fragment thereof. In some embodiments, the CAR cytoplasmic domain can include a co-stimulatory domain derived from CD 40. In some embodiments, the co-stimulatory domain comprises the intracellular domain of CD40 (e.g., amino acids 216 to 277 of the following sequence) or a fragment thereof. In some embodiments, the CAR may include two domains derived from CD40, a costimulatory signaling domain and a transmembrane domain. In some embodiments, the CAR has an amino acid sequence that includes the transmembrane domain and the intracellular domain of CD40, and the CAR includes amino acids 194 to 277 of CD 40. It is understood that CD40 sequences shorter or longer than the particular described domain may be included in the CAR if desired.

MVRLPLQCVL WGCLLTAVHP EPPTACREKQ YLINSQCCSL CQPGQKLVSD CTEFTETECL

PCGESEFLDT WNRETHCHQH KYCDPNLGLR VQQKGTSETD TICTCEEGWH CTSEACESCV

LHRSCSPGFG VKQIATGVSD TICEPCPVGF FSNVSSAFEK CHPWTSCETK DLVVQQAGTN

KTDVVCGPQD RLRALVVIPI IFGILFAILL VLVFIKKVAK KPTNKAPHPK QEPQEINFPD

DLPGSNTAAP VQETLHGCQP VTQEDGKESR ISVQERQ(SEQ ID NO:213)

CD2The binding of the CD2 molecule to its ligand CD58 co-stimulates the proliferation, cytokine production and effector function of the T cells, particularly the CD28 deficient T cell subset. CD58 is widely expressed on APCs, including dendritic cells. Binding of CD2 to CD28 ^- CD8 ⁺ TCR signaling was amplified in T cells, suggesting that the CD2-CD58 interaction has a true co-stimulatory effect. CD28 may be promoted by CD2 signaling ^- CD8 ⁺ Control of viral infection by T cells, but also promotion of CD28 ^- CD8 ⁺ Continued expansion of T cells under chronic stimulation with persistent Ag. (Judith Leitner Jet et al, immunol,2015, 195 (2) 477-487). The CD2 polypeptide may have an amino acid sequence corresponding to the amino acid sequence provided below with seq id no: NP _001758.2 gi. See GenBank NP _001758.2 for reference to domains within CD2, e.g., signal peptide of amino acids 1-24; an extracellular domain of amino acids 25-209; a transmembrane domain of amino acids 210-235; an intracellular domain of amino acids 236-351. In some embodiments, the CAR can include a transmembrane domain derived from CD 2. In some embodiments, the CAR transmembrane domain comprises the transmembrane region of CD2 (e.g., amino acids 210 to 235 of the following sequence), or a fragment thereof. In some embodiments, the CAR cytoplasmic domain can include a co-stimulatory domain derived from CD 2. In some embodiments, the co-stimulatory domain comprises the intracellular domain of CD2 (e.g., amino acids 236-351 of the following sequence), or a fragment thereof. In some embodiments, the CAR may include two domains derived from CD2, a costimulatory transduction domain and a transmembrane domain. In some embodiments, the CAR has an amino acid sequence that includes a transmembrane domain and an intracellular domain of CD2, and the CAR includes amino acids 210 to 351 of CD 2. It is understood that CD2 sequences shorter or longer than the particular described domain may be used if desired Included in the CAR.

MSFPCKFVAS FLLIFNVSSK GAVSKEITNA LETWGALGQD INLDIPSFQM SDDIDDIKWE

KTSDKKKIAQ FRKEKETFKE KDTYKLFKNG TLKIKHLKTD DQDIYKVSIY DTKGKNVLEK

IFDLKIQERV SKPKISWTCI NTTLTCEVMN GTDPELNLYQ DGKHLKLSQR VITHKWTTSL

SAKFKCTAGN KVSKESSVEP VSCPEKGLDI YLIIGICGGG SLLMVFVALL VFYITKRKKQ

RSRRNDEELE TRAHRVATEE RGRKPHQIPA STPQNPATSQ HPPPPPGHRS QAPSHRPPPP

GHRVQHQPQK RPPAPSGTQV HQQKGPPLPR PRVQPKPPHG AAENSLSPSS N(SEQ ID NO:214)

LIGHTTNF superfamily member 14 (also known as LTg, CD258, HVEML and LIGHT) is a co-stimulatory receptor involved in cellular immune responses. LIGHT can act as a co-stimulatory factor to activate lymphoid cells and as a block for herpes virus infection. LIGHT has been shown to stimulate T cell proliferation, triggering apoptosis in a variety of tumor cells. LIGHT is present in T cells and stromal cells. LIGHT is expressed on immature Dendritic Cells (DCs) produced by human PBMCs. LIGHT is involved in co-stimulating human T cell proliferation, amplifying the NF-. Kappa.B signaling pathway, and preferentially inducing the production of IFN-. Gamma.rather than IL-4 in the presence of an antigenic signal. (Tamada Ket al, J Immunol,2000,164 (8) 4105-4110). The LIGHT polypeptide can have an amino acid sequence corresponding to the sequence provided below (accession number: NP-001363816.1GI. See GenBank NP _001363816.1 for reference to domains within LIGHT, such as the intracellular domain of amino acids 1-37; a transmembrane domain of amino acids 38-58; an extracellular domain of amino acids 59-240. In some embodiments, the CAR cytoplasmic domain can include a co-stimulatory domain derived from LIGHT. In some embodiments, the co-stimulatory domain comprises the intracellular domain of LIGHT (e.g., amino acids 1 to 37 of the following sequence) or a fragment thereof. It is understood that LIGHT sequences shorter or longer than the particular described domain can be included in the CAR if desired.

MEESVVRPSV FVVDGQTDIP FTRLGRSHRR QSCSVARVGL GLLLLLMGAG LAVQGWFLLQ

LHWRLGEMVT RLPDGPAGSW EQLIQERRSH EVNPAAHLTG ANSSLTGSGG PLLWETQLGL

AFLRGLSYHD GALVVTKAGY YYIYSKVQLG GVGCPLGLAS TITHGLYKRT PRYPEELELL

VSQQSPCGRA TSSSRVWWDS SFLGGVVHLE AGEKVVVRVL DERLVRLRDG TRSYFGAFMV

(SEQ ID NO:215)

GITR，TNF receptor superfamily member 18 (also known as TNFRSF18, AITR, GITR; CD357; GITR-D; ENERGEN) is increased in expression upon T cell activation. Stimulation of T cells by GITR can enhance immunity to tumor and viral pathogens and exacerbate autoimmune disease. The effect of stimulation by GITR is generally thought to be due to a reduction in the effector activity of immunosuppressive CD4+ CD25+ regulatory T (TReg) cells. (Shevach, E. And Stephens, G.Nat Rev Immunol6,613-618 (2006)). The LIGHT polypeptide can have an amino acid sequence corresponding to the sequence provided below (accession No.: AAI52382.1, genBank NP-004186.1, GI 158931986), or a fragment thereof. See GenBank NP _004186.1 for reference to a domain within GITR, e.g., a signal peptide of amino acids 1-25; an extracellular domain of amino acids 26-162; a transmembrane domain of amino acids 163-183; an intracellular domain of amino acids 184-241. In some embodiments, the CAR can include a transmembrane domain derived from GITR. In some embodiments, the CAR transmembrane domain comprises a transmembrane region of GITR (e.g., amino acids 163 to 183 of the following sequence), or a fragment thereof. In some embodiments, the CAR cytoplasmic domain can include a costimulatory domain derived from GITR. In some embodiments, the co-stimulatory domain comprises the intracellular domain of GITR (e.g., amino acids 184 to 241 of the following sequence) or a fragment thereof. In some embodiments, the CAR may include two domains derived from GITR, a costimulatory signaling domain and a transmembrane domain. In some embodiments, the CAR has an amino acid sequence that includes a transmembrane domain and an intracellular domain of GITR, and the CAR includes amino acids 163 to 241 of GITR. It is understood that, if desired, GITR sequences shorter or longer than the particular described domain may be included in the CAR.

MAQHGAMGAF RALCGLALLC ALSLGQRPTG GPGCGPGRLL LGTGTDARCC RVHTTRCCRD

YPGEECCSEW DCMCVQPEFH CGDPCCTTCR HHPCPPGQGV QSQGKFSFGF QCIDCASGTF

SGGHEGHCKP WTDCTQFGFL TVFPGNKTHN AVCVPGSPPA EPLGWLTVVL LAVAACVLLL

TSAQLGLHIW QLRSQCMWPR ETQLLLEVPP STEDARSCQF PEEERGERSA EEKGRLGDLW

V(SEQ ID NO:216)

DR3TNF receptor superfamily member 25 (also known as DR3, TR3, DDR3, LARD, APO-3, TRAMP, WSL-1, GEF720, WSL-LR, PLEKHG5, or TNFRSF 12) is preferentially expressed in lymphocyte-rich tissues and plays a role in regulating lymphocyte homeostasis. This receptor stimulates NF-. Kappa.B activation and regulates apoptosis. The signal transduction of this receptor is mediated by various adaptor-containing death domains. This gene has been reported to encode multiple alternatively spliced transcript variants of different subtypes, most of which are potential secreted molecules. The selective splicing of this gene in B and T cells, which mainly produces full-length membrane-bound subtypes and is involved in controlling T cell activation-induced lymphocyte proliferation, encounters programmed changes upon T cell activation. The DR3 polypeptide can have an amino acid sequence corresponding to the sequence provided below (accession number: AAI17190.1, genBank NP-003781.1GI. See GenBank NP _003781.1 for reference to domains within DR3, e.g., signal peptides of amino acids 1-24; an extracellular domain of amino acids 25-199; a transmembrane domain of amino acids 200-220; an intracellular domain of amino acids 221-417. In some embodiments, the CAR may include a transmembrane domain derived from DR 3. In some embodiments, the CAR transmembrane domain comprises the transmembrane region of DR3 (e.g., amino acids 200 to 220 of the following sequence), or a fragment thereof. In some embodiments, the CAR cytoplasmic domain can include a costimulatory domain derived from DR 3. In some embodiments, the co-stimulatory domain comprises the intracellular domain of DR3 (e.g., amino acids 221 through 417 of the following sequence) or a fragment thereof. In some embodiments, the CAR may include two domains derived from DR3, a costimulatory signaling domain and a transmembrane domain. In one embodiment, the CAR is provided There is an amino acid sequence comprising the transmembrane domain and the intracellular domain of DR3, and the CAR comprises amino acids 200 to 417 of DR 3. It is understood that DR3 sequences shorter or longer than the particular described domain may be included in the CAR if desired.

MEQRPRGCAA VAAALLLVLL GARAQGGTRS PRCDCAGDFH KKIGLFCCRG CPAGHYLKAP

CTEPCGNSTC LVCPQDTFLA WENHHNSECA RCQACDEQAS QVALENCSAV ADTRCGCKPG

WFVECQVSQC VSSSPFYCQP CLDCGALHRH TRLLCSRRDT DCGTCLPGFY EHGDGCVSCP

TSTLGSCPER CAAVCGWRQM FWVQVLLAGL VVPLLLGATL TYTYRHCWPH KPLVTADEAG

MEALTPPPAT HLSPLDSAHT LLAPPDSSEK ICTVQLVGNS WTPGYPETQE ALCPQVTWSW

DQLPSRALGP AAAPTLSPES PAGSPAMMLQ PGPQLYDVMD AVPARRWKEF VRTLGLREAE

IEAVEVEIGR FRDQQYEMLK RWRQQQPAGL GAVYAALERM GLDGCVEDLR SRLQRGP

(SEQ ID NO:217)

CD43，CD43 (also known as SPN sialoprotein, LSN, GALGP, GPL 115) is a highly sialylated glycoprotein with antigen-specific T cell activating functions, present on the surface of thymocytes, T lymphocytes, monocytes, granulocytes, and certain B lymphocytes. It comprises a mucin-like extracellular domain, a transmembrane region and a carboxy-terminal intracellular region. In stimulated immune effector cells, the extracellular domain of certain cell types undergoes proteolytic cleavage, releasing soluble extracellular fragments. The CD43 polypeptide can have an amino acid sequence corresponding to the sequence provided below (GenBank NP-003114.1, accession number: EAW80016.1 GI: 119600422), or a fragment thereof. See GenBank NP _003114.1 for reference to domains within CD43, such as signal peptides of amino acids 1-19; an extracellular domain of amino acids 20-253; a transmembrane domain of amino acids 254 to 276; an intracellular domain of amino acids 277-400. In some embodiments, the CAR can include a transmembrane domain derived from CD 43. In some embodiments, the CAR transmembrane domain comprises a transmembrane region of CD43 (e.g., amino acids 254 to 276 of the following sequence), or a fragment thereof. In some embodiments The CAR cytoplasmic domain can include a co-stimulatory domain derived from CD 43. In some embodiments, the co-stimulatory domain comprises the intracellular domain of CD43 (e.g., amino acids 277 to 400 of the following sequence), or a fragment thereof. In some embodiments, the CAR may include two domains derived from CD43, a costimulatory signaling domain and a transmembrane domain. In some embodiments, the CAR has an amino acid sequence that includes a transmembrane domain and an intracellular domain of CD43, and the CAR includes amino acids 254 to 400 of CD 43. It is understood that a CD43 sequence that is shorter or longer than a particular described domain may be included in a CAR, if desired.

MATLLLLLGV LVVSPDALGS TTAVQTPTSG EPLVSTSEPL SSKMYTTSIT SDPKADSTGD

QTSALPPSTS INEGSPLWTS IGASTGSPLP EPTTYQEVSI KMSSVPQETP HATSHPAVPI

TANSLGSHTV TGGTITTNSP ETSSRTSGAP VTTAASSLET SRGTSGPPLT MATVSLETSK

GTSGPPVTMA TDSLETSTGT TGPPVTMTTG SLEPSSGASG PQVSSVKLST MMSPTTSTNA

STVPFRNPDE NSRGMLPVAV LVALLAVIVL VALLLLWRRR QKRRTGALVL SRGGKRNGVV

DAWAGPAQVP EEGAVTVTVG GSGGDKGSGF PDGEGSSRRP TLTTFFGRRK SRQGSLAMEE

LKSGSGPSLK GEEEPLVASE DGAVDAPAPD EPEGGDGAAP(SEQ ID NO:218)

CD4，Cluster of differentiation 4 (CD 4), also known as T cell surface glycoprotein CD4, is a glycoprotein found on the surface of immune cells such as helper T cells, monocytes, macrophages and dendritic cells. In some embodiments, the CAR can include a transmembrane domain derived from CD 4. CD4 exists in a number of isomers. It will be appreciated that any isomer may be selected to achieve the desired function. Exemplary isomers include isomer 1 (NP — 000607.1, gi 10835167), isomer 2 (NP — 001181943.1, gi. The sequence of an exemplary isomer, isomer 1, is provided below. See GenBank NP _000607.1 for reference to domains within CD4, e.g., such as the signal peptide of amino acids 1-25; ammonia at position 26-396 An extracellular domain of an amino acid; a transmembrane domain of amino acids 397-418; an intracellular domain of amino acids 419-458. In some embodiments, the CAR can include a transmembrane domain derived from CD 4. In some embodiments, the CAR transmembrane domain comprises the transmembrane region of CD4 (e.g., amino acids 397 to 418 of the following sequence) or a fragment thereof. It is understood that additional sequences of CD4 beyond the transmembrane domain of amino acids 397 to 418 may be included in the CAR if desired. It is further understood that CD4 sequences shorter or longer than the particular described domain may be included in the CAR, if desired.

1 MNRGVPFRHL LLVLQLALLP AATQGKKVVL GKKGDTVELT CTASQKKSIQ FHWKNSNQIK

61 ILGNQGSFLT KGPSKLNDRA DSRRSLWDQG NFPLIIKNLK IEDSDTYICE VEDQKEEVQL

121 LVFGLTANSD THLLQGQSLT LTLESPPGSS PSVQCRSPRG KNIQGGKTLS VSQLELQDSG

181 TWTCTVLQNQ KKVEFKIDIV VLAFQKASSI VYKKEGEQVE FSFPLAFTVE KLTGSGELWW

241 QAERASSSKS WITFDLKNKE VSVKRVTQDP KLQMGKKLPL HLTLPQALPQ YAGSGNLTLA

301 LEAKTGKLHQ EVNLVVMRAT QLQKNLTCEV WGPTSPKLML SLKLENKEAK VSKREKAVWV

361 LNPEAGMWQC LLSDSGQVLL ESNIKVLPTW STPVQPMALI VLGGVAGLLL FIGLGIFFCV

421 RCRHRRRQAE RMSQIKRLLS EKKTCQCPHR FQKTCSPI(SEQ ID NO:219)

CD8，Cluster of differentiation 8 (CD 8) is a transmembrane glycoprotein that acts as a co-receptor for T Cell Receptors (TCRs). CD8 binds to Major Histocompatibility Complex (MHC) molecules and is specific for MHC class I proteins. In some embodiments, the CAR can include a transmembrane domain derived from CD 8. The CD8 polypeptide may have an amino acid sequence corresponding to the sequence provided below with GenBank No. NP-001139345.1 (GI: 225007536) or a fragment thereof. See GenBank NP _001139345.1 for reference to domains within CD8, e.g., signal peptides such as amino acids 1-21; an extracellular domain of amino acids 22-182; a transmembrane domain of amino acids 183-203; an intracellular domain of amino acids 204-235. In some embodiments, the CAR can Including hinge domains derived from CD 8. In some embodiments, the hinge domain can include amino acids 137-182 of the CD8 polypeptide provided below. In some embodiments, the CAR can include a transmembrane domain derived from CD 8. In some embodiments, the CAR transmembrane domain comprises the transmembrane region of CD8 (e.g., amino acids 183 to 203 of the following sequence), or a fragment thereof. In another embodiment, the CAR can include amino acids 137-203 of the CD8 polypeptide provided below. In yet another embodiment, the CAR can include amino acids 137-209 of the CD8 polypeptide provided below. It is understood that additional CD8 sequences, in addition to the hinge domain of amino acids 137 to 182 and the transmembrane domain of amino acids 183 to 203, may be included in the CAR if desired. It is further understood that a CD8 sequence that is shorter or longer than a particular described domain may be included in a CAR, if desired.

1 MALPVTALLL PLALLLHAAR PSQFRVSPLD RTWNLGETVE LKCQVLLSNP TSGCSWLFQP

61 RGAAASPTFL LYLSQNKPKA AEGLDTQRFS GKRLGDTFVL TLSDFRRENE GYYFCSALSN

121 SIMYFSHFVP VFLPAKPTTT PAPRPPTPAP TIASQPLSLR PEACRPAAGG AVHTRGLDFA

181 CDIYIWAPLA GTCGVLLLSL VITLYCNHRN RRRVCKCPRP VVKSGDKPSL SARYV(SEQ ID NO:220)

Thus, for exemplary purposes, a disclosed CAR can include, from N-terminus to C-terminus, an anti-mesothelin antibody or antigen-binding fragment (e.g., a scFv disclosed herein), a hinge (e.g., a CD8 hinge or a CD28 hinge), a transmembrane region (e.g., a CD8 transmembrane region or a CD28 transmembrane region), a costimulatory domain (e.g., the intracellular region of 4-1BB, CD28, or both), and a signaling domain (e.g., the T cell signaling domain of CD3 ζ).

5.4 Polynucleotide and vectors

The invention also provides polynucleotides encoding a polypeptide of the invention (e.g., an anti-mesothelin antibody or antigen-binding fragment, or a CAR that specifically binds mesothelin). The term "polynucleotide encoding a polypeptide" comprises: a polynucleotide comprising only the coding sequence for the polypeptide; and polynucleotides comprising additional coding and/or non-coding sequences. The polynucleotide of the present invention may be in the form of RNA or in the form of DNA. The DNA may be cDNA, genomic DNA, or synthetic DNA, and may be double-stranded or single-stranded. The single-stranded DNA may be a coding strand or a non-coding (antisense) strand. The polynucleotides disclosed herein may be mRNA.

The present invention does contemplate polynucleotides encoding any of the anti-mesothelin antibodies or antigen-binding fragments disclosed herein. For illustrative purposes, in some embodiments, the polynucleotides provided herein encode an anti-mesothelin antibody or antigen-binding fragment that includes (a) a VL that includes (1) a VL CDR1 having an amino acid sequence selected from the group consisting of the sequences set forth in SEQ ID NOs 1-15; (2) VL CDR2 having an amino acid sequence selected from the group consisting of the sequences shown in SEQ ID NOS 16-29; and (3) a VL CDR3 having an amino acid sequence selected from the group consisting of the sequences set forth in SEQ ID NOS: 30-44; or a variant thereof having up to about 5 amino acid substitutions, additions and/or deletions in the VL CDR; and/or, (b) a VH comprising (1) a VH CDR1 having an amino acid sequence selected from the group consisting of the sequences set forth in SEQ ID NOS: 45-57; (2) A VH CDR2 having an amino acid sequence selected from the group consisting of the sequences set forth in SEQ ID NOs 58-70; and (3) a VH CDR3 having an amino acid sequence selected from the group consisting of the sequences set forth in SEQ ID NOS: 71-85; or a variant thereof having up to about 5 amino acid substitutions, additions and/or deletions in the VH CDRs. In some embodiments, the polynucleotides provided herein encode an anti-mesothelin antibody or antigen-binding fragment comprising (a) a VL having at least 85%, at least 90%, at least 95%, at least 98%, or 100% sequence identity to an amino acid sequence selected from the group consisting of SEQ ID NOs 86-100; and/or, (b) a VH having at least 85%, at least 90%, at least 95%, at least 98%, or 100% sequence identity to an amino acid sequence selected from the group consisting of SEQ ID NOs 101-115. The polynucleotide may be in the form of DNA. The polynucleotide may be in the form of an mRNA.

In some embodiments, the polynucleotides provided herein encode an anti-mesothelin antibody or antigen-binding fragment disclosed herein, which antibody or antigen-binding fragment comprises a VL and a VH, wherein the VL comprises a VL CDR1, a CDR2 and a CDR3, and the VH comprises a VH CDR1, a CDR2 and a CDR3, and wherein the VL CDR1, VL CDR2, VL CDR3, VH CDR1, VH CDR2 and VH CDR3 have the amino acid sequences shown in (1) SEQ ID NOs 1, 16, 30, 45, 58 and 71, respectively; (2) 2, 17, 31, 46, 59 and 72; (3) 3, 18, 32, 47, 60 and 73; (4) 4, 19, 33, 48, 61 and 74; (5) Amino acid sequences shown as SEQ ID NOS 5, 20, 34, 49, 62 and 75; (6) Amino acid sequences shown as SEQ ID NOS 6, 21, 35, 50, 63 and 76; (7) Amino acid sequences shown as SEQ ID NOS 7, 22, 36, 51, 64 and 77; (8) The amino acid sequences shown as SEQ ID NOS: 8, 23, 37, 52, 65 and 78; (9) 9, 24, 38, 53, 66 and 79; (10) 10, 25, 39, 48, 61 and 80; (11) 11, 26, 40, 54, 67 and 81; (12) 12, 27, 41, 53, 66 and 82; (13) 13, 28, 42, 55, 68 and 83 of SEQ ID NO; (14) 14, 29, 43, 56, 69 and 84; or (15) the amino acid sequences shown in SEQ ID NOS: 15, 18, 44, 57, 70 and 85; or a variant thereof having up to about 5 amino acid substitutions, additions and/or deletions in the CDRs. The polynucleotide may be in the form of DNA. The polynucleotide may be in the form of an mRNA.

In some embodiments, the polynucleotides provided herein encode an anti-mesothelin antibody or antigen-binding fragment disclosed herein, comprising a VL and a VH, wherein the VL and VH have (1) the amino acid sequences set forth in SEQ ID NOs 86 and 101, respectively; (2) amino acid sequences shown as SEQ ID NOS: 87 and 102; (3) the amino acid sequences shown as SEQ ID NOS: 88 and 103; (4) the amino acid sequences shown as SEQ ID NOS: 89 and 104; (5) the amino acid sequences shown as SEQ ID NOS: 90 and 105; (6) the amino acid sequences shown in SEQ ID NOS: 91 and 106; (7) the amino acid sequences shown as SEQ ID NOS: 92 and 107; (8) amino acid sequences shown as SEQ ID NOS: 93 and 108; (9) amino acid sequences shown as SEQ ID NOS: 94 and 109; (10) the amino acid sequences shown as SEQ ID NOS: 95 and 110; (11) the amino acid sequences shown in SEQ ID NOS: 96 and 111; (12) the amino acid sequences shown as SEQ ID NOS: 97 and 112; (13) the amino acid sequences shown in SEQ ID NOS: 98 and 113; (14) the amino acid sequences shown as SEQ ID NOS 99 and 114; or (15) the amino acid sequences shown in SEQ ID NOS: 100 and 115. The polynucleotide may be in the form of DNA. The polynucleotide may be in the form of an mRNA.

In some embodiments, the VL and VH are connected by a linker. The linker may be a flexible linker or a rigid linker. In some embodiments, the linker has an amino acid sequence of (GGGGS) n, n =1, 2, 3, 4, or 5 (SEQ ID NO: 191). In some embodiments, the linker has an amino acid sequence of (EAAAK) n, n =1, 2, 3, 4, or 5 (SEQ ID NO: 192). In some embodiments, the linker has an amino acid sequence of (PA) nP, n =1, 2, 3, 4 or 5 (SEQ ID NO: 193). In some embodiments, the linker has the amino acid sequence GGGGSGGGGSGGGS (SEQ ID NO: 194).

In some embodiments, the polynucleotides provided herein encode an anti-mesothelin antibody or antigen-binding fragment disclosed herein, which includes a VL having at least 85%, at least 90%, at least 95%, at least 98%, or 100% sequence identity to an amino acid sequence selected from the group consisting of SEQ ID NOs 86-100. In some embodiments, the polynucleotide encodes an anti-mesothelin antibody or antigen-binding fragment that includes a VL having the amino acid sequence set forth in SEQ ID No. 86. In some embodiments, the polynucleotide encodes an anti-mesothelin antibody or antigen-binding fragment that includes a VL having an amino acid sequence set forth in SEQ ID No. 87. In some embodiments, the polynucleotide encodes an anti-mesothelin antibody or antigen-binding fragment that includes a VL having an amino acid sequence set forth in SEQ ID NO. 88. In some embodiments, the polynucleotide encodes an anti-mesothelin antibody or antigen-binding fragment comprising a VL having the amino acid sequence set forth in SEQ ID NO. 89. In some embodiments, the polynucleotide encodes an anti-mesothelin antibody or antigen-binding fragment comprising a VL having the amino acid sequence set forth in SEQ ID NO. 90. In some embodiments, the polynucleotide encodes an anti-mesothelin antibody or antigen-binding fragment comprising a VL having the amino acid sequence set forth in SEQ ID NO. 91. In some embodiments, the polynucleotide encodes an anti-mesothelin antibody or antigen-binding fragment comprising a VL having the amino acid sequence set forth in SEQ ID NO. 92. In some embodiments, the polynucleotide encodes an anti-mesothelin antibody or antigen-binding fragment that includes a VL having an amino acid sequence set forth in SEQ ID No. 93. In some embodiments, the polynucleotide encodes an anti-mesothelin antibody or antigen-binding fragment that includes a VL having an amino acid sequence set forth in SEQ ID No. 94. In some embodiments, the polynucleotide encodes an anti-mesothelin antibody or antigen-binding fragment comprising a VL having the amino acid sequence set forth in SEQ ID NO. 95. In some embodiments, the polynucleotide encodes an anti-mesothelin antibody or antigen-binding fragment comprising a VL having the amino acid sequence set forth in SEQ ID NO. 96. In some embodiments, the polynucleotide encodes an anti-mesothelin antibody or antigen-binding fragment comprising a VL having the amino acid sequence set forth in SEQ ID NO: 97. In some embodiments, the polynucleotide encodes an anti-mesothelin antibody or antigen-binding fragment comprising a VL having the amino acid sequence set forth in SEQ ID NO. 98. In some embodiments, the polynucleotide encodes an anti-mesothelin antibody or antigen-binding fragment that includes a VL having an amino acid sequence set forth in SEQ ID NO. 99. In some embodiments, the polynucleotide encodes an anti-mesothelin antibody or antigen-binding fragment comprising a VL having the amino acid sequence set forth in SEQ ID NO. 100.

In some embodiments, the polynucleotides provided herein have a nucleotide sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a nucleotide sequence selected from the group consisting of SEQ ID NOs 116-130. In some embodiments, the polynucleotides provided herein have a nucleotide sequence that is at least 85%, at least 90%, at least 95%, at least 99%, or 100% identical to the sequence set forth in SEQ ID NO. 116. In some embodiments, the polynucleotides provided herein have a nucleotide sequence that is at least 85%, at least 90%, at least 95%, at least 99%, or 100% identical to the sequence set forth in SEQ ID NO. 117. In some embodiments, the polynucleotides provided herein have a nucleotide sequence that is at least 85%, at least 90%, at least 95%, at least 99%, or 100% identical to the sequence set forth in SEQ ID NO. 118. In some embodiments, the polynucleotides provided herein have a nucleotide sequence that is at least 85%, at least 90%, at least 95%, at least 99%, or 100% identical to the sequence set forth in SEQ ID NO. 119. In some embodiments, the polynucleotides provided herein have a nucleotide sequence that is at least 85%, at least 90%, at least 95%, at least 99%, or 100% identical to a sequence set forth in SEQ ID No. 120. In some embodiments, the polynucleotides provided herein have a nucleotide sequence that is at least 85%, at least 90%, at least 95%, at least 99%, or 100% identical to the sequence set forth in SEQ ID NO. 121. In some embodiments, the polynucleotides provided herein have a nucleotide sequence that is at least 85%, at least 90%, at least 95%, at least 99%, or 100% identical to the sequence set forth in SEQ ID No. 122. In some embodiments, the polynucleotides provided herein have a nucleotide sequence that is at least 85%, at least 90%, at least 95%, at least 99%, or 100% identical to the sequence set forth in SEQ ID NO 123. In some embodiments, the polynucleotides provided herein have a nucleotide sequence that is at least 85%, at least 90%, at least 95%, at least 99%, or 100% identical to the sequence set forth in SEQ ID NO. 124. In some embodiments, the polynucleotides provided herein have a nucleotide sequence that is at least 85%, at least 90%, at least 95%, at least 99%, or 100% identical to the sequence set forth in SEQ ID No. 125. In some embodiments, the polynucleotides provided herein have a nucleotide sequence that is at least 85%, at least 90%, at least 95%, at least 99%, or 100% identical to the sequence set forth in SEQ ID NO. 126. In some embodiments, the polynucleotides provided herein have a nucleotide sequence that is at least 85%, at least 90%, at least 95%, at least 99%, or 100% identical to the sequence set forth in SEQ ID NO. 127. In some embodiments, the polynucleotides provided herein have a nucleotide sequence that is at least 85%, at least 90%, at least 95%, at least 99%, or 100% identical to the sequence set forth in SEQ ID NO. 128. In some embodiments, the polynucleotides provided herein have a nucleotide sequence that is at least 85%, at least 90%, at least 95%, at least 99%, or 100% identical to the sequence set forth in SEQ ID NO. 129. In some embodiments, the polynucleotides provided herein have a nucleotide sequence that is at least 85%, at least 90%, at least 95%, at least 99%, or 100% identical to the sequence set forth in SEQ ID NO. 130. The present invention also provides a polynucleotide that hybridizes to a polynucleotide having a nucleotide sequence selected from the group consisting of the sequences set forth as SEQ ID NOS 116-130. In some embodiments, hybridization is performed under high stringency conditions known to those skilled in the art. The polynucleotide may be in the form of DNA. The polynucleotide may be in the form of an mRNA.

In some embodiments, the polynucleotides provided herein encode an anti-mesothelin antibody or antigen-binding fragment disclosed herein, which antibody or antigen-binding fragment comprises a VH having at least 85%, at least 90%, at least 95%, at least 98%, or 100% sequence identity to an amino acid sequence selected from the group consisting of SEQ ID NOs 101-115. In some embodiments, the polynucleotide encodes an anti-mesothelin antibody or antigen-binding fragment comprising a VH having the amino acid sequence set forth in SEQ ID NO. 101. In some embodiments, the polynucleotide encodes an anti-mesothelin antibody or antigen-binding fragment comprising a VH having the amino acid sequence set forth in SEQ ID NO. 102. In some embodiments, the polynucleotide encodes an anti-mesothelin antibody or antigen-binding fragment comprising a VH having the amino acid sequence set forth in SEQ ID NO. 103. In some embodiments, the polynucleotide encodes an anti-mesothelin antibody or antigen-binding fragment comprising a VH having the amino acid sequence set forth in SEQ ID NO. 104. In some embodiments, the polynucleotide encodes an anti-mesothelin antibody or antigen-binding fragment comprising a VH having the amino acid sequence set forth in SEQ ID NO 105. In some embodiments, the polynucleotide encodes an anti-mesothelin antibody or antigen-binding fragment that includes a VH having the amino acid sequence set forth in SEQ ID No. 106. In some embodiments, the polynucleotide encodes an anti-mesothelin antibody or antigen-binding fragment comprising a VH having the amino acid sequence set forth in SEQ ID NO: 107. In some embodiments, the polynucleotide encodes an anti-mesothelin antibody or antigen-binding fragment comprising a VH having the amino acid sequence set forth in SEQ ID NO: 108. In some embodiments, the polynucleotide encodes an anti-mesothelin antibody or antigen-binding fragment comprising a VH having the amino acid sequence set forth in SEQ ID NO: 109. In some embodiments, the polynucleotide encodes an anti-mesothelin antibody or antigen-binding fragment comprising a VH having the amino acid sequence shown in SEQ ID NO. 110. In some embodiments, the polynucleotide encodes an anti-mesothelin antibody or antigen-binding fragment comprising a VH having the amino acid sequence set forth in SEQ ID NO: 111. In some embodiments, the polynucleotide encodes an anti-mesothelin antibody or antigen-binding fragment comprising a VH having the amino acid sequence set forth in SEQ ID NO: 112. In some embodiments, the polynucleotide encodes an anti-mesothelin antibody or antigen-binding fragment comprising a VH having the amino acid sequence set forth in SEQ ID NO 113. In some embodiments, the polynucleotide encodes an anti-mesothelin antibody or antigen-binding fragment comprising a VH having the amino acid sequence set forth in SEQ ID NO: 114. In some embodiments, the polynucleotide encodes an anti-mesothelin antibody or antigen-binding fragment comprising a VH having the amino acid sequence set forth in SEQ ID NO. 115.

In some embodiments, the polynucleotides provided herein have a nucleotide sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a sequence selected from the group consisting of SEQ ID NOs 131-145. In some embodiments, the polynucleotides provided herein have a nucleotide sequence that is at least 85%, at least 90%, at least 95%, at least 99%, or 100% identical to a sequence set forth in SEQ ID No. 131. In some embodiments, the polynucleotides provided herein have a nucleotide sequence that is at least 85%, at least 90%, at least 95%, at least 99%, or 100% identical to the sequence set forth in SEQ ID NO. 132. In some embodiments, the polynucleotides provided herein have a nucleotide sequence that is at least 85%, at least 90%, at least 95%, at least 99%, or 100% identical to the sequence set forth in SEQ ID No. 133. In some embodiments, the polynucleotides provided herein have a nucleotide sequence that is at least 85%, at least 90%, at least 95%, at least 99%, or 100% identical to a sequence set forth in SEQ ID No. 134. In some embodiments, the polynucleotides provided herein have a nucleotide sequence that is at least 85%, at least 90%, at least 95%, at least 99%, or 100% identical to the sequence set forth in SEQ ID NO. 135. In some embodiments, the polynucleotides provided herein have a nucleotide sequence that is at least 85%, at least 90%, at least 95%, at least 99%, or 100% identical to the sequence set forth in SEQ ID NO. 136. In some embodiments, the polynucleotides provided herein have a nucleotide sequence that is at least 85%, at least 90%, at least 95%, at least 99%, or 100% identical to the sequence set forth in SEQ ID NO. 137. In some embodiments, the polynucleotides provided herein have a nucleotide sequence that is at least 85%, at least 90%, at least 95%, at least 99%, or 100% identical to the sequence set forth in SEQ ID No. 138. In some embodiments, the polynucleotides provided herein have a nucleotide sequence that is at least 85%, at least 90%, at least 95%, at least 99%, or 100% identical to the sequence set forth in SEQ ID No. 139. In some embodiments, the polynucleotides provided herein have a nucleotide sequence that is at least 85%, at least 90%, at least 95%, at least 99%, or 100% identical to the sequence set forth in SEQ ID NO. 140. In some embodiments, the polynucleotides provided herein have a nucleotide sequence that is at least 85%, at least 90%, at least 95%, at least 99%, or 100% identical to the sequence set forth in SEQ ID NO. 141. In some embodiments, the polynucleotides provided herein have a nucleotide sequence that is at least 85%, at least 90%, at least 95%, at least 99%, or 100% identical to the sequence set forth in SEQ ID NO: 142. In some embodiments, the polynucleotides provided herein have a nucleotide sequence that is at least 85%, at least 90%, at least 95%, at least 99%, or 100% identical to the sequence set forth in SEQ ID NO. 143. In some embodiments, the polynucleotides provided herein have a nucleotide sequence that is at least 85%, at least 90%, at least 95%, at least 99%, or 100% identical to the sequence set forth in SEQ ID NO. 144. In some embodiments, the polynucleotides provided herein have a nucleotide sequence that is at least 85%, at least 90%, at least 95%, at least 99%, or 100% identical to the sequence set forth in SEQ ID NO. 145. The present invention also provides a polynucleotide that hybridizes with a polynucleotide having a nucleotide sequence selected from the group consisting of the sequences set forth in SEQ ID NOS 131-145. In some embodiments, hybridization is performed under high stringency conditions known to those skilled in the art. The polynucleotide may be in the form of DNA. The polynucleotide may be in the form of an mRNA.

The invention also provides variants of the polynucleotides of the invention, wherein the variants encode, for example, fragments, analogs and/or derivatives of the anti-mesothelin antibodies or antigen-binding fragments of the invention. In some embodiments, the invention provides a polynucleotide having a nucleotide sequence that is at least about 80% identical, at least about 85% identical, at least about 90% identical, at least about 95% identical, at least about 96% identical, at least about 97% identical, at least about 98% identical, or at least about 99% identical to a polynucleotide sequence encoding an anti-mesothelin antibody or antigen-binding fragment described herein. In some embodiments, the invention provides a polynucleotide having a nucleotide sequence that is at least about 80% identical, at least about 85% identical, at least about 90% identical, at least about 95% identical, at least about 96% identical, at least about 97% identical, at least about 98% identical, or at least about 99% identical to a polynucleotide sequence encoding an anti-mesothelin antibody or antigen-binding fragment described herein.

In some embodiments, the polynucleotides provided herein encode an anti-mesothelin antibody or antigen-binding fragment that is an scFv labeled as M6, M7, M8, M10, M12, M13, M15, M20, M22, M24, M27, M28, M31, M32, or M37. In some embodiments, the polynucleotides provided herein encode an anti-mesothelin antibody or antigen-binding fragment having an amino acid sequence selected from the group consisting of SEQ ID NOs 146-160.

The invention also provides polynucleotides encoding the disclosed TCRs. In some embodiments, the invention provides polynucleotides encoding TCR α chains comprising an anti-mesothelin antibody or antigen-binding fragment of the invention. In some embodiments, the invention provides polynucleotides encoding TCR β chains comprising an anti-mesothelin antibody or antigen-binding fragment of the invention. In some embodiments, the invention provides a polynucleotide encoding a TCR γ chain comprising an anti-mesothelin antibody or antigen-binding fragment of the invention. In some embodiments, the invention provides polynucleotides encoding TCR delta chains comprising the anti-mesothelin antibodies or antigen binding fragments of the invention. The polynucleotide may be in the form of DNA. The polynucleotide may be in the form of an mRNA.

The invention also provides polynucleotides encoding the disclosed CARs. In some embodiments, the invention provides a polynucleotide encoding a CAR that specifically binds mesothelin, the CAR comprising, from N-terminus to C-terminus: a (a) a mesothelin binding domain comprising an anti-mesothelin antibody or antigen-binding fragment provided by the present invention, (b) a transmembrane domain, and (c) a cytoplasmic domain. The transmembrane and cytoplasmic domain may be any of the transmembrane and cytoplasmic domains disclosed herein. For illustrative purposes, provided herein, for example, are polynucleotides encoding a CAR that specifically binds mesothelin, the CAR comprising, from N-terminus to C-terminus: a mesothelin binding domain comprising an anti-mesothelin scFv provided herein, (b) a transmembrane domain comprising the CD28 transmembrane region, and (c) a cytoplasmic domain comprising a CD3 zeta signaling domain and a 4-1BB co-stimulatory domain. The polynucleotide may be in the form of DNA. The polynucleotide may be in the form of an mRNA.

In some embodiments, the polynucleotides provided herein encode an anti-mesothelin CAR that has at least 85%, at least 90%, at least 95%, at least 98%, or 100% sequence identity to an amino acid sequence selected from the group consisting of SEQ ID NOs 161-175. In some embodiments, the polynucleotides provided herein encode an anti-mesothelin CAR having the amino acid sequence set forth in SEQ ID No. 161. In some embodiments, the polynucleotides provided herein encode an anti-mesothelin CAR having the amino acid sequence set forth in SEQ ID NO: 162. In some embodiments, the polynucleotides provided herein encode an anti-mesothelin CAR having the amino acid sequence set forth in SEQ ID No. 163. In some embodiments, the polynucleotides provided herein encode an anti-mesothelin CAR having the amino acid sequence set forth in SEQ ID NO: 164. In some embodiments, the polynucleotides provided herein encode an anti-mesothelin CAR having an amino acid sequence set forth in SEQ ID No. 165. In some embodiments, the polynucleotides provided herein encode an anti-mesothelin CAR having the amino acid sequence set forth in SEQ ID NO: 166. In some embodiments, the polynucleotides provided herein encode an anti-mesothelin CAR having an amino acid sequence set forth in SEQ ID NO: 167. In some embodiments, the polynucleotides provided herein encode an anti-mesothelin CAR having the amino acid sequence set forth in SEQ ID NO: 168. In some embodiments, the polynucleotides provided herein encode an anti-mesothelin CAR having the amino acid sequence set forth in SEQ ID No. 169. In some embodiments, the polynucleotides provided herein encode an anti-mesothelin CAR having the amino acid sequence set forth in SEQ ID NO: 170. In some embodiments, the polynucleotides provided herein encode an anti-mesothelin CAR having the amino acid sequence set forth in SEQ ID No. 171. In some embodiments, the polynucleotides provided herein encode an anti-mesothelin CAR having the amino acid sequence set forth in SEQ ID NO: 172. In some embodiments, the polynucleotides provided herein encode an anti-mesothelin CAR having an amino acid sequence set forth in SEQ ID No. 173. In some embodiments, the polynucleotides provided herein encode an anti-mesothelin CAR having an amino acid sequence set forth in SEQ ID NO: 174. In some embodiments, the polynucleotides provided herein encode an anti-mesothelin CAR having the amino acid sequence set forth in SEQ ID NO: 175.

In some embodiments, the polynucleotides provided herein have a nucleotide sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% at least 99%, or 100% identical to a sequence selected from the group consisting of SEQ ID NOS 176-190. In some embodiments, the polynucleotides provided herein have an amino acid sequence that is at least 85%, at least 90%, at least 95%, at least 99%, or 100% identical to the sequence set forth in SEQ ID NO. 176. In some embodiments, the polynucleotides provided herein have an amino acid sequence that is at least 85%, at least 90%, at least 95%, at least 99%, or 100% identical to the sequence set forth in SEQ ID NO. 177. In some embodiments, the polynucleotides provided herein have an amino acid sequence that is at least 85%, at least 90%, at least 95%, at least 99%, or 100% identical to the sequence set forth in SEQ ID NO. 178. In some embodiments, the polynucleotides provided herein have an amino acid sequence that is at least 85%, at least 90%, at least 95%, at least 99%, or 100% identical to the sequence set forth in SEQ ID NO 179. In some embodiments, the polynucleotides provided herein have an amino acid sequence that is at least 85%, at least 90%, at least 95%, at least 99%, or 100% identical to the sequence set forth in SEQ ID NO. 180. In some embodiments, the polynucleotides provided herein have an amino acid sequence that is at least 85%, at least 90%, at least 95%, at least 99%, or 100% identical to the sequence set forth in SEQ ID NO. 181. In some embodiments, the polynucleotides provided herein have an amino acid sequence that is at least 85%, at least 90%, at least 95%, at least 99%, or 100% identical to the sequence set forth in SEQ ID No. 182. In some embodiments, the polynucleotides provided herein have an amino acid sequence that is at least 85%, at least 90%, at least 95%, at least 99%, or 100% identical to the sequence set forth in SEQ ID NO 183. In some embodiments, the polynucleotides provided herein have an amino acid sequence that is at least 85%, at least 90%, at least 95%, at least 99%, or 100% identical to the sequence set forth in SEQ ID No. 184. In some embodiments, the polynucleotides provided herein have an amino acid sequence that is at least 85%, at least 90%, at least 95%, at least 99%, or 100% identical to the sequence set forth in SEQ ID NO. 185. In some embodiments, the polynucleotides provided herein have an amino acid sequence that is at least 85%, at least 90%, at least 95%, at least 99%, or 100% identical to the sequence set forth in SEQ ID NO: 186. In some embodiments, the polynucleotides provided herein have an amino acid sequence that is at least 85%, at least 90%, at least 95%, at least 99%, or 100% identical to the sequence set forth in SEQ ID NO. 187. In some embodiments, the polynucleotides provided herein have an amino acid sequence that is at least 85%, at least 90%, at least 95%, at least 99%, or 100% identical to the sequence set forth in SEQ ID NO. 188. In some embodiments, the polynucleotides provided herein have an amino acid sequence that is at least 85%, at least 90%, at least 95%, at least 99%, or 100% identical to the sequence set forth in SEQ ID NO. 189. In some embodiments, the polynucleotides provided herein have an amino acid sequence that is at least 85%, at least 90%, at least 95%, at least 99%, or 100% identical to a sequence set forth in SEQ ID No. 190.

As used herein, the phrase "a polynucleotide having a nucleotide sequence at least about 95% identical to a polynucleotide sequence" refers to a polynucleotide having a nucleotide sequence identical to a reference sequence except that the reference sequence may include up to 5 point mutations per 100 nucleotides. In other words, to obtain a polynucleotide whose sequence has at least 95% identity to a reference nucleotide sequence, up to 5% of the nucleotides in the reference sequence may be deleted or replaced with other nucleotides, or up to 5% of the total number of nucleotides in the reference sequence may be inserted into the reference sequence. These mutations of the reference sequence can occur at the 5 'or 3' terminal sites of the reference nucleotide sequence or anywhere between these terminal sites, interspersed individually between nucleotides in the reference sequence or in one or more contiguous groups in the reference sequence.

The polynucleotide variants may comprise alterations at the coding regions, the non-coding regions, or both. In some embodiments, a polynucleotide variant comprises an alteration that produces a silent substitution, addition, or deletion, but does not alter the property or activity of the encoded polypeptide. In some embodiments, a polynucleotide variant comprises silent substitutions (due to the degeneracy of the genetic code) that result in no alteration of the amino acid sequence of the polypeptide. Polynucleotide variants are produced for a variety of reasons, e.g., to optimize codon expression for a particular host (e.g., to change codons in human mRNA to codons preferred by bacteria, such as e. In some embodiments, a polynucleotide variant comprises at least one silent mutation in a non-coding region or a coding region of a sequence.

In some embodiments, polynucleotide variants are prepared to modulate or alter the expression (or expression level) of the encoded polypeptide. In some embodiments, polynucleotide variants are prepared to increase expression of the encoded polypeptide. In some embodiments, polynucleotide variants are prepared to reduce expression of the encoded polypeptide. In some embodiments, the polynucleotide variant increases expression of the encoded polypeptide compared to the parent polynucleotide sequence. In some embodiments, the polynucleotide variant reduces the expression of the encoded polypeptide compared to a parent polynucleotide sequence.

In some embodiments, the polynucleotide comprises a coding sequence for a polypeptide (e.g., a CAR or an antibody) fused in the same reading frame to a polynucleotide that facilitates expression and secretion of the polypeptide from the host cell (e.g., a leader sequence that is a secretory sequence that controls the transport of the polypeptide). The polypeptide may have a leader sequence which is cleaved by the host cell to form a "mature" polypeptide form.

In some embodiments, a polynucleotide includes a coding sequence for a polypeptide (e.g., a CAR or an antibody) fused in the same reading frame to a tag or label sequence. For example, in some embodiments, the tag sequence is a hexa-histidine tag (HIS-tag), which allows for efficient purification of polypeptides fused to the tag. In some embodiments, when a mammalian host (e.g., COS-7 cells) is used, the marker sequence is a Hemagglutinin (HA) tag derived from an influenza hemagglutinin protein. In some embodiments, the tag sequence is a FLAGTM tag. In some embodiments, the label may be used in combination with other labels or tags.

In some embodiments, the polynucleotide is isolated. In some embodiments, the polynucleotide is substantially purified.

The invention also provides vectors and cells comprising the polynucleotides of the invention. In some embodiments, vectors comprising a polynucleotide provided herein are provided. The vector may be an expression vector. In some embodiments, the invention provides vectors comprising polynucleotides encoding the anti-mesothelin antibodies or antigen-binding fragments of the invention. In some embodiments, the vectors provided herein comprise a polynucleotide encoding a polypeptide that is part of an anti-mesothelin antibody or antigen-binding fragment of the present invention. In some embodiments, the invention provides a vector comprising a polynucleotide encoding a CAR or TCR as described herein. In some embodiments, the invention provides a vector comprising a polynucleotide encoding a polypeptide that is part of a CAR or TCR of the invention.

In some embodiments, the invention provides a recombinant expression vector that can be used to amplify and express a polynucleotide encoding a CAR/TCR of the invention that specifically binds mesothelin or the anti-mesothelin antibody or antigen binding fragment. For example, the recombinant expression vector can be a replicable DNA construct comprising a DNA fragment, synthetic or derived from a cDNA, encoding a polypeptide chain of a CAR/TCR or an anti-mesothelin antibody, operably linked to suitable transcriptional and/or translational regulatory elements derived from a mammalian, microbial, viral, or insect gene. In some embodiments, a viral vector is used. When DNA regions are functionally related, they are "operably linked". For example, a promoter is operably linked to a coding sequence if it controls the transcription of the sequence; or operably linked to a coding sequence if the ribosome binding site is positioned so as to permit translation. In some embodiments, structural elements intended for use in certain expression systems include a leader sequence that may enable a host cell to secrete a translated protein extracellularly. In some embodiments, the polypeptide may include an N-terminal methionine residue in the absence of a leader or transport sequence for expression of the recombinant protein.

Various combinations of expression hosts/vectors may be used. Expression vectors useful for eukaryotic hosts include, for example, vectors containing expression control sequences from SV40, bovine papilloma virus, adenovirus and cytomegalovirus. Expression vectors useful for bacterial hosts include known bacterial plasmids, such as those from E.coli, including pCR1, pBR322, pMB9, and derivatives thereof, as well as a broader host range of plasmids, such as M13 and other filamentous single stranded DNA phages.

In some embodiments, the CAR/TCR of the invention or the anti-mesothelin antibody or antigen-binding fragment is expressed from one or more vectors. Suitable host cells for expression include prokaryotes, yeast cells, insect cells or higher eukaryotic cells under the control of an appropriate promoter. Suitable cloning and expression vectors for bacterial, fungal, yeast and mammalian cell hosts, as well as methods of protein production, including antibody production, are well known in the art.

Examples of suitable mammalian host cell lines include, but are not limited to, COS-7 (derived from monkey kidney), L-929 (derived from murine fibroblasts), C127 (derived from murine breast tumor), 3T3 (derived from murine fibroblasts), CHO (derived from Chinese hamster ovary), heLa (derived from human cervical cancer), BHK (derived from hamster kidney fibroblasts), HEK-293 (derived from human embryonic kidney) cell lines, and variants thereof. Mammalian expression vectors can include non-transcribed elements (e.g., origins of replication), suitable promoters and enhancers for linkage to the gene to be expressed, and other 5 'or 3' flanking non-transcribed and 5 'or 3' untranslated sequences (e.g., necessary ribosome binding sites, polyadenylation sites, splice donor and acceptor sites, and transcriptional termination sequences). Expression of recombinant proteins in insect cell culture systems (e.g., baculovirus) also provides a powerful method for producing correctly folded and biologically functional proteins. Baculovirus systems for the production of heterologous proteins in insect cells are well known to those skilled in the art.

The invention also provides a host cell comprising a polypeptide of the invention, a polynucleotide encoding a polypeptide of the invention, or a vector comprising such a polynucleotide. In some embodiments, the invention also provides a host cell comprising a vector comprising a polynucleotide disclosed herein. In some embodiments, the invention provides a host cell comprising a vector comprising a polynucleotide encoding an anti-mesothelin antibody or antigen-binding fragment of the invention. In some embodiments, the invention provides a host cell comprising a vector comprising a polynucleotide encoding a polypeptide that is part of an anti-mesothelin antibody or antigen-binding fragment of the invention. In some embodiments, the invention provides host cells comprising a polynucleotide encoding an anti-mesothelin antibody or antigen-binding fragment of the invention. In some embodiments, the cell produces an anti-mesothelin antibody or antigen-binding fragment of the invention. In some embodiments, the invention provides a host cell comprising a vector comprising a polynucleotide encoding a CAR or TCR of the invention. In some embodiments, the invention provides a host cell comprising a vector comprising a polynucleotide molecule encoding a polypeptide that is part of a CAR or TCR described herein. In some embodiments, the invention provides a host cell comprising a polynucleotide encoding a CAR or TCR of the invention. In some embodiments, the host cell produces a mesothelin CAR or TCR of the invention.

5.5 cells

The invention provides cells comprising a polynucleotide disclosed herein. In some embodiments, the invention provides a cell comprising a polynucleotide encoding a polypeptide disclosed herein. In some embodiments, the invention provides a cell comprising a vector having a polynucleotide disclosed herein. In some embodiments, the invention provides cells capable of recombinantly expressing a polypeptide disclosed herein. The polypeptide may be an anti-mesothelin antibody or antigen-binding fragment. The polypeptide can be a mesothelin CAR. The polypeptide may be mesothelin TCR.

In some embodiments, the cells provided herein are immune effector cells. In some embodiments, the immune effector cell is selected from the group consisting of a T cell, a B cell, a Natural Killer (NK) cell, an NKT cell, a macrophage, a granulocyte, a neutrophil, an eosinophil, a mast cell, and a basophil. In some embodiments, the immune effector cells provided herein are selected from the group consisting of T cells, NK cells, NKT cells, macrophages, neutrophils, and granulocytes. In some embodiments, the immune effector cells provided herein are T cells. In some embodiments, the immune effector cells provided herein are NK cells. In some embodiments, the immune effector cells provided herein are NKT cells. In some embodiments, the immune effector cell provided by the invention is a macrophage. In some embodiments, the immune effector cells provided herein are neutrophils. In some embodiments, the immune effector cells provided herein are granulocytes.

In some embodiments, the immune effector cells provided by the present invention may be genetically engineered. In some embodiments, the genetically engineered immune effector cells provided herein are isolated. In some embodiments, the genetically engineered immune effector cells provided herein are substantially purified.

Thus, in some embodiments, the invention provides immune effector cells capable of recombinantly expressing a polypeptide (e.g., an antibody or CAR) disclosed herein. The invention also provides an immune effector cell (e.g., a T cell) comprising a polynucleotide encoding a polypeptide (e.g., an antibody or CAR) disclosed herein or a vector bearing a polynucleotide disclosed herein. In some embodiments, the invention provides an immune effector cell (e.g., a T cell) comprising a polynucleotide encoding an anti-mesothelin antibody or antigen binding fragment disclosed herein. In some embodiments, the invention provides immune effector cells (e.g., T cells) capable of recombinantly expressing an anti-mesothelin antibody or antigen binding fragment disclosed herein. In some embodiments, the invention provides an immune effector cell comprising a polynucleotide encoding a mesothelin CAR disclosed herein. In some embodiments, the invention provides immune effector cells (e.g., T cells; e.g., mesothelin CART cells) capable of recombinantly expressing a mesothelin CAR disclosed herein. In some embodiments, the invention provides immune effector cells comprising a polynucleotide encoding a disclosed mesothelin TCR. In some embodiments, the invention provides immune effector cells (e.g., T cells; e.g., mesothelin TCRT cells) capable of recombinantly expressing a mesothelin TCR as disclosed herein.

In some embodiments, the immune effector cells provided herein are T cells. The T cell may be a cytotoxic T cell, a helper T cell, or a γ δ T, CD4+/CD8+ double positive T cell, CD4+ T cell, CD8+ T cell, CD4/CD8 double negative T cell, CD3+ T cell, naive T cell, effector T cell, cytotoxic T cell, helper T cell, memory T cell, regulatory T cell, th0 cell, th1 cell, th2 cell, th3 (Treg) cell, th9 cell, th17 cell, th α β helper cell, tfh cell, stem cell-like central memory TSCM cell, central memory TCM cell, effector memory TEM cell, effector memory tea cell, or γ δ T cell. In some embodiments, the T cell is a cytotoxic T cell. In some embodiments, the T cell is genetically engineered. In some embodiments, the T cells provided herein are isolated. In some embodiments, the T cells provided herein are substantially purified.

In some embodiments, the genetically engineered cells provided herein are derived from cells isolated from a subject. As used herein, a genetically engineered cell "derived from" a source cell refers to a genetically engineered cell obtained by obtaining a source cell and genetically manipulating the source cell. The source cell may be from a natural source. For example, the source cell can be a primary cell isolated from a subject. The subject may be an animal or a human. The source cell may also be a cell that has been passaged or genetically manipulated in vitro.

In some embodiments, the genetically engineered cells provided herein are derived from cells isolated from a human. Immune effector cells (e.g., T cells) can be obtained from a number of sources, including peripheral blood mononuclear cells, bone marrow, lymph node tissue, cord blood, thymus tissue, tissue at the site of infection, ascites, pleural effusion, spleen tissue, and tumors. In certain embodiments, T cell lines available in the art may be used. In some embodiments, the genetically engineered cells provided herein are derived from cells isolated from peripheral blood. In some embodiments, the genetically engineered cells provided herein are derived from cells isolated from bone marrow. In some embodiments, the genetically engineered cells provided herein are derived from cells isolated from Peripheral Blood Mononuclear Cells (PBMCs).

In some embodiments, the genetically engineered cells provided herein are derived from cells differentiated in vitro from stem cells or progenitor cells. In some embodiments, the stem or progenitor cells are selected from the group consisting of T cell progenitors, hematopoietic stem/progenitors, hematopoietic multipotent progenitors, embryonic stem cells, and induced pluripotent cells. In some embodiments, the genetically engineered cells provided herein are derived from cells differentiated in vitro from T cell progenitors. In some embodiments, the genetically engineered cells provided herein are derived from cells differentiated in vitro from hematopoietic stem/progenitor cells. In some embodiments, the genetically engineered cells provided herein are derived from cells differentiated in vitro from hematopoietic pluripotent progenitor cells. In some embodiments, the genetically engineered cells provided herein are derived from cells differentiated in vitro from embryonic stem cells. In some embodiments, the genetically engineered cells provided herein are derived from cells that induce the differentiation of pluripotent cells in vitro.

In some embodiments, the invention provides a population of cells comprising a cell disclosed herein. The cells disclosed herein can comprise a polynucleotide encoding, or recombinantly express, a polypeptide disclosed herein. The polypeptide can be an anti-mesothelin antibody or antigen-binding fragment, a mesothelin CAR, or a mesothelin TCR. The cell population may be a homogenous cell population. The cell population may be a heterogeneous cell population. In some embodiments, the cell population can be a heterogeneous cell population comprising any combination of the presently disclosed cells. In some embodiments, the population of cells is derived from Peripheral Blood Mononuclear Cells (PBMCs), peripheral Blood Lymphocytes (PBLs), tumor Infiltrating Lymphocytes (TILs), cytokine-induced killer Cells (CIKs), lymphokine-activated killer cells (LAKs), or bone Marrow Infiltrating Lymphocytes (MILs). In some embodiments, the cell populations provided herein are derived from PBMCs. In some embodiments, the cell populations provided herein are derived from PBLs. In some embodiments, the cell populations provided herein are derived from TIL. In some embodiments, the cell populations provided herein are derived from CIK. In some embodiments, the cell population provided herein is derived from LAK. In some embodiments, the cell populations provided herein are derived from MILs. The population of cells can be genetically engineered to recombinantly express the disclosed polypeptides (e.g., antibodies or CARs). In some embodiments, the invention provides a population of cells comprising a polynucleotide encoding a polypeptide (e.g., an antibody or CAR) disclosed herein or a vector bearing a polynucleotide disclosed herein. In some embodiments, the invention provides a population of cells comprising a polynucleotide encoding an anti-mesothelin antibody or antigen-binding fragment disclosed herein. In some embodiments, the invention provides a population of cells recombinantly expressing an anti-mesothelin antibody or antigen-binding fragment disclosed herein. In some embodiments, the invention provides a population of cells comprising a polynucleotide encoding a mesothelin CAR as disclosed herein. In some embodiments, the invention provides a population of cells (e.g., mesothelin CART cells) that are capable of recombinantly expressing the disclosed mesothelin CARs. In some embodiments, the invention provides a population of cells comprising a polynucleotide encoding a disclosed mesothelin TCR. In some embodiments, the invention provides a population of cells (e.g., mesothelin TCRT cells) that are capable of recombinantly expressing mesothelin TCRs disclosed herein.

5.6 pharmaceutical compositions

The invention also provides pharmaceutical compositions comprising the anti-mesothelin antibodies or antigen binding fragments disclosed herein. The invention also provides a pharmaceutical composition comprising the genetically engineered immune effector cell disclosed by the invention. In some embodiments, the pharmaceutical composition comprises a therapeutically effective amount of an anti-mesothelin antibody, or antigen-binding fragment thereof, disclosed herein, and further comprises a pharmaceutically acceptable carrier. In some embodiments, the pharmaceutical composition comprises a pharmaceutically effective amount of the genetically engineered cells disclosed herein and a pharmaceutically acceptable carrier. In some embodiments, the pharmaceutical composition is useful in immunotherapy. In some embodiments, the pharmaceutical composition is useful in immuno-oncology. In some embodiments, the pharmaceutical composition is useful in inhibiting tumor growth in a subject (e.g., a human patient). In some embodiments, the pharmaceutical composition is useful in treating cancer in a subject (e.g., a human patient).

In some embodiments, the pharmaceutical compositions provided herein comprise an anti-mesothelin antibody or antigen-binding fragment provided herein. The anti-mesothelin antibody or antigen binding fragment may be present at different concentrations. In some embodiments, the pharmaceutical compositions provided herein comprise 1-1000mg/ml of the soluble anti-CD 123 mesothelin antibody or antigen-binding fragment thereof provided herein. In some embodiments, the pharmaceutical composition comprises a soluble anti-CD 123 mesothelin antibody or antigen-binding fragment thereof provided herein in an amount of 10-500mg/ml, 10-400mg/ml, 10-300mg/ml, 10-200mg/ml, 10-100mg/ml, 20-100mg/ml, or 50-100mg/ml. In some embodiments, the pharmaceutical compositions provided herein comprise an anti-mesothelin antibody or antigen-binding fragment provided herein in an amount of about 10mg/ml, about 20mg/ml, about 30mg/ml, about 40mg/ml, about 50mg/ml, about 60mg/ml, about 70mg/ml, about 80mg/ml, about 90mg/ml, about 100mg/ml, about 120mg/ml, about 150mg/ml, about 180mg/ml, about 200mg/ml, about 300mg/ml, about 500mg/ml, about 800mg/ml, or about 1000mg/ml.

Pharmaceutical compositions comprising genetically engineered immune effector cells (e.g., T cells) disclosed herein may comprise purified cell populations. As described herein, the percentage of cells in a cell population can be readily determined by one skilled in the art using a variety of well-known methods. The purity of a cell population comprising genetically engineered cells provided herein can range from about 20% to about 25%, about 25% to about 30%, about 30% to about 35%, about 35% to about 40%, about 40% to about 45%, about 45% to about 50%, about 55% to about 60%, about 65% to about 70%, about 70% to about 75%, about 75% to about 80%, about 80% to about 85%, about 85% to about 90%, about 90% to about 95%, about 95% to about 100%. In some embodiments, the purity of a cell population comprising immune effector cells provided herein may range from about 20% to about 30%, from about 20% to about 50%, from about 20% to about 80%, from about 20% to about 100%, from about 50% to about 80%, or from about 50% to about 100%. The person skilled in the art can easily adjust the dosage; for example, a decrease in purity may require an increase in dosage.

The invention also provides a kit for preparing a pharmaceutical composition comprising an anti-mesothelin antibody or antigen-binding fragment disclosed herein. In some embodiments, the kit comprises an anti-mesothelin antibody, or antigen-binding fragment thereof, disclosed herein, and a pharmaceutically acceptable carrier, in one or more containers. In another embodiment, the kit may include an anti-mesothelin antibody or antigen-binding fragment thereof disclosed herein for administration to a subject. In particular embodiments, the kit includes instructions for the preparation and/or administration of an anti-mesothelin antibody, or antigen-binding fragment thereof.

The invention also provides kits for preparing the immune effector cells (e.g., T cells) disclosed herein. In one embodiment, the kit comprises one or more vectors for producing genetically engineered cells (e.g., T cells) that express the anti-mesothelin antibodies or antigen-binding fragments thereof disclosed herein. The kits may be used to generate genetically engineered immune effector cells (e.g., T cells) from autologous or non-autologous cells for administration to a compatible subject.

In some embodiments, the invention provides pharmaceutical compositions comprising an anti-mesothelin antibody or antigen-binding fragment thereof provided herein, wherein the composition is suitable for topical administration. In some embodiments, local administration includes intratumoral injection, peritumoral injection, paratumoral injection, intralesional injection, and/or injection into tumor draining lymph nodes, or essentially any tumor targeting injection in which an anti-neoplastic agent is expected to leak into primary lymph nodes adjacent to a targeted solid tumor.

Pharmaceutically acceptable carriers that may be used in the compositions provided herein include any and all physiologically compatible materials such as solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like. In some embodiments, the vector is suitable for intravenous, intramuscular, subcutaneous, parenteral, spinal, or epidermal administration (e.g., by injection or infusion). Depending on the route of administration, the active ingredient (i.e., the anti-mesothelin antibody or antigen binding fragment provided by the present invention, or immune effector cells) may be coated in a material to protect the active ingredient from acids and other natural conditions that may inactivate the active ingredient.

The invention also provides pharmaceutical compositions or formulations that improve the stability of an anti-mesothelin antibody or antigen-binding fragment to allow long-term storage thereof. In some embodiments, the disclosed pharmaceutical compositions or formulations comprise: (a) The invention discloses anti-mesothelin antibodies or antigen-binding fragments; (b) a buffering agent; (c) a stabilizer; (d) a salt; (e) a filler; and/or (f) a surfactant. In some embodiments, the pharmaceutical composition or formulation is stable for at least 1 month, at least 2 months, at least 3 months, at least 6 months, at least 1 year, at least 2 years, at least 3 years, at least 5 years, or longer. In some embodiments, the pharmaceutical composition or formulation is stable when stored at 4 ℃, 25 ℃, or 40 ℃.

A buffer useful in the disclosed pharmaceutical compositions or formulations may be a weak acid or weak base for maintaining the acidity (pH) of the solution near a selected value after addition of another acid or base. Suitable buffering agents can maximize formulation stability by maintaining control over the formulation pH. Suitable buffers may also ensure physiological compatibility or optimize solubility. Rheology, viscosity and other properties also depend on the pH of the formulation. Common buffers include, but are not limited to, histidine, citrate, succinate, acetate, and phosphate. In some embodiments, the buffer comprises histidine with an isotonicity agent (e.g., L-histidine), and the pH may be adjusted with acids or bases known in the art. In certain embodiments, the buffering agent is L-histidine. In certain embodiments, the pH of the formulation is maintained between about 2 to about 10, or about 4 to about 8.

Stabilizers are added to pharmaceutical products to stabilize the product. Such agents may stabilize proteins in different ways. Common stabilizers include, but are not limited to, amino acids (such as glycine, alanine, lysine, arginine, or threonine), carbohydrates (such as glucose, sucrose, trehalose, raffinose, or maltose), polyols (such as glycerol, mannitol, sorbitol, cyclodextrins, or dealkylated species of any kind and molecular weight), or PEG. In some embodiments, the stabilizing agent is to maximize the stability of the FIX polypeptide in the lyophilized formulation. In certain embodiments, the stabilizing agent is sucrose and/or arginine.

Fillers may be added to pharmaceutical compositions or formulations to increase the volume and mass of the product, thereby facilitating accurate metering and handling thereof. Common fillers include, but are not limited to, lactose, sucrose, glucose, mannitol, sorbitol, calcium carbonate, or magnesium stearate.

The surfactant is an amphoteric substance having a hydrophilic group and a hydrophobic group. The surfactant may be anionic, cationic, zwitterionic or nonionic. Nonionic surfactants include, but are not limited to, alkyl ethoxylates, nonylphenoxy ethers, ethoxylates, polyethylene oxides, polypropylene oxides, fatty alcohols (such as cetyl alcohol or oleyl alcohol), cocamide MEA, cocamide DEA, polysorbates, or dodecyldimethylamine oxides. In some embodiments, the surfactant is polysorbate 20 or polysorbate 80.

The pharmaceutical compositions disclosed herein may further include one or more of a buffering system, a preservative, a tonicity agent, a chelating agent, a stabilizer, and/or a surfactant, and various combinations thereof. The use of preservatives, isotonicity agents, chelating agents, stabilizers and surfactants in pharmaceutical compositions is well known to those skilled in the art. Can refer to Remington:The Science and Practice of Pharmacy，19 ^th edition，1995。

In some embodiments, the pharmaceutical composition is an aqueous formulation. Such formulations are typically solutions or suspensions, but may also include colloids, dispersions, emulsions, and multiphase materials. The term "aqueous formulation" is defined as a formulation containing at least 50% w/w water. Likewise, the term "aqueous solution" is defined as a solution comprising at least 50% w/w water, and the term "aqueous suspension" is defined as a suspension comprising at least 50% w/w water.

In some embodiments, the pharmaceutical compositions disclosed herein are lyophilized, and a solvent and/or diluent is added to the composition by the physician or patient prior to use.

The pharmaceutical compositions disclosed herein may also include a pharmaceutically acceptable antioxidant. Examples of pharmaceutically acceptable antioxidants include: examples of pharmaceutically acceptable antioxidants include: (1) Water-soluble antioxidants such as ascorbic acid, cysteine hydrochloride, sodium bisulfate, sodium metabisulfite, sodium sulfite, and the like; (2) Oil-soluble antioxidants such as ascorbyl palmitate, butyl Hydroxyanisole (BHA), 2, 6-di-tert-butyl-p-cresol (BHT), lecithin, propyl gallate, alpha-tocopherol, etc.; and (3) metal chelating agents such as citric acid, ethylenediaminetetraacetic acid (EDTA), sorbitol, tartaric acid, phosphoric acid, and the like.

Examples of suitable aqueous and nonaqueous carriers which may be employed in the pharmaceutical compositions or formulations of the present invention include water, ethanol, polyols (such as glycerol, propylene glycol, polyethylene glycol, and the like), and suitable mixtures thereof, vegetable oils (such as olive oil), and injectable organic esters (such as ethyl oleate). Proper fluidity can be maintained, for example, by the use of a coating material, such as lecithin, by the maintenance of the required particle size in the case of dispersions and by the use of surfactants.

These compositions may also contain adjuvants such as preservatives, wetting agents, emulsifying and dispersing agents. Prevention of the presence of microorganisms can be ensured by the sterilization procedures described above and by the addition of various antibacterial and antifungal agents (e.g., parabens, chlorobutanol, phenol sorbic acid, and the like). It may also be desirable to include isotonic agents, for example, sugars, sodium chloride, and the like in the compositions. In addition, prolonged absorption of the injectable pharmaceutical form may be brought about by the addition of agents delaying absorption, such as aluminum monostearate and gelatin.

Pharmaceutically acceptable carriers include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. Such media and agents for pharmaceutically active substances are known in the art. Except insofar as any conventional media or agent is incompatible with the active compound, its use in the pharmaceutical compositions of the invention is contemplated. The pharmaceutical composition or formulation may or may not include a preservative. Supplementary active compounds may be incorporated into the compositions.

Pharmaceutical compositions or formulations must generally be sterile and stable under the conditions of manufacture and storage. The compositions may be formulated as solutions, microemulsions, liposomes, or other ordered structures suitable for high antibody concentrations. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), and suitable mixtures thereof. Proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersions, and by the use of surfactants. In many cases, the composition can include isotonic agents, for example, sugars, polyalcohols such as mannitol, sorbitol, or the composition, or sodium chloride in the composition. Prolonged absorption of the injectable compositions can be brought about by the addition to the compositions of agents delaying absorption, for example, monostearate salts and gelatin.

If desired, sterile injectable solutions can be prepared by incorporating one or more of the ingredients into the active compound in the required amount in the appropriate solvent, followed by sterile microfiltration. Generally, dispersions are prepared by incorporating the active compound into a sterile vehicle which contains a basic dispersion medium and the required other ingredients enumerated herein. In the case of sterile powders for the preparation of sterile injectable solutions, several methods of preparation are vacuum drying and freeze-drying (lyophilization), whereby a powder of the active ingredient plus any additional desired ingredient may be obtained from a previously sterile-filtered solution thereof.

The amount of active ingredient that may be combined with the carrier material in the pharmaceutical compositions or formulations disclosed herein may vary. In some embodiments, the amount of active ingredient that can be combined with the carrier material is that amount which produces a therapeutic effect. Typically, the amount of active ingredient in combination with a pharmaceutically acceptable carrier ranges from about 0.01% to about 99%, from about 0.1% to about 70%, or from about 1% to about 30%, by percent.

The pharmaceutical compositions disclosed herein can be prepared with carriers that protect the active ingredient from rapid release, such as controlled release formulations, including implants, transdermal patches, and microencapsulated delivery systems. Biodegradable, biocompatible polymers such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid may be used. Many methods for preparing such formulationsPatented methods or are generally known to those skilled in the art. See, for example,Sustained and Controlled Release Drug Delivery Systems,J.R.Robinson,ed.,Marcel Dekker,Inc.,New York,1978。

in some embodiments, an anti-mesothelin antibody or antigen-binding fragment, or immune effector cells (e.g., T cells) as described herein may be formulated to ensure proper distribution in vivo. For example, the Blood Brain Barrier (BBB) excludes many highly hydrophilic compounds. To ensure that the activating components described herein cross the BBB (if desired, e.g., for brain cancer), they can be formulated in liposomes, for example. For methods of making liposomes, see U.S. Pat. nos. 4,522,811;5,374,548; and 5,399,331. Liposomes can include one or more groups that selectively transport to a particular cell or organ, thereby enhancing targeted drug delivery (see, e.g., v.v. ranade (1989) j.clin.pharmacol.29: 685). Ranade (1989) j. Clin. Pharmacol.29: 685.) examples of targeting groups include folic acid or biotin (see, e.g., U.S. Pat. No. 5,416,016to Low et al), mannosides (Umezawa et al, (1988) biochem. Biophysis. Res. Commu.153: 1038), antibodies (p.g. bloeman et al (1995) FEBS lett.357:140; m.owais et al (1995) antipicrob. Ingredients chemither.39: 180), surfactant protein a receptor (Briscoe et al (1995) am.j.physiol.1233: 134), pl20 (Schreier et al (1994) j.biol.chem.269: 9090), see also k.keenanen; M.L.Laukkanen (1994) FEBS Lett.346:123; j.j.killion; i.j. fidler (1994) immunolmethods 4.

5.7 methods and uses

The invention also provides the following that are disclosed by the invention: an anti-mesothelin antibody or antigen-binding fragment; mesothelin CAR; mesothelin TCR; polynucleotides encoding such anti-mesothelin antibodies or antigen-binding fragments, and mesothelin CAR/TCR; vectors comprising such polynucleotides; a cell expressing the mesothelin CAR/TCR; and methods of using pharmaceutical compositions having such cells in the treatment of cancer. Without being bound by theory, the anti-mesothelin antibodies or antigen-binding fragments disclosed herein, and mesothelin CAR/TCR-expressing cells, are capable of specifically targeting mesothelin-expressing cancer cells in vivo, thereby achieving therapeutic effects in which they eliminate, lyse, and/or kill cancer cells. In some embodiments, the method comprises administering to a subject in need thereof a therapeutically effective amount of an anti-mesothelin antibody or antigen binding fragment disclosed herein. In some embodiments, the method comprises administering to a subject in need thereof a therapeutically effective amount of a disclosed mesothelin CAR-expressing immune effector cell. In one embodiment, the method can comprise administering to a subject in need thereof a therapeutically effective amount of a disclosed mesothelin CAR.

In some embodiments, the invention provides a method of treating a tumor or cancer in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of an anti-mesothelin antibody or antigen-binding fragment disclosed herein. In some embodiments, the invention provides the use of an anti-mesothelin antibody or antigen-binding fragment disclosed herein in the treatment of a tumor or cancer. In some embodiments, the invention provides the use of an anti-mesothelin antibody or antigen-binding fragment disclosed herein for the manufacture of a medicament for the treatment of a tumor or cancer.

In some embodiments, the invention provides a method of treating a tumor or cancer in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of an immune effector cell disclosed herein (e.g., mesothelin CART). In some embodiments, the invention provides the use of the immune effector cells disclosed herein in the treatment of a tumor or cancer. In some embodiments, the invention provides the use of an immune effector cell provided herein in the manufacture of a medicament for the treatment of a tumor or cancer. In some embodiments, the disclosed cell populations comprising immune effector cells are used in therapy. The cell population may be homologous. The cell population may be heterologous.

In some embodiments, the present invention provides a method of treating a tumor or cancer in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of a pharmaceutical composition disclosed herein. In some embodiments, the invention provides the use of the pharmaceutical compositions disclosed herein for the treatment of a tumor or cancer. In some embodiments, the present invention provides the use of a pharmaceutical composition provided herein in the manufacture of a medicament for the treatment of a tumor or cancer.

The actual dosage level of the active ingredient in the pharmaceutical compositions of the invention (i.e., the anti-mesothelin antibody or antigen-binding fragment provided by the invention, or the immune effector cells) may be varied to obtain a content of active ingredient, composition and mode of administration that is effective to achieve the desired therapeutic response for a particular patient without toxicity to the patient. The selected dosage level will depend upon a variety of pharmacokinetic factors including the activity of the particular composition of the invention, the route of administration, the time of administration, the rate of excretion, the duration of the treatment, other drugs, compounds and/or materials used in conjunction with the particular composition being used, the age, sex, body weight, condition, general health and past medical history of the patient being treated, and like factors well known in the medical arts.

The anti-mesothelin antibody or antigen binding fragment may be administered as a sustained release formulation, in which case frequent administration is not required. The dose and frequency will vary depending on the half-life of the anti-mesothelin antibody, or antigen-binding fragment thereof, in the patient. In therapeutic applications, it is sometimes desirable to administer relatively high doses over a relatively short time interval until progression of the disease is reduced or terminated, and until the patient exhibits partial or complete amelioration of the symptoms of the disease.

In some embodiments, the immune effector cells provided herein that are capable of recombinantly expressing the disclosed mesothelin CARs or TCRs are useful in the disclosed methods of treatment. When cell therapy is employed, the cells provided by the invention can be administered at a dose per kilogram of cells (cells/kg) based on the body weight of the subject to which the cells are administered. The cell dose may range from about 10 ⁴ To 10 ¹⁰ Individual cells/kg body weight, e.g., about 10 ⁵ To about 10 ⁹ About 10 ⁵ To about 10 ⁸ About 10 ⁵ To about 10 ⁷ Or about 10 ⁵ To about 10 ⁶ Individual cells/kg body weight, whichDepending on the mode and location of administration. Generally, in the case of systemic administration, higher doses are used than for regional administration (administration of the immune effector cells in the tumor region). As noted above, the precise determination of what is an effective dose can be based on individual factors per subject, including their size, age, sex, weight and condition of the particular subject. Dosages can be readily determined by those skilled in the art based on the present disclosure and the knowledge available in the art.

The anti-mesothelin antibodies or antigen binding fragments thereof, immune effector cells, and pharmaceutical compositions provided herein may be administered to a subject by any method known in the art, including, but not limited to, thoracic administration, intravenous administration, subcutaneous administration, intranodal administration, intratumoral administration, intramuscular administration, intradermal administration, intrathecal administration, intrapleural administration, intraperitoneal administration, intracranial administration, spinal cord, or other parenteral routes of administration, such as by injection or infusion, or direct administration to the thymus. The phrase "parenteral administration" as used herein refers to modes of administration other than enteral and topical administration, typically by injection, including but not limited to intravenous, intramuscular, intraarterial, intrathecal, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcuticular, intraarticular, subcapsular, subarachnoid, intraspinal, epidural and intraperitoneal injection and infusion. In some embodiments, subcutaneous administration is employed. In some embodiments, intravenous administration is employed. In some embodiments, oral administration is employed. In one embodiment, the cells provided herein can be delivered locally to a tumor using well known methods, including but not limited to hepatic or aortic pumps; limb, lung or liver perfusion; in the portal vein; by venous shunting; in the lumen or blood vessels near the tumor, etc. In another embodiment, the cells provided herein can be administered systemically. In a preferred embodiment, the cells are administered locally at the tumor site. The cells may also be administered intratumorally, e.g., by direct injection of the cells at the tumor site and/or into the tumor vasculature. For example, in the case of malignant pleural disease, mesothelioma or lung cancer, intrapleural administration is preferred (see, adusumili et al, science relative Medicine 6 (261): 261ra151 (2014)). One skilled in the art can select an appropriate mode of administration based on the type and/or location of the tumor to be treated. The cells may be introduced by injection or catheter. In one embodiment, the subject in need thereof is administered intrapleurally, e.g., using an intrapleural catheter. Optionally, the subject can be administered an expansion and/or differentiation agent prior to, during, or after administration of the cells, optionally to increase in vivo cell production provided by the invention.

The proliferation of cells provided by the present invention is typically performed in vitro, and it is also desirable to perform in vivo following administration to a subject (see Kaiser et al, cancer Gene Therapy 22 (2015)). Cell proliferation should be accompanied by cell survival to allow expansion and persistence of cells (e.g., T cells).

Cancers or tumors, including cancers that are typically responsive to immunotherapy, are treated using the anti-mesothelin antibodies or antigen-binding fragments, cells, or pharmaceutical compositions provided by the present invention. The anti-mesothelin antibodies or antigen binding fragments, cells, or pharmaceutical compositions disclosed herein may be used to treat mesothelin-associated diseases or disorders. For example, mesothelioma is a mesothelin-related disease.

Malignant mesothelioma is a type of cancer that occurs in thin layer cells (called mesothelium) lining internal organs of the body. There are three recognized types of mesothelioma. Pleural mesothelioma (e.g., malignant pleural mesothelioma, or MPM) is the most common one of the diseases, accounting for approximately 70% of cases, occurring in the lining of the lung known as the pleura. Peritoneal mesothelioma occurs in the inner wall of the abdominal cavity, known as the peritoneum. Pericardial mesothelioma originates from the pericardium, which is distributed over the heart. In some embodiments, the anti-mesothelin antibodies or antigen binding fragments, cells, or pharmaceutical compositions disclosed herein may be used to treat mesothelioma. In some embodiments, the mesothelioma is pleural mesothelioma. In some embodiments, the mesothelioma is peritoneal mesothelioma. In some embodiments, the mesothelioma is pericardial mesothelioma.

Symptoms of pleural mesothelioma include, for example, lower back pain or lateral chest pain, and shortness of breath. Other symptoms include dysphagia, persistent cough, fever, weight loss, or fatigue. Other symptoms that some patients present include muscle weakness, loss of sensory ability, hemoptysis, swelling of the face and arms, and hoarseness. Early in onset, such as dermatoma at 1, symptoms may be mild. Patients typically report pain in one area of the chest, and the pain appears to never disappear, as well as weight loss and fever.

Peritoneal mesothelioma originates in the abdomen, and therefore, symptoms often include abdominal pain, weight loss, nausea, and vomiting. Fluid accumulation may occur in the abdomen, which also leads to cancer. Peritoneal mesothelioma originates in the abdomen and often spreads to other organs in the liver, spleen or intestinal tract. Severe abdominal pain is the first most common complaint among patients. There may also be uncomfortable levels with abdominal fluid accumulation. Other symptoms of peritoneal mesothelioma may include difficulty defecation, nausea and vomiting, fever, and swelling of the foot.

Pericardial mesothelioma is the least common one of mesotheliomas. Pericardial mesothelioma involves the heart. This rare type of mesothelioma cancer invades the pericardium. As cancer progresses, the heart fails to deliver oxygen to the body efficiently, resulting in a further decline in health at an increasingly rapid rate. The symptoms most commonly associated with pericardial mesothelioma are similar to heart attacks: nausea, chest pain, and shortness of breath.

In some embodiments, the methods provided herein can treat a subject having mesothelioma. In some embodiments, the methods provided herein can treat a subject at risk of developing mesothelioma. If a subject is exposed to asbestos, there may be a risk of mesothelioma developing. Contact with asbestos and inhalation of asbestos particles can cause mesothelioma. In most cases, asbestos-exposed subjects do not develop mesothelioma symptoms until years later. In some embodiments, the methods provided herein can treat a subject suspected of having mesothelioma, e.g., as evidenced by the presence of one or more symptoms described herein and/or exposure to asbestos. In some embodiments, a subject that may be treated by the methods disclosed herein may have a precancerous state, such as a pleural plaque, benign mesothelioma, or mesothelial hyperplasia.

Another example of a mesothelin-associated disease or disorder is pancreatic cancer. In some embodiments, the anti-mesothelin antibodies or antigen binding fragments, cells, or pharmaceutical compositions provided by the present invention may be used to treat pancreatic cancer. Pancreatic cancers that can be treated using the methods of the invention include, but are not limited to, exocrine pancreatic tumors and endocrine tumors. Exocrine pancreatic tumors include, but are not limited to, adenocarcinoma, acinar cell carcinoma, adenosquamous carcinoma, glioma, undifferentiated carcinoma with osteoclastoid-like giant cells, hepatoid carcinoma, intraductal papillary mucinous tumors, mucinous cysts, pancreatoblastomas, serous cystadenomas, signet ring cell carcinoma, solid and pseudopapillary tumors, pancreatic ductal carcinoma, and undifferentiated carcinoma. In some embodiments, the pancreatic exocrine tumor is a pancreatic ductal carcinoma. Pancreatic endocrine tumors include, but are not limited to, insulinomas and glucagonoma.

In some embodiments, the pancreatic cancer is any one of early stage pancreatic cancer, non-metastatic pancreatic cancer, primary pancreatic cancer, resected pancreatic cancer, advanced pancreatic cancer, locally advanced pancreatic cancer, metastatic pancreatic cancer, unresectable pancreatic cancer, remission pancreatic cancer, recurrent pancreatic cancer, pancreatic cancer in adjuvant therapy, and pancreatic cancer in neoadjuvant therapy. In some embodiments, the pancreatic cancer is locally advanced pancreatic cancer, unresectable pancreatic cancer, or metastatic pancreatic ductal cancer. In some embodiments, the pancreatic cancer is resistant to gemcitabine-based therapy. In some embodiments, the pancreatic cancer is refractory to gemcitabine-based therapy.

Ovarian cancer may also be associated with mesothelin expression. In some embodiments, the anti-mesothelin antibodies or antigen binding fragments, cells, or pharmaceutical compositions provided herein may be used to treat ovarian cancer. Ovarian cancer is classified according to the histology of the tumor. Superficial epithelial stromal tumors, also known as ovarian epithelial cancers, are the most common type of ovarian cancer. It includes serous tumors (including serous papillary cystadenocarcinoma), endometrioid tumors, and mucinous cystadenocarcinoma.

The methods of the invention may be used to treat various stages of ovarian cancer, such as stage I, II, III, or IV. Staging may be performed, for example, when ovarian cancer is removed. Ovarian cancer stages were as follows: stage I cancer is confined to one or both ovaries. Stage II if the cancer involves one or both ovaries and spreads to the uterus and/or fallopian tubes, or other sites in the pelvis. Stage III cancer is if the cancer involves one or both ovaries and has spread to the lymph nodes or other sites outside the pelvis, but is still located in the abdominal cavity, e.g., the intestinal tract or liver surface. Stage IV cancer if the cancer involves one or both ovaries and has spread outside the abdomen or inside the liver.

In some embodiments, the ovarian cancer is resistant to one or more chemotherapeutic agents. In some embodiments, the ovarian cancer is refractory to one or more chemotherapeutic agents.

Other cancers that may be treated with the anti-mesothelin antibodies or antigen binding fragments, cells or pharmaceutical compositions provided herein include, for example, brain cancer, bladder cancer, breast cancer, cervical cancer, colorectal cancer, liver cancer, kidney cancer, lymphoma, leukemia, lung cancer (e.g., lung adenocarcinoma), melanoma, metastatic melanoma, mesothelioma, neuroblastoma, ovarian cancer, prostate cancer, pancreatic cancer, kidney cancer, skin cancer, thymoma, sarcoma, non-hodgkin lymphoma, uterine cancer, and any combination thereof.

In cancer treatment, the cancer or tumor cells of a subject can be eliminated, but any clinical improvement would be beneficial. The anti-tumor effect can be manifested by a reduction in tumor volume, a reduction in the number of tumor cells, a reduction in the number of metastases, an increase in life expectancy, or an improvement in various physiological symptoms associated with the cancer condition. The anti-tumor effect may also be manifested by the ability of the cells or pharmaceutical compositions provided by the invention to prevent tumorigenesis in the first instance. In some embodiments, an "anti-tumor effect" can be manifested by a reduction in cancer-induced immunosuppression. Clinical improvement includes a reduction in the risk or rate of progression or a reduction in the pathological consequences of the cancer or tumor. It is also understood that the method of treating cancer may include any effect that ameliorates a sign or symptom associated with the cancer. Such signs or symptoms include, but are not limited to, reduction in tumor burden, including inhibition of tumor growth, reduction in tumor growth rate, reduction in tumor size, reduction in tumor number, elimination of tumors, all of which can be measured using conventional tumor imaging techniques well known in the art. Other signs or symptoms associated with cancer include, but are not limited to, fatigue, pain, weight loss, and other signs or symptoms associated with various cancers.

In some embodiments, the methods or uses provided herein can reduce tumor burden. Thus, administration of an anti-mesothelin antibody, or antigen-binding fragment, cell, or pharmaceutical composition thereof as disclosed herein may reduce the number of tumor cells, reduce the size of the tumor, and/or eradicate the tumor in the subject. Methods for monitoring a patient's response to administration of the disclosed pharmaceutical compositions are known in the art and can be used in accordance with the disclosed methods. In some embodiments, methods known in the art can be used to monitor a patient's response to administration of the disclosed treatment methods.

In the presently disclosed methods, a therapeutically effective amount of an anti-mesothelin antibody, or antigen-binding fragment, cell, or pharmaceutical composition thereof, presently disclosed, is administered to a subject in need of cancer treatment. The subject may be a mammal. In some embodiments, the subject is a human. In some embodiments, the individuals do not have clinically measurable tumors. However, they are suspected of being at risk for disease progression, either near the original tumor site or by metastasis. This group can be further subdivided into high risk and low risk individuals. The subdivision is based on features observed before or after the initial processing. These characteristics are known in the clinic and are appropriately defined for different types of cancer. The high risk subgroup is typically characterized by tumor invasion of adjacent tissues, or evidence of lymph node metastasis.

The anti-mesothelin antibodies or antigen binding fragments, cells, or pharmaceutical compositions provided by the present invention may be administered in conjunction with medical devices known in the art. For example, in some embodiments, needleless hypodermic injection devices can be used, such as those described in U.S. patent nos.5,399,163;5,383,851;5,312,335;5,064,413;4,941,880;4,790,824; or the device disclosed in 4,596,556. Examples of the use of well known implants and modules described in this invention include: U.S. patent No.4,487,603, which discloses an implantable micro-infusion pump for dispensing medication at a controlled rate; U.S. patent No.4,486,194, which discloses a therapeutic device for transdermal drug delivery; U.S. patent No.4,447,233, which discloses a medication infusion pump for delivering medication at a precise infusion rate; U.S. patent No.4,447,224, which discloses a variable flow implantable infusion device for continuous administration; U.S. patent No.4,439,196, which discloses an osmotic drug delivery system having multiple chambers; and U.S. patent No.4,475,196, which discloses an osmotic drug delivery system. These patents are incorporated by reference into the present invention. Many other such implants, delivery systems, and modules are known to those skilled in the art.

Combination therapy with agents of different mechanisms of action may produce additive or synergistic effects. Combination therapy may allow the dosage of each agent to be lower than the dosage used in monotherapy, thereby reducing toxic side effects and/or increasing the therapeutic index of the agents disclosed herein. Combination therapy can reduce the likelihood of drug-resistant cancer cell generation. In some embodiments, the additional treatment results in an increase in the therapeutic index of the cells or pharmaceutical composition of the invention. In some embodiments, the additional treatment results in a reduction in toxicity and/or side effects of the cells or pharmaceutical compositions described herein. In some embodiments, the anti-mesothelin antibody, or antigen-binding fragment, cell, or pharmaceutical composition thereof, described herein may be administered in combination with an additional therapy. In some embodiments, the additional treatment may be surgical resection, radiation therapy, or chemotherapy.

The additional therapy may be administered prior to, concurrently with, or subsequent to the administration of the anti-mesothelin antibody, or antigen-binding fragment, cell, or pharmaceutical composition thereof, as described herein. Co-administration may include co-administration, either in a single pharmaceutical formulation or using separate formulations, or sequential administration in either order, but typically over a period of time such that all of the active agents can exert their biological activities simultaneously. One skilled in the art can readily determine the appropriate regimen for administration of the pharmaceutical compositions of the present invention and combination adjunctive therapy, including the timing and dosage of the additional agents used in the combination therapy, based on the needs of the subject being treated.

5.8 preparation method

5.8.1 polynucleotides, polypeptides, and antibodies

Polynucleotides provided by the invention can be prepared, manipulated and/or expressed using any of the well-established techniques known and available in the art. Many vectors can be used. Examples of vectors are plasmids, autonomously replicating sequences and transposable elements. Typical transposon systems, such as Sleeping Beauty (Sleeping Beauty) and PiggyBac, which can be stably integrated into the genome can be used (e.g., ivics et al, cell,91 (4): 501-510 (1997);

et al.,(2007)Nucleic Acids Research.35(12):e87)。501–510(1997)；/>

other exemplary vectors include, but are not limited to, plasmids, phages, cosmids, artificial chromosomes (such as Yeast Artificial Chromosomes (YACs), bacterial Artificial Chromosomes (BACs) or P1-derived artificial chromosomes (PACs)), phages (such as lambda phages or M13 phages), and animal viruses. Examples of animal virus species that can be used as vectors include, but are not limited to, retroviruses (including lentiviruses), adenoviruses, adeno-associated viruses, herpes viruses (e.g., herpes simplex virus), poxviruses, baculoviruses, papilloma viruses, and papovaviruses (e.g., SV 40). Examples of expression vectors are the pClneo vector (Promega) for expression in mammalian cells; for lentivirus-mediated gene transfer Plenti4/V5-Dest to induce expression in mammalian cells ^TM 、Plenti6/V5-Dest ^TM And Plenti6.2/V5-GW/Lacz (Invitrogen).

In some embodiments, the vector is an episomal vector or an extrachromosomal vector. As used herein, the term "episomal" refers to a vector that is capable of replication without integration into the chromosomal DNA of the host and without gradual loss from dividing host cells, and also means that the vector replicates extrachromosomally or in episomal form. The vector is engineered to contain a sequence encoding a DNA origin of replication or "ori" from a lymphotrophic or gammaherpes virus, adenovirus, SV40, bovine papilloma virus or yeast, in particular an origin of replication of a lymphotrophic or gammaherpes virus corresponding to oriP of EBV. In some embodiments, the lymphoherpesvirus may be Epstein Barr Virus (EBV), kaposi's Sarcoma Herpesvirus (KSHV), herpesvirus Saimiri (HS), or Marek's Disease Virus (MDV). Epstein Barr Virus (EBV) and Kaposi's Sarcoma Herpes Virus (KSHV) are also examples of gamma herpes viruses. Typically, the host cell includes a viral replication transactivator that activates replication.

"expression control sequences", "control elements" or "regulatory sequences" present in an expression vector refer to the untranslated regions of the vector (e.g., origins of replication, selection agents, promoters, enhancers, translational initiation signals (Shine Dalgarno sequence or Kozak sequence), polyadenylation sequences, 5 'and 3' untranslated regions) that interact with host cell proteins for transcription and translation. The strength and specificity of these elements vary. Any number of suitable transcription and translation elements may be used, depending on the vector system and host used, including ubiquitous promoters and inducible promoters.

Illustrative universal expression control sequences useful in the present invention include, but are not limited to, cytomegalovirus (CMV) immediate early promoter, viral monkey virus (SV 40) promoter (e.g., early or late), moloney murine leukemia virus (MoMLV) LTR promoter, rous Sarcoma Virus (RSV) LTR, herpes Simplex Virus (HSV) (thymidine kinase) promoter, H5, P7.5 and P11 promoters from vaccinia virus, elongation factor 1-alpha (EF 1 a) promoter, early growth response factor 1 (EGR 1), ferritin H (FerH), ferritin L (FerL), 3-phosphoglycerol aldehyde dehydrogenase (GAPDH), eukaryotic translation initiation factor 4A1 (EIF 4 A1), heat shock 70kDa protein 5 (HSPA 5), heat shock protein 90 β -member 1 (90B 1), heat shock protein 70kDa (HSPA 5), β -kinesin (β -KIN), human ROSA 26 gene site (irs, nature technology, heat shock protein 90 β -member 1 (HSP 1472C 1), chicken phosphoglycerate kinase (PGK-kinase) promoter, and chicken ubiquitin kinase promoter.

Illustrative examples of inducible promoters/systems include, but are not limited to, steroid-inducible promoters (e.g., gene promoters encoding glucocorticoid or estrogen receptor (induced by treatment with the corresponding hormone)), metallothionein promoters (induced by treatment with various heavy metals), MX-1 promoters (induced by interferon), "Gene switch" mifepristone-regulatory system (Sirin et al, 2003, gene,323 67), cumate-inducible gene switch (WO 2002/088346), tetracycline-dependent regulatory system, and the like. The anti-mesothelin antibodies or antigen binding fragments thereof described herein may be prepared by any method known in the art, including chemical synthesis and recombinant expression techniques. The practice of the present invention employs, unless otherwise indicated, molecular biology, microbiology, genetic analysis, recombinant DNA, organic chemistry, biochemistry, PCR, oligonucleotide synthesis and modification, nucleic acid hybridization, and related conventional techniques within the art. These techniques are described in the references cited herein and are fully explained in the literature. See, e.g., maniatis et al (1982) Molecular CLONING, A LABORATORY MANUAL, cold Spring Harbor LABORATORY Press; sambrook et al, (1989), molecular CLONING, A Laboratory Manual, second Edition, cold Spring Harbor LABORATORY Press; sambrook et al (2001) Molecular CLONING A Laborary Manual, cold Spring Harbor LABORATORY Press, cold Spring Harbor, NY; ausubel et al, current PROTOCOLS IN Molecular BIOLOGY, john Wiley & Sons (1987 and annual updates); CURRENT PROTOCOLS IN IMMUNOLOGY, john Wiley & Sons (1987 and annual updates) Gait (ed.) (1984) OLIGONUCLEOTIDE SYNTHESIS A PRACTICAL APPROACH, IRL Press; eckstein (ed.) (1991) OLIGONUCLEOTIDES AND ANALOGUES A PRACTICAL APPROACH, IRL Press; birren et al, (eds.) (1999) GENOME ANALYSIS: A LABORATORY MANUAL, cold Spring Harbor LABORATORY Press; borrebaeck (ed.) (1995) ANTIBODY Engine, second Edition, oxford University Press; lo (ed.) (2006) ANTIBODY end: METHODS AND promoters (METHODS IN MOLECULAR BIOLOGY); vol.248, humana Press, inc; each of which is incorporated by reference herein in its entirety.

The polypeptides of the invention (e.g., the anti-mesothelin antibodies or antigen binding fragments) may be produced and isolated using methods well known in the art. Peptides can be synthesized in whole or in part using chemical methods (see, e.g., caruthers (1980), nucleic Acids Res. Symp. Ser.215; horns (1980); and Banga, A.K., therapeutic Peptides and Proteins, formulation, processing and Delivery Systems (1995) technical Publishing Co., lancaster, pa.). Peptide synthesis can be performed using various solid phase techniques (see, e.g., roberge Science 269 (1995); merrifield, methods. Enzymol.289:3 (1997)) and automated synthesis can be achieved, e.g., using an ABI 431A peptide synthesizer (Perkin Elmer) according to the manufacturer's instructions. Peptides may also be synthesized using combinatorial approaches. Artificially synthesized residues and polypeptides can be synthesized using various programs and methods known in the art (see, e.g., organic Synthesis Collective Volumes, gilman, et al, (Eds) John Wiley & Sons, inc., NY). Modified polypeptides can be produced by chemical modification methods (see, e.g., belouov, nucleic Acids Res.25:3440 (1997); frenkel, free Radic.biol.Med.19:373 (1995); and Blommers, biochemistry 33 (1994)). Peptide sequence variations, derivatives, substitutions and modifications can also be made using methods such as oligonucleotide-mediated (site-directed) mutagenesis, alanine scanning and PCR-based mutagenesis. Site-directed mutagenesis (Carter et al, nucleic acids res, 13.

The polypeptides of the invention can be prepared using a variety of techniques known in the art, including the use of hybridoma and recombinant techniques, or a combination thereof. In some embodiments, the recombinant expression vector is used to express a polynucleotide encoding a polypeptide of the invention. For example, a recombinant expression vector may be a replicable DNA construct comprising a synthetic or cDNA-derived DNA segment encoding a polypeptide operably linked to suitable transcriptional and/or translational regulatory elements derived from a mammalian, microbial, viral, or insect gene. In some embodiments, the coding sequence for a polypeptide disclosed herein can be ligated into such an expression vector for expression in a mammalian cell. In some embodiments, a viral vector is used. When DNA regions are functionally related, they are "operably linked". For example, a promoter is operably linked to a coding sequence if it controls the transcription of the sequence; or operably linked to a coding sequence if the ribosome binding site is positioned so as to permit translation. In some embodiments, the structural element intended for use in a yeast expression system comprises a leader sequence that may enable the host cell to secrete the translated protein extracellularly. In some embodiments, the polypeptide may include an N-terminal methionine residue in the absence of a leader or transport sequence for expression of the recombinant protein.

Various combinations of expression hosts/vectors may be used. Suitable host cells for expression include prokaryotes, yeast cells, insect cells or higher eukaryotic cells under the control of an appropriate promoter. Suitable cloning and expression vectors for bacterial, fungal, yeast and mammalian cell hosts, as well as methods of protein production, including antibody production, are well known in the art. Expression vectors useful for bacterial hosts include known bacterial plasmids, such as those from E.coli, including pCR1, pBR322, pMB9, and derivatives thereof, as well as a broader host range of plasmids, such as M13 and other filamentous single stranded DNA phages.

Expression vectors useful for eukaryotic hosts include, for example, vectors containing expression control sequences from SV40, bovine papilloma virus, adenovirus and cytomegalovirus. Examples of suitable mammalian host cell lines include, but are not limited to, COS-7 (derived from monkey kidney), L-929 (derived from murine fibroblasts), C127 (derived from murine breast tumor), 3T3 (derived from murine fibroblasts), CHO (derived from Chinese hamster ovary), heLa (derived from human cervical cancer), BHK (derived from hamster kidney fibroblasts), HEK-293 (derived from human embryonic kidney) cell lines, and variants thereof. Mammalian expression vectors can include non-transcriptional elements (e.g., origins of replication), suitable promoters and enhancers for linkage to the gene to be expressed, and other 5 'or 3' flanking non-transcribed and 5 'or 3' untranslated sequences (e.g., necessary ribosome binding sites, polyadenylation sites, splice donor and acceptor sites, and transcriptional termination sequences). Expression of recombinant proteins in insect cell culture systems (e.g., baculovirus) also provides a powerful method for producing correctly folded and biologically functional proteins. Baculovirus systems for the production of heterologous proteins in insect cells are well known to those skilled in the art.

The antibodies and antigen binding fragments thereof provided by the present invention include, but are not limited to, monoclonal antibodies, polyclonal antibodies, synthetic antibodies, human antibodies, humanized antibodies, and antigen binding fragments thereof.

Methods for the preparation of antibodies are well known in the art. See, e.g., harlow et al, antibodies: A Laboratory Manual, (Cold Spring Harbor Laboratory Press,2nd ed.1988); hammerling et al, in Monoclonal Antibodies and T-Cell hybrids 563 681 (Elsevier, N.Y., 1981), each of which is incorporated by reference in its entirety. For antibodies used in vivo in humans, it may be preferable to use human antibodies. Fully human antibodies are particularly desirable for therapeutic treatment of human subjects. Human antibodies can be made by a variety of methods known in the art, including phage display methods using antibody libraries derived from human immunoglobulin sequences, including improvements to these techniques. See, also, U.S. Pat. Nos. 4,444,887and 4,716,111; and PCT publications WO 98/46645, WO 98/50433, WO 98/24893, WO98/16654, WO 96/34096, WO 96/33735, and WO 91/10741; each of which is incorporated by reference herein in its entirety. A human antibody can also be an antibody in which the heavy and light chains are encoded by nucleotide sequences derived from one or more human DNA sources.

Human antibodies can also be produced using transgenic mice that do not express functional endogenous immunoglobulins, but express human immunoglobulin genes. For example, human heavy and light chain immunoglobulin gene complexes can be introduced into mouse embryonic stem cells at random or by homologous recombination. In addition, human variable, constant and diversity regions can be introduced into mouse embryonic stem cells in addition to human heavy and light chain genes. Mouse heavy and light chain immunoglobulin genes can be introduced into human immunoglobulin gene sites separately or simultaneously by means of homologous recombination, so that the genes are disabled. For example, it is described that homozygous deletion of the antibody heavy chain joining region (JH) gene in chimeras and germ line mutant mice results in complete inhibition of endogenous antibody production. The modified embryonic stem cells were expanded and microinjected into blastocysts to generate chimeric mice. Chimeric mice are then bred to produce homozygous progeny that express human antibodies. Transgenic mice are immunized in a normal manner with a selected antigen (e.g., a polypeptide of the invention in whole or in part). For example, anti-mesothelin antibodies directed against human mesothelin antigen may be obtained from immunized transgenic mice using conventional hybridoma techniques. The human immunoglobulin transgene carried by the transgenic mice rearranges during B cell differentiation, followed by class switching and somatic mutation. Thus, using such techniques, therapeutically useful IgG, igA, igM, and IgE antibodies, including but not limited to IgG1 (γ 1) and IgG3, can be produced. For a summary of this technology for the production of human antibodies, see Lonberg and huskzar (int. Rev. Immunol., 13. For a detailed discussion of techniques for producing human antibodies and human monoclonal antibodies, and protocols for producing such antibodies, see, e.g., PCT publication Nos. WO 98/24893, WO 96/34096, and WO 96/33735; and U.S. Pat. nos.5,413,923;5,625,126;5,633,425;5,569,825;5,661,016;5,545,806;5,814,318; and 5,939,598, each of which is incorporated by reference herein in its entirety. In addition, abgenix, inc. (Freemont, calif.) and Genpharm (Jose, calif.) can provide human antibodies to selected antigens using methods similar to those described above. For a detailed discussion of transduction of human germline immunoglobulin gene arrays in germline mutant mice see, e.g., jakobovits et al, proc.natl.acad.sci.usa, 90; jakobovits et al, nature, 362; bruggermann et al, yeast in Immunol, 7 (1993); and Duchosal et al, nature, 355.

Human antibodies can also be obtained from phage display libraries (Hoogenboom et al, J.mol.biol.,227 (1991); marks et al, J.mol.biol., 222. Phage display technology (McCafferty et al, nature,348, 552-553 (1990)) can be used to produce human antibodies and antibody fragments in vitro from immunoglobulin variable (V) region gene banks of uninmmunized donors. According to this technique, antibody V region genes are cloned into the framework of major or minor coat protein genes of filamentous phages, such as M13 or fd, and displayed as functional antibody fragments on the surface of the phage particles. Since the filamentous particle contains copies of the single-stranded DNA of the phage genome, selection based on antibody functionality will also result in selection of genes encoding antibodies with these properties. Thus, the phage mimics certain properties of B cells. Phage display can be performed in a variety of formats; for a review of them see, for example, johnson and Chiswell, current Opinion in Structural Biology 3. Several sources of V gene fragments are available for phage display. A panel of different anti-oxazolone antibodies was isolated from a small random combinatorial library of V genes derived from the spleen of naive mice, clackson et al, nature, 352. V gene banks can be constructed from non-immunized human donors and antibodies to a variety of antigens, including autoantigens, can be isolated by the methods described in Marks et al, j.mol.biol., 222-597 (1991), or Griffith et al, EMBO j., 12. Reference may also be made to U.S. patent nos.5,565,332 and 5,573,905, each of which is incorporated by reference herein in its entirety.

Human antibodies can also be produced by in vitro activated B cells (see, U.S. patent nos.5,567,610 and 5,229,275, each of which is incorporated by reference herein in its entirety). Human antibodies can also be produced in vitro using hybridoma technology, such as, but not limited to, the technology described in Roder et al (Methods enzymol.,121, 1986).

Alternatively, in some embodiments, non-human antibodies are humanized, wherein specific sequences or regions of the antibody are modified to increase similarity to antibodies naturally occurring in humans. In some embodiments, the antigen binding domain portion is humanized.

Humanized antibody can be produced using various technologies known in the art, including but not limited to CDR transplantation (see, for example, European Patent No. EP 239400; international disclosure No. WO 91/09967; and U.S. Pat.Nos.5225539, 5530101, and 5585089, each of which is incorporated into the invention by reference) Veneering or resurfacing (see, for example, European Patent Nos. EP 592106 and EP 519596; Padlan, 1991, Molecular Immunology, 28 (4/5): 489-498; Studnicka et al.,1994,Protein Engineering,7(6):805-814； And Roguska et al., 1994, PNAS, 91:969-973, each of which is incorporated by reference into the present invention, chain restructuring (see, for example, U.S. Pat. No.5565332, each of which is incorporated by reference into the present invention), and for example, U.S. Pat Application Publication No. US2005/0042664, U.S. Pat Application Publication No. US2005/0048617, U.S. Pat. No.6407213, U.S. Pat. No.5766886, International Publication No.WO 9317105,Tan et al.,J.Immunol.,169:1119-25(2002),Caldas et al.,Protein Eng.,13(5):353-60(2000),Morea et al.,Methods,20(3):267-79(2000),Baca et al.,J.Biol.Chem.,272(16):10678-84(1997),Roguska et al.,Protein Eng.,9(10):895-904(1996),Couto et al.,Cancer Res.,55(23Supp):5973s-5977s(1995),Couto et al.,Cancer Res.,55(8):171722(1995),Sandhu J S,Gene,150(2):409-10(1994), Technology disclosed in Pedersen et al., J.Mol. Biol., 235 (3): 959-73 (1994). Each of which is incorporated by reference herein in its entirety. Typically, framework residues in the framework regions may be replaced by corresponding residues from a CDR donor antibody to alter, preferably improve, antigen binding. These framework substitutions are identified by methods well known in the art, for example, by mimicking the interaction of CDRs with framework residues to identify framework residues important for antigen binding and by sequence comparison to identify framework residues that are aberrant at particular positions. ( See, e.g., queen et al, u.s.pat. No.5,585,089; and Riechmann et al, 1988, nature,332, each of which is incorporated by reference herein in its entirety. )

Humanized antibodies have one or more amino acid residues introduced from a source that is not human. These non-human amino acid residues are often referred to as "import" residues, which are typically taken from an "import" variable region. Thus, a humanized antibody comprises one or more CDRs from a non-human immunoglobulin molecule and framework regions from a human. Humanization of antibodies is well known in the art and can be performed essentially according to the methods of Winter and co-workers (Jones et al, nature, 321. In such humanized chimeric antibodies, significantly less than the entire human variable domain is replaced by the corresponding sequence from a non-human species. In practice, humanized antibodies are typically human antibodies in which some CDR residues and possibly some FR residues are replaced by residues from analogous sites in rodent antibodies. Humanization of antibodies can also be achieved by veneering (tunneling) or resurfacing (EP 592,106.

In making humanized antibodies, human variable domains (including light and heavy chains) are selected to reduce antigenicity. According to the so-called "best-fit" method, the sequence of the variable domains of rodent antibodies is screened against the entire library of known human variable region sequences. The human sequence closest to the rodent sequence was then used as the human Framework (FR) for the humanized antibody (Sims et al, J.Immunol.,151 2296 (1993); chothia et al, J.mol.biol.,196 (1987), the contents of which are herein incorporated by reference in their entirety). Another approach uses a particular framework derived from the consensus sequence of all human antibodies for a particular subgroup of light or heavy chains. The same framework can be used for several different humanized antibodies (Carter et al, proc. Natl. Acad. Sci. USA, 89.

Antibodies can be humanized and retain high affinity for the antigen of interest and other favorable biological properties. For example, humanized antibodies can be prepared by analyzing the parent sequence and various conceptual humanized products using three-dimensional models of the parent sequence and the humanized sequence. Three-dimensional immunoglobulin models are generally available and familiar to those skilled in the art. The computer program may illustrate and display the possible three-dimensional conformational structures of the selected candidate immunoglobulin sequence. Examination of these displays allows analysis of the likely role of the residues in the function of the candidate immunoglobulin sequence, i.e., analysis of residues that affect the ability of the candidate immunoglobulin to bind its antigen. In this way, FR residues can be selected and combined from the acceptor and import sequences such that the desired antibody characteristics, such as enhanced affinity for the target antigen, are achieved. Generally, CDR residues are directly and most fundamentally involved in the effect on antigen binding.

"humanized antibodies retain similar antigen specificity as the original antibody, e.g., the ability to bind human mesothelin antigen. However, using certain humanization methods, "directed evolution" methods can be used to increase the affinity and/or specificity of an antibody for binding to a particular antigen, which are described in Wu et al, j.mol.biol.,294 (1999), the contents of which are hereby incorporated by reference in their entirety into the present invention.

5.8.2 genetically engineered immune Effector cells

In some embodiments, the invention provides genetically engineered immune effector cells comprising a polynucleotide encoding a disclosed mesothelin CAR or TCR. In some embodiments, the invention provides genetically engineered immune effector cells capable of recombinantly expressing the disclosed mesothelin CARs or TCRs. In some embodiments, the invention provides genetically engineered immune effector cells comprising a vector comprising a polynucleotide encoding a disclosed mesothelin CAR or TCR. In some embodiments, the immune effector cell is a T cell.

5.8.2.1 Gene engineering method

For the production of cells capable of recombinantly expressing the mesothelin CARs or TCRs disclosed herein, one or more polynucleotides encoding the mesothelin CARs or TCRs are introduced into a target cell using a suitable expression vector. Transferring one or more polynucleotides encoding a mesothelin CAR or TCR to a target immune effector cell (e.g., a T cell). The genetically engineered cells may also express the anti-mesothelin antibodies or antigen binding fragments disclosed herein.

In some embodiments, the invention provides methods for genetically engineering immune effector cells by transferring polynucleotides provided by the invention to immune effector cells using a non-viral delivery system. The polynucleotide encoding the mesothelin CAR or TCR may be an mRNA, which allows for transient expression and self-elimination of immune effector cells expressing such mesothelin CARs or TCRs. Physical methods for introducing polynucleotides into host cells include calcium phosphate precipitation, lipofection, particle bombardment, microinjection, electroporation, and the like. In some embodiments, RNA electroporation (Van Driessche et al, folia histochemica et cytobiologica 43. The method may further comprise preparing mRNA by in vitro transcription of the polynucleotide of the invention. In some embodiments, the invention provides methods of genetically engineering immune effector cells into which polynucleotides encoding anti-mesothelin antibodies or antigen binding fragments provided by the invention are transferred using electroporation. In some embodiments, the invention provides methods of genetically engineering immune effector cells by transferring a polynucleotide encoding a mesothelin CAR or TCR provided herein into the cells using electroporation.

In some embodiments, DNA transfection and transposons may be used. In some embodiments, a Sleeping Beauty system or a PiggyBac system is used (e.g., ivics et al, cell,91 (4): 501-510 (1997);

et al (2007) Nucleic Acids research.35 (12): e 87). Chemical methods for introducing polynucleotides into host cells include colloidally dispersed systems such as macromolecular complexes, nanocapsules, microspheres, microbeads, and lipid systems, including oil-in-water emulsions, micelles, mixed micelles, and liposomes. Exemplary colloidal systems for use as delivery vehicles in vitro and in vivo are liposomes (e.g., artificial membrane vesicles).

For example, a polynucleotide encoding a mesothelin CAR or TCR disclosed herein may be cloned into a suitable vector and introduced into a target cell using well-known Molecular Biology techniques (see Ausubel et al, current Protocols in Molecular Biology, john Wiley and Sons, baltimore, MD (1999)). Any vector suitable for expression in cells, particularly human cells, may be used. The vector contains suitable expression elements, such as a promoter, that provide for expression of the encoding nucleic acid in the target cell.

The use of retroviral vectors for expression in T cells or other immune effector cells, including engineered T cells, has been described (see Scholler et al, sci.trans.med.4: 132-153 (2012 parete-Pereira et al, j.biol.methods 1 (2): e7 (1-9) (2014); larmers et al, blood 117 (1): 72-82 (2011); reviere et al, proc.natl.acad.sci.usa 92 In one embodiment, the vector is a gamma retroviral vector. In one embodiment, the vector is an SGF retroviral vector, such as an SGF γ -retroviral vector, which is a Moloney murine leukemia-based retroviral vector. SGF vectors have been described previously (see, e.g., wang et al, gene Therapy 15. In the case of retroviral vectors, cells can be selectively activated to increase transduction efficiency (see ParentePereira et al, J.biol. Methods 1 (2) e7 (doi 10.14440/jbm.2014.30) (2014); movasssagh et al, hum. Gene Ther.11:1189-1200 (2000); rettig et al, mol. Ther.8:29-41 (2003); agarwal et al, J.Virol.72:3720-3728 (1998); pollok et al, hum. Gene Ther.10:2221-2236 (1998); quinn et al, hum. Gene Ther.9:1457-1467 (1998); and also commercially available methods such as Dynabeads ^TM Human T cell activator product, thermo Fisher Scientific, waltham, mass.). It will be appreciated that any suitable viral vector or non-viral delivery system may be used. Combinations of retroviral vectors and appropriate packaging cell lines are also suitable, where the capsid protein will act to infect human cells. Various cell lines producing pleiotropic virus (amphotropic virus) are known, including but not limited to PA12 (Miller et al, mol.cell.biol.5:431-437 (1985)); PA317 (Miller et al, mol.cell.biol.6:2895-2902 (1986)); and CRIP (Danos et al, proc.natl.acad.sci.usa 85. Non-facultative particles are also suitable, for example, with VSVG, RD114 or GALV envelopes and any other pseudotype particles known in the art (Relander et al, mol. Therap.11:452-459 (2005)). Possible transduction methods also include co-culturing the cells directly with producer cells (e.g., bregni et al, blood 80, 1418-1422 (1992)) or culturing with virus supernatant or concentrated vector stock alone (with or without appropriate growth factors or polycations) (see, e.g., xu et al, exp. Hemat.22:223-230 (1994); hughes, et al. J. Clin. Invest.89:1817-1824 (1992)).

Other viral vectors that may be used include, for example, adenovirus, lentivirus and adeno-associated virus vectors, vaccinia virus, bovine papilloma virus derived vectors or herpes viruses such as Epstein-Barr virus (see, for example, miller, hum. Gene Ther.1 (1): 5-14 (1990); friedman, science 244. Retroviral vectors are well developed and have been used clinically (Rosenberg et al, N.Engl. J.Med.323:370 (1990); anderson et al, U.S. Pat.No.5,399, 346). In general, the vectors of choice exhibit high infection efficiency as well as stable integration and expression (see, e.g., cayoutte et al, human Gene Therapy 8 (423-430); kido et al, current Eye Research 15.

The vectors used in the present invention are expressed in a particular host cell using a suitable promoter. The promoter may be an inducible promoter or a constitutive promoter. In some embodiments, the promoter of the expression vector provides expression in a stem cell (e.g., hematopoietic stem cell). In some embodiments, the promoter of the expression vector provides expression in immune effector cells (e.g., T cells). Non-viral vectors may also be used, so long as the vector contains expression elements suitable for expression in the target cell. Some vectors, such as retroviral vectors, can integrate into the host genome.

In some embodiments, the invention provides methods for genetically engineering immune effector cells by transferring polynucleotides provided by the invention into immune effector cells using gene editing. If desired, site-directed integration can be achieved using techniques such as nucleases, transcription activator-like effector nucleases (TALENs), zinc Finger Nucleases (ZFNs), regularly clustered spaced short palindromic repeats (CRISPRs), homologous recombination, non-homologous end joining, microhomology-mediated end joining, homology-mediated end joining, and the like (Gersbach et al, nucl. Acids Res.39:7868-7878 (2011); vasileva, et al. Cell Death Dis.6: 183e 20151 (Jul 23); sonthimer, hum. Gene Ther.26 (7): 413-424 (2015); yao. Cell Research volume 27,801-814 (2017)). In some embodiments, the methods provided herein use a ZFN system. Zinc finger nucleases consist of a DNA recognition domain and a non-specific endonuclease. The DNA recognition domain consists of a series of Cys2-His2 zinc finger proteins in tandem, each zinc finger unit comprising about 30 amino acids for specific binding to DNA. The non-specific endonuclease is a FokI endonuclease, which forms dimers to cleave DNA. In some embodiments, the methods provided herein use TALEN systems. TALENs are a transcription activator-like effector nuclease. The TALE proteins are core components of the DNA binding domain and are typically composed of multiple basic repeat units in tandem. The series of units designed and combined can specifically recognize DNA sequences and cut specific DNA sequences by coupling with FokI endonuclease.

In some embodiments, the methods provided herein use CRISPR-Cas systems. The CRISPR-Cas system may be a CRISPR-Cas9 system. The CRISPR/Cas system is a nuclease system, consisting of regularly clustered short palindromic repeats (CRISPR) and CRISPR-binding proteins (i.e., cas proteins), which can cleave almost all genomic sequences adjacent to Protospacer Adjacent Motifs (PAMs) in eukaryotic cells (Cong et al. Science 2013.339. The "CRISPR/Cas system" is used to collectively refer to the transcript of a CRISPR-associated ("Cas") gene, as well as to other elements that relate to its expression or direct its activity, including sequences encoding the Cas gene, tracr (trans-activated CRISPR) sequences (e.g., tracrRNA or active portions of tracrRNA), tracr mate sequences (in the context of endogenous CRISPR systems, covering "direct repeats" and processed portions of direct repeats), guide sequences, or other sequences from CRISPR sites and transcripts. In general, CRISPR systems are characterized by elements (also referred to as pre-spacers in endogenous CRISPR systems) that promote the formation of CRISPR complexes at sites of the target sequence. In general, CRISPR systems are characterized by elements (also referred to as pre-spacers in endogenous CRISPR systems) that promote the formation of CRISPR complexes at sites of the target sequence. Non-limiting examples of Cas proteins include Cas1, cas1B, cas2, cas3, cas4, cas5, cas6, cas7, cas8, cas9 (also known as Csn1 and Csx 12), cas10, csy1, csy2, csy3, cse1, cse2, csc1, csc2, csa5, csn2, csm3, csm4, csm5, csm6, cmr1, cmr3, cmr4, cmr5, cmr6, csb1, csb2, csb3, csx17, csx14, csx10, csx16, csaX, csx3, csx1, csx15, csf1, csf2, csf3, csf4 homologs, or modified forms thereof. In some embodiments, the Cas protein is a Cas9 protein (gasitunas, barrangouu et al.2012; jinek, chrysnski et al.2012; deltcheva, chrysnski et al.2011; makarova, grishin et al (2006)). The amino acid sequence of Cas9 proteins is known in the art. Example sequences can be found, for example, under the SwissProt database, accession number Q99ZW2, under the UniProt database, accession numbers A1IQ68, Q03LF7, or J7RUA5.

Vectors and constructs can optionally be designed to include a reporter. For example, the vector can be designed to express a reporter protein that can be used to identify a cell that contains the vector or a polynucleotide provided on the vector (e.g., a polynucleotide that has integrated into the host chromosome). In one embodiment, the reporter may be expressed with an anti-mesothelin antibody or antigen binding fragment, or, mesothelin CAR or TCR as a bicistronic or polycistronic expression construct. Exemplary reporter proteins include, but are not limited to, fluorescent proteins such as mCherry, green Fluorescent Protein (GFP), blue fluorescent proteins (e.g., EBFP2, azurite, and mKalama 1), cyan fluorescent proteins (e.g., ECFP, cerulean, and CyPet), and yellow fluorescent proteins (e.g., YFP, citrine, venus, and YPet).

Transduction efficiency can be determined experimentally using conventional molecular biology techniques. If a marker (e.g., a fluorescent protein) is included in the construct, gene transfer efficiency can be monitored by FACS analysis to quantify the proportion of transduced (e.g., GFP +) immune effector cells (e.g., T cells), and/or by quantitative PCR. Using a mature co-culture system (Gade et al., cancer Res.65:9080-9088 (2005); gong et al., neoplasia 1. The effect of CD80 and/or 4-1BBL on T cell survival, proliferation and efficacy can be assessed. T cells can be exposed to repeated stimulation of cancer antigen-positive target cells and it can be determined whether T cell proliferation and cytokine response remain similar or diminish with repeated stimulation. Cancer antigen CAR constructs can be compared side-by-side under equivalent experimental conditions. Various E's can be performed using the chromium release test: cytotoxicity test of T ratio.

Combinations and permutations of the various methods described herein or otherwise known in the art are expressly contemplated to produce the genetically engineered cells disclosed herein.

5.8.2.2 manipulation of immune Effector cells

The immune effector cells provided by the invention can be obtained from a subject. Sources of immune effector cells provided by the present invention include, but are not limited to, hematopoietic cells from peripheral blood, cord blood, bone marrow, or other sources. Immune effector cells (e.g., T cells) can be obtained from a number of sources, including peripheral blood mononuclear cells, bone marrow, lymph node tissue, umbilical cord blood, thymus tissue, tissue at the site of infection, ascites, pleural effusion, spleen tissue, and tumors. In certain embodiments, cell lines available in the art may be used. The immune effector cells provided herein can be isolated by methods well known in the art, including commercially available isolation methods (see, e.g., rowland Jones et al, LYMPHOCYTES: A PRACTICAL APPROACH, oxford University Press, new York (1999)). Various methods for isolating immune effector cells have been previously described and may be used including, but not limited to, the use of peripheral donor lymphocytes (Sadelain et al, nat. Rev. Cancer 3 (2003); morgan et al, science 314.

In certain embodiments, the immune effector cells (e.g., T cells) disclosed herein can use any technique known to those of skill in the art (e.g., ficoll) ^TM Isolated) from a blood unit collected from a subject. In some embodiments, the cells from the circulating blood of the individual are obtained by apheresis. The apheresis product typically contains lymphocytes, including T cells, monocytes, granulocytes, B cells, other nucleated leukocytes, erythrocytes, and platelets. In some embodiments, cells collected by apheresis may be washed to remove the plasma fraction and the cells placed in an appropriate buffer or medium for subsequent processing steps. In some embodiments, the cells are washed with Phosphate Buffered Saline (PBS). In another embodiment, the wash solution is devoid of calcium, and may be devoid of magnesium, or may be devoid of many (if not all) divalent cations. In the absence of calcium, the initial activation step results in amplified activation. As will be readily appreciated by those of ordinary skill in the art, the washing step may be accomplished by methods known to those of skill in the art, such as using a semi-automatic "flow-through" centrifuge (e.g., cobe 2991 cell processor, baxter CytoMate, or autologous blood salvage machine 5) according to the manufacturer's instructions. After washing, the cells can be resuspended in various biocompatible buffers, e.g., ca-free ²⁺ Free of Mg ²⁺ PBS, bokali a (PlasmaLyte a) or other physiological saline solution with or without buffer. Alternatively, undesired components of the apheresis sample may be removed and the cells resuspended directly in culture.

In another embodiment, by lysing erythrocytes and depleting monocytes (e.g., by Percoll) ^TM Gradient centrifugation or countercurrent centrifugation elution) from outsideT cells were isolated from peripheral blood lymphocytes. A specific subset of T cells, e.g. CD3 ⁺ ,CD28 ⁺ ,CD4 ⁺ ,CD8 ⁺ ，CD45RA ⁺ And CD45RO ⁺ T cells, which may be further isolated by positive or negative selection techniques. For example, in one embodiment, the microbeads are coupled (e.g., by conjugation to anti-CD 3/anti-CD 28 (i.e., 3X 28)

M-450CD3/CD 28T) for a sufficient period of time for positive selection of the desired T cells. In one embodiment, the period of time is about 30 minutes. In another embodiment, the period of time ranges from 30 minutes to 36 hours or more, and all integer values included therebetween. In another embodiment, the period of time is at least 1, 2, 3, 4, 5, or 6 hours. In yet another preferred embodiment, the period of time is from 10 to 24 hours. In a preferred embodiment, the incubation period is 24 hours. For T cell isolation in leukemia patients, cell yield can be increased using longer incubation times (e.g., 24 hours). In any case where there are fewer T cells than other cell types, longer incubation times can be used to isolate T cells, such as Tumor Infiltrating Lymphocytes (TILs) from tumor tissue or immunocompromised individuals. Furthermore, the efficiency of capturing CD8+ T cells can be improved using longer incubation times. Thus, by simply shortening or extending the time for T cells to bind to CD3/CD28 microbeads and/or by increasing or decreasing the ratio of microbeads to T cells (as further described herein), T cell subsets can be preferentially selected or depleted at the beginning of the culture or at other time points in the process. In addition, by increasing or decreasing the proportion of anti-CD 3 and/or anti-CD 28 antibodies on the beads or other surfaces, T cell subsets can be preferentially selected or depleted at the start of the culture or at other desired time points. Those skilled in the art will recognize that multiple rounds of selection may also be used in the context of the present invention.

Various techniques can be employed to isolate cells to enrich for desired immune effector cells. For example, negative selection methods can be used to removeCells that are not desired immune effector cells. In addition, positive selection methods may be used to isolate or enrich for desired immune effector cells or their precursors, or a combination of positive and negative selection methods may be used. Monoclonal antibodies (MAbs) are particularly useful for identifying markers associated with specific cell lineages and/or differentiation stages associated with both positive and negative selections. If a particular type of CELL is to be isolated, for example a particular type of T CELL, various CELL surface markers or combinations of markers can be used to isolate the CELL, including but not limited to CD3, CD4, CD8, CD34 (for hematopoietic stem/progenitor CELLs), etc., as is well known in the art (see, kearse, T CELL PROTOCOLS: DEVELOPMENT AND ACTIVATION, humana Press, totowa NJ (2000); de Libero, T CELL PROTOCOLS, vol.514 of Methods in Molecular Biology, humana Press, totowa NJ (2009)). In some embodiments, enrichment of the T cell population by negative selection can be accomplished with antibody binding to a surface marker specific to the negatively selected cells. One approach is cell sorting and/or selection by negative magnetic immunoadhesion or flow cytometry using a mixture of monoclonal antibodies directed against cell surface markers present on the negatively selected cells. For example, to enrich for CD4 by negative selection ⁺ The cell, monoclonal antibody mixture usually includes CD14, CD20, CD11b, CD16, HLA-DR and CD8 antibody. In certain embodiments, it may be desirable to enrich for or positively select regulatory T cells, which typically express CD4 ⁺ ，CD25 ⁺ ，CD62L ^hi ，GITR ⁺ And FoxP3 ⁺ . Alternatively, in certain embodiments, T regulatory cells are eliminated by anti-C25 conjugated microbeads or other similar selection methods.

Isolation procedures for immune effector cells include, but are not limited to, density gradient centrifugation, coupling of particles that modify cell density, magnetic separation with antibody-coated magnetic beads, affinity chromatography; cytotoxic agents used in conjunction or conjugation with monoclonal antibodies (mabs) include, but are not limited to, complement AND cytotoxins, as well as antibody panning, such as plates or chips, attached to a solid substrate, elution, flow cytometry, or any other convenient technique (see, e.g., recktenwald et al, CELL SEPARATION METHODS AND APPLICATIONS, marcel Dekker, inc., new York (1998)). It will be appreciated that the immune effector cells used in the methods provided herein may be substantially pure cells or may be a polyclonal population. In some embodiments, the polyclonal population can be enriched for the desired immune effector cells. This enrichment can be performed before or after the cells are genetically engineered to express the mesothelin CARs or TCRs provided by the present invention, as desired.

The immune effector cells may be autologous or non-autologous to the subject to whom they are administered in accordance with the disclosed methods of treatment. Autologous cells are isolated from the subject to which the engineered cells are administered. Optionally, the cells may be obtained by leukapheresis, wherein the leukapheresis is selectively removed from the extracted blood, made into recombinants, and then infused into the donor. Alternatively, allogeneic cells from non-autologous donors of non-subjects may be used. In the case of non-autologous donors, the cells are typed and matched with Human Leukocyte Antigens (HLA) to determine the appropriate level of compatibility, as is well known in the art. Cells may optionally be cryopreserved after isolation and/or genetic engineering and/or cell expansion following genetic engineering (see Kaiser et al, supra, 2015)). Methods for cryopreserving CELLS are well known in the art (see, e.g., freshney, CURURE OF ANIMAL CELLS: A MANUAL OF BASIC TECHNIQUES,4th ed., wiley-Liss, new York (2000); harrison and Rae, GENERAL TECHNIQUEQUES OF CELL CULTURE, cambridge University Press (1997)).

In some embodiments, the isolated immune effector cell is genetically engineered in vitro for recombinant expression of a polypeptide (e.g., a CAR or a TCR). In some embodiments, the isolated immune effector cell is genetically engineered in vitro for recombinant expression of a mesothelin CAR or TCR. In some embodiments, the immune effector cells provided herein are obtained by in vitro priming (sensitization), wherein the priming reaction can occur before or after the immune effector cells are genetically engineered to recombinantly express the disclosed polypeptides. In one embodiment, the primed immune effector cells (e.g., T cells) are isolated from an in vivo source and it will be self-evident that the primed immune effector cells will be genetically engineered.

It is also contemplated in the present invention that a blood sample or apheresis product is collected from a subject for a period of time before the genetically engineered cells according to the present invention may be needed. Thus, the source of cells to be expanded can be collected at any necessary point in time, and the desired cells (e.g., T cells) isolated and frozen for later use in T cell therapy for any number of diseases or disorders that would benefit from T cell therapy, such as those described herein. In one embodiment, a blood sample or aliquot is taken from a generally healthy subject. In certain embodiments, a blood sample or single is taken from a generally healthy subject at risk of developing the disease but who has not yet developed the disease, and the desired cells are isolated and frozen for later use. In certain embodiments, the T cells may be expanded, frozen, and used at a later time. In certain embodiments, a sample is collected from a patient shortly after diagnosis of a particular disease as described herein, but prior to any treatment. In another embodiment, cells are isolated from a blood sample or a single sample from a subject prior to any number of related treatment modalities, including, but not limited to, medication (e.g., natalizumab, efletuzumab, antiviral agents), chemotherapy, radiation therapy, immunosuppressive agents (e.g., cyclosporine, azathioprine, methotrexate, mycophenolic acid, and FK 506), antibodies or other immunosuppressive agents (e.g., CAMPATH, anti-CD 3 antibodies, cyclophosphamide, fludarabine, cyclosporine, FK506, rapamycin, mycophenolic acid, steroids, FR 901228), and irradiation. These drugs inhibit the calcium-dependent phosphatases calcineurin (cyclosporine and FK 506) or inhibit the p70S6 kinase (rapamycin) important for growth factor-induced signaling (Liu et al, cell 66 807-815,1991, henderson et al, immun 73. In further embodiments, the cells are isolated and frozen for subsequent use in conjunction with bone marrow transplantation or stem cell transplantation (e.g., prior to, concurrent with, or after transplantation), T cell ablation therapy with a chemotherapeutic agent (e.g., fludarabine), external electron beam radiation therapy (XRT), cyclophosphamide, or an antibody (e.g., OKT3 or CAMPATH). In another embodiment, the cells are isolated prior to B-cell ablation therapy and can be frozen for later use in later therapy, such as drugs that react with CD20 (e.g., rituxan).

In further embodiments, the T cells are obtained directly from the patient after treatment. In this respect, it has been observed that after certain cancer treatments, in particular treatments with drugs that damage the immune system, during a period of time shortly after the treatment, the patient is usually recovered from the treatment and the quality of the T cells obtained can be optimized or improved due to their capacity to expand in vitro. Likewise, these cells can be in a preferred state for enhanced transplantation and in vivo expansion following in vitro manipulation using the methods described herein. Therefore, it is contemplated that blood cells, including T cells, NK cells, or other immune effector cells of the hematopoietic lineage, are collected at this stage of recovery. Furthermore, in certain embodiments, mobilization (e.g., mobilization with GM-CSF) and pretreatment regimens can be used to create conditions in a subject that favor the re-proliferation, recycling, regeneration, and/or expansion of a particular cell type, particularly during a defined time window following treatment. Exemplary cell types include T cells, B cells, dendritic cells, and other cells of the immune system.

The immune effector cells disclosed herein may be subjected to conditions known in the art to facilitate cell maintenance or expansion. (De Libero, T Cell Protocols, vol.514 of Methods in Molecular Biology, humana Press, totowa NJ (2009); parente-Pereira et al, J.Biol.Methods 1 (2) e7 (doi 10.14440/jbm.2014.30) (2014); movasssag et al, hum.Gene Ther.11:11891200 (2000); rettig et al, mol.Ther.8:29-41 (2003); agarwal et al, J.Virol.72:3720-3728 (1998); pollok et al, hum.Gene Ther.10:2221-2236 (1999); quinn Huinn et al, hum.Gene. Therr.9: 7-Ther (1998); see also commercially available Methods such as Wanals et al, hurmman T Cell 1451-2236 (1998); fisher et al). Immune effector cells (e.g., T cells) disclosed herein can optionally be expanded prior to or after in vitro genetic engineering. Expansion of cells is particularly useful for increasing the number of cells in a subject for administration. Such methods for cell expansion are well known in the art (see, e.g., kaiser et al, cancer Gene Therapy 22 (2015); wolfl et al, nat. Protocols 9. In addition, the cells may optionally be cryopreserved after isolation and/or genetic engineering and/or expansion of the genetically engineered cells (see Kaiser et al, supra, 2015)). Methods for cryopreserving CELLS are well known in the art (see, e.g., freshney, CULTURE OF ANIMAL CELLS: A MANUAL OF BASIC TECHNIQUES,4th ed., wiley-Liss, new York (2000); harrison and Rae, GENERAL TECHNIQUES OF CELL CULTURE, cambridge University Press (1997)).

In general, the T cells provided herein can be expanded by contacting the T cells with a surface having attached thereto an agent that stimulates a signal associated with the CD3/TCR complex and a ligand that stimulates a co-stimulatory receptor on the surface of the T cell. In particular, the population of T cells may be stimulated as described herein, for example by contact with an anti-CD 3 antibody or antigen-binding fragment thereof, or an anti-CD 2 antibody immobilized on a surface, or by contact with a protein kinase C activator (e.g. bryostatin) that binds to a calcium ionophore. To co-stimulate accessory molecules on the surface of T cells, ligands that bind the accessory molecules are used. For example, a population of T cells can be contacted with an anti-CD 3 antibody and an anti-CD 28 antibody under conditions suitable to stimulate T cell proliferation. To stimulate proliferation of CD4+ T cells or CD8+ T cells, anti-CD 3 antibodies and anti-CD 28 antibodies. Examples of anti-CD 28 antibodies include 9.3, B-T3, XR-CD28 (Diaclone, besancon, france), other methods common in the art may also be used (Berg et al, transplant Proc.30 (8): 3939397777, 1998, haanen et al, J.Exp.Med.190 (9): 131328, 1999 Garland et al, J.Immunol meth.227 (1-2): 53-63, 1999).

The present invention has been described herein in language specific to numerous embodiments. The invention also specifically includes embodiments that wholly or partially exclude a particular subject matter, such as a substance or material, method steps and conditions, protocols, procedures, assays, or assays. Thus, even if the present invention is not generally expressed in a content that is not included in the present invention, aspects that are not explicitly included in the present invention are still disclosed in the present invention.

Specific embodiments of this invention are described herein, including the best mode known to the inventors for carrying out the invention. Variations of the disclosed embodiments may become apparent to those of ordinary skill in the art upon reading the foregoing description, and it is contemplated that such variations may be suitably employed by those skilled in the art. Accordingly, this invention is intended to be practiced otherwise than as specifically described, and this invention includes all modifications and equivalents of the subject matter recited in the claims appended hereto as permitted by applicable law. Moreover, any combination of the above-described elements in all possible variations thereof is encompassed by the invention unless otherwise indicated herein or otherwise clearly contradicted by context.

All publications, patent applications, accession numbers and other references cited in this specification are herein incorporated in their entirety by reference into the specification, to the same extent as if each individual publication or patent application was specifically and individually indicated to be incorporated herein by reference. The publications discussed herein are provided solely for their disclosure prior to the filing date of the present application. Citation or identification of any reference in the description of some embodiments of the invention shall not be construed as an admission that such reference is available as prior art to the present invention. Further, the dates of publication provided may be different from the actual publication dates which may need to be independently confirmed.

Various embodiments of the present invention have been described. Nevertheless, it will be understood that various modifications may be made without departing from the spirit and scope of the invention. Accordingly, the description in the experiments is intended to illustrate but not limit the scope of the invention described in the claims.

5.9 experiment

As detailed below, 38 anti-mesothelin scfvs were produced and characterized. T cells expressing CARs comprising these mesothelin scfvs were also produced and characterized. The cytotoxicity of these mesothelin CART on cancer cells, including mesothelin-expressing cancer cells, was demonstrated.

5.9.1 examples1: preparation of anti-mesothelin antibodies

Anti-mesothelin antibodies were prepared using a fully human antibody phage display library according to the following procedure:

(1) Expression and purification of phage display libraries: the log phase TG1 library cultures were infected with freshly thawed M13K07 helper phage with a multiple infection rate of 20 (phage to cell ratio) and induced overnight with IPTG; the phage library was purified by PEG/NaCl precipitation and then the phage titer was determined. Phage were stored at 4 ℃ and later scFv selected.

(2) Selection of mesothelin-specific scFv-phages: in the first round of selection, 20. Mu.g/ml mesothelin-6 His protein dissolved in 1 XPBS was coated on Maxisorp plates and incubated overnight at 4 ℃. (in subsequent rounds of selection, lower protein concentrations were used for more stringent selection, including 2. Mu.g/ml in the second round of bioscreening, 0.5. Mu.g/ml in the third round of bioscreening.) after washing the plates three times with PBS, blocking buffer (5% milk and 1%BSA in 1 XPBS) was added to each well. After incubation for 2 hours at room temperature, the blocking buffer was discarded, the phage solution was added, the plate was sealed with a preservative film, and incubated for 2 hours with gentle shaking. In the first round of selection, the plate was then washed 10 times with PBST. (in the next few rounds, the stringency of the washes was increased by adding more wash cycles: the second 20 wash cycles, the third 30 wash cycles). The antigen-binding scFv-phages were then eluted using 1mL of acid wash-off buffer (pH 2.2), neutralized, inoculated into 15mL of log-phase TG1 culture (OD 600= 0.5), incubated at 37 ℃ for 30min and shaking for 30min, inoculated on 2xYT-GA agar plates, and incubated overnight at 30 ℃ for subsequent selection.

(3) mpELISA screening: after three rounds of screening, 288 positive clones were selected for monoclonal phage ELISA (mpasa) screening. Phage supernatants were generated from single colony clones and tested for binding to mesothelin-Fc protein. The supernatant and coated with 2 u g/ml mesothelin-6 His protein pre-closed Maxisorp plate with incubation. After three washes, 100. Mu.l are addedWell HRP-conjugated anti-M13 antibody, which was conjugated to an anti-M13 antibody in a blocking buffer (1 × PBS containing 5% milk and 1% bsa) in 1:5000 dilution, and then incubation at room temperature for 60min. After washing the plates 5 times with PBST, 100. Mu.l/well of TMB matrix solution was added and incubated for 10-30 minutes until a blue color appeared. By adding 50. Mu.l/well of stop solution (2 NH) ₂ SO ₄ ) The reaction was stopped. The absorbance was read at 450nm in a microplate reader. Figure 1 shows the resulting absorbance readings for the mpELISA screen. As shown, positive colonies (absorbance at 450 nm. Gtoreq.0.5) were identified to produce anti-mesothelin antibodies capable of binding mesothelin-6 His protein (FIG. 1).

(4) Cloning and sequence analysis: positive clones were selected based on the ELISA results and used as PCR cloning templates for scFv sequences (forward primer sequence: tgcagctggcacgacaggttttc, reverse primer sequence: cgtcagactgtagcacgtt). The PCR product was then sequenced by sanger sequencing (forward primer sequence: aacaattgaattcaggga, reverse primer sequence: cctctctaagaagcgtgagtc). CDR regions of the scFv were analyzed by the abysis website (http:// abysis. Org /), see tables 1 and 2 above.

5.9.2 example 2: preparation of mesothelin CAR

Vectors were constructed for the production of anti-mesothelin CAR mRNA. The pDA vector was first digested with Xba1 and Sal1 enzymes and purified by gel purification. The scFv fragment and CAR fragment (CD 8 hinge, CD8 transmembrane domain, 4-1BB costimulatory domain, CD3-zeta signaling domain) were amplified by PCR and purified by gel purification. The scFv fragment, CAR fragment (from hinge domain to CD3-zeta domain) and pDA vector were ligated by Gibson assembly method and transformed into competent cells. Colonies with the correct construct were identified by Sanger sequencing and selected for further experiments. Figure 2 provides a schematic diagram of a pDA-CAR vector for producing CAR mRNA.

The pDA-CAR plasmid was then linearized by digestion with Spe 1. The linearized vector was purified using the PCR clean kit and eluted with ribonuclease-free water. The concentration of DNA was determined by nanodrop and checked by agarose DNA gel.In Vitro Transcription (IVT) was then carried out according to the protocol of the manufacturer (Thermofoisher, cat. No.: AM 13455). Briefly, 1. Mu.g template DNA, NTP/ARCA buffer, T7 buffer, GTP, T7 enzyme and RNase-free H ₂ A20. Mu.l aliquot of O was added to a 0.2ml PCR tube and incubated at 37 ℃ for 3 hours. After 3 hours, 2. Mu.l DNase was added to each reaction and incubated at 37 ℃ for 15min. The final step was performed according to the manufacturer's recommendations. IVT mRNA was purified using the RNase kit (Qiagen), RNA concentration was determined by nanodrop and checked by PAGE gels.

5.9.3 example 3: tumor cell lines and human primary lymphocytes

Culturing tumor cell lines comprising A549-CBG (human lung cancer (cancer) cells), H226-CBG (human lung cancer (malignant epithelial tumor) cells), MOLM14-CBG (human leukemia cells), ASPC1-CBG (human pancreatic tumor cells), HCC70-CBG (human breast cancer cells) and OVCAR3-CBG (human ovarian cancer cells) in RPMI-1640 medium supplemented with 10% FCS. Primary lymphocytes from normal donors were stimulated with anti-CD 3/CD28 immunomagnetic beads (Life Technologies) and cultured in R10 medium (RPMI-1640 supplemented with 10% FCS, penicillin-streptomycin (100X), HEPES (100X), sodium pyruvate (100X), glutamax (100X), NEAA (100X)). On day 10 post-stimulation, T cells were plated at 1X 10 ⁸ Individual cells/flasks are cryopreserved in a solution of 90% FCS and 10% DMSO.

5.9.4 example 4: preparation and characterization of mesothelin CART

Mesothelin CAR mRNA was introduced into a549 tumor cells and T cells by electroporation, as follows: a549 tumor cells and T cells were collected and washed 3 times with Opti-MEM medium. The cell pellet was resuspended in Opti-MEM medium and the cell concentration was adjusted to 1 × 10e 7/ml. An equal amount of 10. Mu.g of RNA was dispensed into 1.5mL EP tubes, and 100. Mu.l of T cells or A549 cells were added and mixed well. 100 μ l of cells mixed with RNA were added to a BTX electroporation cuvette and tapped to avoid air bubbles. Electroporation was performed using a BTX instrument under the following parameters: for T cells: 500V voltage, 0.7ms; for a549 tumor cells: 300V voltage, 0.5ms. The cells were then transferred to pre-warmed medium and cultured at 37 ℃.

Binding of mesothelin CART cells to mesothelin-Fc recombinant protein was determined by FACS staining. As shown in FIG. 3, anti-mesothelin scFv-M1, -M2, -M3, -M6, -M7, -M8, -M9, -M10, -M11, -M12, -M13, -M14, -M15, -M16, -M17, -M20, -M22, -M23, -M24, -M25, -M27, -M28, -M29, -M30, -M31, -M32, -M33, -M34, -M35, -M36, and-M37 bind to the mesothelin-Fc recombinant protein. T cells without CAR molecules served as controls ("Mock"). As shown in fig. 4, ectopic expression levels of mesothelin correlated with the amount of mesothelin mRNA introduced into a549 cells by electroporation.

The cytotoxicity of mesothelin CART cells on tumor cells was determined in an in vitro cytotoxicity assay. EGFP-expressing tumor cell lines or EGFP-A549 cells electroporated with varying amounts of tumor antigen were seeded at 3000 cells/100. Mu.l/well in flat-bottomed 96-well plates. CART cells were diluted to appropriate concentrations, seeded at 100 μ l/well, and co-cultured plates at different E/T ratios with tumor cells, e.g., 10. After 3 days of scanning, the green image was analyzed for total integrated intensity (GCU x μm) ² Per well), killing efficiency was calculated.

A549 cells express mesothelin at low levels. As shown in fig. 5, CART cells expressing anti-mesothelin scFv-M4, -M22, -M28 and-M31 effectively blocked the growth of a549 cells, indicating that these scFv-based CART cells are quite cytotoxic to tumor cells. As shown in FIG. 6, CART cells expressing anti-mesothelin scFv-M4, -M6, -M7, -M8, -M9, -M10, -M11, -M12, -M13, -M15, -M20, -M22, -M23, -M24, -M27, -M28, -M31, -M32, -M35, -M37 and-M38 CAR showed potent killing of mesothelin-overexpressing A549 tumor cells (electroporated with 10 μ g mesothelin mRNA). As shown in figure 7, CART cells expressing anti-mesothelin scFv-M4, -M6, -M13, -M20, -M27, -M31 and-M37 CARs maintained strong killing of a549 tumor cells with less ectopic expression of mesothelin (electroporated with 2 μ g mesothelin mRNA). CART cells expressing anti-mesothelin scFv-M7, -M8, -M9, -M10, -M11, -M12, -M15, -M23, -M24, -M32, -M35 and-M38 selectively show high cytotoxicity only to tumor cells that highly express mesothelin, not to tumor cells that lowly express mesothelin, but have superior safety because mesothelin is also expressed in some normal tissues.

Fig. 8 shows killing curves for different mRNA-based anti-mesothelin CART cells, with a549-GFP tumor cells electroporated with 0 (upper panel), 2 μ g (middle panel), or 10 μ g (lower panel) mesothelin mRNA as target cells (E/T ratio = 10. As shown in the figure, anti-mesothelin scFv-M12, -M24 and-M32 CART cells have mild killing effect on A549 tumor cells (2 mu g group) with low mesothelin expression, but have stronger killing effect on A549 tumor cells (10 mu g group) with high mesothelin expression. The results indicate that these CART cells will specifically target mesothelin-highly expressing tumor cells and will not kill mesothelin-lowly expressing normal tissues.

Figure 9 shows FACS staining of OVCAR3 (human ovarian cancer cells), H226 (human lung cancer (malignant epithelial tumor) cells), ASPC1 (human pancreatic tumor cells), a549 (human lung cancer (cancer) cells), and HCC70 (human breast cancer cells) with isotype control and anti-mesothelin mAb. As shown, certain cancer cells, including OVCAR3, H226 and ASPC1, express mesothelin at high levels; a549 expressed mesothelin at low levels and HCC70 did not express mesothelin.

5.9.5 example 5: mesothelin-expressing cancer cell-specific activation of CART cells

CD107a is an early activation marker for T cells. Mesothelin CART activation by mesothelin-expressing tumor cells was determined by CD107a staining as follows: add 20. Mu.l PE-CD107a mAb to each well of a 96-well plate; tumor cells were diluted to 2 × 10e 6/ml and plated onto 96-well circular plates (100 μ l/well); CAR-T cells were diluted to 1 × 10e 6/ml, seeded on 96-well circular plates (100 μ l/well), plates were centrifuged at 500rpm × 5min to allow cells to adhere, cultured at 37 ℃ for 1 hour, golgiStop was diluted 1500-fold with medium and added to each well (20 μ l/well); the cells were incubated at 37 ℃ for an additional 2.5 hours, stained with anti-CD 3-APC and anti-CD 8-FITC antibodies at 37 ℃ for 30min, washed and analyzed by flow cytometry.

Figure 10 shows CD107a staining of mesothelin M12 and M32 CAR-T cells in coculture and killing assays with OVCAR3, H226, ASPC1, a549 and HCC 70. These data indicate that anti-mesothelin M12 and M32 CART cells are specifically activated by OVCAR3, H226 and ASPC1 (tumor cells with high mesothelin expression levels), but not a549 and HCC70 (tumor cell lines with low or no mesothelin expression).

6. Electronically submitted sequence listing reference

The present application incorporates by reference a sequence listing created with the present application at 12.8.2021, with a size of 256,027 bytes, the ASCII text file name "613a004wo01_st25. Txt".

SEQUENCE LISTING

<110> Shanghai excellent Biopharmaceutical Co., ltd

<120> mesothelin-targeted antibody, chimeric antigen receptor and application thereof

<130> PWNCN210909-MO

<160> 220

<170> PatentIn version 3.5

<210> 1

<211> 11

<212> PRT

<213> artificial sequence

<220>

<223> M6 VL CDR1

<400> 1

Arg Ala Ser Gln Ser Ile Gly Asn Ser Leu Ala

1 5 10

<210> 2

<211> 11

<212> PRT

<213> artificial sequence

<220>

<223> M7 VL CDR1

<400> 2

Arg Ala Ser Gln Ala Ile Ser Ser Ala Leu Ala

1 5 10

<210> 3

<211> 11

<212> PRT

<213> artificial sequence

<220>

<223> M8 VL CDR1

<400> 3

Arg Ala Ser Gln Ser Ile Ser Ser Ser Leu Asn

1 5 10

<210> 4

<211> 11

<212> PRT

<213> artificial sequence

<220>

<223> M10 VL CDR1

<400> 4

Arg Ala Ser Gln Ser Ile Ser Ser Trp Leu Ala

1 5 10

<210> 5

<211> 11

<212> PRT

<213> artificial sequence

<220>

<223> M12 VL CDR1

<400> 5

Arg Ala Ser Gln Gly Gly Gly Asn Tyr Leu Ala

1 5 10

<210> 6

<211> 11

<212> PRT

<213> artificial sequence

<220>

<223> M13 VL CDR1

<400> 6

Arg Ala Ser Gln Gly Ile Ser Asn Ser Leu Ala

1 5 10

<210> 7

<211> 11

<212> PRT

<213> artificial sequence

<220>

<223> M15 VL CDR1

<400> 7

Arg Ala Ser Gln Gly Val Asn Ser Ala Leu Ala

1 5 10

<210> 8

<211> 11

<212> PRT

<213> artificial sequence

<220>

<223> M20 VL CDR1

<400> 8

Arg Ala Ser Gln Gly Ile Ser Ser Ala Val Ala

1 5 10

<210> 9

<211> 14

<212> PRT

<213> artificial sequence

<220>

<223> M22 VL CDR1

<400> 9

Thr Gly Thr Arg Arg Asp Ile Gly Gly Tyr Glu Tyr Val Ser

1 5 10

<210> 10

<211> 13

<212> PRT

<213> artificial sequence

<220>

<223> M24 VL CDR1

<400> 10

Ser Gly Ser Ser Ser Asn Ile Gly Ser Asn Tyr Val Tyr

1 5 10

<210> 11

<211> 12

<212> PRT

<213> artificial sequence

<220>

<223> M27 VL CDR1

<400> 11

Arg Ala Ser Gln Pro Ile Val Ala Ser His Leu Ala

1 5 10

<210> 12

<211> 14

<212> PRT

<213> artificial sequence

<220>

<223> M28 VL CDR1

<400> 12

Ser Gly Thr Ser Ser Asp Val Gly Gly Tyr Asn Phe Val Ser

1 5 10

<210> 13

<211> 14

<212> PRT

<213> artificial sequence

<220>

<223> M31 VL CDR1

<400> 13

Thr Gly Thr Ser Ser Asp Ile Gly Gly Tyr Asn Ser Val Ser

1 5 10

<210> 14

<211> 11

<212> PRT

<213> artificial sequence

<220>

<223> M32 VL CDR1

<400> 14

Gln Ala Ser Glu Asp Ile Asn Asn Ser Leu Asn

1 5 10

<210> 15

<211> 11

<212> PRT

<213> artificial sequence

<220>

<223> M37 VL CDR1

<400> 15

Arg Ala Ser Gln Gly Ile Ser Asn Tyr Leu Ala

1 5 10

<210> 16

<211> 7

<212> PRT

<213> artificial sequence

<220>

<223> M6 VL CDR2

<400> 16

Asp Val Ser Asn Arg Ala Thr

1 5

<210> 17

<211> 7

<212> PRT

<213> artificial sequence

<220>

<223> M7 VL CDR2

<400> 17

Asp Ala Ser Thr Leu Glu Ser

1 5

<210> 18

<211> 7

<212> PRT

<213> artificial sequence

<220>

<223> M8, M37 VL CDR2

<400> 18

Ala Ala Ser Ser Leu Gln Ser

1 5

<210> 19

<211> 7

<212> PRT

<213> artificial sequence

<220>

<223> M10 VL CDR2

<400> 19

Lys Ala Ser Ser Leu Glu Ser

1 5

<210> 20

<211> 7

<212> PRT

<213> artificial sequence

<220>

<223> M12 VL CDR2

<400> 20

Gly Ala Ser Lys Leu Gln Ser

1 5

<210> 21

<211> 7

<212> PRT

<213> artificial sequence

<220>

<223> M13 VL CDR2

<400> 21

Ala Ala Ser Arg Leu Glu Ser

1 5

<210> 22

<211> 7

<212> PRT

<213> artificial sequence

<220>

<223> M15 VL CDR2

<400> 22

Asp Ala Ser Ser Leu Glu Ser

1 5

<210> 23

<211> 7

<212> PRT

<213> artificial sequence

<220>

<223> M20 VL CDR2

<400> 23

Tyr Ala Ser Ser Leu Glu Ser

1 5

<210> 24

<211> 7

<212> PRT

<213> artificial sequence

<220>

<223> M22 VL CDR2

<400> 24

Ser Val Asn Asn Arg Pro Ser

1 5

<210> 25

<211> 7

<212> PRT

<213> artificial sequence

<220>

<223> M24 VL CDR2

<400> 25

Met Asn Asn Gln Arg Pro Ser

1 5

<210> 26

<211> 7

<212> PRT

<213> artificial sequence

<220>

<223> M27 VL CDR2

<400> 26

Gly Ala Ser Thr Arg Ala Ala

1 5

<210> 27

<211> 7

<212> PRT

<213> artificial sequence

<220>

<223> M28 VL CDR2

<400> 27

Glu Val Ser Lys Arg Pro Ser

1 5

<210> 28

<211> 7

<212> PRT

<213> artificial sequence

<220>

<223> M31 VL CDR2

<400> 28

Gly Val Ser Arg Arg Pro Ser

1 5

<210> 29

<211> 7

<212> PRT

<213> artificial sequence

<220>

<223> M32 VL CDR2

<400> 29

Asp Ala Ser Asp Leu Glu Thr

1 5

<210> 30

<211> 9

<212> PRT

<213> artificial sequence

<220>

<223> M6 VL CDR3

<400> 30

Gln His Arg Tyr Ser Trp Pro Leu Thr

1 5

<210> 31

<211> 9

<212> PRT

<213> artificial sequence

<220>

<223> M7 VL CDR3

<400> 31

Gln Gln Ala Asp Ser Phe Pro Leu Thr

1 5

<210> 32

<211> 9

<212> PRT

<213> artificial sequence

<220>

<223> M8 VL CDR3

<400> 32

Gln Gln Ser Tyr Ser Thr Pro Leu Thr

1 5

<210> 33

<211> 9

<212> PRT

<213> artificial sequence

<220>

<223> M10 VL CDR3

<400> 33

Gln Gln Tyr Tyr Ser Tyr Pro Leu Thr

1 5

<210> 34

<211> 9

<212> PRT

<213> artificial sequence

<220>

<223> M12 VL CDR3

<400> 34

Gln Gln Leu Asn Ser Tyr Pro Val Thr

1 5

<210> 35

<211> 9

<212> PRT

<213> artificial sequence

<220>

<223> M13 VL CDR3

<400> 35

Gln Gln Tyr Tyr Ser Thr Pro Phe Thr

1 5

<210> 36

<211> 9

<212> PRT

<213> artificial sequence

<220>

<223> M15 VL CDR3

<400> 36

Gln Gln Phe Ser Ser Tyr Pro Leu Thr

1 5

<210> 37

<211> 9

<212> PRT

<213> artificial sequence

<220>

<223> M20 VL CDR3

<400> 37

Gln Gln Phe Asn Ser Tyr Pro Leu Thr

1 5

<210> 38

<211> 11

<212> PRT

<213> artificial sequence

<220>

<223> M22 VL CDR3

<400> 38

Ser Ser Tyr Ser Ser Arg Asp Thr Leu Val Leu

1 5 10

<210> 39

<211> 12

<212> PRT

<213> artificial sequence

<220>

<223> M24 VL CDR3

<400> 39

Ala Ala Arg Asp Asp Ser Leu Ser Gly Tyr Val Thr

1 5 10

<210> 40

<211> 8

<212> PRT

<213> artificial sequence

<220>

<223> M27 VL CDR3

<400> 40

Gln Gln Tyr Gly Ile Ser Pro Phe

1 5

<210> 41

<211> 11

<212> PRT

<213> artificial sequence

<220>

<223> M28 VL CDR3

<400> 41

Ser Ser Tyr Ala Gly Arg Asn Asn Pro Tyr Leu

1 5 10

<210> 42

<211> 10

<212> PRT

<213> artificial sequence

<220>

<223> M31 VL CDR3

<400> 42

Ser Ser Tyr Gly Gly Ser Asn Asn Leu Leu

1 5 10

<210> 43

<211> 9

<212> PRT

<213> artificial sequence

<220>

<223> M32 VL CDR3

<400> 43

Gln Gln Leu Asn Ser Tyr Pro Leu Thr

1 5

<210> 44

<211> 9

<212> PRT

<213> artificial sequence

<220>

<223> M37 VL CDR3

<400> 44

Gln Gln Tyr Ser Ser Tyr Pro Ile Thr

1 5

<210> 45

<211> 5

<212> PRT

<213> artificial sequence

<220>

<223> M6 VH CDR1

<400> 45

Asp Tyr Tyr Met Ser

1 5

<210> 46

<211> 5

<212> PRT

<213> artificial sequence

<220>

<223> M7 VH CDR1

<400> 46

Ala Tyr Trp Ile Ala

1 5

<210> 47

<211> 5

<212> PRT

<213> artificial sequence

<220>

<223> M8 VH CDR1

<400> 47

Gly Tyr Ala Met Tyr

1 5

<210> 48

<211> 5

<212> PRT

<213> artificial sequence

<220>

<223> M10, M24 VH CDR1

<400> 48

Ser Tyr Ala Met Ser

1 5

<210> 49

<211> 5

<212> PRT

<213> artificial sequence

<220>

<223> M12 VH CDR1

<400> 49

Thr Tyr Tyr Ile His

1 5

<210> 50

<211> 5

<212> PRT

<213> artificial sequence

<220>

<223> M13 VH CDR1

<400> 50

Ala Asn Thr Ile Asn

1 5

<210> 51

<211> 5

<212> PRT

<213> artificial sequence

<220>

<223> M15 VH CDR1

<400> 51

Ser Tyr Tyr Met His

1 5

<210> 52

<211> 5

<212> PRT

<213> artificial sequence

<220>

<223> M20 VH CDR1

<400> 52

Asp Ser Trp Ile Ala

1 5

<210> 53

<211> 5

<212> PRT

<213> artificial sequence

<220>

<223> M22, M28 VH CDR1

<400> 53

Ser Tyr Ala Ile Ser

1 5

<210> 54

<211> 5

<212> PRT

<213> artificial sequence

<220>

<223> M27 VH CDR1

<400> 54

Asp Tyr Trp Ile Gly

1 5

<210> 55

<211> 5

<212> PRT

<213> artificial sequence

<220>

<223> M31 VH CDR1

<400> 55

Ser Ser Trp Met Ala

1 5

<210> 56

<211> 5

<212> PRT

<213> artificial sequence

<220>

<223> M32 VH CDR1

<400> 56

Gly Tyr Tyr Leu His

1 5

<210> 57

<211> 5

<212> PRT

<213> artificial sequence

<220>

<223> M37 VH CDR1

<400> 57

Pro Tyr Tyr Trp Thr

1 5

<210> 58

<211> 17

<212> PRT

<213> artificial sequence

<220>

<223> M6 VH CDR2

<400> 58

Tyr Ile Ser Ser Ser Gly Ser Thr Ile Tyr Tyr Ala Asp Ser Val Lys

1 5 10 15

Gly

<210> 59

<211> 17

<212> PRT

<213> artificial sequence

<220>

<223> M7 VH CDR2

<400> 59

Ile Ile Tyr Pro Gly Asp Ser Arg Val Ile Tyr Ser Pro Tyr Phe Gln

1 5 10 15

Gly

<210> 60

<211> 17

<212> PRT

<213> artificial sequence

<220>

<223> M8 VH CDR2

<400> 60

Ala Ile Thr Thr Asn Gly Gly Ser Thr Asn Tyr Ala Asp Ser Val Lys

1 5 10 15

Gly

<210> 61

<211> 17

<212> PRT

<213> artificial sequence

<220>

<223> M10 M24 VH CDR2

<400> 61

Ala Ile Ser Gly Ser Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val Lys

1 5 10 15

Gly

<210> 62

<211> 17

<212> PRT

<213> artificial sequence

<220>

<223> M12 VH CDR2

<400> 62

Ile Ile Asn Pro Ser Ser Gly Ser Thr Thr Tyr Thr Gln Lys Phe Gln

1 5 10 15

Gly

<210> 63

<211> 17

<212> PRT

<213> artificial sequence

<220>

<223> M13 VH CDR2

<400> 63

Arg Ile Ile Pro Ser Leu Asn Ile Arg Asp Tyr Ala Gln Glu Phe Gln

1 5 10 15

Gly

<210> 64

<211> 17

<212> PRT

<213> artificial sequence

<220>

<223> M15 VH CDR2

<400> 64

Ile Ile Asn Pro Ser Gly Gly Ser Thr Ser Tyr Ala Gln Lys Phe Gln

1 5 10 15

Gly

<210> 65

<211> 17

<212> PRT

<213> artificial sequence

<220>

<223> M20 VH CDR2

<400> 65

Ile Ile Phe Pro Gly Asp Ser Asn Pro Ile Tyr Ser Pro Ser Phe Gln

1 5 10 15

Gly

<210> 66

<211> 17

<212> PRT

<213> artificial sequence

<220>

<223> M22, M28 VH CDR2

<400> 66

Gly Ile Ile Pro Ile Phe Gly Thr Ala Asn Tyr Ala Gln Lys Phe Gln

1 5 10 15

Gly

<210> 67

<211> 17

<212> PRT

<213> artificial sequence

<220>

<223> M27 VH CDR2

<400> 67

Trp Ile Thr Pro Asn Asn Gly Asn Thr Asn Tyr Ala Pro Lys Phe Gln

1 5 10 15

Gly

<210> 68

<211> 17

<212> PRT

<213> artificial sequence

<220>

<223> M31 VH CDR2

<400> 68

Asn Ile Lys Gln Asp Gly Ser Ser Gln Tyr Tyr Val Asp Ser Val Lys

1 5 10 15

Gly

<210> 69

<211> 17

<212> PRT

<213> artificial sequence

<220>

<223> M32 VH CDR2

<400> 69

Ile Ile Asn Pro Ser Gly Gly Arg Thr Ser Met Ala Gln Lys Phe Gln

1 5 10 15

Gly

<210> 70

<211> 16

<212> PRT

<213> artificial sequence

<220>

<223> M37 VH CDR2

<400> 70

Tyr Ile His Tyr Ser Gly Arg Thr Asn Tyr Asn Pro Ser Leu Glu Ser

1 5 10 15

<210> 71

<211> 11

<212> PRT

<213> artificial sequence

<220>

<223> M6 VH CDR3

<400> 71

Asp Gly Tyr Arg Thr His Asn Trp Phe Asp Pro

1 5 10

<210> 72

<211> 13

<212> PRT

<213> artificial sequence

<220>

<223> M7 VH CDR3

<400> 72

Phe Gly Gly Pro Lys Phe Ala Thr Asn Trp Phe Asp Ile

1 5 10

<210> 73

<211> 12

<212> PRT

<213> artificial sequence

<220>

<223> M8 VH CDR3

<400> 73

Gly Ala Pro Gly Tyr Arg Gly Tyr Tyr Met Asp Val

1 5 10

<210> 74

<211> 9

<212> PRT

<213> artificial sequence

<220>

<223> M10 VH CDR3

<400> 74

Arg Gly Ser Ser Trp Tyr Phe Asp Tyr

1 5

<210> 75

<211> 10

<212> PRT

<213> artificial sequence

<220>

<223> M12 VH CDR3

<400> 75

Gly Glu Thr Leu Arg Gly Tyr Phe Asp Tyr

1 5 10

<210> 76

<211> 14

<212> PRT

<213> artificial sequence

<220>

<223> M13 VH CDR3

<400> 76

Asp Pro Gly Ser Thr Trp Ser Pro Asn Gln Phe Phe Pro His

1 5 10

<210> 77

<211> 11

<212> PRT

<213> artificial sequence

<220>

<223> M15 VH CDR3

<400> 77

Ala Gln Arg Gly Gly Ser Val Tyr Phe Asp Tyr

1 5 10

<210> 78

<211> 11

<212> PRT

<213> artificial sequence

<220>

<223> M20 VH CDR3

<400> 78

His Ala Ala Trp Gly Ala Gly Trp Phe Asp Pro

1 5 10

<210> 79

<211> 9

<212> PRT

<213> artificial sequence

<220>

<223> M22 VH CDR3

<400> 79

Gly Arg Ser Gly Ser Tyr Gly Leu Tyr

1 5

<210> 80

<211> 7

<212> PRT

<213> artificial sequence

<220>

<223> M24 VH CDR3

<400> 80

Gly Val Ala Thr Phe Asp Tyr

1 5

<210> 81

<211> 16

<212> PRT

<213> artificial sequence

<220>

<223> M27 VH CDR3

<400> 81

Arg Gly Arg Asn Ser Ser Gly Tyr Leu Tyr Tyr Tyr Ser Met Asp Val

1 5 10 15

<210> 82

<211> 13

<212> PRT

<213> artificial sequence

<220>

<223> M28 VH CDR3

<400> 82

Asp Leu Gly Gly Tyr Ser Tyr Gly His Gly Leu Asp Tyr

1 5 10

<210> 83

<211> 8

<212> PRT

<213> artificial sequence

<220>

<223> M31 VH CDR3

<400> 83

Asp Ile Trp Tyr Ser Ile Asp Tyr

1 5

<210> 84

<211> 11

<212> PRT

<213> artificial sequence

<220>

<223> M32 VH CDR3

<400> 84

Ala Asp Asn Trp Asn Ala Gly Ser Met Asp Val

1 5 10

<210> 85

<211> 9

<212> PRT

<213> artificial sequence

<220>

<223> M37 VH CDR3

<400> 85

Val Gly Asp Pro Gly Leu Phe Asp Tyr

1 5

<210> 86

<211> 107

<212> PRT

<213> artificial sequence

<220>

<223> M6 VL AA

<400> 86

Glu Ile Val Met Thr Gln Ser Pro Ala Thr Leu Ser Leu Ser Pro Gly

1 5 10 15

Glu Arg Ala Thr Leu Ser Cys Arg Ala Ser Gln Ser Ile Gly Asn Ser

20 25 30

Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro Arg Leu Leu Ile

35 40 45

Tyr Asp Val Ser Asn Arg Ala Thr Gly Ile Pro Ala Arg Phe Ser Gly

50 55 60

Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Glu Pro

65 70 75 80

Glu Asp Phe Ala Val Tyr Tyr Cys Gln His Arg Tyr Ser Trp Pro Leu

85 90 95

Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys

100 105

<210> 87

<211> 107

<212> PRT

<213> artificial sequence

<220>

<223> M7 VL AA

<400> 87

Asp Ile Arg Leu Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Leu Gly

1 5 10 15

Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Ala Ile Ser Ser Ala

20 25 30

Leu Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Arg Leu Leu Ile

35 40 45

Tyr Asp Ala Ser Thr Leu Glu Ser Gly Val Pro Ser Arg Phe Ser Gly

50 55 60

Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro

65 70 75 80

Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Ala Asp Ser Phe Pro Leu

85 90 95

Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys

100 105

<210> 88

<211> 107

<212> PRT

<213> artificial sequence

<220>

<223> M8 VL AA

<400> 88

Asp Ile Gln Leu Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly

1 5 10 15

Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Ser Ile Ser Ser Ser

20 25 30

Leu Asn Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile

35 40 45

Tyr Ala Ala Ser Ser Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly

50 55 60

Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro

65 70 75 80

Glu Asp Phe Ala Thr Tyr Ser Cys Gln Gln Ser Tyr Ser Thr Pro Leu

85 90 95

Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys

100 105

<210> 89

<211> 107

<212> PRT

<213> artificial sequence

<220>

<223> M10 VL AA

<400> 89

Asp Ile Arg Met Thr Gln Ser Pro Ser Thr Leu Ser Ala Ser Val Gly

1 5 10 15

Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Ser Ile Ser Ser Trp

20 25 30

Leu Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile

35 40 45

Tyr Lys Ala Ser Ser Leu Glu Ser Gly Val Pro Ser Arg Phe Ser Gly

50 55 60

Ser Gly Ser Gly Thr Glu Phe Thr Leu Thr Ile Ser Thr Leu Gln Pro

65 70 75 80

Asp Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Tyr Tyr Ser Tyr Pro Leu

85 90 95

Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys

100 105

<210> 90

<211> 107

<212> PRT

<213> artificial sequence

<220>

<223> M12 VL AA

<400> 90

Ala Ile Arg Leu Thr Gln Ser Pro Ser Leu Leu Ser Ala Ser Val Gly

1 5 10 15

Asp Arg Val Thr Val Thr Cys Arg Ala Ser Gln Gly Gly Gly Asn Tyr

20 25 30

Leu Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile

35 40 45

Tyr Gly Ala Ser Lys Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly

50 55 60

Ser Gly Ser Gly Thr Glu Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro

65 70 75 80

Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Leu Asn Ser Tyr Pro Val

85 90 95

Thr Phe Gly Gln Gly Thr Lys Val Asp Ile Lys

100 105

<210> 91

<211> 107

<212> PRT

<213> artificial sequence

<220>

<223> M13 VL AA

<400> 91

Ala Ile Arg Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly

1 5 10 15

Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Gly Ile Ser Asn Ser

20 25 30

Leu Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Leu

35 40 45

Tyr Ala Ala Ser Arg Leu Glu Ser Gly Val Pro Ser Arg Phe Ser Gly

50 55 60

Ser Gly Ser Gly Thr Asp Tyr Thr Leu Thr Ile Ser Ser Leu Gln Pro

65 70 75 80

Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Tyr Tyr Ser Thr Pro Phe

85 90 95

Thr Phe Gly Pro Gly Thr Lys Leu Glu Ile Lys

100 105

<210> 92

<211> 107

<212> PRT

<213> artificial sequence

<220>

<223> M15 VL AA

<400> 92

Asp Ile Gln Leu Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Ile Gly

1 5 10 15

Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Gly Val Asn Ser Ala

20 25 30

Leu Ala Trp Tyr Gln Gln Lys Pro Gly Lys Pro Pro Asn Leu Leu Ile

35 40 45

Tyr Asp Ala Ser Ser Leu Glu Ser Gly Val Pro Ser Arg Phe Ser Gly

50 55 60

Ser Gly Ser Gly Arg Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro

65 70 75 80

Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Phe Ser Ser Tyr Pro Leu

85 90 95

Thr Phe Gly Gly Gly Thr Lys Val Asp Ile Lys

100 105

<210> 93

<211> 107

<212> PRT

<213> artificial sequence

<220>

<223> M20 VL AA

<400> 93

Ala Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly

1 5 10 15

Asn Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Gly Ile Ser Ser Ala

20 25 30

Val Ala Trp Tyr Gln Gln Lys Pro Gly Lys Pro Pro Lys Leu Leu Ile

35 40 45

Ser Tyr Ala Ser Ser Leu Glu Ser Gly Val Pro Ser Arg Phe Ser Gly

50 55 60

Ser Gly Ser Gly Thr Asp Phe Ser Leu Thr Ile Ser Ser Leu Gln Pro

65 70 75 80

Glu Asp Phe Ala Thr Tyr Phe Cys Gln Gln Phe Asn Ser Tyr Pro Leu

85 90 95

Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys

100 105

<210> 94

<211> 111

<212> PRT

<213> artificial sequence

<220>

<223> M22 VL AA

<400> 94

Gln Ser Ala Leu Thr Gln Pro Ala Ser Val Ser Gly Ser Pro Gly Gln

1 5 10 15

Ser Ile Thr Leu Ser Cys Thr Gly Thr Arg Arg Asp Ile Gly Gly Tyr

20 25 30

Glu Tyr Val Ser Trp Tyr Gln Gln His Pro Gly Lys Ala Pro Lys Leu

35 40 45

Leu Ile Phe Ser Val Asn Asn Arg Pro Ser Gly Val Ser His Arg Phe

50 55 60

Ser Gly Ser Lys Ser Gly Asn Thr Ala Ser Leu Thr Ile Ser Gly Leu

65 70 75 80

Gln Ala Glu Asp Glu Ala Ala Tyr Phe Cys Ser Ser Tyr Ser Ser Arg

85 90 95

Asp Thr Leu Val Leu Phe Gly Gly Gly Thr Lys Leu Thr Val Leu

100 105 110

<210> 95

<211> 111

<212> PRT

<213> artificial sequence

<220>

<223> M24 VL AA

<400> 95

Gln Pro Val Leu Thr Gln Pro Pro Ser Ala Ser Gly Thr Pro Gly Gln

1 5 10 15

Arg Val Thr Ile Ser Cys Ser Gly Ser Ser Ser Asn Ile Gly Ser Asn

20 25 30

Tyr Val Tyr Trp Tyr Gln Gln Phe Pro Gly Thr Ala Pro Lys Leu Leu

35 40 45

Ile Tyr Met Asn Asn Gln Arg Pro Ser Gly Val Pro Asp Arg Phe Ser

50 55 60

Gly Ser Lys Ser Gly Thr Ser Ala Ser Leu Ala Ile Ser Gly Leu Arg

65 70 75 80

Ser Glu Asp Glu Ala Asp Tyr Tyr Cys Ala Ala Arg Asp Asp Ser Leu

85 90 95

Ser Gly Tyr Val Thr Phe Gly Gly Gly Thr Lys Leu Thr Val Leu

100 105 110

<210> 96

<211> 108

<212> PRT

<213> artificial sequence

<220>

<223> M27 VL AA

<400> 96

Glu Ile Val Leu Thr Gln Ser Pro Gly Thr Leu Ser Leu Ser Pro Gly

1 5 10 15

Glu Arg Ala Thr Leu Ser Cys Arg Ala Ser Gln Pro Ile Val Ala Ser

20 25 30

His Leu Ala Trp Tyr Gln His Lys Pro Gly Gln Ala Pro Arg Leu Leu

35 40 45

Ile Tyr Gly Ala Ser Thr Arg Ala Ala Gly Ile Pro Asp Arg Phe Ser

50 55 60

Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Arg Leu Glu

65 70 75 80

Pro Glu Asp Phe Ala Val Tyr Phe Cys Gln Gln Tyr Gly Ile Ser Pro

85 90 95

Phe Thr Phe Gly Pro Gly Thr Lys Val Asp Ile Lys

100 105

<210> 97

<211> 111

<212> PRT

<213> artificial sequence

<220>

<223> M28 VL AA

<400> 97

Gln Ser Ala Leu Thr Gln Pro Pro Ser Ala Ser Gly Ser Pro Gly Gln

1 5 10 15

Ser Val Thr Ile Ser Cys Ser Gly Thr Ser Ser Asp Val Gly Gly Tyr

20 25 30

Asn Phe Val Ser Trp Tyr Gln His His Pro Gly Lys Ala Pro Lys Leu

35 40 45

Met Ile Tyr Glu Val Ser Lys Arg Pro Ser Gly Val Pro Asp Arg Phe

50 55 60

Ser Gly Ser Lys Ser Gly Asn Thr Ala Ser Leu Thr Val Ser Gly Leu

65 70 75 80

Gln Ala Glu Asp Glu Ala Asp Tyr Tyr Cys Ser Ser Tyr Ala Gly Arg

85 90 95

Asn Asn Pro Tyr Leu Phe Gly Thr Gly Thr Lys Leu Thr Val Leu

100 105 110

<210> 98

<211> 110

<212> PRT

<213> artificial sequence

<220>

<223> M31 VL AA

<400> 98

Gln Ser Ala Leu Thr Gln Pro Pro Ser Ala Ser Gly Ser Pro Gly Gln

1 5 10 15

Ser Val Thr Ile Ser Cys Thr Gly Thr Ser Ser Asp Ile Gly Gly Tyr

20 25 30

Asn Ser Val Ser Trp Tyr Gln Gln His Pro Gly Lys Ala Pro Lys Leu

35 40 45

Ile Ile Tyr Gly Val Ser Arg Arg Pro Ser Gly Val Pro Asp Arg Phe

50 55 60

Ser Gly Ser Lys Ser Ala Asn Thr Ala Ser Leu Thr Val Ser Gly Leu

65 70 75 80

Gln Ala Val Asp Glu Ala Asp Tyr Tyr Cys Ser Ser Tyr Gly Gly Ser

85 90 95

Asn Asn Leu Leu Phe Gly Gly Gly Thr Lys Leu Thr Val Leu

100 105 110

<210> 99

<211> 107

<212> PRT

<213> artificial sequence

<220>

<223> M32 VL AA

<400> 99

Asp Ile Arg Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly

1 5 10 15

Asp Arg Val Thr Val Thr Cys Gln Ala Ser Glu Asp Ile Asn Asn Ser

20 25 30

Leu Asn Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Gln Leu Leu Ile

35 40 45

Tyr Asp Ala Ser Asp Leu Glu Thr Gly Val Pro Ser Arg Phe Ser Gly

50 55 60

Arg Gly Ser Gly Arg Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro

65 70 75 80

Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Leu Asn Ser Tyr Pro Leu

85 90 95

Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys

100 105

<210> 100

<211> 107

<212> PRT

<213> artificial sequence

<220>

<223> M37 VL AA

<400> 100

Asp Ile Val Met Thr Gln Thr Pro Ser Ser Leu Ser Ala Ser Val Gly

1 5 10 15

Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Gly Ile Ser Asn Tyr

20 25 30

Leu Ala Trp Phe Gln Gln Lys Pro Gly Lys Ala Pro Lys Pro Leu Ile

35 40 45

Tyr Ala Ala Ser Ser Leu Gln Ser Gly Val Pro Ser Lys Phe Ser Gly

50 55 60

Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Asn Leu Gln Pro

65 70 75 80

Glu Asp Phe Ala Thr Tyr Ile Cys Gln Gln Tyr Ser Ser Tyr Pro Ile

85 90 95

Thr Phe Gly Gln Gly Thr Arg Leu Glu Ile Lys

100 105

<210> 101

<211> 120

<212> PRT

<213> artificial sequence

<220>

<223> M6 VH AA

<400> 101

Gln Val Gln Leu Val Gln Ser Gly Gly Gly Leu Val Lys Pro Gly Gly

1 5 10 15

Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Asp Tyr

20 25 30

Tyr Met Ser Trp Ile Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val

35 40 45

Ser Tyr Ile Ser Ser Ser Gly Ser Thr Ile Tyr Tyr Ala Asp Ser Val

50 55 60

Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Ser Leu Tyr

65 70 75 80

Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys

85 90 95

Ala Arg Asp Gly Tyr Arg Thr His Asn Trp Phe Asp Pro Trp Gly Gln

100 105 110

Gly Thr Leu Val Thr Val Ser Ser

115 120

<210> 102

<211> 122

<212> PRT

<213> artificial sequence

<220>

<223> M7 VH AA

<400> 102

Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Ser Gly Glu

1 5 10 15

Ser Leu Lys Ile Ser Cys Lys Gly Ser Gly Tyr Gly Phe Gly Ala Tyr

20 25 30

Trp Ile Ala Trp Val Arg Gln Met Pro Gly Lys Gly Leu Glu Trp Met

35 40 45

Gly Ile Ile Tyr Pro Gly Asp Ser Arg Val Ile Tyr Ser Pro Tyr Phe

50 55 60

Gln Gly Gln Val Thr Ile Ser Ala Asp Lys Ser Ile Ser Thr Ala Tyr

65 70 75 80

Leu Gln Trp Ser Ser Leu Lys Ala Ser Asp Thr Ala Met Tyr Tyr Cys

85 90 95

Ala Arg Phe Gly Gly Pro Lys Phe Ala Thr Asn Trp Phe Asp Ile Trp

100 105 110

Gly Gln Gly Thr Thr Val Thr Val Ser Ser

115 120

<210> 103

<211> 121

<212> PRT

<213> artificial sequence

<220>

<223> M8 VH AA

<400> 103

Gln Val His Leu Val Glu Ser Gly Gly Gly Val Val Gln Pro Gly Arg

1 5 10 15

Ser Leu Arg Val Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Gly Tyr

20 25 30

Ala Met Tyr Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Tyr Val

35 40 45

Ser Ala Ile Thr Thr Asn Gly Gly Ser Thr Asn Tyr Ala Asp Ser Val

50 55 60

Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr

65 70 75 80

Leu Gln Met Ser Ser Leu Arg Ala Gly Asp Thr Ala Val Tyr Tyr Cys

85 90 95

Ala Arg Gly Ala Pro Gly Tyr Arg Gly Tyr Tyr Met Asp Val Trp Gly

100 105 110

Lys Gly Thr Thr Val Thr Val Ser Ser

115 120

<210> 104

<211> 118

<212> PRT

<213> artificial sequence

<220>

<223> M10 VH AA

<400> 104

Gln Val Gln Leu Val Gln Ser Gly Gly Gly Leu Val Gln Pro Gly Gly

1 5 10 15

Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr

20 25 30

Ala Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val

35 40 45

Ser Ala Ile Ser Gly Ser Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val

50 55 60

Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr

65 70 75 80

Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys

85 90 95

Ala Lys Arg Gly Ser Ser Trp Tyr Phe Asp Tyr Trp Gly Gln Gly Thr

100 105 110

Leu Val Thr Val Ser Ser

115

<210> 105

<211> 119

<212> PRT

<213> artificial sequence

<220>

<223> M12 VH AA

<400> 105

Glu Val Gln Leu Val Glu Ser Gly Ala Glu Val Lys Lys Pro Gly Ala

1 5 10 15

Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Thr Tyr

20 25 30

Tyr Ile His Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met

35 40 45

Gly Ile Ile Asn Pro Ser Ser Gly Ser Thr Thr Tyr Thr Gln Lys Phe

50 55 60

Gln Gly Arg Val Thr Met Thr Arg Asp Thr Ser Thr Ser Thr Val Tyr

65 70 75 80

Ile Glu Leu Ser Gly Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys

85 90 95

Ala Arg Gly Glu Thr Leu Arg Gly Tyr Phe Asp Tyr Trp Gly Gln Gly

100 105 110

Thr Leu Val Thr Val Ser Ser

115

<210> 106

<211> 123

<212> PRT

<213> artificial sequence

<220>

<223> M13 VH AA

<400> 106

Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ser

1 5 10 15

Ser Val Lys Val Ser Cys Lys Thr Ser Ala Asp Thr Phe Ser Ala Asn

20 25 30

Thr Ile Asn Trp Val Arg Gln Ala Pro Gly His Gly Leu Glu Trp Met

35 40 45

Gly Arg Ile Ile Pro Ser Leu Asn Ile Arg Asp Tyr Ala Gln Glu Phe

50 55 60

Gln Gly Arg Val Thr Phe Thr Ala Asp Glu Ser Thr Asn Thr Val Tyr

65 70 75 80

Met Gln Leu Thr Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys

85 90 95

Ala Arg Asp Pro Gly Ser Thr Trp Ser Pro Asn Gln Phe Phe Pro His

100 105 110

Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser

115 120

<210> 107

<211> 120

<212> PRT

<213> artificial sequence

<220>

<223> M15 VH AA

<400> 107

Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala

1 5 10 15

Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Ser Tyr

20 25 30

Tyr Met His Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met

35 40 45

Gly Ile Ile Asn Pro Ser Gly Gly Ser Thr Ser Tyr Ala Gln Lys Phe

50 55 60

Gln Gly Arg Val Thr Met Thr Arg Asp Thr Ser Thr Ser Thr Val Tyr

65 70 75 80

Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys

85 90 95

Ala Arg Ala Gln Arg Gly Gly Ser Val Tyr Phe Asp Tyr Trp Gly Gln

100 105 110

Gly Thr Leu Val Thr Val Ser Ser

115 120

<210> 108

<211> 120

<212> PRT

<213> artificial sequence

<220>

<223> M20 VH AA

<400> 108

Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Arg Lys Pro Gly Glu

1 5 10 15

Ser Leu Lys Ile Ser Cys Lys Gly Ser Gly Tyr Ser Phe Arg Asp Ser

20 25 30

Trp Ile Ala Trp Val Arg Gln Met Pro Gly Gln Gly Leu Glu Trp Met

35 40 45

Gly Ile Ile Phe Pro Gly Asp Ser Asn Pro Ile Tyr Ser Pro Ser Phe

50 55 60

Gln Gly Gln Val Thr Ile Ser Ala Asp Thr Ser Ile Ser Thr Thr Phe

65 70 75 80

Leu Gln Trp Arg Ser Leu Lys Ala Ser Asp Ser Ala Ile Tyr Tyr Cys

85 90 95

Ala Arg His Ala Ala Trp Gly Ala Gly Trp Phe Asp Pro Trp Gly Gln

100 105 110

Gly Thr Leu Val Thr Val Ser Ser

115 120

<210> 109

<211> 118

<212> PRT

<213> artificial sequence

<220>

<223> M22 VH AA

<400> 109

Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ser

1 5 10 15

Ser Val Lys Val Ser Cys Lys Ala Ser Gly Gly Thr Phe Ser Ser Tyr

20 25 30

Ala Ile Ser Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met

35 40 45

Gly Gly Ile Ile Pro Ile Phe Gly Thr Ala Asn Tyr Ala Gln Lys Phe

50 55 60

Gln Gly Arg Val Thr Ile Thr Ala Asp Glu Ser Thr Ser Thr Ala Tyr

65 70 75 80

Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys

85 90 95

Ala Ser Gly Arg Ser Gly Ser Tyr Gly Leu Tyr Trp Gly Gln Gly Thr

100 105 110

Leu Val Thr Val Ser Ser

115

<210> 110

<211> 116

<212> PRT

<213> artificial sequence

<220>

<223> M24 VH AA

<400> 110

Glu Val His Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly

1 5 10 15

Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr

20 25 30

Ala Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val

35 40 45

Ser Ala Ile Ser Gly Ser Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val

50 55 60

Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr

65 70 75 80

Leu Gln Met Asn Ser Leu Lys Thr Glu Asp Thr Ala Val Tyr Tyr Cys

85 90 95

Thr Arg Gly Val Ala Thr Phe Asp Tyr Trp Gly Gln Gly Thr Leu Val

100 105 110

Thr Val Ser Ser

115

<210> 111

<211> 125

<212> PRT

<213> artificial sequence

<220>

<223> M27 VH AA

<400> 111

Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Glu

1 5 10 15

Ser Leu Lys Ile Ser Cys Gln Gly Ser Gly Tyr Ser Phe Thr Asp Tyr

20 25 30

Trp Ile Gly Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met

35 40 45

Gly Trp Ile Thr Pro Asn Asn Gly Asn Thr Asn Tyr Ala Pro Lys Phe

50 55 60

Gln Gly Arg Val Thr Leu Thr Thr Asp Thr Ser Thr Ser Thr Ala Tyr

65 70 75 80

Met Glu Leu Arg Ser Leu Thr Ser Asp Asp Thr Ala Val Tyr Phe Cys

85 90 95

Ala Arg Arg Gly Arg Asn Ser Ser Gly Tyr Leu Tyr Tyr Tyr Ser Met

100 105 110

Asp Val Trp Gly Gln Gly Thr Thr Val Thr Val Ser Ser

115 120 125

<210> 112

<211> 122

<212> PRT

<213> artificial sequence

<220>

<223> M28 VH AA

<400> 112

Gln Leu Gln Leu Gln Glu Ser Gly Ala Glu Val Lys Lys Pro Gly Ser

1 5 10 15

Ser Val Lys Val Ser Cys Lys Ala Ser Gly Gly Thr Phe Ser Ser Tyr

20 25 30

Ala Ile Ser Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met

35 40 45

Gly Gly Ile Ile Pro Ile Phe Gly Thr Ala Asn Tyr Ala Gln Lys Phe

50 55 60

Gln Gly Arg Val Thr Ile Thr Ala Asp Glu Ser Thr Ser Thr Ala Tyr

65 70 75 80

Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys

85 90 95

Ala Arg Asp Leu Gly Gly Tyr Ser Tyr Gly His Gly Leu Asp Tyr Trp

100 105 110

Gly Gln Gly Thr Leu Val Thr Val Ser Ser

115 120

<210> 113

<211> 117

<212> PRT

<213> artificial sequence

<220>

<223> M31 VH AA

<400> 113

Glu Val His Leu Val Glu Ser Gly Gly Gly Leu Ala Gln Pro Gly Gly

1 5 10 15

Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Ser Phe Ser Ser Ser

20 25 30

Trp Met Ala Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val

35 40 45

Ala Asn Ile Lys Gln Asp Gly Ser Ser Gln Tyr Tyr Val Asp Ser Val

50 55 60

Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Ser Leu Ser

65 70 75 80

Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys

85 90 95

Ala Arg Asp Ile Trp Tyr Ser Ile Asp Tyr Trp Gly Gln Gly Thr Leu

100 105 110

Val Thr Val Ser Ser

115

<210> 114

<211> 120

<212> PRT

<213> artificial sequence

<220>

<223> M32 VH AA

<400> 114

Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala

1 5 10 15

Ser Val Lys Val Ser Cys Lys Ala Ser Gly Phe Thr Phe Ile Gly Tyr

20 25 30

Tyr Leu His Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met

35 40 45

Gly Ile Ile Asn Pro Ser Gly Gly Arg Thr Ser Met Ala Gln Lys Phe

50 55 60

Gln Gly Arg Val Ser Met Thr Thr Asp Thr Ser Thr Gly Thr Val Tyr

65 70 75 80

Leu Asp Leu Gly Arg Leu Gly Ser Asp Asp Thr Ala Val Tyr Tyr Cys

85 90 95

Ala Arg Ala Asp Asn Trp Asn Ala Gly Ser Met Asp Val Trp Gly Asn

100 105 110

Gly Thr Thr Val Thr Val Ser Ser

115 120

<210> 115

<211> 117

<212> PRT

<213> artificial sequence

<220>

<223> M37 VH AA

<400> 115

Gln Leu Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Glu

1 5 10 15

Thr Leu Ser Leu Thr Cys Ala Val Ser Gly Gly Ser Ile Ser Pro Tyr

20 25 30

Tyr Trp Thr Trp Ile Arg Gln Ser Pro Gly Lys Ala Met Glu Trp Met

35 40 45

Gly Tyr Ile His Tyr Ser Gly Arg Thr Asn Tyr Asn Pro Ser Leu Glu

50 55 60

Ser Arg Ala Thr Phe Ser Val Asp Thr Ser Lys Asn Gln Ile Ser Leu

65 70 75 80

Lys Leu Asn Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys Thr

85 90 95

Lys Val Gly Asp Pro Gly Leu Phe Asp Tyr Trp Gly Pro Gly Thr Leu

100 105 110

Val Thr Val Ser Ser

115

<210> 116

<211> 321

<212> DNA

<213> artificial sequence

<220>

<223> M6 VL NT

<400> 116

gaaattgtga tgacacagtc tccagccacg ctgtctttgt ctccagggga aagagccacc 60

ctctcctgca gggccagtca gagtattggc aactccttag cctggtacca acagaaacct 120

ggccaggctc cccggctcct catctatgat gtatccaata gggccactgg catcccagcc 180

aggttcagtg gcagtgggtc tgggacagac ttcactctca ccatcagcag cctagagcct 240

gaagattttg cagtttatta ctgtcagcac cgttacagct ggcctctcac tttcggcgga 300

gggaccaagg tggaaatcaa a 321

<210> 117

<211> 321

<212> DNA

<213> artificial sequence

<220>

<223> M7 VL NT

<400> 117

gacatccggt tgacccagtc tccatcctcc ctgtctgcat ctcttggaga cagagtcacc 60

atcacttgtc gggcaagtca ggccattagc agtgctttag cctggtatca gcagaagcca 120

gggaaagctc ctaggctcct gatctatgat gcctccactt tggaaagtgg ggtcccatca 180

agattcagcg gcagtggatc tgggacagat ttcactctca ccatcagcag cctgcagcct 240

gaggattttg caacttacta ttgtcagcag gctgacagtt tccctctcac tttcggcgga 300

gggaccaagc tggagatcaa a 321

<210> 118

<211> 321

<212> DNA

<213> artificial sequence

<220>

<223> M8 VL NT

<400> 118

gacatccagt tgacccagtc tccatcctcc ctgtctgcat ctgtaggaga cagagtcacc 60

atcacttgcc gggcaagtca gagcattagc agctctttaa attggtatca gcagaaacca 120

gggaaagccc ctaagctcct gatctatgct gcgtccagtt tgcaaagtgg ggtcccatca 180

aggttcagtg gcagtggatc tgggacagat ttcactctca ccatcagcag tctgcaacct 240

gaagattttg caacttactc ctgtcaacag agttacagta ccccgctcac tttcggcgga 300

gggaccaagg tggaaatcaa a 321

<210> 119

<211> 321

<212> DNA

<213> artificial sequence

<220>

<223> M10 VL NT

<400> 119

gacatccgga tgacccagtc tccttccacc ctgtctgcat ctgtaggaga cagagtcacc 60

atcacttgcc gggccagtca gagtattagt agctggttgg cctggtatca gcagaaacca 120

gggaaagccc ctaagctcct gatctataag gcgtctagtt tagaaagtgg ggtcccttca 180

aggttcagcg gcagtggatc tgggacagaa ttcactctca ccatcagcac cctgcagcct 240

gacgattttg caacttatta ctgccaacag tattatagtt acccgctcac tttcggcgga 300

gggaccaagg tggagatcaa a 321

<210> 120

<211> 321

<212> DNA

<213> artificial sequence

<220>

<223> M12 VL NT

<400> 120

gccatccggt tgacccagtc tccatccctc ctgtctgcat ctgtaggaga cagggtcacc 60

gtcacttgtc gggccagtca gggcggtggc aattatttag cctggtatca gcaaaaacca 120

gggaaagccc cgaaactcct gatctatggt gcatccaagt tgcaaagtgg ggtcccatcg 180

aggttcagcg gcagtggatc tgggacagaa ttcactctca caatcagcag tctgcagcct 240

gaagattttg caacttatta ctgtcaacag cttaatagtt accctgtcac ttttggccag 300

gggaccaaag tggatatcaa a 321

<210> 121

<211> 321

<212> DNA

<213> artificial sequence

<220>

<223> M13 VL NT

<400> 121

gccatccgga tgacccagtc tccatcctcc ctgtctgcat ctgtaggaga cagagtcacc 60

atcacttgcc gggcgagtca gggcattagc aattctttag cctggtatca gcagaaacca 120

gggaaagccc ctaagctcct gctctatgct gcatccagat tggaaagtgg ggtcccatcc 180

aggttcagtg gcagtggatc tgggacggat tacactctca ccatcagcag cctgcagcct 240

gaagattttg caacttatta ctgtcaacag tattatagta cccccttcac tttcggccct 300

gggaccaagc tggagatcaa a 321

<210> 122

<211> 321

<212> DNA

<213> artificial sequence

<220>

<223> M15 VL NT

<400> 122

gacatccagt tgacccagtc tccatcctcc ctgtctgcat ctattggaga cagagtcacc 60

atcacttgcc gggcaagtca gggcgttaac agtgctttag cctggtatca gcagaaacca 120

gggaaacctc ctaacctcct gatctatgat gcctccagtt tggaaagtgg ggtcccatca 180

aggttcagcg gcagtggatc tgggagagat ttcactctca ccatcagcag cctgcagcct 240

gaagattttg caacttatta ctgtcaacag tttagtagtt accctctcac tttcggcgga 300

gggaccaaag tggatatcaa a 321

<210> 123

<211> 321

<212> DNA

<213> artificial sequence

<220>

<223> M20 VL NT

<400> 123

gccatccaga tgacccagtc tccatcctcc ctgtctgcat ctgtcgggaa cagagtcacc 60

atcacttgcc gggcaagtca aggcattagc agtgctgtag cctggtatca gcagaaacca 120

gggaaacccc ctaaactcct aatctcttat gcctccagtt tggaaagtgg ggtcccatca 180

aggttcagcg gcagtggatc tgggacagat ttcagtctca ccatcagcag cctgcagcct 240

gaagattttg caacttattt ctgtcaacag tttaatagtt accctctcac tttcggcgga 300

gggaccaagg tggagatcaa a 321

<210> 124

<211> 333

<212> DNA

<213> artificial sequence

<220>

<223> M22 VL NT

<400> 124

caatctgccc tgactcagcc tgcctccgtg tctgggtctc ctggacagtc gatcaccctc 60

tcctgcactg gaacccgccg tgacattggt ggttatgagt atgtctcctg gtaccaacaa 120

caccccggca aagcccccaa actccttata tttagtgtca ataatcggcc ctcaggggtt 180

tctcatcgct tctctggctc caagtctggc aacacggcct ccctgaccat ctctgggctc 240

caggctgagg acgaggctgc ttatttctgc agttcatatt caagccgcga cactctcgtc 300

cttttcggcg gagggaccaa gctgaccgtc cta 333

<210> 125

<211> 333

<212> DNA

<213> artificial sequence

<220>

<223> M24 VL NT

<400> 125

cagcctgtgc tgactcaacc accctcagcg tctgggaccc ccgggcagag ggtcaccatc 60

tcttgttctg gaagcagctc caacatcgga agtaattatg tatactggta ccagcagttc 120

ccgggaacgg cccccaaact cctcatctat atgaataatc agcggccctc aggggtccct 180

gaccgattct ctggctccaa gtctggcacc tcagcctccc tggccatcag tgggctccgg 240

tccgaggatg aggctgatta ttactgtgca gcaagggatg acagcctgag tggctatgtg 300

acatttggcg gagggaccaa gctgaccgtc cta 333

<210> 126

<211> 324

<212> DNA

<213> artificial sequence

<220>

<223> M27 VL NT

<400> 126

gaaattgtgt tgacacagtc tccgggcacc ctgtctttgt ctccggggga aagagccacc 60

ctctcctgca gggccagtca acctattgtc gccagtcact tagcctggta ccagcacaaa 120

cctggccagg ctcccaggct cctcatctat ggtgcatcca ccagggccgc tggcatccca 180

gacaggttca gtggcagtgg gtctgggaca gacttcactc tcaccatcag cagactggag 240

cctgaagatt ttgctgtgta tttctgtcag caatatggta tttcaccctt cactttcggc 300

cctgggacca aagtggatat caaa 324

<210> 127

<211> 333

<212> DNA

<213> artificial sequence

<220>

<223> M28 VL NT

<400> 127

cagtctgccc tgactcagcc tccctccgcg tccgggtctc ctggacagtc agtcaccatc 60

tcctgctctg gaaccagcag tgacgttggt ggttataact ttgtctcctg gtaccaacat 120

cacccaggca aagcccccaa actcatgatt tatgaggtca gtaagcggcc ctcaggggtc 180

cctgatcgct tctctggctc caagtctggc aacacggcct ccctgaccgt ctctgggctc 240

caggctgagg atgaggctga ttattactgc agctcatatg caggccgcaa caatccttat 300

ctcttcggaa ctgggaccaa gctgaccgtc cta 333

<210> 128

<211> 330

<212> DNA

<213> artificial sequence

<220>

<223> M31 VL NT

<400> 128

cagtctgccc tgactcagcc tccctccgcg tccgggtctc ctggacagtc agtcaccatc 60

tcctgcactg gaaccagcag tgacattggt ggttataatt ctgtctcctg gtaccaacaa 120

cacccaggca aagcccccaa actcataatt tatggggtca gtaggcggcc ctcaggggtc 180

cctgatcgct tctctggctc caagtctgcc aacacggcct ccctgaccgt ctctgggctc 240

caggctgtgg atgaggctga ttattactgc agctcctatg gaggcagcaa caatttgcta 300

ttcggcggag ggaccaagct gaccgtccta 330

<210> 129

<211> 321

<212> DNA

<213> artificial sequence

<220>

<223> M32 VL NT

<400> 129

gacatccgga tgacccagtc tccatcctcc ctgtctgcct ctgtaggaga cagagtcacc 60

gtcacttgcc aggcgagtga ggacattaac aactctttaa attggtatca gcagaaacca 120

gggaaagccc ctcaactcct gatctacgat gcatccgatt tggagacagg ggtcccatca 180

aggttcagtg gacgtgggtc tgggagagat ttcactctca ccatcagcag cctgcagcct 240

gaagattttg caacttatta ctgtcaacag cttaatagtt accccctcac tttcggcgga 300

gggaccaagc tggagatcaa a 321

<210> 130

<211> 321

<212> DNA

<213> artificial sequence

<220>

<223> M37 VL NT

<400> 130

gatattgtga tgactcagac tccatcctca ctgtctgcat ctgtagggga cagagtcacc 60

atcacttgtc gggcgagtca gggcattagc aattatttag cctggtttca gcagaaacca 120

gggaaagccc ctaagcccct gatctatgct gcatccagtt tgcaaagtgg ggtcccatca 180

aagttcagcg gcagtggatc tgggacagat ttcactctca ccatcagcaa cctgcagcct 240

gaagattttg caacttatat ctgccaacag tatagtagtt atcctatcac cttcggccaa 300

gggacacgac tggagatcaa a 321

<210> 131

<211> 360

<212> DNA

<213> artificial sequence

<220>

<223> M6 VH NT

<400> 131

caggtccagc tggtacagtc tgggggaggc ttggtcaagc ctggagggtc cctgagactc 60

tcctgtgcag cctctggatt caccttcagt gactactaca tgagctggat ccgccaggct 120

ccagggaagg ggctggagtg ggtttcatac attagtagta gtggtagtac catatactac 180

gcagactctg tgaagggccg attcaccatc tccagggaca acgccaagaa ctcactgtat 240

ctgcaaatga acagcctgag agccgaggac acggccgtgt attactgtgc gagagatggg 300

tatagaacgc acaactggtt cgacccctgg ggccagggaa ccctggtcac tgtctcctca 360

<210> 132

<211> 366

<212> DNA

<213> artificial sequence

<220>

<223> M7 VH NT

<400> 132

caggtgcagc tggtacagtc tggagcagag gtgaaaaagt ccggggagtc tcttaagatc 60

tcctgtaagg gttctggata cggctttggc gcctactgga tcgcctgggt gcgccagatg 120

cccggcaaag gcctggagtg gatggggatc atctatcctg gtgactctcg agtcatctac 180

agcccgtact tccaaggcca ggtcaccatc tcagccgaca agtccatcag caccgcctac 240

ctgcagtgga gcagcctgaa ggcctcggac accgccatgt attactgtgc gagattcggg 300

ggacccaaat tcgctaccaa ctggttcgac atctggggcc agggaaccac ggtcaccgtc 360

tcctca 366

<210> 133

<211> 363

<212> DNA

<213> artificial sequence

<220>

<223> M8 VH NT

<400> 133

caggtgcatc tggtggagtc tgggggaggc gtggtccagc cggggaggtc cctgagagtc 60

tcctgtgcag cctctggatt caccttcagc ggctatgcta tgtactgggt ccgccaggct 120

ccagggaagg gactggaata tgtttcagct attactacca atgggggtag cacaaactac 180

gcagactcag tgaagggcag attcaccatc tccagagaca attccaagaa cacgctatat 240

cttcaaatga gcagcctgag agccggggac acggctgtgt attactgtgc aagaggggcc 300

ccagggtacc gaggatacta catggacgtc tggggcaaag ggaccacggt caccgtctcc 360

tca 363

<210> 134

<211> 354

<212> DNA

<213> artificial sequence

<220>

<223> M10 VH NT

<400> 134

caggtgcagc tggtgcagtc tgggggaggc ttggtacagc ctggggggtc cctgagactc 60

tcctgtgcag cctctggatt cacctttagc agctatgcca tgagctgggt ccgccaggct 120

ccagggaagg ggctggagtg ggtctcagct attagtggta gtggtggtag cacatactac 180

gcagactccg tgaagggccg gttcaccatc tccagagaca attccaagaa cacgctgtat 240

ctgcaaatga acagcctgag agccgaggac acggccgtat attactgtgc gaaacggggc 300

agcagctggt actttgacta ctggggccag ggaaccctgg tcactgtctc ctca 354

<210> 135

<211> 357

<212> DNA

<213> artificial sequence

<220>

<223> M12 VH NT

<400> 135

gaggtgcagc tggtggagtc tggggctgag gtgaagaagc ctggggcctc agtgaaggtt 60

tcctgcaagg catctggata caccttcacc acctactata tacactgggt gcgacaggcc 120

cctggacaag ggcttgagtg gatgggaata atcaacccta gtagtggtag cactacctac 180

acacagaagt tccagggcag agtcaccatg accagggaca cgtccacgag cacagtctac 240

attgaactga gcggcctgag atctgaagac acggccgtgt attactgtgc ccgaggggag 300

acgcttcggg gctactttga ctactggggc cagggaaccc tggtcaccgt ctcttca 357

<210> 136

<211> 369

<212> DNA

<213> artificial sequence

<220>

<223> M13 VH NT

<400> 136

caggtgcagc tggtacagtc tggggctgaa gtgaagaagc ctgggtcctc ggtgaaggtc 60

tcctgcaaga cttctgcaga caccttcagc gcaaatacta tcaactgggt gcgacaggcc 120

cctggacacg ggcttgagtg gatgggaagg atcatccctt ctctgaatat acgagactac 180

gcacaggagt tccagggcag agtcacattt accgcggacg aatccacgaa cacagtctat 240

atgcagttga ccagcctgag atctgaggac acggccgtgt attactgtgc gagagatccg 300

ggcagcacct ggtccccgaa tcaattcttc ccccactggg gccagggcac cctggtcacc 360

gtctcctca 369

<210> 137

<211> 360

<212> DNA

<213> artificial sequence

<220>

<223> M15 VH NT

<400> 137

caggtgcagc tggtacagtc tggggctgag gtgaagaagc ctggggcctc agtgaaggtt 60

tcctgcaagg catctggata caccttcacc agctactata tgcactgggt gcgacaggcc 120

cctggacaag ggcttgagtg gatgggaata atcaacccta gtggtggtag cacaagctac 180

gcacagaagt tccagggcag agtcaccatg accagggaca cgtccacgag cacagtctac 240

atggagctga gcagcctgag atctgaggac acggccgtgt attactgtgc gagagcccaa 300

agggggggct ccgtctactt tgactactgg ggccagggaa ccctggtcac cgtctcctca 360

<210> 138

<211> 360

<212> DNA

<213> artificial sequence

<220>

<223> M20 VH NT

<400> 138

caggtccagc tggtacagtc tggagcggag gtgagaaagc ccggggagtc tctgaagata 60

tcatgtaagg ggtctggata tagctttcgt gactcctgga tcgcctgggt gcgccagatg 120

cccgggcaag gcctggaatg gatgggcatc atctttcctg gtgactctaa tcccatatac 180

agcccgtcct tccaaggcca ggtcaccata tcagccgaca cgtccatcag taccaccttc 240

ctgcagtgga gaagcctgaa ggcctcggac agcgccatat attactgtgc gagacatgca 300

gcctggggtg cggggtggtt cgacccctgg ggccagggaa ccctggtcac tgtctcctca 360

<210> 139

<211> 354

<212> DNA

<213> artificial sequence

<220>

<223> M22 VH NT

<400> 139

caggtccagc tggtgcagtc tggggctgag gtgaagaagc ctgggtcctc ggtgaaggtc 60

tcctgcaagg cttctggagg caccttcagc agctatgcta tcagctgggt gcgacaggcc 120

cctggacaag ggcttgagtg gatgggaggg atcatcccta tctttggtac agcaaactac 180

gcacagaagt tccagggcag agtcacgatt accgcggacg aatccacgag cacagcctac 240

atggagctga gcagcctgag atctgaggac acggccgtgt attactgtgc gagtggccgt 300

agtgggagct acgggttgta ctggggccag ggaaccctgg tcaccgtctc ctca 354

<210> 140

<211> 348

<212> DNA

<213> artificial sequence

<220>

<223> M24 VH NT

<400> 140

gaagtgcatc tggtggagtc tgggggaggc ttggtacagc ctggggggtc cctgagactc 60

tcctgtgcag cctctggatt cacctttagc agctatgcca tgagctgggt ccgccaggct 120

ccagggaagg ggctggagtg ggtctcagct attagtggta gtggtggtag cacatactac 180

gcagactccg tgaagggccg gttcaccatc tccagagaca attccaagaa cacgctgtat 240

ctgcaaatga acagcctgaa aaccgaggac acagccgtgt attactgtac tagaggagtg 300

gccacctttg actactgggg ccagggaacc ctggtcactg tctcctca 348

<210> 141

<211> 375

<212> DNA

<213> artificial sequence

<220>

<223> M27 VH NT

<400> 141

caggtgcagc tggtacagtc tggagcagag gtgaaaaagc cgggggagtc tctgaagatc 60

tcctgtcagg gttctggata cagttttacc gactactgga tcggctgggt gcgacaggcc 120

cctggacaag ggcttgagtg gatgggatgg atcaccccta acaatggtaa cacaaactat 180

gcaccgaagt tccagggcag agtcaccctg accacagaca catccacgag cacagcctac 240

atggagctga ggagcctgac ctctgacgac acggccgtgt atttctgtgc gaggagaggt 300

cggaacagca gcggctactt atattattac agtatggacg tctggggcca agggaccacg 360

gtcaccgtct cctca 375

<210> 142

<211> 366

<212> DNA

<213> artificial sequence

<220>

<223> M28 VH NT

<400> 142

cagctgcagc tgcaggagtc gggggctgag gtgaagaagc ctgggtcctc ggtgaaggtc 60

tcctgcaagg cttctggagg caccttcagc agctatgcta tcagctgggt gcgacaggcc 120

cctggacaag ggcttgagtg gatgggaggg atcatcccta tctttggtac agcaaactac 180

gcacagaagt tccagggcag agtcacgatt accgcggacg aatccacgag cacagcctac 240

atggagctga gcagcctgag atctgaggac acggccgtgt attactgtgc gagagatctg 300

gggggataca gctatggcca cggtcttgac tactggggcc agggaaccct ggtcaccgtc 360

tcctca 366

<210> 143

<211> 351

<212> DNA

<213> artificial sequence

<220>

<223> M31 VH NT

<400> 143

gaggtgcatc tggtggagtc tgggggaggc ttggcccagc ctggggggtc cctgagactc 60

tcctgtgcag cctctggatt cagctttagt agttcttgga tggcctgggt ccgccaggct 120

ccagggaagg ggctggagtg ggtggccaac ataaagcaag atggaagttc gcaatactat 180

gtggactctg tgaagggccg attcaccatc tccagagaca acgccaagaa ctcactgtct 240

ctgcaaatga acagcctgag agccgaggac acggctgtgt attactgtgc gagagacatc 300

tggtactcga ttgactactg gggccaggga accctggtca ctgtctcctc a 351

<210> 144

<211> 360

<212> DNA

<213> artificial sequence

<220>

<223> M32 VH NT

<400> 144

caggtccagc tggtacagtc tggggctgag gtgaagaagc ctggggcctc agtgaaggtt 60

tcctgcaagg cgtctggatt taccttcatc ggctactatc tacactgggt gcgacaggcc 120

cctggacaag ggcttgagtg gatgggaata atcaaccctt caggtggtag gacaagcatg 180

gcacagaagt tccagggcag agtctccatg accactgaca cgtccacggg cacagtctac 240

ttggacctgg gcagactggg atctgatgac acggccgtgt attactgtgc gagagccgat 300

aactggaacg ccgggtccat ggacgtctgg ggcaatggga ccacggtcac cgtctcctca 360

<210> 145

<211> 351

<212> DNA

<213> artificial sequence

<220>

<223> M37 VH NT

<400> 145

cagctgcagc tgcaggagtc gggcccagga ctggtgaagc cttcggagac cctgtccctc 60

acctgcgctg tctcgggtgg ctccatcagc ccttactact ggacctggat ccggcagtcc 120

ccagggaagg cgatggagtg gatgggatat atccattaca gtgggaggac caactacaac 180

ccctccctcg agagtcgagc caccttttca gtagacacgt ccaagaacca gatctccctg 240

aagctgaact ctgtgaccgc tgcggacacg gccgtgtatt actgtacgaa agtgggagac 300

cctggcttat tcgactactg gggcccggga accctggtca ctgtctcctc a 351

<210> 146

<211> 242

<212> PRT

<213> artificial sequence

<220>

<223> M6 scFv

<400> 146

Glu Ile Val Met Thr Gln Ser Pro Ala Thr Leu Ser Leu Ser Pro Gly

1 5 10 15

Glu Arg Ala Thr Leu Ser Cys Arg Ala Ser Gln Ser Ile Gly Asn Ser

20 25 30

Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro Arg Leu Leu Ile

35 40 45

Tyr Asp Val Ser Asn Arg Ala Thr Gly Ile Pro Ala Arg Phe Ser Gly

50 55 60

Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Glu Pro

65 70 75 80

Glu Asp Phe Ala Val Tyr Tyr Cys Gln His Arg Tyr Ser Trp Pro Leu

85 90 95

Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys Gly Gly Gly Gly Ser

100 105 110

Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gln Val Gln Leu Val Gln

115 120 125

Ser Gly Gly Gly Leu Val Lys Pro Gly Gly Ser Leu Arg Leu Ser Cys

130 135 140

Ala Ala Ser Gly Phe Thr Phe Ser Asp Tyr Tyr Met Ser Trp Ile Arg

145 150 155 160

Gln Ala Pro Gly Lys Gly Leu Glu Trp Val Ser Tyr Ile Ser Ser Ser

165 170 175

Gly Ser Thr Ile Tyr Tyr Ala Asp Ser Val Lys Gly Arg Phe Thr Ile

180 185 190

Ser Arg Asp Asn Ala Lys Asn Ser Leu Tyr Leu Gln Met Asn Ser Leu

195 200 205

Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala Arg Asp Gly Tyr Arg

210 215 220

Thr His Asn Trp Phe Asp Pro Trp Gly Gln Gly Thr Leu Val Thr Val

225 230 235 240

Ser Ser

<210> 147

<211> 244

<212> PRT

<213> artificial sequence

<220>

<223> M7 scFv

<400> 147

Asp Ile Arg Leu Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Leu Gly

1 5 10 15

Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Ala Ile Ser Ser Ala

20 25 30

Leu Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Arg Leu Leu Ile

35 40 45

Tyr Asp Ala Ser Thr Leu Glu Ser Gly Val Pro Ser Arg Phe Ser Gly

50 55 60

Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro

65 70 75 80

Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Ala Asp Ser Phe Pro Leu

85 90 95

Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys Gly Gly Gly Gly Ser

100 105 110

Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gln Val Gln Leu Val Gln

115 120 125

Ser Gly Ala Glu Val Lys Lys Ser Gly Glu Ser Leu Lys Ile Ser Cys

130 135 140

Lys Gly Ser Gly Tyr Gly Phe Gly Ala Tyr Trp Ile Ala Trp Val Arg

145 150 155 160

Gln Met Pro Gly Lys Gly Leu Glu Trp Met Gly Ile Ile Tyr Pro Gly

165 170 175

Asp Ser Arg Val Ile Tyr Ser Pro Tyr Phe Gln Gly Gln Val Thr Ile

180 185 190

Ser Ala Asp Lys Ser Ile Ser Thr Ala Tyr Leu Gln Trp Ser Ser Leu

195 200 205

Lys Ala Ser Asp Thr Ala Met Tyr Tyr Cys Ala Arg Phe Gly Gly Pro

210 215 220

Lys Phe Ala Thr Asn Trp Phe Asp Ile Trp Gly Gln Gly Thr Thr Val

225 230 235 240

Thr Val Ser Ser

<210> 148

<211> 243

<212> PRT

<213> artificial sequence

<220>

<223> M8 scFv

<400> 148

Asp Ile Gln Leu Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly

1 5 10 15

Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Ser Ile Ser Ser Ser

20 25 30

Leu Asn Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile

35 40 45

Tyr Ala Ala Ser Ser Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly

50 55 60

Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro

65 70 75 80

Glu Asp Phe Ala Thr Tyr Ser Cys Gln Gln Ser Tyr Ser Thr Pro Leu

85 90 95

Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys Gly Gly Gly Gly Ser

100 105 110

Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gln Val His Leu Val Glu

115 120 125

Ser Gly Gly Gly Val Val Gln Pro Gly Arg Ser Leu Arg Val Ser Cys

130 135 140

Ala Ala Ser Gly Phe Thr Phe Ser Gly Tyr Ala Met Tyr Trp Val Arg

145 150 155 160

Gln Ala Pro Gly Lys Gly Leu Glu Tyr Val Ser Ala Ile Thr Thr Asn

165 170 175

Gly Gly Ser Thr Asn Tyr Ala Asp Ser Val Lys Gly Arg Phe Thr Ile

180 185 190

Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu Gln Met Ser Ser Leu

195 200 205

Arg Ala Gly Asp Thr Ala Val Tyr Tyr Cys Ala Arg Gly Ala Pro Gly

210 215 220

Tyr Arg Gly Tyr Tyr Met Asp Val Trp Gly Lys Gly Thr Thr Val Thr

225 230 235 240

Val Ser Ser

<210> 149

<211> 240

<212> PRT

<213> artificial sequence

<220>

<223> M10 scFv

<400> 149

Asp Ile Arg Met Thr Gln Ser Pro Ser Thr Leu Ser Ala Ser Val Gly

1 5 10 15

Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Ser Ile Ser Ser Trp

20 25 30

Leu Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile

35 40 45

Tyr Lys Ala Ser Ser Leu Glu Ser Gly Val Pro Ser Arg Phe Ser Gly

50 55 60

Ser Gly Ser Gly Thr Glu Phe Thr Leu Thr Ile Ser Thr Leu Gln Pro

65 70 75 80

Asp Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Tyr Tyr Ser Tyr Pro Leu

85 90 95

Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys Gly Gly Gly Gly Ser

100 105 110

Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gln Val Gln Leu Val Gln

115 120 125

Ser Gly Gly Gly Leu Val Gln Pro Gly Gly Ser Leu Arg Leu Ser Cys

130 135 140

Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr Ala Met Ser Trp Val Arg

145 150 155 160

Gln Ala Pro Gly Lys Gly Leu Glu Trp Val Ser Ala Ile Ser Gly Ser

165 170 175

Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val Lys Gly Arg Phe Thr Ile

180 185 190

Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu Gln Met Asn Ser Leu

195 200 205

Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala Lys Arg Gly Ser Ser

210 215 220

Trp Tyr Phe Asp Tyr Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser

225 230 235 240

<210> 150

<211> 241

<212> PRT

<213> artificial sequence

<220>

<223> M12 scFv

<400> 150

Ala Ile Arg Leu Thr Gln Ser Pro Ser Leu Leu Ser Ala Ser Val Gly

1 5 10 15

Asp Arg Val Thr Val Thr Cys Arg Ala Ser Gln Gly Gly Gly Asn Tyr

20 25 30

Leu Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile

35 40 45

Tyr Gly Ala Ser Lys Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly

50 55 60

Ser Gly Ser Gly Thr Glu Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro

65 70 75 80

Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Leu Asn Ser Tyr Pro Val

85 90 95

Thr Phe Gly Gln Gly Thr Lys Val Asp Ile Lys Gly Gly Gly Gly Ser

100 105 110

Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Glu Val Gln Leu Val Glu

115 120 125

Ser Gly Ala Glu Val Lys Lys Pro Gly Ala Ser Val Lys Val Ser Cys

130 135 140

Lys Ala Ser Gly Tyr Thr Phe Thr Thr Tyr Tyr Ile His Trp Val Arg

145 150 155 160

Gln Ala Pro Gly Gln Gly Leu Glu Trp Met Gly Ile Ile Asn Pro Ser

165 170 175

Ser Gly Ser Thr Thr Tyr Thr Gln Lys Phe Gln Gly Arg Val Thr Met

180 185 190

Thr Arg Asp Thr Ser Thr Ser Thr Val Tyr Ile Glu Leu Ser Gly Leu

195 200 205

Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys Ala Arg Gly Glu Thr Leu

210 215 220

Arg Gly Tyr Phe Asp Tyr Trp Gly Gln Gly Thr Leu Val Thr Val Ser

225 230 235 240

Ser

<210> 151

<211> 245

<212> PRT

<213> artificial sequence

<220>

<223> M13 scFv

<400> 151

Ala Ile Arg Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly

1 5 10 15

Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Gly Ile Ser Asn Ser

20 25 30

Leu Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Leu

35 40 45

Tyr Ala Ala Ser Arg Leu Glu Ser Gly Val Pro Ser Arg Phe Ser Gly

50 55 60

Ser Gly Ser Gly Thr Asp Tyr Thr Leu Thr Ile Ser Ser Leu Gln Pro

65 70 75 80

Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Tyr Tyr Ser Thr Pro Phe

85 90 95

Thr Phe Gly Pro Gly Thr Lys Leu Glu Ile Lys Gly Gly Gly Gly Ser

100 105 110

Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gln Val Gln Leu Val Gln

115 120 125

Ser Gly Ala Glu Val Lys Lys Pro Gly Ser Ser Val Lys Val Ser Cys

130 135 140

Lys Thr Ser Ala Asp Thr Phe Ser Ala Asn Thr Ile Asn Trp Val Arg

145 150 155 160

Gln Ala Pro Gly His Gly Leu Glu Trp Met Gly Arg Ile Ile Pro Ser

165 170 175

Leu Asn Ile Arg Asp Tyr Ala Gln Glu Phe Gln Gly Arg Val Thr Phe

180 185 190

Thr Ala Asp Glu Ser Thr Asn Thr Val Tyr Met Gln Leu Thr Ser Leu

195 200 205

Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys Ala Arg Asp Pro Gly Ser

210 215 220

Thr Trp Ser Pro Asn Gln Phe Phe Pro His Trp Gly Gln Gly Thr Leu

225 230 235 240

Val Thr Val Ser Ser

245

<210> 152

<211> 242

<212> PRT

<213> artificial sequence

<220>

<223> M15 scFv

<400> 152

Asp Ile Gln Leu Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Ile Gly

1 5 10 15

Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Gly Val Asn Ser Ala

20 25 30

Leu Ala Trp Tyr Gln Gln Lys Pro Gly Lys Pro Pro Asn Leu Leu Ile

35 40 45

Tyr Asp Ala Ser Ser Leu Glu Ser Gly Val Pro Ser Arg Phe Ser Gly

50 55 60

Ser Gly Ser Gly Arg Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro

65 70 75 80

Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Phe Ser Ser Tyr Pro Leu

85 90 95

Thr Phe Gly Gly Gly Thr Lys Val Asp Ile Lys Gly Gly Gly Gly Ser

100 105 110

Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gln Val Gln Leu Val Gln

115 120 125

Ser Gly Ala Glu Val Lys Lys Pro Gly Ala Ser Val Lys Val Ser Cys

130 135 140

Lys Ala Ser Gly Tyr Thr Phe Thr Ser Tyr Tyr Met His Trp Val Arg

145 150 155 160

Gln Ala Pro Gly Gln Gly Leu Glu Trp Met Gly Ile Ile Asn Pro Ser

165 170 175

Gly Gly Ser Thr Ser Tyr Ala Gln Lys Phe Gln Gly Arg Val Thr Met

180 185 190

Thr Arg Asp Thr Ser Thr Ser Thr Val Tyr Met Glu Leu Ser Ser Leu

195 200 205

Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys Ala Arg Ala Gln Arg Gly

210 215 220

Gly Ser Val Tyr Phe Asp Tyr Trp Gly Gln Gly Thr Leu Val Thr Val

225 230 235 240

Ser Ser

<210> 153

<211> 242

<212> PRT

<213> artificial sequence

<220>

<223> M20 scFv

<400> 153

Ala Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly

1 5 10 15

Asn Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Gly Ile Ser Ser Ala

20 25 30

Val Ala Trp Tyr Gln Gln Lys Pro Gly Lys Pro Pro Lys Leu Leu Ile

35 40 45

Ser Tyr Ala Ser Ser Leu Glu Ser Gly Val Pro Ser Arg Phe Ser Gly

50 55 60

Ser Gly Ser Gly Thr Asp Phe Ser Leu Thr Ile Ser Ser Leu Gln Pro

65 70 75 80

Glu Asp Phe Ala Thr Tyr Phe Cys Gln Gln Phe Asn Ser Tyr Pro Leu

85 90 95

Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys Gly Gly Gly Gly Ser

100 105 110

Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gln Val Gln Leu Val Gln

115 120 125

Ser Gly Ala Glu Val Arg Lys Pro Gly Glu Ser Leu Lys Ile Ser Cys

130 135 140

Lys Gly Ser Gly Tyr Ser Phe Arg Asp Ser Trp Ile Ala Trp Val Arg

145 150 155 160

Gln Met Pro Gly Gln Gly Leu Glu Trp Met Gly Ile Ile Phe Pro Gly

165 170 175

Asp Ser Asn Pro Ile Tyr Ser Pro Ser Phe Gln Gly Gln Val Thr Ile

180 185 190

Ser Ala Asp Thr Ser Ile Ser Thr Thr Phe Leu Gln Trp Arg Ser Leu

195 200 205

Lys Ala Ser Asp Ser Ala Ile Tyr Tyr Cys Ala Arg His Ala Ala Trp

210 215 220

Gly Ala Gly Trp Phe Asp Pro Trp Gly Gln Gly Thr Leu Val Thr Val

225 230 235 240

Ser Ser

<210> 154

<211> 244

<212> PRT

<213> artificial sequence

<220>

<223> M22 scFv

<400> 154

Gln Ser Ala Leu Thr Gln Pro Ala Ser Val Ser Gly Ser Pro Gly Gln

1 5 10 15

Ser Ile Thr Leu Ser Cys Thr Gly Thr Arg Arg Asp Ile Gly Gly Tyr

20 25 30

Glu Tyr Val Ser Trp Tyr Gln Gln His Pro Gly Lys Ala Pro Lys Leu

35 40 45

Leu Ile Phe Ser Val Asn Asn Arg Pro Ser Gly Val Ser His Arg Phe

50 55 60

Ser Gly Ser Lys Ser Gly Asn Thr Ala Ser Leu Thr Ile Ser Gly Leu

65 70 75 80

Gln Ala Glu Asp Glu Ala Ala Tyr Phe Cys Ser Ser Tyr Ser Ser Arg

85 90 95

Asp Thr Leu Val Leu Phe Gly Gly Gly Thr Lys Leu Thr Val Leu Gly

100 105 110

Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gln Val

115 120 125

Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ser Ser Val

130 135 140

Lys Val Ser Cys Lys Ala Ser Gly Gly Thr Phe Ser Ser Tyr Ala Ile

145 150 155 160

Ser Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met Gly Gly

165 170 175

Ile Ile Pro Ile Phe Gly Thr Ala Asn Tyr Ala Gln Lys Phe Gln Gly

180 185 190

Arg Val Thr Ile Thr Ala Asp Glu Ser Thr Ser Thr Ala Tyr Met Glu

195 200 205

Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys Ala Ser

210 215 220

Gly Arg Ser Gly Ser Tyr Gly Leu Tyr Trp Gly Gln Gly Thr Leu Val

225 230 235 240

Thr Val Ser Ser

<210> 155

<211> 242

<212> PRT

<213> artificial sequence

<220>

<223> M24 scFv

<400> 155

Gln Pro Val Leu Thr Gln Pro Pro Ser Ala Ser Gly Thr Pro Gly Gln

1 5 10 15

Arg Val Thr Ile Ser Cys Ser Gly Ser Ser Ser Asn Ile Gly Ser Asn

20 25 30

Tyr Val Tyr Trp Tyr Gln Gln Phe Pro Gly Thr Ala Pro Lys Leu Leu

35 40 45

Ile Tyr Met Asn Asn Gln Arg Pro Ser Gly Val Pro Asp Arg Phe Ser

50 55 60

Gly Ser Lys Ser Gly Thr Ser Ala Ser Leu Ala Ile Ser Gly Leu Arg

65 70 75 80

Ser Glu Asp Glu Ala Asp Tyr Tyr Cys Ala Ala Arg Asp Asp Ser Leu

85 90 95

Ser Gly Tyr Val Thr Phe Gly Gly Gly Thr Lys Leu Thr Val Leu Gly

100 105 110

Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Glu Val

115 120 125

His Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly Ser Leu

130 135 140

Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr Ala Met

145 150 155 160

Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val Ser Ala

165 170 175

Ile Ser Gly Ser Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val Lys Gly

180 185 190

Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu Gln

195 200 205

Met Asn Ser Leu Lys Thr Glu Asp Thr Ala Val Tyr Tyr Cys Thr Arg

210 215 220

Gly Val Ala Thr Phe Asp Tyr Trp Gly Gln Gly Thr Leu Val Thr Val

225 230 235 240

Ser Ser

<210> 156

<211> 248

<212> PRT

<213> artificial sequence

<220>

<223> M27 scFv

<400> 156

Glu Ile Val Leu Thr Gln Ser Pro Gly Thr Leu Ser Leu Ser Pro Gly

1 5 10 15

Glu Arg Ala Thr Leu Ser Cys Arg Ala Ser Gln Pro Ile Val Ala Ser

20 25 30

His Leu Ala Trp Tyr Gln His Lys Pro Gly Gln Ala Pro Arg Leu Leu

35 40 45

Ile Tyr Gly Ala Ser Thr Arg Ala Ala Gly Ile Pro Asp Arg Phe Ser

50 55 60

Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Arg Leu Glu

65 70 75 80

Pro Glu Asp Phe Ala Val Tyr Phe Cys Gln Gln Tyr Gly Ile Ser Pro

85 90 95

Phe Thr Phe Gly Pro Gly Thr Lys Val Asp Ile Lys Gly Gly Gly Gly

100 105 110

Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gln Val Gln Leu Val

115 120 125

Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Glu Ser Leu Lys Ile Ser

130 135 140

Cys Gln Gly Ser Gly Tyr Ser Phe Thr Asp Tyr Trp Ile Gly Trp Val

145 150 155 160

Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met Gly Trp Ile Thr Pro

165 170 175

Asn Asn Gly Asn Thr Asn Tyr Ala Pro Lys Phe Gln Gly Arg Val Thr

180 185 190

Leu Thr Thr Asp Thr Ser Thr Ser Thr Ala Tyr Met Glu Leu Arg Ser

195 200 205

Leu Thr Ser Asp Asp Thr Ala Val Tyr Phe Cys Ala Arg Arg Gly Arg

210 215 220

Asn Ser Ser Gly Tyr Leu Tyr Tyr Tyr Ser Met Asp Val Trp Gly Gln

225 230 235 240

Gly Thr Thr Val Thr Val Ser Ser

245

<210> 157

<211> 248

<212> PRT

<213> artificial sequence

<220>

<223> M28 scFv

<400> 157

Gln Ser Ala Leu Thr Gln Pro Pro Ser Ala Ser Gly Ser Pro Gly Gln

1 5 10 15

Ser Val Thr Ile Ser Cys Ser Gly Thr Ser Ser Asp Val Gly Gly Tyr

20 25 30

Asn Phe Val Ser Trp Tyr Gln His His Pro Gly Lys Ala Pro Lys Leu

35 40 45

Met Ile Tyr Glu Val Ser Lys Arg Pro Ser Gly Val Pro Asp Arg Phe

50 55 60

Ser Gly Ser Lys Ser Gly Asn Thr Ala Ser Leu Thr Val Ser Gly Leu

65 70 75 80

Gln Ala Glu Asp Glu Ala Asp Tyr Tyr Cys Ser Ser Tyr Ala Gly Arg

85 90 95

Asn Asn Pro Tyr Leu Phe Gly Thr Gly Thr Lys Leu Thr Val Leu Gly

100 105 110

Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gln Leu

115 120 125

Gln Leu Gln Glu Ser Gly Ala Glu Val Lys Lys Pro Gly Ser Ser Val

130 135 140

Lys Val Ser Cys Lys Ala Ser Gly Gly Thr Phe Ser Ser Tyr Ala Ile

145 150 155 160

Ser Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met Gly Gly

165 170 175

Ile Ile Pro Ile Phe Gly Thr Ala Asn Tyr Ala Gln Lys Phe Gln Gly

180 185 190

Arg Val Thr Ile Thr Ala Asp Glu Ser Thr Ser Thr Ala Tyr Met Glu

195 200 205

Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys Ala Arg

210 215 220

Asp Leu Gly Gly Tyr Ser Tyr Gly His Gly Leu Asp Tyr Trp Gly Gln

225 230 235 240

Gly Thr Leu Val Thr Val Ser Ser

245

<210> 158

<211> 242

<212> PRT

<213> artificial sequence

<220>

<223> M31 scFv

<400> 158

Gln Ser Ala Leu Thr Gln Pro Pro Ser Ala Ser Gly Ser Pro Gly Gln

1 5 10 15

Ser Val Thr Ile Ser Cys Thr Gly Thr Ser Ser Asp Ile Gly Gly Tyr

20 25 30

Asn Ser Val Ser Trp Tyr Gln Gln His Pro Gly Lys Ala Pro Lys Leu

35 40 45

Ile Ile Tyr Gly Val Ser Arg Arg Pro Ser Gly Val Pro Asp Arg Phe

50 55 60

Ser Gly Ser Lys Ser Ala Asn Thr Ala Ser Leu Thr Val Ser Gly Leu

65 70 75 80

Gln Ala Val Asp Glu Ala Asp Tyr Tyr Cys Ser Ser Tyr Gly Gly Ser

85 90 95

Asn Asn Leu Leu Phe Gly Gly Gly Thr Lys Leu Thr Val Leu Gly Gly

100 105 110

Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Glu Val His

115 120 125

Leu Val Glu Ser Gly Gly Gly Leu Ala Gln Pro Gly Gly Ser Leu Arg

130 135 140

Leu Ser Cys Ala Ala Ser Gly Phe Ser Phe Ser Ser Ser Trp Met Ala

145 150 155 160

Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val Ala Asn Ile

165 170 175

Lys Gln Asp Gly Ser Ser Gln Tyr Tyr Val Asp Ser Val Lys Gly Arg

180 185 190

Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Ser Leu Ser Leu Gln Met

195 200 205

Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala Arg Asp

210 215 220

Ile Trp Tyr Ser Ile Asp Tyr Trp Gly Gln Gly Thr Leu Val Thr Val

225 230 235 240

Ser Ser

<210> 159

<211> 242

<212> PRT

<213> artificial sequence

<220>

<223> M32 scFv

<400> 159

Asp Ile Arg Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly

1 5 10 15

Asp Arg Val Thr Val Thr Cys Gln Ala Ser Glu Asp Ile Asn Asn Ser

20 25 30

Leu Asn Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Gln Leu Leu Ile

35 40 45

Tyr Asp Ala Ser Asp Leu Glu Thr Gly Val Pro Ser Arg Phe Ser Gly

50 55 60

Arg Gly Ser Gly Arg Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro

65 70 75 80

Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Leu Asn Ser Tyr Pro Leu

85 90 95

Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys Gly Gly Gly Gly Ser

100 105 110

Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gln Val Gln Leu Val Gln

115 120 125

Ser Gly Ala Glu Val Lys Lys Pro Gly Ala Ser Val Lys Val Ser Cys

130 135 140

Lys Ala Ser Gly Phe Thr Phe Ile Gly Tyr Tyr Leu His Trp Val Arg

145 150 155 160

Gln Ala Pro Gly Gln Gly Leu Glu Trp Met Gly Ile Ile Asn Pro Ser

165 170 175

Gly Gly Arg Thr Ser Met Ala Gln Lys Phe Gln Gly Arg Val Ser Met

180 185 190

Thr Thr Asp Thr Ser Thr Gly Thr Val Tyr Leu Asp Leu Gly Arg Leu

195 200 205

Gly Ser Asp Asp Thr Ala Val Tyr Tyr Cys Ala Arg Ala Asp Asn Trp

210 215 220

Asn Ala Gly Ser Met Asp Val Trp Gly Asn Gly Thr Thr Val Thr Val

225 230 235 240

Ser Ser

<210> 160

<211> 239

<212> PRT

<213> artificial sequence

<220>

<223> M37 scFv

<400> 160

Asp Ile Val Met Thr Gln Thr Pro Ser Ser Leu Ser Ala Ser Val Gly

1 5 10 15

Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Gly Ile Ser Asn Tyr

20 25 30

Leu Ala Trp Phe Gln Gln Lys Pro Gly Lys Ala Pro Lys Pro Leu Ile

35 40 45

Tyr Ala Ala Ser Ser Leu Gln Ser Gly Val Pro Ser Lys Phe Ser Gly

50 55 60

Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Asn Leu Gln Pro

65 70 75 80

Glu Asp Phe Ala Thr Tyr Ile Cys Gln Gln Tyr Ser Ser Tyr Pro Ile

85 90 95

Thr Phe Gly Gln Gly Thr Arg Leu Glu Ile Lys Gly Gly Gly Gly Ser

100 105 110

Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gln Leu Gln Leu Gln Glu

115 120 125

Ser Gly Pro Gly Leu Val Lys Pro Ser Glu Thr Leu Ser Leu Thr Cys

130 135 140

Ala Val Ser Gly Gly Ser Ile Ser Pro Tyr Tyr Trp Thr Trp Ile Arg

145 150 155 160

Gln Ser Pro Gly Lys Ala Met Glu Trp Met Gly Tyr Ile His Tyr Ser

165 170 175

Gly Arg Thr Asn Tyr Asn Pro Ser Leu Glu Ser Arg Ala Thr Phe Ser

180 185 190

Val Asp Thr Ser Lys Asn Gln Ile Ser Leu Lys Leu Asn Ser Val Thr

195 200 205

Ala Ala Asp Thr Ala Val Tyr Tyr Cys Thr Lys Val Gly Asp Pro Gly

210 215 220

Leu Phe Asp Tyr Trp Gly Pro Gly Thr Leu Val Thr Val Ser Ser

225 230 235

<210> 161

<211> 486

<212> PRT

<213> artificial sequence

<220>

<223> M6 CAR AA

<400> 161

Met Ala Leu Pro Val Thr Ala Leu Leu Leu Pro Leu Ala Leu Leu Leu

1 5 10 15

His Ala Ala Arg Pro Glu Ile Val Met Thr Gln Ser Pro Ala Thr Leu

20 25 30

Ser Leu Ser Pro Gly Glu Arg Ala Thr Leu Ser Cys Arg Ala Ser Gln

35 40 45

Ser Ile Gly Asn Ser Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln Ala

50 55 60

Pro Arg Leu Leu Ile Tyr Asp Val Ser Asn Arg Ala Thr Gly Ile Pro

65 70 75 80

Ala Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile

85 90 95

Ser Ser Leu Glu Pro Glu Asp Phe Ala Val Tyr Tyr Cys Gln His Arg

100 105 110

Tyr Ser Trp Pro Leu Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys

115 120 125

Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gln

130 135 140

Val Gln Leu Val Gln Ser Gly Gly Gly Leu Val Lys Pro Gly Gly Ser

145 150 155 160

Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Asp Tyr Tyr

165 170 175

Met Ser Trp Ile Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val Ser

180 185 190

Tyr Ile Ser Ser Ser Gly Ser Thr Ile Tyr Tyr Ala Asp Ser Val Lys

195 200 205

Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Ser Leu Tyr Leu

210 215 220

Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala

225 230 235 240

Arg Asp Gly Tyr Arg Thr His Asn Trp Phe Asp Pro Trp Gly Gln Gly

245 250 255

Thr Leu Val Thr Val Ser Ser Thr Thr Thr Pro Ala Pro Arg Pro Pro

260 265 270

Thr Pro Ala Pro Thr Ile Ala Ser Gln Pro Leu Ser Leu Arg Pro Glu

275 280 285

Ala Cys Arg Pro Ala Ala Gly Gly Ala Val His Thr Arg Gly Leu Asp

290 295 300

Phe Ala Cys Asp Ile Tyr Ile Trp Ala Pro Leu Ala Gly Thr Cys Gly

305 310 315 320

Val Leu Leu Leu Ser Leu Val Ile Thr Leu Tyr Cys Lys Arg Gly Arg

325 330 335

Lys Lys Leu Leu Tyr Ile Phe Lys Gln Pro Phe Met Arg Pro Val Gln

340 345 350

Thr Thr Gln Glu Glu Asp Gly Cys Ser Cys Arg Phe Pro Glu Glu Glu

355 360 365

Glu Gly Gly Cys Glu Leu Arg Val Lys Phe Ser Arg Ser Ala Asp Ala

370 375 380

Pro Ala Tyr Lys Gln Gly Gln Asn Gln Leu Tyr Asn Glu Leu Asn Leu

385 390 395 400

Gly Arg Arg Glu Glu Tyr Asp Val Leu Asp Lys Arg Arg Gly Arg Asp

405 410 415

Pro Glu Met Gly Gly Lys Pro Arg Arg Lys Asn Pro Gln Glu Gly Leu

420 425 430

Tyr Asn Glu Leu Gln Lys Asp Lys Met Ala Glu Ala Tyr Ser Glu Ile

435 440 445

Gly Met Lys Gly Glu Arg Arg Arg Gly Lys Gly His Asp Gly Leu Tyr

450 455 460

Gln Gly Leu Ser Thr Ala Thr Lys Asp Thr Tyr Asp Ala Leu His Met

465 470 475 480

Gln Ala Leu Pro Pro Arg

485

<210> 162

<211> 488

<212> PRT

<213> artificial sequence

<220>

<223> M7 CAR AA

<400> 162

Met Ala Leu Pro Val Thr Ala Leu Leu Leu Pro Leu Ala Leu Leu Leu

1 5 10 15

His Ala Ala Arg Pro Asp Ile Arg Leu Thr Gln Ser Pro Ser Ser Leu

20 25 30

Ser Ala Ser Leu Gly Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln

35 40 45

Ala Ile Ser Ser Ala Leu Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ala

50 55 60

Pro Arg Leu Leu Ile Tyr Asp Ala Ser Thr Leu Glu Ser Gly Val Pro

65 70 75 80

Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile

85 90 95

Ser Ser Leu Gln Pro Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Ala

100 105 110

Asp Ser Phe Pro Leu Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys

115 120 125

Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gln

130 135 140

Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Ser Gly Glu Ser

145 150 155 160

Leu Lys Ile Ser Cys Lys Gly Ser Gly Tyr Gly Phe Gly Ala Tyr Trp

165 170 175

Ile Ala Trp Val Arg Gln Met Pro Gly Lys Gly Leu Glu Trp Met Gly

180 185 190

Ile Ile Tyr Pro Gly Asp Ser Arg Val Ile Tyr Ser Pro Tyr Phe Gln

195 200 205

Gly Gln Val Thr Ile Ser Ala Asp Lys Ser Ile Ser Thr Ala Tyr Leu

210 215 220

Gln Trp Ser Ser Leu Lys Ala Ser Asp Thr Ala Met Tyr Tyr Cys Ala

225 230 235 240

Arg Phe Gly Gly Pro Lys Phe Ala Thr Asn Trp Phe Asp Ile Trp Gly

245 250 255

Gln Gly Thr Thr Val Thr Val Ser Ser Thr Thr Thr Pro Ala Pro Arg

260 265 270

Pro Pro Thr Pro Ala Pro Thr Ile Ala Ser Gln Pro Leu Ser Leu Arg

275 280 285

Pro Glu Ala Cys Arg Pro Ala Ala Gly Gly Ala Val His Thr Arg Gly

290 295 300

Leu Asp Phe Ala Cys Asp Ile Tyr Ile Trp Ala Pro Leu Ala Gly Thr

305 310 315 320

Cys Gly Val Leu Leu Leu Ser Leu Val Ile Thr Leu Tyr Cys Lys Arg

325 330 335

Gly Arg Lys Lys Leu Leu Tyr Ile Phe Lys Gln Pro Phe Met Arg Pro

340 345 350

Val Gln Thr Thr Gln Glu Glu Asp Gly Cys Ser Cys Arg Phe Pro Glu

355 360 365

Glu Glu Glu Gly Gly Cys Glu Leu Arg Val Lys Phe Ser Arg Ser Ala

370 375 380

Asp Ala Pro Ala Tyr Lys Gln Gly Gln Asn Gln Leu Tyr Asn Glu Leu

385 390 395 400

Asn Leu Gly Arg Arg Glu Glu Tyr Asp Val Leu Asp Lys Arg Arg Gly

405 410 415

Arg Asp Pro Glu Met Gly Gly Lys Pro Arg Arg Lys Asn Pro Gln Glu

420 425 430

Gly Leu Tyr Asn Glu Leu Gln Lys Asp Lys Met Ala Glu Ala Tyr Ser

435 440 445

Glu Ile Gly Met Lys Gly Glu Arg Arg Arg Gly Lys Gly His Asp Gly

450 455 460

Leu Tyr Gln Gly Leu Ser Thr Ala Thr Lys Asp Thr Tyr Asp Ala Leu

465 470 475 480

His Met Gln Ala Leu Pro Pro Arg

485

<210> 163

<211> 487

<212> PRT

<213> artificial sequence

<220>

<223> M8 CAR AA

<400> 163

Met Ala Leu Pro Val Thr Ala Leu Leu Leu Pro Leu Ala Leu Leu Leu

1 5 10 15

His Ala Ala Arg Pro Asp Ile Gln Leu Thr Gln Ser Pro Ser Ser Leu

20 25 30

Ser Ala Ser Val Gly Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln

35 40 45

Ser Ile Ser Ser Ser Leu Asn Trp Tyr Gln Gln Lys Pro Gly Lys Ala

50 55 60

Pro Lys Leu Leu Ile Tyr Ala Ala Ser Ser Leu Gln Ser Gly Val Pro

65 70 75 80

Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile

85 90 95

Ser Ser Leu Gln Pro Glu Asp Phe Ala Thr Tyr Ser Cys Gln Gln Ser

100 105 110

Tyr Ser Thr Pro Leu Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys

115 120 125

Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gln

130 135 140

Val His Leu Val Glu Ser Gly Gly Gly Val Val Gln Pro Gly Arg Ser

145 150 155 160

Leu Arg Val Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Gly Tyr Ala

165 170 175

Met Tyr Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Tyr Val Ser

180 185 190

Ala Ile Thr Thr Asn Gly Gly Ser Thr Asn Tyr Ala Asp Ser Val Lys

195 200 205

Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu

210 215 220

Gln Met Ser Ser Leu Arg Ala Gly Asp Thr Ala Val Tyr Tyr Cys Ala

225 230 235 240

Arg Gly Ala Pro Gly Tyr Arg Gly Tyr Tyr Met Asp Val Trp Gly Lys

245 250 255

Gly Thr Thr Val Thr Val Ser Ser Thr Thr Thr Pro Ala Pro Arg Pro

260 265 270

Pro Thr Pro Ala Pro Thr Ile Ala Ser Gln Pro Leu Ser Leu Arg Pro

275 280 285

Glu Ala Cys Arg Pro Ala Ala Gly Gly Ala Val His Thr Arg Gly Leu

290 295 300

Asp Phe Ala Cys Asp Ile Tyr Ile Trp Ala Pro Leu Ala Gly Thr Cys

305 310 315 320

Gly Val Leu Leu Leu Ser Leu Val Ile Thr Leu Tyr Cys Lys Arg Gly

325 330 335

Arg Lys Lys Leu Leu Tyr Ile Phe Lys Gln Pro Phe Met Arg Pro Val

340 345 350

Gln Thr Thr Gln Glu Glu Asp Gly Cys Ser Cys Arg Phe Pro Glu Glu

355 360 365

Glu Glu Gly Gly Cys Glu Leu Arg Val Lys Phe Ser Arg Ser Ala Asp

370 375 380

Ala Pro Ala Tyr Lys Gln Gly Gln Asn Gln Leu Tyr Asn Glu Leu Asn

385 390 395 400

Leu Gly Arg Arg Glu Glu Tyr Asp Val Leu Asp Lys Arg Arg Gly Arg

405 410 415

Asp Pro Glu Met Gly Gly Lys Pro Arg Arg Lys Asn Pro Gln Glu Gly

420 425 430

Leu Tyr Asn Glu Leu Gln Lys Asp Lys Met Ala Glu Ala Tyr Ser Glu

435 440 445

Ile Gly Met Lys Gly Glu Arg Arg Arg Gly Lys Gly His Asp Gly Leu

450 455 460

Tyr Gln Gly Leu Ser Thr Ala Thr Lys Asp Thr Tyr Asp Ala Leu His

465 470 475 480

Met Gln Ala Leu Pro Pro Arg

485

<210> 164

<211> 484

<212> PRT

<213> artificial sequence

<220>

<223> M10 CAR AA

<400> 164

Met Ala Leu Pro Val Thr Ala Leu Leu Leu Pro Leu Ala Leu Leu Leu

1 5 10 15

His Ala Ala Arg Pro Asp Ile Arg Met Thr Gln Ser Pro Ser Thr Leu

20 25 30

Ser Ala Ser Val Gly Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln

35 40 45

Ser Ile Ser Ser Trp Leu Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ala

50 55 60

Pro Lys Leu Leu Ile Tyr Lys Ala Ser Ser Leu Glu Ser Gly Val Pro

65 70 75 80

Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Glu Phe Thr Leu Thr Ile

85 90 95

Ser Thr Leu Gln Pro Asp Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Tyr

100 105 110

Tyr Ser Tyr Pro Leu Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys

115 120 125

Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gln

130 135 140

Val Gln Leu Val Gln Ser Gly Gly Gly Leu Val Gln Pro Gly Gly Ser

145 150 155 160

Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr Ala

165 170 175

Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val Ser

180 185 190

Ala Ile Ser Gly Ser Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val Lys

195 200 205

Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu

210 215 220

Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala

225 230 235 240

Lys Arg Gly Ser Ser Trp Tyr Phe Asp Tyr Trp Gly Gln Gly Thr Leu

245 250 255

Val Thr Val Ser Ser Thr Thr Thr Pro Ala Pro Arg Pro Pro Thr Pro

260 265 270

Ala Pro Thr Ile Ala Ser Gln Pro Leu Ser Leu Arg Pro Glu Ala Cys

275 280 285

Arg Pro Ala Ala Gly Gly Ala Val His Thr Arg Gly Leu Asp Phe Ala

290 295 300

Cys Asp Ile Tyr Ile Trp Ala Pro Leu Ala Gly Thr Cys Gly Val Leu

305 310 315 320

Leu Leu Ser Leu Val Ile Thr Leu Tyr Cys Lys Arg Gly Arg Lys Lys

325 330 335

Leu Leu Tyr Ile Phe Lys Gln Pro Phe Met Arg Pro Val Gln Thr Thr

340 345 350

Gln Glu Glu Asp Gly Cys Ser Cys Arg Phe Pro Glu Glu Glu Glu Gly

355 360 365

Gly Cys Glu Leu Arg Val Lys Phe Ser Arg Ser Ala Asp Ala Pro Ala

370 375 380

Tyr Lys Gln Gly Gln Asn Gln Leu Tyr Asn Glu Leu Asn Leu Gly Arg

385 390 395 400

Arg Glu Glu Tyr Asp Val Leu Asp Lys Arg Arg Gly Arg Asp Pro Glu

405 410 415

Met Gly Gly Lys Pro Arg Arg Lys Asn Pro Gln Glu Gly Leu Tyr Asn

420 425 430

Glu Leu Gln Lys Asp Lys Met Ala Glu Ala Tyr Ser Glu Ile Gly Met

435 440 445

Lys Gly Glu Arg Arg Arg Gly Lys Gly His Asp Gly Leu Tyr Gln Gly

450 455 460

Leu Ser Thr Ala Thr Lys Asp Thr Tyr Asp Ala Leu His Met Gln Ala

465 470 475 480

Leu Pro Pro Arg

<210> 165

<211> 485

<212> PRT

<213> artificial sequence

<220>

<223> M12 CAR AA

<400> 165

Met Ala Leu Pro Val Thr Ala Leu Leu Leu Pro Leu Ala Leu Leu Leu

1 5 10 15

His Ala Ala Arg Pro Ala Ile Arg Leu Thr Gln Ser Pro Ser Leu Leu

20 25 30

Ser Ala Ser Val Gly Asp Arg Val Thr Val Thr Cys Arg Ala Ser Gln

35 40 45

Gly Gly Gly Asn Tyr Leu Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ala

50 55 60

Pro Lys Leu Leu Ile Tyr Gly Ala Ser Lys Leu Gln Ser Gly Val Pro

65 70 75 80

Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Glu Phe Thr Leu Thr Ile

85 90 95

Ser Ser Leu Gln Pro Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Leu

100 105 110

Asn Ser Tyr Pro Val Thr Phe Gly Gln Gly Thr Lys Val Asp Ile Lys

115 120 125

Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Glu

130 135 140

Val Gln Leu Val Glu Ser Gly Ala Glu Val Lys Lys Pro Gly Ala Ser

145 150 155 160

Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Thr Tyr Tyr

165 170 175

Ile His Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met Gly

180 185 190

Ile Ile Asn Pro Ser Ser Gly Ser Thr Thr Tyr Thr Gln Lys Phe Gln

195 200 205

Gly Arg Val Thr Met Thr Arg Asp Thr Ser Thr Ser Thr Val Tyr Ile

210 215 220

Glu Leu Ser Gly Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys Ala

225 230 235 240

Arg Gly Glu Thr Leu Arg Gly Tyr Phe Asp Tyr Trp Gly Gln Gly Thr

245 250 255

Leu Val Thr Val Ser Ser Thr Thr Thr Pro Ala Pro Arg Pro Pro Thr

260 265 270

Pro Ala Pro Thr Ile Ala Ser Gln Pro Leu Ser Leu Arg Pro Glu Ala

275 280 285

Cys Arg Pro Ala Ala Gly Gly Ala Val His Thr Arg Gly Leu Asp Phe

290 295 300

Ala Cys Asp Ile Tyr Ile Trp Ala Pro Leu Ala Gly Thr Cys Gly Val

305 310 315 320

Leu Leu Leu Ser Leu Val Ile Thr Leu Tyr Cys Lys Arg Gly Arg Lys

325 330 335

Lys Leu Leu Tyr Ile Phe Lys Gln Pro Phe Met Arg Pro Val Gln Thr

340 345 350

Thr Gln Glu Glu Asp Gly Cys Ser Cys Arg Phe Pro Glu Glu Glu Glu

355 360 365

Gly Gly Cys Glu Leu Arg Val Lys Phe Ser Arg Ser Ala Asp Ala Pro

370 375 380

Ala Tyr Lys Gln Gly Gln Asn Gln Leu Tyr Asn Glu Leu Asn Leu Gly

385 390 395 400

Arg Arg Glu Glu Tyr Asp Val Leu Asp Lys Arg Arg Gly Arg Asp Pro

405 410 415

Glu Met Gly Gly Lys Pro Arg Arg Lys Asn Pro Gln Glu Gly Leu Tyr

420 425 430

Asn Glu Leu Gln Lys Asp Lys Met Ala Glu Ala Tyr Ser Glu Ile Gly

435 440 445

Met Lys Gly Glu Arg Arg Arg Gly Lys Gly His Asp Gly Leu Tyr Gln

450 455 460

Gly Leu Ser Thr Ala Thr Lys Asp Thr Tyr Asp Ala Leu His Met Gln

465 470 475 480

Ala Leu Pro Pro Arg

485

<210> 166

<211> 489

<212> PRT

<213> artificial sequence

<220>

<223> M13 CAR AA

<400> 166

Met Ala Leu Pro Val Thr Ala Leu Leu Leu Pro Leu Ala Leu Leu Leu

1 5 10 15

His Ala Ala Arg Pro Ala Ile Arg Met Thr Gln Ser Pro Ser Ser Leu

20 25 30

Ser Ala Ser Val Gly Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln

35 40 45

Gly Ile Ser Asn Ser Leu Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ala

50 55 60

Pro Lys Leu Leu Leu Tyr Ala Ala Ser Arg Leu Glu Ser Gly Val Pro

65 70 75 80

Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Tyr Thr Leu Thr Ile

85 90 95

Ser Ser Leu Gln Pro Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Tyr

100 105 110

Tyr Ser Thr Pro Phe Thr Phe Gly Pro Gly Thr Lys Leu Glu Ile Lys

115 120 125

Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gln

130 135 140

Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ser Ser

145 150 155 160

Val Lys Val Ser Cys Lys Thr Ser Ala Asp Thr Phe Ser Ala Asn Thr

165 170 175

Ile Asn Trp Val Arg Gln Ala Pro Gly His Gly Leu Glu Trp Met Gly

180 185 190

Arg Ile Ile Pro Ser Leu Asn Ile Arg Asp Tyr Ala Gln Glu Phe Gln

195 200 205

Gly Arg Val Thr Phe Thr Ala Asp Glu Ser Thr Asn Thr Val Tyr Met

210 215 220

Gln Leu Thr Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys Ala

225 230 235 240

Arg Asp Pro Gly Ser Thr Trp Ser Pro Asn Gln Phe Phe Pro His Trp

245 250 255

Gly Gln Gly Thr Leu Val Thr Val Ser Ser Thr Thr Thr Pro Ala Pro

260 265 270

Arg Pro Pro Thr Pro Ala Pro Thr Ile Ala Ser Gln Pro Leu Ser Leu

275 280 285

Arg Pro Glu Ala Cys Arg Pro Ala Ala Gly Gly Ala Val His Thr Arg

290 295 300

Gly Leu Asp Phe Ala Cys Asp Ile Tyr Ile Trp Ala Pro Leu Ala Gly

305 310 315 320

Thr Cys Gly Val Leu Leu Leu Ser Leu Val Ile Thr Leu Tyr Cys Lys

325 330 335

Arg Gly Arg Lys Lys Leu Leu Tyr Ile Phe Lys Gln Pro Phe Met Arg

340 345 350

Pro Val Gln Thr Thr Gln Glu Glu Asp Gly Cys Ser Cys Arg Phe Pro

355 360 365

Glu Glu Glu Glu Gly Gly Cys Glu Leu Arg Val Lys Phe Ser Arg Ser

370 375 380

Ala Asp Ala Pro Ala Tyr Lys Gln Gly Gln Asn Gln Leu Tyr Asn Glu

385 390 395 400

Leu Asn Leu Gly Arg Arg Glu Glu Tyr Asp Val Leu Asp Lys Arg Arg

405 410 415

Gly Arg Asp Pro Glu Met Gly Gly Lys Pro Arg Arg Lys Asn Pro Gln

420 425 430

Glu Gly Leu Tyr Asn Glu Leu Gln Lys Asp Lys Met Ala Glu Ala Tyr

435 440 445

Ser Glu Ile Gly Met Lys Gly Glu Arg Arg Arg Gly Lys Gly His Asp

450 455 460

Gly Leu Tyr Gln Gly Leu Ser Thr Ala Thr Lys Asp Thr Tyr Asp Ala

465 470 475 480

Leu His Met Gln Ala Leu Pro Pro Arg

485

<210> 167

<211> 486

<212> PRT

<213> artificial sequence

<220>

<223> M15 CAR AA

<400> 167

Met Ala Leu Pro Val Thr Ala Leu Leu Leu Pro Leu Ala Leu Leu Leu

1 5 10 15

His Ala Ala Arg Pro Asp Ile Gln Leu Thr Gln Ser Pro Ser Ser Leu

20 25 30

Ser Ala Ser Ile Gly Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln

35 40 45

Gly Val Asn Ser Ala Leu Ala Trp Tyr Gln Gln Lys Pro Gly Lys Pro

50 55 60

Pro Asn Leu Leu Ile Tyr Asp Ala Ser Ser Leu Glu Ser Gly Val Pro

65 70 75 80

Ser Arg Phe Ser Gly Ser Gly Ser Gly Arg Asp Phe Thr Leu Thr Ile

85 90 95

Ser Ser Leu Gln Pro Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Phe

100 105 110

Ser Ser Tyr Pro Leu Thr Phe Gly Gly Gly Thr Lys Val Asp Ile Lys

115 120 125

Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gln

130 135 140

Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala Ser

145 150 155 160

Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Ser Tyr Tyr

165 170 175

Met His Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met Gly

180 185 190

Ile Ile Asn Pro Ser Gly Gly Ser Thr Ser Tyr Ala Gln Lys Phe Gln

195 200 205

Gly Arg Val Thr Met Thr Arg Asp Thr Ser Thr Ser Thr Val Tyr Met

210 215 220

Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys Ala

225 230 235 240

Arg Ala Gln Arg Gly Gly Ser Val Tyr Phe Asp Tyr Trp Gly Gln Gly

245 250 255

Thr Leu Val Thr Val Ser Ser Thr Thr Thr Pro Ala Pro Arg Pro Pro

260 265 270

Thr Pro Ala Pro Thr Ile Ala Ser Gln Pro Leu Ser Leu Arg Pro Glu

275 280 285

Ala Cys Arg Pro Ala Ala Gly Gly Ala Val His Thr Arg Gly Leu Asp

290 295 300

Phe Ala Cys Asp Ile Tyr Ile Trp Ala Pro Leu Ala Gly Thr Cys Gly

305 310 315 320

Val Leu Leu Leu Ser Leu Val Ile Thr Leu Tyr Cys Lys Arg Gly Arg

325 330 335

Lys Lys Leu Leu Tyr Ile Phe Lys Gln Pro Phe Met Arg Pro Val Gln

340 345 350

Thr Thr Gln Glu Glu Asp Gly Cys Ser Cys Arg Phe Pro Glu Glu Glu

355 360 365

Glu Gly Gly Cys Glu Leu Arg Val Lys Phe Ser Arg Ser Ala Asp Ala

370 375 380

Pro Ala Tyr Lys Gln Gly Gln Asn Gln Leu Tyr Asn Glu Leu Asn Leu

385 390 395 400

Gly Arg Arg Glu Glu Tyr Asp Val Leu Asp Lys Arg Arg Gly Arg Asp

405 410 415

Pro Glu Met Gly Gly Lys Pro Arg Arg Lys Asn Pro Gln Glu Gly Leu

420 425 430

Tyr Asn Glu Leu Gln Lys Asp Lys Met Ala Glu Ala Tyr Ser Glu Ile

435 440 445

Gly Met Lys Gly Glu Arg Arg Arg Gly Lys Gly His Asp Gly Leu Tyr

450 455 460

Gln Gly Leu Ser Thr Ala Thr Lys Asp Thr Tyr Asp Ala Leu His Met

465 470 475 480

Gln Ala Leu Pro Pro Arg

485

<210> 168

<211> 486

<212> PRT

<213> artificial sequence

<220>

<223> M20 CAR AA

<400> 168

Met Ala Leu Pro Val Thr Ala Leu Leu Leu Pro Leu Ala Leu Leu Leu

1 5 10 15

His Ala Ala Arg Pro Ala Ile Gln Met Thr Gln Ser Pro Ser Ser Leu

20 25 30

Ser Ala Ser Val Gly Asn Arg Val Thr Ile Thr Cys Arg Ala Ser Gln

35 40 45

Gly Ile Ser Ser Ala Val Ala Trp Tyr Gln Gln Lys Pro Gly Lys Pro

50 55 60

Pro Lys Leu Leu Ile Ser Tyr Ala Ser Ser Leu Glu Ser Gly Val Pro

65 70 75 80

Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Ser Leu Thr Ile

85 90 95

Ser Ser Leu Gln Pro Glu Asp Phe Ala Thr Tyr Phe Cys Gln Gln Phe

100 105 110

Asn Ser Tyr Pro Leu Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys

115 120 125

Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gln

130 135 140

Val Gln Leu Val Gln Ser Gly Ala Glu Val Arg Lys Pro Gly Glu Ser

145 150 155 160

Leu Lys Ile Ser Cys Lys Gly Ser Gly Tyr Ser Phe Arg Asp Ser Trp

165 170 175

Ile Ala Trp Val Arg Gln Met Pro Gly Gln Gly Leu Glu Trp Met Gly

180 185 190

Ile Ile Phe Pro Gly Asp Ser Asn Pro Ile Tyr Ser Pro Ser Phe Gln

195 200 205

Gly Gln Val Thr Ile Ser Ala Asp Thr Ser Ile Ser Thr Thr Phe Leu

210 215 220

Gln Trp Arg Ser Leu Lys Ala Ser Asp Ser Ala Ile Tyr Tyr Cys Ala

225 230 235 240

Arg His Ala Ala Trp Gly Ala Gly Trp Phe Asp Pro Trp Gly Gln Gly

245 250 255

Thr Leu Val Thr Val Ser Ser Thr Thr Thr Pro Ala Pro Arg Pro Pro

260 265 270

Thr Pro Ala Pro Thr Ile Ala Ser Gln Pro Leu Ser Leu Arg Pro Glu

275 280 285

Ala Cys Arg Pro Ala Ala Gly Gly Ala Val His Thr Arg Gly Leu Asp

290 295 300

Phe Ala Cys Asp Ile Tyr Ile Trp Ala Pro Leu Ala Gly Thr Cys Gly

305 310 315 320

Val Leu Leu Leu Ser Leu Val Ile Thr Leu Tyr Cys Lys Arg Gly Arg

325 330 335

Lys Lys Leu Leu Tyr Ile Phe Lys Gln Pro Phe Met Arg Pro Val Gln

340 345 350

Thr Thr Gln Glu Glu Asp Gly Cys Ser Cys Arg Phe Pro Glu Glu Glu

355 360 365

Glu Gly Gly Cys Glu Leu Arg Val Lys Phe Ser Arg Ser Ala Asp Ala

370 375 380

Pro Ala Tyr Lys Gln Gly Gln Asn Gln Leu Tyr Asn Glu Leu Asn Leu

385 390 395 400

Gly Arg Arg Glu Glu Tyr Asp Val Leu Asp Lys Arg Arg Gly Arg Asp

405 410 415

Pro Glu Met Gly Gly Lys Pro Arg Arg Lys Asn Pro Gln Glu Gly Leu

420 425 430

Tyr Asn Glu Leu Gln Lys Asp Lys Met Ala Glu Ala Tyr Ser Glu Ile

435 440 445

Gly Met Lys Gly Glu Arg Arg Arg Gly Lys Gly His Asp Gly Leu Tyr

450 455 460

Gln Gly Leu Ser Thr Ala Thr Lys Asp Thr Tyr Asp Ala Leu His Met

465 470 475 480

Gln Ala Leu Pro Pro Arg

485

<210> 169

<211> 488

<212> PRT

<213> artificial sequence

<220>

<223> M22 CAR AA

<400> 169

Met Ala Leu Pro Val Thr Ala Leu Leu Leu Pro Leu Ala Leu Leu Leu

1 5 10 15

His Ala Ala Arg Pro Gln Ser Ala Leu Thr Gln Pro Ala Ser Val Ser

20 25 30

Gly Ser Pro Gly Gln Ser Ile Thr Leu Ser Cys Thr Gly Thr Arg Arg

35 40 45

Asp Ile Gly Gly Tyr Glu Tyr Val Ser Trp Tyr Gln Gln His Pro Gly

50 55 60

Lys Ala Pro Lys Leu Leu Ile Phe Ser Val Asn Asn Arg Pro Ser Gly

65 70 75 80

Val Ser His Arg Phe Ser Gly Ser Lys Ser Gly Asn Thr Ala Ser Leu

85 90 95

Thr Ile Ser Gly Leu Gln Ala Glu Asp Glu Ala Ala Tyr Phe Cys Ser

100 105 110

Ser Tyr Ser Ser Arg Asp Thr Leu Val Leu Phe Gly Gly Gly Thr Lys

115 120 125

Leu Thr Val Leu Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly

130 135 140

Gly Gly Ser Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys

145 150 155 160

Pro Gly Ser Ser Val Lys Val Ser Cys Lys Ala Ser Gly Gly Thr Phe

165 170 175

Ser Ser Tyr Ala Ile Ser Trp Val Arg Gln Ala Pro Gly Gln Gly Leu

180 185 190

Glu Trp Met Gly Gly Ile Ile Pro Ile Phe Gly Thr Ala Asn Tyr Ala

195 200 205

Gln Lys Phe Gln Gly Arg Val Thr Ile Thr Ala Asp Glu Ser Thr Ser

210 215 220

Thr Ala Tyr Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val

225 230 235 240

Tyr Tyr Cys Ala Ser Gly Arg Ser Gly Ser Tyr Gly Leu Tyr Trp Gly

245 250 255

Gln Gly Thr Leu Val Thr Val Ser Ser Thr Thr Thr Pro Ala Pro Arg

260 265 270

Pro Pro Thr Pro Ala Pro Thr Ile Ala Ser Gln Pro Leu Ser Leu Arg

275 280 285

Pro Glu Ala Cys Arg Pro Ala Ala Gly Gly Ala Val His Thr Arg Gly

290 295 300

Leu Asp Phe Ala Cys Asp Ile Tyr Ile Trp Ala Pro Leu Ala Gly Thr

305 310 315 320

Cys Gly Val Leu Leu Leu Ser Leu Val Ile Thr Leu Tyr Cys Lys Arg

325 330 335

Gly Arg Lys Lys Leu Leu Tyr Ile Phe Lys Gln Pro Phe Met Arg Pro

340 345 350

Val Gln Thr Thr Gln Glu Glu Asp Gly Cys Ser Cys Arg Phe Pro Glu

355 360 365

Glu Glu Glu Gly Gly Cys Glu Leu Arg Val Lys Phe Ser Arg Ser Ala

370 375 380

Asp Ala Pro Ala Tyr Lys Gln Gly Gln Asn Gln Leu Tyr Asn Glu Leu

385 390 395 400

Asn Leu Gly Arg Arg Glu Glu Tyr Asp Val Leu Asp Lys Arg Arg Gly

405 410 415

Arg Asp Pro Glu Met Gly Gly Lys Pro Arg Arg Lys Asn Pro Gln Glu

420 425 430

Gly Leu Tyr Asn Glu Leu Gln Lys Asp Lys Met Ala Glu Ala Tyr Ser

435 440 445

Glu Ile Gly Met Lys Gly Glu Arg Arg Arg Gly Lys Gly His Asp Gly

450 455 460

Leu Tyr Gln Gly Leu Ser Thr Ala Thr Lys Asp Thr Tyr Asp Ala Leu

465 470 475 480

His Met Gln Ala Leu Pro Pro Arg

485

<210> 170

<211> 486

<212> PRT

<213> artificial sequence

<220>

<223> M24 CAR AA

<400> 170

Met Ala Leu Pro Val Thr Ala Leu Leu Leu Pro Leu Ala Leu Leu Leu

1 5 10 15

His Ala Ala Arg Pro Gln Pro Val Leu Thr Gln Pro Pro Ser Ala Ser

20 25 30

Gly Thr Pro Gly Gln Arg Val Thr Ile Ser Cys Ser Gly Ser Ser Ser

35 40 45

Asn Ile Gly Ser Asn Tyr Val Tyr Trp Tyr Gln Gln Phe Pro Gly Thr

50 55 60

Ala Pro Lys Leu Leu Ile Tyr Met Asn Asn Gln Arg Pro Ser Gly Val

65 70 75 80

Pro Asp Arg Phe Ser Gly Ser Lys Ser Gly Thr Ser Ala Ser Leu Ala

85 90 95

Ile Ser Gly Leu Arg Ser Glu Asp Glu Ala Asp Tyr Tyr Cys Ala Ala

100 105 110

Arg Asp Asp Ser Leu Ser Gly Tyr Val Thr Phe Gly Gly Gly Thr Lys

115 120 125

Leu Thr Val Leu Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly

130 135 140

Gly Gly Ser Glu Val His Leu Val Glu Ser Gly Gly Gly Leu Val Gln

145 150 155 160

Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe

165 170 175

Ser Ser Tyr Ala Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu

180 185 190

Glu Trp Val Ser Ala Ile Ser Gly Ser Gly Gly Ser Thr Tyr Tyr Ala

195 200 205

Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn

210 215 220

Thr Leu Tyr Leu Gln Met Asn Ser Leu Lys Thr Glu Asp Thr Ala Val

225 230 235 240

Tyr Tyr Cys Thr Arg Gly Val Ala Thr Phe Asp Tyr Trp Gly Gln Gly

245 250 255

Thr Leu Val Thr Val Ser Ser Thr Thr Thr Pro Ala Pro Arg Pro Pro

260 265 270

Thr Pro Ala Pro Thr Ile Ala Ser Gln Pro Leu Ser Leu Arg Pro Glu

275 280 285

Ala Cys Arg Pro Ala Ala Gly Gly Ala Val His Thr Arg Gly Leu Asp

290 295 300

Phe Ala Cys Asp Ile Tyr Ile Trp Ala Pro Leu Ala Gly Thr Cys Gly

305 310 315 320

Val Leu Leu Leu Ser Leu Val Ile Thr Leu Tyr Cys Lys Arg Gly Arg

325 330 335

Lys Lys Leu Leu Tyr Ile Phe Lys Gln Pro Phe Met Arg Pro Val Gln

340 345 350

Thr Thr Gln Glu Glu Asp Gly Cys Ser Cys Arg Phe Pro Glu Glu Glu

355 360 365

Glu Gly Gly Cys Glu Leu Arg Val Lys Phe Ser Arg Ser Ala Asp Ala

370 375 380

Pro Ala Tyr Lys Gln Gly Gln Asn Gln Leu Tyr Asn Glu Leu Asn Leu

385 390 395 400

Gly Arg Arg Glu Glu Tyr Asp Val Leu Asp Lys Arg Arg Gly Arg Asp

405 410 415

Pro Glu Met Gly Gly Lys Pro Arg Arg Lys Asn Pro Gln Glu Gly Leu

420 425 430

Tyr Asn Glu Leu Gln Lys Asp Lys Met Ala Glu Ala Tyr Ser Glu Ile

435 440 445

Gly Met Lys Gly Glu Arg Arg Arg Gly Lys Gly His Asp Gly Leu Tyr

450 455 460

Gln Gly Leu Ser Thr Ala Thr Lys Asp Thr Tyr Asp Ala Leu His Met

465 470 475 480

Gln Ala Leu Pro Pro Arg

485

<210> 171

<211> 492

<212> PRT

<213> artificial sequence

<220>

<223> M27 CAR AA

<400> 171

Met Ala Leu Pro Val Thr Ala Leu Leu Leu Pro Leu Ala Leu Leu Leu

1 5 10 15

His Ala Ala Arg Pro Glu Ile Val Leu Thr Gln Ser Pro Gly Thr Leu

20 25 30

Ser Leu Ser Pro Gly Glu Arg Ala Thr Leu Ser Cys Arg Ala Ser Gln

35 40 45

Pro Ile Val Ala Ser His Leu Ala Trp Tyr Gln His Lys Pro Gly Gln

50 55 60

Ala Pro Arg Leu Leu Ile Tyr Gly Ala Ser Thr Arg Ala Ala Gly Ile

65 70 75 80

Pro Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr

85 90 95

Ile Ser Arg Leu Glu Pro Glu Asp Phe Ala Val Tyr Phe Cys Gln Gln

100 105 110

Tyr Gly Ile Ser Pro Phe Thr Phe Gly Pro Gly Thr Lys Val Asp Ile

115 120 125

Lys Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser

130 135 140

Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Glu

145 150 155 160

Ser Leu Lys Ile Ser Cys Gln Gly Ser Gly Tyr Ser Phe Thr Asp Tyr

165 170 175

Trp Ile Gly Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met

180 185 190

Gly Trp Ile Thr Pro Asn Asn Gly Asn Thr Asn Tyr Ala Pro Lys Phe

195 200 205

Gln Gly Arg Val Thr Leu Thr Thr Asp Thr Ser Thr Ser Thr Ala Tyr

210 215 220

Met Glu Leu Arg Ser Leu Thr Ser Asp Asp Thr Ala Val Tyr Phe Cys

225 230 235 240

Ala Arg Arg Gly Arg Asn Ser Ser Gly Tyr Leu Tyr Tyr Tyr Ser Met

245 250 255

Asp Val Trp Gly Gln Gly Thr Thr Val Thr Val Ser Ser Thr Thr Thr

260 265 270

Pro Ala Pro Arg Pro Pro Thr Pro Ala Pro Thr Ile Ala Ser Gln Pro

275 280 285

Leu Ser Leu Arg Pro Glu Ala Cys Arg Pro Ala Ala Gly Gly Ala Val

290 295 300

His Thr Arg Gly Leu Asp Phe Ala Cys Asp Ile Tyr Ile Trp Ala Pro

305 310 315 320

Leu Ala Gly Thr Cys Gly Val Leu Leu Leu Ser Leu Val Ile Thr Leu

325 330 335

Tyr Cys Lys Arg Gly Arg Lys Lys Leu Leu Tyr Ile Phe Lys Gln Pro

340 345 350

Phe Met Arg Pro Val Gln Thr Thr Gln Glu Glu Asp Gly Cys Ser Cys

355 360 365

Arg Phe Pro Glu Glu Glu Glu Gly Gly Cys Glu Leu Arg Val Lys Phe

370 375 380

Ser Arg Ser Ala Asp Ala Pro Ala Tyr Lys Gln Gly Gln Asn Gln Leu

385 390 395 400

Tyr Asn Glu Leu Asn Leu Gly Arg Arg Glu Glu Tyr Asp Val Leu Asp

405 410 415

Lys Arg Arg Gly Arg Asp Pro Glu Met Gly Gly Lys Pro Arg Arg Lys

420 425 430

Asn Pro Gln Glu Gly Leu Tyr Asn Glu Leu Gln Lys Asp Lys Met Ala

435 440 445

Glu Ala Tyr Ser Glu Ile Gly Met Lys Gly Glu Arg Arg Arg Gly Lys

450 455 460

Gly His Asp Gly Leu Tyr Gln Gly Leu Ser Thr Ala Thr Lys Asp Thr

465 470 475 480

Tyr Asp Ala Leu His Met Gln Ala Leu Pro Pro Arg

485 490

<210> 172

<211> 492

<212> PRT

<213> artificial sequence

<220>

<223> M28 CAR AA

<400> 172

Met Ala Leu Pro Val Thr Ala Leu Leu Leu Pro Leu Ala Leu Leu Leu

1 5 10 15

His Ala Ala Arg Pro Gln Ser Ala Leu Thr Gln Pro Pro Ser Ala Ser

20 25 30

Gly Ser Pro Gly Gln Ser Val Thr Ile Ser Cys Ser Gly Thr Ser Ser

35 40 45

Asp Val Gly Gly Tyr Asn Phe Val Ser Trp Tyr Gln His His Pro Gly

50 55 60

Lys Ala Pro Lys Leu Met Ile Tyr Glu Val Ser Lys Arg Pro Ser Gly

65 70 75 80

Val Pro Asp Arg Phe Ser Gly Ser Lys Ser Gly Asn Thr Ala Ser Leu

85 90 95

Thr Val Ser Gly Leu Gln Ala Glu Asp Glu Ala Asp Tyr Tyr Cys Ser

100 105 110

Ser Tyr Ala Gly Arg Asn Asn Pro Tyr Leu Phe Gly Thr Gly Thr Lys

115 120 125

Leu Thr Val Leu Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly

130 135 140

Gly Gly Ser Gln Leu Gln Leu Gln Glu Ser Gly Ala Glu Val Lys Lys

145 150 155 160

Pro Gly Ser Ser Val Lys Val Ser Cys Lys Ala Ser Gly Gly Thr Phe

165 170 175

Ser Ser Tyr Ala Ile Ser Trp Val Arg Gln Ala Pro Gly Gln Gly Leu

180 185 190

Glu Trp Met Gly Gly Ile Ile Pro Ile Phe Gly Thr Ala Asn Tyr Ala

195 200 205

Gln Lys Phe Gln Gly Arg Val Thr Ile Thr Ala Asp Glu Ser Thr Ser

210 215 220

Thr Ala Tyr Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val

225 230 235 240

Tyr Tyr Cys Ala Arg Asp Leu Gly Gly Tyr Ser Tyr Gly His Gly Leu

245 250 255

Asp Tyr Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser Thr Thr Thr

260 265 270

Pro Ala Pro Arg Pro Pro Thr Pro Ala Pro Thr Ile Ala Ser Gln Pro

275 280 285

Leu Ser Leu Arg Pro Glu Ala Cys Arg Pro Ala Ala Gly Gly Ala Val

290 295 300

His Thr Arg Gly Leu Asp Phe Ala Cys Asp Ile Tyr Ile Trp Ala Pro

305 310 315 320

Leu Ala Gly Thr Cys Gly Val Leu Leu Leu Ser Leu Val Ile Thr Leu

325 330 335

Tyr Cys Lys Arg Gly Arg Lys Lys Leu Leu Tyr Ile Phe Lys Gln Pro

340 345 350

Phe Met Arg Pro Val Gln Thr Thr Gln Glu Glu Asp Gly Cys Ser Cys

355 360 365

Arg Phe Pro Glu Glu Glu Glu Gly Gly Cys Glu Leu Arg Val Lys Phe

370 375 380

Ser Arg Ser Ala Asp Ala Pro Ala Tyr Lys Gln Gly Gln Asn Gln Leu

385 390 395 400

Tyr Asn Glu Leu Asn Leu Gly Arg Arg Glu Glu Tyr Asp Val Leu Asp

405 410 415

Lys Arg Arg Gly Arg Asp Pro Glu Met Gly Gly Lys Pro Arg Arg Lys

420 425 430

Asn Pro Gln Glu Gly Leu Tyr Asn Glu Leu Gln Lys Asp Lys Met Ala

435 440 445

Glu Ala Tyr Ser Glu Ile Gly Met Lys Gly Glu Arg Arg Arg Gly Lys

450 455 460

Gly His Asp Gly Leu Tyr Gln Gly Leu Ser Thr Ala Thr Lys Asp Thr

465 470 475 480

Tyr Asp Ala Leu His Met Gln Ala Leu Pro Pro Arg

485 490

<210> 173

<211> 486

<212> PRT

<213> artificial sequence

<220>

<223> M31 CAR AA

<400> 173

Met Ala Leu Pro Val Thr Ala Leu Leu Leu Pro Leu Ala Leu Leu Leu

1 5 10 15

His Ala Ala Arg Pro Gln Ser Ala Leu Thr Gln Pro Pro Ser Ala Ser

20 25 30

Gly Ser Pro Gly Gln Ser Val Thr Ile Ser Cys Thr Gly Thr Ser Ser

35 40 45

Asp Ile Gly Gly Tyr Asn Ser Val Ser Trp Tyr Gln Gln His Pro Gly

50 55 60

Lys Ala Pro Lys Leu Ile Ile Tyr Gly Val Ser Arg Arg Pro Ser Gly

65 70 75 80

Val Pro Asp Arg Phe Ser Gly Ser Lys Ser Ala Asn Thr Ala Ser Leu

85 90 95

Thr Val Ser Gly Leu Gln Ala Val Asp Glu Ala Asp Tyr Tyr Cys Ser

100 105 110

Ser Tyr Gly Gly Ser Asn Asn Leu Leu Phe Gly Gly Gly Thr Lys Leu

115 120 125

Thr Val Leu Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly

130 135 140

Gly Ser Glu Val His Leu Val Glu Ser Gly Gly Gly Leu Ala Gln Pro

145 150 155 160

Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Ser Phe Ser

165 170 175

Ser Ser Trp Met Ala Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu

180 185 190

Trp Val Ala Asn Ile Lys Gln Asp Gly Ser Ser Gln Tyr Tyr Val Asp

195 200 205

Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Ser

210 215 220

Leu Ser Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr

225 230 235 240

Tyr Cys Ala Arg Asp Ile Trp Tyr Ser Ile Asp Tyr Trp Gly Gln Gly

245 250 255

Thr Leu Val Thr Val Ser Ser Thr Thr Thr Pro Ala Pro Arg Pro Pro

260 265 270

Thr Pro Ala Pro Thr Ile Ala Ser Gln Pro Leu Ser Leu Arg Pro Glu

275 280 285

Ala Cys Arg Pro Ala Ala Gly Gly Ala Val His Thr Arg Gly Leu Asp

290 295 300

Phe Ala Cys Asp Ile Tyr Ile Trp Ala Pro Leu Ala Gly Thr Cys Gly

305 310 315 320

Val Leu Leu Leu Ser Leu Val Ile Thr Leu Tyr Cys Lys Arg Gly Arg

325 330 335

Lys Lys Leu Leu Tyr Ile Phe Lys Gln Pro Phe Met Arg Pro Val Gln

340 345 350

Thr Thr Gln Glu Glu Asp Gly Cys Ser Cys Arg Phe Pro Glu Glu Glu

355 360 365

Glu Gly Gly Cys Glu Leu Arg Val Lys Phe Ser Arg Ser Ala Asp Ala

370 375 380

Pro Ala Tyr Lys Gln Gly Gln Asn Gln Leu Tyr Asn Glu Leu Asn Leu

385 390 395 400

Gly Arg Arg Glu Glu Tyr Asp Val Leu Asp Lys Arg Arg Gly Arg Asp

405 410 415

Pro Glu Met Gly Gly Lys Pro Arg Arg Lys Asn Pro Gln Glu Gly Leu

420 425 430

Tyr Asn Glu Leu Gln Lys Asp Lys Met Ala Glu Ala Tyr Ser Glu Ile

435 440 445

Gly Met Lys Gly Glu Arg Arg Arg Gly Lys Gly His Asp Gly Leu Tyr

450 455 460

Gln Gly Leu Ser Thr Ala Thr Lys Asp Thr Tyr Asp Ala Leu His Met

465 470 475 480

Gln Ala Leu Pro Pro Arg

485

<210> 174

<211> 486

<212> PRT

<213> artificial sequence

<220>

<223> M32 CAR AA

<400> 174

Met Ala Leu Pro Val Thr Ala Leu Leu Leu Pro Leu Ala Leu Leu Leu

1 5 10 15

His Ala Ala Arg Pro Asp Ile Arg Met Thr Gln Ser Pro Ser Ser Leu

20 25 30

Ser Ala Ser Val Gly Asp Arg Val Thr Val Thr Cys Gln Ala Ser Glu

35 40 45

Asp Ile Asn Asn Ser Leu Asn Trp Tyr Gln Gln Lys Pro Gly Lys Ala

50 55 60

Pro Gln Leu Leu Ile Tyr Asp Ala Ser Asp Leu Glu Thr Gly Val Pro

65 70 75 80

Ser Arg Phe Ser Gly Arg Gly Ser Gly Arg Asp Phe Thr Leu Thr Ile

85 90 95

Ser Ser Leu Gln Pro Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Leu

100 105 110

Asn Ser Tyr Pro Leu Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys

115 120 125

Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gln

130 135 140

Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala Ser

145 150 155 160

Val Lys Val Ser Cys Lys Ala Ser Gly Phe Thr Phe Ile Gly Tyr Tyr

165 170 175

Leu His Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met Gly

180 185 190

Ile Ile Asn Pro Ser Gly Gly Arg Thr Ser Met Ala Gln Lys Phe Gln

195 200 205

Gly Arg Val Ser Met Thr Thr Asp Thr Ser Thr Gly Thr Val Tyr Leu

210 215 220

Asp Leu Gly Arg Leu Gly Ser Asp Asp Thr Ala Val Tyr Tyr Cys Ala

225 230 235 240

Arg Ala Asp Asn Trp Asn Ala Gly Ser Met Asp Val Trp Gly Asn Gly

245 250 255

Thr Thr Val Thr Val Ser Ser Thr Thr Thr Pro Ala Pro Arg Pro Pro

260 265 270

Thr Pro Ala Pro Thr Ile Ala Ser Gln Pro Leu Ser Leu Arg Pro Glu

275 280 285

Ala Cys Arg Pro Ala Ala Gly Gly Ala Val His Thr Arg Gly Leu Asp

290 295 300

Phe Ala Cys Asp Ile Tyr Ile Trp Ala Pro Leu Ala Gly Thr Cys Gly

305 310 315 320

Val Leu Leu Leu Ser Leu Val Ile Thr Leu Tyr Cys Lys Arg Gly Arg

325 330 335

Lys Lys Leu Leu Tyr Ile Phe Lys Gln Pro Phe Met Arg Pro Val Gln

340 345 350

Thr Thr Gln Glu Glu Asp Gly Cys Ser Cys Arg Phe Pro Glu Glu Glu

355 360 365

Glu Gly Gly Cys Glu Leu Arg Val Lys Phe Ser Arg Ser Ala Asp Ala

370 375 380

Pro Ala Tyr Lys Gln Gly Gln Asn Gln Leu Tyr Asn Glu Leu Asn Leu

385 390 395 400

Gly Arg Arg Glu Glu Tyr Asp Val Leu Asp Lys Arg Arg Gly Arg Asp

405 410 415

Pro Glu Met Gly Gly Lys Pro Arg Arg Lys Asn Pro Gln Glu Gly Leu

420 425 430

Tyr Asn Glu Leu Gln Lys Asp Lys Met Ala Glu Ala Tyr Ser Glu Ile

435 440 445

Gly Met Lys Gly Glu Arg Arg Arg Gly Lys Gly His Asp Gly Leu Tyr

450 455 460

Gln Gly Leu Ser Thr Ala Thr Lys Asp Thr Tyr Asp Ala Leu His Met

465 470 475 480

Gln Ala Leu Pro Pro Arg

485

<210> 175

<211> 483

<212> PRT

<213> artificial sequence

<220>

<223> M37 CAR AA

<400> 175

Met Ala Leu Pro Val Thr Ala Leu Leu Leu Pro Leu Ala Leu Leu Leu

1 5 10 15

His Ala Ala Arg Pro Asp Ile Val Met Thr Gln Thr Pro Ser Ser Leu

20 25 30

Ser Ala Ser Val Gly Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln

35 40 45

Gly Ile Ser Asn Tyr Leu Ala Trp Phe Gln Gln Lys Pro Gly Lys Ala

50 55 60

Pro Lys Pro Leu Ile Tyr Ala Ala Ser Ser Leu Gln Ser Gly Val Pro

65 70 75 80

Ser Lys Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile

85 90 95

Ser Asn Leu Gln Pro Glu Asp Phe Ala Thr Tyr Ile Cys Gln Gln Tyr

100 105 110

Ser Ser Tyr Pro Ile Thr Phe Gly Gln Gly Thr Arg Leu Glu Ile Lys

115 120 125

Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gln

130 135 140

Leu Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Glu Thr

145 150 155 160

Leu Ser Leu Thr Cys Ala Val Ser Gly Gly Ser Ile Ser Pro Tyr Tyr

165 170 175

Trp Thr Trp Ile Arg Gln Ser Pro Gly Lys Ala Met Glu Trp Met Gly

180 185 190

Tyr Ile His Tyr Ser Gly Arg Thr Asn Tyr Asn Pro Ser Leu Glu Ser

195 200 205

Arg Ala Thr Phe Ser Val Asp Thr Ser Lys Asn Gln Ile Ser Leu Lys

210 215 220

Leu Asn Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys Thr Lys

225 230 235 240

Val Gly Asp Pro Gly Leu Phe Asp Tyr Trp Gly Pro Gly Thr Leu Val

245 250 255

Thr Val Ser Ser Thr Thr Thr Pro Ala Pro Arg Pro Pro Thr Pro Ala

260 265 270

Pro Thr Ile Ala Ser Gln Pro Leu Ser Leu Arg Pro Glu Ala Cys Arg

275 280 285

Pro Ala Ala Gly Gly Ala Val His Thr Arg Gly Leu Asp Phe Ala Cys

290 295 300

Asp Ile Tyr Ile Trp Ala Pro Leu Ala Gly Thr Cys Gly Val Leu Leu

305 310 315 320

Leu Ser Leu Val Ile Thr Leu Tyr Cys Lys Arg Gly Arg Lys Lys Leu

325 330 335

Leu Tyr Ile Phe Lys Gln Pro Phe Met Arg Pro Val Gln Thr Thr Gln

340 345 350

Glu Glu Asp Gly Cys Ser Cys Arg Phe Pro Glu Glu Glu Glu Gly Gly

355 360 365

Cys Glu Leu Arg Val Lys Phe Ser Arg Ser Ala Asp Ala Pro Ala Tyr

370 375 380

Lys Gln Gly Gln Asn Gln Leu Tyr Asn Glu Leu Asn Leu Gly Arg Arg

385 390 395 400

Glu Glu Tyr Asp Val Leu Asp Lys Arg Arg Gly Arg Asp Pro Glu Met

405 410 415

Gly Gly Lys Pro Arg Arg Lys Asn Pro Gln Glu Gly Leu Tyr Asn Glu

420 425 430

Leu Gln Lys Asp Lys Met Ala Glu Ala Tyr Ser Glu Ile Gly Met Lys

435 440 445

Gly Glu Arg Arg Arg Gly Lys Gly His Asp Gly Leu Tyr Gln Gly Leu

450 455 460

Ser Thr Ala Thr Lys Asp Thr Tyr Asp Ala Leu His Met Gln Ala Leu

465 470 475 480

Pro Pro Arg

<210> 176

<211> 1461

<212> DNA

<213> artificial sequence

<220>

<223> M6 CAR NT

<400> 176

atggccttac cagtgaccgc cttgctcctg ccgctggcct tgctgctcca cgccgccagg 60

ccggaaattg tgatgacaca gtctccagcc acgctgtctt tgtctccagg ggaaagagcc 120

accctctcct gcagggccag tcagagtatt ggcaactcct tagcctggta ccaacagaaa 180

cctggccagg ctccccggct cctcatctat gatgtatcca atagggccac tggcatccca 240

gccaggttca gtggcagtgg gtctgggaca gacttcactc tcaccatcag cagcctagag 300

cctgaagatt ttgcagttta ttactgtcag caccgttaca gctggcctct cactttcggc 360

ggagggacca aggtggaaat caaaggtggt ggtggttctg gcggcggcgg ctccggaggt 420

ggtggatccc aggtccagct ggtacagtct gggggaggct tggtcaagcc tggagggtcc 480

ctgagactct cctgtgcagc ctctggattc accttcagtg actactacat gagctggatc 540

cgccaggctc cagggaaggg gctggagtgg gtttcataca ttagtagtag tggtagtacc 600

atatactacg cagactctgt gaagggccga ttcaccatct ccagggacaa cgccaagaac 660

tcactgtatc tgcaaatgaa cagcctgaga gccgaggaca cggccgtgta ttactgtgcg 720

agagatgggt atagaacgca caactggttc gacccctggg gccagggaac cctggtcact 780

gtctcctcaa ccacgacgcc agcgccgcga ccaccaacac cggcgcccac catcgcgtcg 840

cagcccctgt ccctgcgccc agaggcgtgc cggccagcgg cggggggcgc agtgcacacg 900

agggggctgg acttcgcctg tgatatctac atctgggcgc ccttggccgg gacttgtggg 960

gtccttctcc tgtcactggt tatcaccctt tactgcaaac ggggcagaaa gaaactcctg 1020

tatatattca aacaaccatt tatgagacca gtacaaacta ctcaagagga agatggctgt 1080

agctgccgat ttccagaaga agaagaagga ggatgtgaac tgagagtgaa gttcagcagg 1140

agcgcagacg cccccgcgta caagcagggc cagaaccagc tctataacga gctcaatcta 1200

ggacgaagag aggagtacga cgttttggac aagagacgtg gccgggaccc tgagatgggg 1260

ggaaagccga gaaggaagaa ccctcaggaa ggcctgtaca atgaactgca gaaagataag 1320

atggcggagg cctacagtga gattgggatg aaaggcgagc gccggagggg caaggggcac 1380

gatggccttt accagggtct cagtacagcc accaaggaca cctacgacgc ccttcacatg 1440

caggccctgc cccctcgcta a 1461

<210> 177

<211> 1467

<212> DNA

<213> artificial sequence

<220>

<223> M7 CAR NT

<400> 177

atggccttac cagtgaccgc cttgctcctg ccgctggcct tgctgctcca cgccgccagg 60

ccggacatcc ggttgaccca gtctccatcc tccctgtctg catctcttgg agacagagtc 120

accatcactt gtcgggcaag tcaggccatt agcagtgctt tagcctggta tcagcagaag 180

ccagggaaag ctcctaggct cctgatctat gatgcctcca ctttggaaag tggggtccca 240

tcaagattca gcggcagtgg atctgggaca gatttcactc tcaccatcag cagcctgcag 300

cctgaggatt ttgcaactta ctattgtcag caggctgaca gtttccctct cactttcggc 360

ggagggacca agctggagat caaaggtggt ggtggttctg gcggcggcgg ctccggaggt 420

ggtggatccc aggtgcagct ggtacagtct ggagcagagg tgaaaaagtc cggggagtct 480

cttaagatct cctgtaaggg ttctggatac ggctttggcg cctactggat cgcctgggtg 540

cgccagatgc ccggcaaagg cctggagtgg atggggatca tctatcctgg tgactctcga 600

gtcatctaca gcccgtactt ccaaggccag gtcaccatct cagccgacaa gtccatcagc 660

accgcctacc tgcagtggag cagcctgaag gcctcggaca ccgccatgta ttactgtgcg 720

agattcgggg gacccaaatt cgctaccaac tggttcgaca tctggggcca gggaaccacg 780

gtcaccgtct cctcaaccac gacgccagcg ccgcgaccac caacaccggc gcccaccatc 840

gcgtcgcagc ccctgtccct gcgcccagag gcgtgccggc cagcggcggg gggcgcagtg 900

cacacgaggg ggctggactt cgcctgtgat atctacatct gggcgccctt ggccgggact 960

tgtggggtcc ttctcctgtc actggttatc accctttact gcaaacgggg cagaaagaaa 1020

ctcctgtata tattcaaaca accatttatg agaccagtac aaactactca agaggaagat 1080

ggctgtagct gccgatttcc agaagaagaa gaaggaggat gtgaactgag agtgaagttc 1140

agcaggagcg cagacgcccc cgcgtacaag cagggccaga accagctcta taacgagctc 1200

aatctaggac gaagagagga gtacgacgtt ttggacaaga gacgtggccg ggaccctgag 1260

atggggggaa agccgagaag gaagaaccct caggaaggcc tgtacaatga actgcagaaa 1320

gataagatgg cggaggccta cagtgagatt gggatgaaag gcgagcgccg gaggggcaag 1380

gggcacgatg gcctttacca gggtctcagt acagccacca aggacaccta cgacgccctt 1440

cacatgcagg ccctgccccc tcgctaa 1467

<210> 178

<211> 1464

<212> DNA

<213> artificial sequence

<220>

<223> M8 CAR NT

<400> 178

atggccttac cagtgaccgc cttgctcctg ccgctggcct tgctgctcca cgccgccagg 60

ccggacatcc agttgaccca gtctccatcc tccctgtctg catctgtagg agacagagtc 120

accatcactt gccgggcaag tcagagcatt agcagctctt taaattggta tcagcagaaa 180

ccagggaaag cccctaagct cctgatctat gctgcgtcca gtttgcaaag tggggtccca 240

tcaaggttca gtggcagtgg atctgggaca gatttcactc tcaccatcag cagtctgcaa 300

cctgaagatt ttgcaactta ctcctgtcaa cagagttaca gtaccccgct cactttcggc 360

ggagggacca aggtggaaat caaaggtggt ggtggttctg gcggcggcgg ctccggaggt 420

ggtggatccc aggtgcatct ggtggagtct gggggaggcg tggtccagcc ggggaggtcc 480

ctgagagtct cctgtgcagc ctctggattc accttcagcg gctatgctat gtactgggtc 540

cgccaggctc cagggaaggg actggaatat gtttcagcta ttactaccaa tgggggtagc 600

acaaactacg cagactcagt gaagggcaga ttcaccatct ccagagacaa ttccaagaac 660

acgctatatc ttcaaatgag cagcctgaga gccggggaca cggctgtgta ttactgtgca 720

agaggggccc cagggtaccg aggatactac atggacgtct ggggcaaagg gaccacggtc 780

accgtctcct caaccacgac gccagcgccg cgaccaccaa caccggcgcc caccatcgcg 840

tcgcagcccc tgtccctgcg cccagaggcg tgccggccag cggcgggggg cgcagtgcac 900

acgagggggc tggacttcgc ctgtgatatc tacatctggg cgcccttggc cgggacttgt 960

ggggtccttc tcctgtcact ggttatcacc ctttactgca aacggggcag aaagaaactc 1020

ctgtatatat tcaaacaacc atttatgaga ccagtacaaa ctactcaaga ggaagatggc 1080

tgtagctgcc gatttccaga agaagaagaa ggaggatgtg aactgagagt gaagttcagc 1140

aggagcgcag acgcccccgc gtacaagcag ggccagaacc agctctataa cgagctcaat 1200

ctaggacgaa gagaggagta cgacgttttg gacaagagac gtggccggga ccctgagatg 1260

gggggaaagc cgagaaggaa gaaccctcag gaaggcctgt acaatgaact gcagaaagat 1320

aagatggcgg aggcctacag tgagattggg atgaaaggcg agcgccggag gggcaagggg 1380

cacgatggcc tttaccaggg tctcagtaca gccaccaagg acacctacga cgcccttcac 1440

atgcaggccc tgccccctcg ctaa 1464

<210> 179

<211> 1455

<212> DNA

<213> artificial sequence

<220>

<223> M10 CAR NT

<400> 179

atggccttac cagtgaccgc cttgctcctg ccgctggcct tgctgctcca cgccgccagg 60

ccggacatcc ggatgaccca gtctccttcc accctgtctg catctgtagg agacagagtc 120

accatcactt gccgggccag tcagagtatt agtagctggt tggcctggta tcagcagaaa 180

ccagggaaag cccctaagct cctgatctat aaggcgtcta gtttagaaag tggggtccct 240

tcaaggttca gcggcagtgg atctgggaca gaattcactc tcaccatcag caccctgcag 300

cctgacgatt ttgcaactta ttactgccaa cagtattata gttacccgct cactttcggc 360

ggagggacca aggtggagat caaaggtggt ggtggttctg gcggcggcgg ctccggaggt 420

ggtggatccc aggtgcagct ggtgcagtct gggggaggct tggtacagcc tggggggtcc 480

ctgagactct cctgtgcagc ctctggattc acctttagca gctatgccat gagctgggtc 540

cgccaggctc cagggaaggg gctggagtgg gtctcagcta ttagtggtag tggtggtagc 600

acatactacg cagactccgt gaagggccgg ttcaccatct ccagagacaa ttccaagaac 660

acgctgtatc tgcaaatgaa cagcctgaga gccgaggaca cggccgtata ttactgtgcg 720

aaacggggca gcagctggta ctttgactac tggggccagg gaaccctggt cactgtctcc 780

tcaaccacga cgccagcgcc gcgaccacca acaccggcgc ccaccatcgc gtcgcagccc 840

ctgtccctgc gcccagaggc gtgccggcca gcggcggggg gcgcagtgca cacgaggggg 900

ctggacttcg cctgtgatat ctacatctgg gcgcccttgg ccgggacttg tggggtcctt 960

ctcctgtcac tggttatcac cctttactgc aaacggggca gaaagaaact cctgtatata 1020

ttcaaacaac catttatgag accagtacaa actactcaag aggaagatgg ctgtagctgc 1080

cgatttccag aagaagaaga aggaggatgt gaactgagag tgaagttcag caggagcgca 1140

gacgcccccg cgtacaagca gggccagaac cagctctata acgagctcaa tctaggacga 1200

agagaggagt acgacgtttt ggacaagaga cgtggccggg accctgagat ggggggaaag 1260

ccgagaagga agaaccctca ggaaggcctg tacaatgaac tgcagaaaga taagatggcg 1320

gaggcctaca gtgagattgg gatgaaaggc gagcgccgga ggggcaaggg gcacgatggc 1380

ctttaccagg gtctcagtac agccaccaag gacacctacg acgcccttca catgcaggcc 1440

ctgccccctc gctaa 1455

<210> 180

<211> 1458

<212> DNA

<213> artificial sequence

<220>

<223> M12 CAR NT

<400> 180

atggccttac cagtgaccgc cttgctcctg ccgctggcct tgctgctcca cgccgccagg 60

ccggccatcc ggttgaccca gtctccatcc ctcctgtctg catctgtagg agacagggtc 120

accgtcactt gtcgggccag tcagggcggt ggcaattatt tagcctggta tcagcaaaaa 180

ccagggaaag ccccgaaact cctgatctat ggtgcatcca agttgcaaag tggggtccca 240

tcgaggttca gcggcagtgg atctgggaca gaattcactc tcacaatcag cagtctgcag 300

cctgaagatt ttgcaactta ttactgtcaa cagcttaata gttaccctgt cacttttggc 360

caggggacca aagtggatat caaaggtggt ggtggttctg gcggcggcgg ctccggaggt 420

ggtggatccg aggtgcagct ggtggagtct ggggctgagg tgaagaagcc tggggcctca 480

gtgaaggttt cctgcaaggc atctggatac accttcacca cctactatat acactgggtg 540

cgacaggccc ctggacaagg gcttgagtgg atgggaataa tcaaccctag tagtggtagc 600

actacctaca cacagaagtt ccagggcaga gtcaccatga ccagggacac gtccacgagc 660

acagtctaca ttgaactgag cggcctgaga tctgaagaca cggccgtgta ttactgtgcc 720

cgaggggaga cgcttcgggg ctactttgac tactggggcc agggaaccct ggtcaccgtc 780

tcttcaacca cgacgccagc gccgcgacca ccaacaccgg cgcccaccat cgcgtcgcag 840

cccctgtccc tgcgcccaga ggcgtgccgg ccagcggcgg ggggcgcagt gcacacgagg 900

gggctggact tcgcctgtga tatctacatc tgggcgccct tggccgggac ttgtggggtc 960

cttctcctgt cactggttat caccctttac tgcaaacggg gcagaaagaa actcctgtat 1020

atattcaaac aaccatttat gagaccagta caaactactc aagaggaaga tggctgtagc 1080

tgccgatttc cagaagaaga agaaggagga tgtgaactga gagtgaagtt cagcaggagc 1140

gcagacgccc ccgcgtacaa gcagggccag aaccagctct ataacgagct caatctagga 1200

cgaagagagg agtacgacgt tttggacaag agacgtggcc gggaccctga gatgggggga 1260

aagccgagaa ggaagaaccc tcaggaaggc ctgtacaatg aactgcagaa agataagatg 1320

gcggaggcct acagtgagat tgggatgaaa ggcgagcgcc ggaggggcaa ggggcacgat 1380

ggcctttacc agggtctcag tacagccacc aaggacacct acgacgccct tcacatgcag 1440

gccctgcccc ctcgctaa 1458

<210> 181

<211> 1470

<212> DNA

<213> artificial sequence

<220>

<223> M13 CAR NT

<400> 181

atggccttac cagtgaccgc cttgctcctg ccgctggcct tgctgctcca cgccgccagg 60

ccggccatcc ggatgaccca gtctccatcc tccctgtctg catctgtagg agacagagtc 120

accatcactt gccgggcgag tcagggcatt agcaattctt tagcctggta tcagcagaaa 180

ccagggaaag cccctaagct cctgctctat gctgcatcca gattggaaag tggggtccca 240

tccaggttca gtggcagtgg atctgggacg gattacactc tcaccatcag cagcctgcag 300

cctgaagatt ttgcaactta ttactgtcaa cagtattata gtaccccctt cactttcggc 360

cctgggacca agctggagat caaaggtggt ggtggttctg gcggcggcgg ctccggaggt 420

ggtggatccc aggtgcagct ggtacagtct ggggctgaag tgaagaagcc tgggtcctcg 480

gtgaaggtct cctgcaagac ttctgcagac accttcagcg caaatactat caactgggtg 540

cgacaggccc ctggacacgg gcttgagtgg atgggaagga tcatcccttc tctgaatata 600

cgagactacg cacaggagtt ccagggcaga gtcacattta ccgcggacga atccacgaac 660

acagtctata tgcagttgac cagcctgaga tctgaggaca cggccgtgta ttactgtgcg 720

agagatccgg gcagcacctg gtccccgaat caattcttcc cccactgggg ccagggcacc 780

ctggtcaccg tctcctcaac cacgacgcca gcgccgcgac caccaacacc ggcgcccacc 840

atcgcgtcgc agcccctgtc cctgcgccca gaggcgtgcc ggccagcggc ggggggcgca 900

gtgcacacga gggggctgga cttcgcctgt gatatctaca tctgggcgcc cttggccggg 960

acttgtgggg tccttctcct gtcactggtt atcacccttt actgcaaacg gggcagaaag 1020

aaactcctgt atatattcaa acaaccattt atgagaccag tacaaactac tcaagaggaa 1080

gatggctgta gctgccgatt tccagaagaa gaagaaggag gatgtgaact gagagtgaag 1140

ttcagcagga gcgcagacgc ccccgcgtac aagcagggcc agaaccagct ctataacgag 1200

ctcaatctag gacgaagaga ggagtacgac gttttggaca agagacgtgg ccgggaccct 1260

gagatggggg gaaagccgag aaggaagaac cctcaggaag gcctgtacaa tgaactgcag 1320

aaagataaga tggcggaggc ctacagtgag attgggatga aaggcgagcg ccggaggggc 1380

aaggggcacg atggccttta ccagggtctc agtacagcca ccaaggacac ctacgacgcc 1440

cttcacatgc aggccctgcc ccctcgctaa 1470

<210> 182

<211> 1461

<212> DNA

<213> artificial sequence

<220>

<223> M15 CAR NT

<400> 182

atggccttac cagtgaccgc cttgctcctg ccgctggcct tgctgctcca cgccgccagg 60

ccggacatcc agttgaccca gtctccatcc tccctgtctg catctattgg agacagagtc 120

accatcactt gccgggcaag tcagggcgtt aacagtgctt tagcctggta tcagcagaaa 180

ccagggaaac ctcctaacct cctgatctat gatgcctcca gtttggaaag tggggtccca 240

tcaaggttca gcggcagtgg atctgggaga gatttcactc tcaccatcag cagcctgcag 300

cctgaagatt ttgcaactta ttactgtcaa cagtttagta gttaccctct cactttcggc 360

ggagggacca aagtggatat caaaggtggt ggtggttctg gcggcggcgg ctccggaggt 420

ggtggatccc aggtgcagct ggtacagtct ggggctgagg tgaagaagcc tggggcctca 480

gtgaaggttt cctgcaaggc atctggatac accttcacca gctactatat gcactgggtg 540

cgacaggccc ctggacaagg gcttgagtgg atgggaataa tcaaccctag tggtggtagc 600

acaagctacg cacagaagtt ccagggcaga gtcaccatga ccagggacac gtccacgagc 660

acagtctaca tggagctgag cagcctgaga tctgaggaca cggccgtgta ttactgtgcg 720

agagcccaaa gggggggctc cgtctacttt gactactggg gccagggaac cctggtcacc 780

gtctcctcaa ccacgacgcc agcgccgcga ccaccaacac cggcgcccac catcgcgtcg 840

cagcccctgt ccctgcgccc agaggcgtgc cggccagcgg cggggggcgc agtgcacacg 900

agggggctgg acttcgcctg tgatatctac atctgggcgc ccttggccgg gacttgtggg 960

gtccttctcc tgtcactggt tatcaccctt tactgcaaac ggggcagaaa gaaactcctg 1020

tatatattca aacaaccatt tatgagacca gtacaaacta ctcaagagga agatggctgt 1080

agctgccgat ttccagaaga agaagaagga ggatgtgaac tgagagtgaa gttcagcagg 1140

agcgcagacg cccccgcgta caagcagggc cagaaccagc tctataacga gctcaatcta 1200

ggacgaagag aggagtacga cgttttggac aagagacgtg gccgggaccc tgagatgggg 1260

ggaaagccga gaaggaagaa ccctcaggaa ggcctgtaca atgaactgca gaaagataag 1320

atggcggagg cctacagtga gattgggatg aaaggcgagc gccggagggg caaggggcac 1380

gatggccttt accagggtct cagtacagcc accaaggaca cctacgacgc ccttcacatg 1440

caggccctgc cccctcgcta a 1461

<210> 183

<211> 1461

<212> DNA

<213> artificial sequence

<220>

<223> M20 CAR NT

<400> 183

atggccttac cagtgaccgc cttgctcctg ccgctggcct tgctgctcca cgccgccagg 60

ccggccatcc agatgaccca gtctccatcc tccctgtctg catctgtcgg gaacagagtc 120

accatcactt gccgggcaag tcaaggcatt agcagtgctg tagcctggta tcagcagaaa 180

ccagggaaac cccctaaact cctaatctct tatgcctcca gtttggaaag tggggtccca 240

tcaaggttca gcggcagtgg atctgggaca gatttcagtc tcaccatcag cagcctgcag 300

cctgaagatt ttgcaactta tttctgtcaa cagtttaata gttaccctct cactttcggc 360

ggagggacca aggtggagat caaaggtggt ggtggttctg gcggcggcgg ctccggaggt 420

ggtggatccc aggtccagct ggtacagtct ggagcggagg tgagaaagcc cggggagtct 480

ctgaagatat catgtaaggg gtctggatat agctttcgtg actcctggat cgcctgggtg 540

cgccagatgc ccgggcaagg cctggaatgg atgggcatca tctttcctgg tgactctaat 600

cccatataca gcccgtcctt ccaaggccag gtcaccatat cagccgacac gtccatcagt 660

accaccttcc tgcagtggag aagcctgaag gcctcggaca gcgccatata ttactgtgcg 720

agacatgcag cctggggtgc ggggtggttc gacccctggg gccagggaac cctggtcact 780

gtctcctcaa ccacgacgcc agcgccgcga ccaccaacac cggcgcccac catcgcgtcg 840

cagcccctgt ccctgcgccc agaggcgtgc cggccagcgg cggggggcgc agtgcacacg 900

agggggctgg acttcgcctg tgatatctac atctgggcgc ccttggccgg gacttgtggg 960

gtccttctcc tgtcactggt tatcaccctt tactgcaaac ggggcagaaa gaaactcctg 1020

tatatattca aacaaccatt tatgagacca gtacaaacta ctcaagagga agatggctgt 1080

agctgccgat ttccagaaga agaagaagga ggatgtgaac tgagagtgaa gttcagcagg 1140

agcgcagacg cccccgcgta caagcagggc cagaaccagc tctataacga gctcaatcta 1200

ggacgaagag aggagtacga cgttttggac aagagacgtg gccgggaccc tgagatgggg 1260

ggaaagccga gaaggaagaa ccctcaggaa ggcctgtaca atgaactgca gaaagataag 1320

atggcggagg cctacagtga gattgggatg aaaggcgagc gccggagggg caaggggcac 1380

gatggccttt accagggtct cagtacagcc accaaggaca cctacgacgc ccttcacatg 1440

caggccctgc cccctcgcta a 1461

<210> 184

<211> 1467

<212> DNA

<213> artificial sequence

<220>

<223> M22 CAR NT

<400> 184

atggccttac cagtgaccgc cttgctcctg ccgctggcct tgctgctcca cgccgccagg 60

ccgcaatctg ccctgactca gcctgcctcc gtgtctgggt ctcctggaca gtcgatcacc 120

ctctcctgca ctggaacccg ccgtgacatt ggtggttatg agtatgtctc ctggtaccaa 180

caacaccccg gcaaagcccc caaactcctt atatttagtg tcaataatcg gccctcaggg 240

gtttctcatc gcttctctgg ctccaagtct ggcaacacgg cctccctgac catctctggg 300

ctccaggctg aggacgaggc tgcttatttc tgcagttcat attcaagccg cgacactctc 360

gtccttttcg gcggagggac caagctgacc gtcctaggtg gtggtggttc tggcggcggc 420

ggctccggag gtggtggatc ccaggtccag ctggtgcagt ctggggctga ggtgaagaag 480

cctgggtcct cggtgaaggt ctcctgcaag gcttctggag gcaccttcag cagctatgct 540

atcagctggg tgcgacaggc ccctggacaa gggcttgagt ggatgggagg gatcatccct 600

atctttggta cagcaaacta cgcacagaag ttccagggca gagtcacgat taccgcggac 660

gaatccacga gcacagccta catggagctg agcagcctga gatctgagga cacggccgtg 720

tattactgtg cgagtggccg tagtgggagc tacgggttgt actggggcca gggaaccctg 780

gtcaccgtct cctcaaccac gacgccagcg ccgcgaccac caacaccggc gcccaccatc 840

gcgtcgcagc ccctgtccct gcgcccagag gcgtgccggc cagcggcggg gggcgcagtg 900

cacacgaggg ggctggactt cgcctgtgat atctacatct gggcgccctt ggccgggact 960

tgtggggtcc ttctcctgtc actggttatc accctttact gcaaacgggg cagaaagaaa 1020

ctcctgtata tattcaaaca accatttatg agaccagtac aaactactca agaggaagat 1080

ggctgtagct gccgatttcc agaagaagaa gaaggaggat gtgaactgag agtgaagttc 1140

agcaggagcg cagacgcccc cgcgtacaag cagggccaga accagctcta taacgagctc 1200

aatctaggac gaagagagga gtacgacgtt ttggacaaga gacgtggccg ggaccctgag 1260

atggggggaa agccgagaag gaagaaccct caggaaggcc tgtacaatga actgcagaaa 1320

gataagatgg cggaggccta cagtgagatt gggatgaaag gcgagcgccg gaggggcaag 1380

gggcacgatg gcctttacca gggtctcagt acagccacca aggacaccta cgacgccctt 1440

cacatgcagg ccctgccccc tcgctaa 1467

<210> 185

<211> 1461

<212> DNA

<213> artificial sequence

<220>

<223> M24 CAR NT

<400> 185

atggccttac cagtgaccgc cttgctcctg ccgctggcct tgctgctcca cgccgccagg 60

ccgcagcctg tgctgactca accaccctca gcgtctggga cccccgggca gagggtcacc 120

atctcttgtt ctggaagcag ctccaacatc ggaagtaatt atgtatactg gtaccagcag 180

ttcccgggaa cggcccccaa actcctcatc tatatgaata atcagcggcc ctcaggggtc 240

cctgaccgat tctctggctc caagtctggc acctcagcct ccctggccat cagtgggctc 300

cggtccgagg atgaggctga ttattactgt gcagcaaggg atgacagcct gagtggctat 360

gtgacatttg gcggagggac caagctgacc gtcctaggtg gtggtggttc tggcggcggc 420

ggctccggag gtggtggatc cgaagtgcat ctggtggagt ctgggggagg cttggtacag 480

cctggggggt ccctgagact ctcctgtgca gcctctggat tcacctttag cagctatgcc 540

atgagctggg tccgccaggc tccagggaag gggctggagt gggtctcagc tattagtggt 600

agtggtggta gcacatacta cgcagactcc gtgaagggcc ggttcaccat ctccagagac 660

aattccaaga acacgctgta tctgcaaatg aacagcctga aaaccgagga cacagccgtg 720

tattactgta ctagaggagt ggccaccttt gactactggg gccagggaac cctggtcact 780

gtctcctcaa ccacgacgcc agcgccgcga ccaccaacac cggcgcccac catcgcgtcg 840

cagcccctgt ccctgcgccc agaggcgtgc cggccagcgg cggggggcgc agtgcacacg 900

agggggctgg acttcgcctg tgatatctac atctgggcgc ccttggccgg gacttgtggg 960

gtccttctcc tgtcactggt tatcaccctt tactgcaaac ggggcagaaa gaaactcctg 1020

tatatattca aacaaccatt tatgagacca gtacaaacta ctcaagagga agatggctgt 1080

agctgccgat ttccagaaga agaagaagga ggatgtgaac tgagagtgaa gttcagcagg 1140

agcgcagacg cccccgcgta caagcagggc cagaaccagc tctataacga gctcaatcta 1200

ggacgaagag aggagtacga cgttttggac aagagacgtg gccgggaccc tgagatgggg 1260

ggaaagccga gaaggaagaa ccctcaggaa ggcctgtaca atgaactgca gaaagataag 1320

atggcggagg cctacagtga gattgggatg aaaggcgagc gccggagggg caaggggcac 1380

gatggccttt accagggtct cagtacagcc accaaggaca cctacgacgc ccttcacatg 1440

caggccctgc cccctcgcta a 1461

<210> 186

<211> 1479

<212> DNA

<213> artificial sequence

<220>

<223> M27 CAR NT

<400> 186

atggccttac cagtgaccgc cttgctcctg ccgctggcct tgctgctcca cgccgccagg 60

ccggaaattg tgttgacaca gtctccgggc accctgtctt tgtctccggg ggaaagagcc 120

accctctcct gcagggccag tcaacctatt gtcgccagtc acttagcctg gtaccagcac 180

aaacctggcc aggctcccag gctcctcatc tatggtgcat ccaccagggc cgctggcatc 240

ccagacaggt tcagtggcag tgggtctggg acagacttca ctctcaccat cagcagactg 300

gagcctgaag attttgctgt gtatttctgt cagcaatatg gtatttcacc cttcactttc 360

ggccctggga ccaaagtgga tatcaaaggt ggtggtggtt ctggcggcgg cggctccgga 420

ggtggtggat cccaggtgca gctggtacag tctggagcag aggtgaaaaa gccgggggag 480

tctctgaaga tctcctgtca gggttctgga tacagtttta ccgactactg gatcggctgg 540

gtgcgacagg cccctggaca agggcttgag tggatgggat ggatcacccc taacaatggt 600

aacacaaact atgcaccgaa gttccagggc agagtcaccc tgaccacaga cacatccacg 660

agcacagcct acatggagct gaggagcctg acctctgacg acacggccgt gtatttctgt 720

gcgaggagag gtcggaacag cagcggctac ttatattatt acagtatgga cgtctggggc 780

caagggacca cggtcaccgt ctcctcaacc acgacgccag cgccgcgacc accaacaccg 840

gcgcccacca tcgcgtcgca gcccctgtcc ctgcgcccag aggcgtgccg gccagcggcg 900

gggggcgcag tgcacacgag ggggctggac ttcgcctgtg atatctacat ctgggcgccc 960

ttggccggga cttgtggggt ccttctcctg tcactggtta tcacccttta ctgcaaacgg 1020

ggcagaaaga aactcctgta tatattcaaa caaccattta tgagaccagt acaaactact 1080

caagaggaag atggctgtag ctgccgattt ccagaagaag aagaaggagg atgtgaactg 1140

agagtgaagt tcagcaggag cgcagacgcc cccgcgtaca agcagggcca gaaccagctc 1200

tataacgagc tcaatctagg acgaagagag gagtacgacg ttttggacaa gagacgtggc 1260

cgggaccctg agatgggggg aaagccgaga aggaagaacc ctcaggaagg cctgtacaat 1320

gaactgcaga aagataagat ggcggaggcc tacagtgaga ttgggatgaa aggcgagcgc 1380

cggaggggca aggggcacga tggcctttac cagggtctca gtacagccac caaggacacc 1440

tacgacgccc ttcacatgca ggccctgccc cctcgctaa 1479

<210> 187

<211> 1479

<212> DNA

<213> artificial sequence

<220>

<223> M28 CAR NT

<400> 187

atggccttac cagtgaccgc cttgctcctg ccgctggcct tgctgctcca cgccgccagg 60

ccgcagtctg ccctgactca gcctccctcc gcgtccgggt ctcctggaca gtcagtcacc 120

atctcctgct ctggaaccag cagtgacgtt ggtggttata actttgtctc ctggtaccaa 180

catcacccag gcaaagcccc caaactcatg atttatgagg tcagtaagcg gccctcaggg 240

gtccctgatc gcttctctgg ctccaagtct ggcaacacgg cctccctgac cgtctctggg 300

ctccaggctg aggatgaggc tgattattac tgcagctcat atgcaggccg caacaatcct 360

tatctcttcg gaactgggac caagctgacc gtcctaggtg gtggtggttc tggcggcgga 420

ggctccggag gtggtggatc ccagctgcag ctgcaggagt cgggggctga ggtgaagaag 480

cctgggtcct cggtgaaggt ctcctgcaag gcttctggag gcaccttcag cagctatgct 540

atcagctggg tgcgacaggc ccctggacaa gggcttgagt ggatgggagg gatcatccct 600

atctttggta cagcaaacta cgcacagaag ttccagggca gagtcacgat taccgcggac 660

gaatccacga gcacagccta catggagctg agcagcctga gatctgagga cacggccgtg 720

tattactgtg cgagagatct ggggggatac agctatggcc acggtcttga ctactggggc 780

cagggaaccc tggtcaccgt ctcctcaacc acgacgccag cgccgcgacc accaacaccg 840

gcgcccacca tcgcgtcgca gcccctgtcc ctgcgcccag aggcgtgccg gccagcggcg 900

gggggcgcag tgcacacgag ggggctggac ttcgcctgtg atatctacat ctgggcgccc 960

ttggccggga cttgtggggt ccttctcctg tcactggtta tcacccttta ctgcaaacgg 1020

ggcagaaaga aactcctgta tatattcaaa caaccattta tgagaccagt acaaactact 1080

caagaggaag atggctgtag ctgccgattt ccagaagaag aagaaggagg atgtgaactg 1140

agagtgaagt tcagcaggag cgcagacgcc cccgcgtaca agcagggcca gaaccagctc 1200

tataacgagc tcaatctagg acgaagagag gagtacgacg ttttggacaa gagacgtggc 1260

cgggaccctg agatgggggg aaagccgaga aggaagaacc ctcaggaagg cctgtacaat 1320

gaactgcaga aagataagat ggcggaggcc tacagtgaga ttgggatgaa aggcgagcgc 1380

cggaggggca aggggcacga tggcctttac cagggtctca gtacagccac caaggacacc 1440

tacgacgccc ttcacatgca ggccctgccc cctcgctaa 1479

<210> 188

<211> 1461

<212> DNA

<213> artificial sequence

<220>

<223> M31 CAR NT

<400> 188

atggccttac cagtgaccgc cttgctcctg ccgctggcct tgctgctcca cgccgccagg 60

ccgcagtctg ccctgactca gcctccctcc gcgtccgggt ctcctggaca gtcagtcacc 120

atctcctgca ctggaaccag cagtgacatt ggtggttata attctgtctc ctggtaccaa 180

caacacccag gcaaagcccc caaactcata atttatgggg tcagtaggcg gccctcaggg 240

gtccctgatc gcttctctgg ctccaagtct gccaacacgg cctccctgac cgtctctggg 300

ctccaggctg tggatgaggc tgattattac tgcagctcct atggaggcag caacaatttg 360

ctattcggcg gagggaccaa gctgaccgtc ctaggtggtg gtggttctgg cggcggcggc 420

tccggaggtg gtggatccga ggtgcatctg gtggagtctg ggggaggctt ggcccagcct 480

ggggggtccc tgagactctc ctgtgcagcc tctggattca gctttagtag ttcttggatg 540

gcctgggtcc gccaggctcc agggaagggg ctggagtggg tggccaacat aaagcaagat 600

ggaagttcgc aatactatgt ggactctgtg aagggccgat tcaccatctc cagagacaac 660

gccaagaact cactgtctct gcaaatgaac agcctgagag ccgaggacac ggctgtgtat 720

tactgtgcga gagacatctg gtactcgatt gactactggg gccagggaac cctggtcact 780

gtctcctcaa ccacgacgcc agcgccgcga ccaccaacac cggcgcccac catcgcgtcg 840

cagcccctgt ccctgcgccc agaggcgtgc cggccagcgg cggggggcgc agtgcacacg 900

agggggctgg acttcgcctg tgatatctac atctgggcgc ccttggccgg gacttgtggg 960

gtccttctcc tgtcactggt tatcaccctt tactgcaaac ggggcagaaa gaaactcctg 1020

tatatattca aacaaccatt tatgagacca gtacaaacta ctcaagagga agatggctgt 1080

agctgccgat ttccagaaga agaagaagga ggatgtgaac tgagagtgaa gttcagcagg 1140

agcgcagacg cccccgcgta caagcagggc cagaaccagc tctataacga gctcaatcta 1200

ggacgaagag aggagtacga cgttttggac aagagacgtg gccgggaccc tgagatgggg 1260

ggaaagccga gaaggaagaa ccctcaggaa ggcctgtaca atgaactgca gaaagataag 1320

atggcggagg cctacagtga gattgggatg aaaggcgagc gccggagggg caaggggcac 1380

gatggccttt accagggtct cagtacagcc accaaggaca cctacgacgc ccttcacatg 1440

caggccctgc cccctcgcta a 1461

<210> 189

<211> 1461

<212> DNA

<213> artificial sequence

<220>

<223> M32 CAR NT

<400> 189

atggccttac cagtgaccgc cttgctcctg ccgctggcct tgctgctcca cgccgccagg 60

ccggacatcc ggatgaccca gtctccatcc tccctgtctg cctctgtagg agacagagtc 120

accgtcactt gccaggcgag tgaggacatt aacaactctt taaattggta tcagcagaaa 180

ccagggaaag cccctcaact cctgatctac gatgcatccg atttggagac aggggtccca 240

tcaaggttca gtggacgtgg gtctgggaga gatttcactc tcaccatcag cagcctgcag 300

cctgaagatt ttgcaactta ttactgtcaa cagcttaata gttaccccct cactttcggc 360

ggagggacca agctggagat caaaggtggt ggtggttctg gcggcggcgg ctccggaggt 420

ggtggatccc aggtccagct ggtacagtct ggggctgagg tgaagaagcc tggggcctca 480

gtgaaggttt cctgcaaggc gtctggattt accttcatcg gctactatct acactgggtg 540

cgacaggccc ctggacaagg gcttgagtgg atgggaataa tcaacccttc aggtggtagg 600

acaagcatgg cacagaagtt ccagggcaga gtctccatga ccactgacac gtccacgggc 660

acagtctact tggacctggg cagactggga tctgatgaca cggccgtgta ttactgtgcg 720

agagccgata actggaacgc cgggtccatg gacgtctggg gcaatgggac cacggtcacc 780

gtctcctcaa ccacgacgcc agcgccgcga ccaccaacac cggcgcccac catcgcgtcg 840

cagcccctgt ccctgcgccc agaggcgtgc cggccagcgg cggggggcgc agtgcacacg 900

agggggctgg acttcgcctg tgatatctac atctgggcgc ccttggccgg gacttgtggg 960

gtccttctcc tgtcactggt tatcaccctt tactgcaaac ggggcagaaa gaaactcctg 1020

tatatattca aacaaccatt tatgagacca gtacaaacta ctcaagagga agatggctgt 1080

agctgccgat ttccagaaga agaagaagga ggatgtgaac tgagagtgaa gttcagcagg 1140

agcgcagacg cccccgcgta caagcagggc cagaaccagc tctataacga gctcaatcta 1200

ggacgaagag aggagtacga cgttttggac aagagacgtg gccgggaccc tgagatgggg 1260

ggaaagccga gaaggaagaa ccctcaggaa ggcctgtaca atgaactgca gaaagataag 1320

atggcggagg cctacagtga gattgggatg aaaggcgagc gccggagggg caaggggcac 1380

gatggccttt accagggtct cagtacagcc accaaggaca cctacgacgc ccttcacatg 1440

caggccctgc cccctcgcta a 1461

<210> 190

<211> 1452

<212> DNA

<213> artificial sequence

<220>

<223> M37 CAR NT

<400> 190

atggccttac cagtgaccgc cttgctcctg ccgctggcct tgctgctcca cgccgccagg 60

ccggatattg tgatgactca gactccatcc tcactgtctg catctgtagg ggacagagtc 120

accatcactt gtcgggcgag tcagggcatt agcaattatt tagcctggtt tcagcagaaa 180

ccagggaaag cccctaagcc cctgatctat gctgcatcca gtttgcaaag tggggtccca 240

tcaaagttca gcggcagtgg atctgggaca gatttcactc tcaccatcag caacctgcag 300

cctgaagatt ttgcaactta tatctgccaa cagtatagta gttatcctat caccttcggc 360

caagggacac gactggagat caaaggtggt ggtggttctg gcggcggcgg ctccggaggt 420

ggtggatccc agctgcagct gcaggagtcg ggcccaggac tggtgaagcc ttcggagacc 480

ctgtccctca cctgcgctgt ctcgggtggc tccatcagcc cttactactg gacctggatc 540

cggcagtccc cagggaaggc gatggagtgg atgggatata tccattacag tgggaggacc 600

aactacaacc cctccctcga gagtcgagcc accttttcag tagacacgtc caagaaccag 660

atctccctga agctgaactc tgtgaccgct gcggacacgg ccgtgtatta ctgtacgaaa 720

gtgggagacc ctggcttatt cgactactgg ggcccgggaa ccctggtcac tgtctcctca 780

accacgacgc cagcgccgcg accaccaaca ccggcgccca ccatcgcgtc gcagcccctg 840

tccctgcgcc cagaggcgtg ccggccagcg gcggggggcg cagtgcacac gagggggctg 900

gacttcgcct gtgatatcta catctgggcg cccttggccg ggacttgtgg ggtccttctc 960

ctgtcactgg ttatcaccct ttactgcaaa cggggcagaa agaaactcct gtatatattc 1020

aaacaaccat ttatgagacc agtacaaact actcaagagg aagatggctg tagctgccga 1080

tttccagaag aagaagaagg aggatgtgaa ctgagagtga agttcagcag gagcgcagac 1140

gcccccgcgt acaagcaggg ccagaaccag ctctataacg agctcaatct aggacgaaga 1200

gaggagtacg acgttttgga caagagacgt ggccgggacc ctgagatggg gggaaagccg 1260

agaaggaaga accctcagga aggcctgtac aatgaactgc agaaagataa gatggcggag 1320

gcctacagtg agattgggat gaaaggcgag cgccggaggg gcaaggggca cgatggcctt 1380

taccagggtc tcagtacagc caccaaggac acctacgacg cccttcacat gcaggccctg 1440

ccccctcgct aa 1452

<210> 191

<211> 5

<212> PRT

<213> artificial sequence

<220>

<223> linker

<220>

<221> REPEAT

<222> (1)..(5)

<223> (GGGGS)n, n=1,2,3,4,or 5

<400> 191

Gly Gly Gly Gly Ser

1 5

<210> 192

<211> 5

<212> PRT

<213> artificial sequence

<220>

<223> linker

<220>

<221> REPEAT

<222> (1)..(5)

<223> (EAAAK)n, n=1,2,3,4,or 5

<400> 192

Glu Ala Ala Ala Lys

1 5

<210> 193

<211> 3

<212> PRT

<213> artificial sequence

<220>

<223> linker

<220>

<221> REPEAT

<222> (1)..(2)

<223> (PA)nP, n=1,2,3,4,or 5

<400> 193

Pro Ala Pro

1

<210> 194

<211> 15

<212> PRT

<213> artificial sequence

<220>

<223> linker

<400> 194

Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser

1 5 10 15

<210> 195

<211> 164

<212> PRT

<213> artificial sequence

<220>

<223> human CD3zeta

<400> 195

Met Lys Trp Lys Ala Leu Phe Thr Ala Ala Ile Leu Gln Ala Gln Leu

1 5 10 15

Pro Ile Thr Glu Ala Gln Ser Phe Gly Leu Leu Asp Pro Lys Leu Cys

20 25 30

Tyr Leu Leu Asp Gly Ile Leu Phe Ile Tyr Gly Val Ile Leu Thr Ala

35 40 45

Leu Phe Leu Arg Val Lys Phe Ser Arg Ser Ala Asp Ala Pro Ala Tyr

50 55 60

Gln Gln Gly Gln Asn Gln Leu Tyr Asn Glu Leu Asn Leu Gly Arg Arg

65 70 75 80

Glu Glu Tyr Asp Val Leu Asp Lys Arg Arg Gly Arg Asp Pro Glu Met

85 90 95

Gly Gly Lys Pro Gln Arg Arg Lys Asn Pro Gln Glu Gly Leu Tyr Asn

100 105 110

Glu Leu Gln Lys Asp Lys Met Ala Glu Ala Tyr Ser Glu Ile Gly Met

115 120 125

Lys Gly Glu Arg Arg Arg Gly Lys Gly His Asp Gly Leu Tyr Gln Gly

130 135 140

Leu Ser Thr Ala Thr Lys Asp Thr Tyr Asp Ala Leu His Met Gln Ala

145 150 155 160

Leu Pro Pro Arg

<210> 196

<211> 86

<212> PRT

<213> artificial sequence

<220>

<223> human FcRGamma

<400> 196

Met Ile Pro Ala Val Val Leu Leu Leu Leu Leu Leu Val Glu Gln Ala

1 5 10 15

Ala Ala Leu Gly Glu Pro Gln Leu Cys Tyr Ile Leu Asp Ala Ile Leu

20 25 30

Phe Leu Tyr Gly Ile Val Leu Thr Leu Leu Tyr Cys Arg Leu Lys Ile

35 40 45

Gln Val Arg Lys Ala Ala Ile Thr Ser Tyr Glu Lys Ser Asp Gly Val

50 55 60

Tyr Thr Gly Leu Ser Thr Arg Asn Gln Glu Thr Tyr Glu Thr Leu Lys

65 70 75 80

His Glu Lys Pro Pro Gln

85

<210> 197

<211> 317

<212> PRT

<213> artificial sequence

<220>

<223> human FcgammaRIIa

<400> 197

Met Thr Met Glu Thr Gln Met Ser Gln Asn Val Cys Pro Arg Asn Leu

1 5 10 15

Trp Leu Leu Gln Pro Leu Thr Val Leu Leu Leu Leu Ala Ser Ala Asp

20 25 30

Ser Gln Ala Ala Ala Pro Pro Lys Ala Val Leu Lys Leu Glu Pro Pro

35 40 45

Trp Ile Asn Val Leu Gln Glu Asp Ser Val Thr Leu Thr Cys Gln Gly

50 55 60

Ala Arg Ser Pro Glu Ser Asp Ser Ile Gln Trp Phe His Asn Gly Asn

65 70 75 80

Leu Ile Pro Thr His Thr Gln Pro Ser Tyr Arg Phe Lys Ala Asn Asn

85 90 95

Asn Asp Ser Gly Glu Tyr Thr Cys Gln Thr Gly Gln Thr Ser Leu Ser

100 105 110

Asp Pro Val His Leu Thr Val Leu Ser Glu Trp Leu Val Leu Gln Thr

115 120 125

Pro His Leu Glu Phe Gln Glu Gly Glu Thr Ile Met Leu Arg Cys His

130 135 140

Ser Trp Lys Asp Lys Pro Leu Val Lys Val Thr Phe Phe Gln Asn Gly

145 150 155 160

Lys Ser Gln Lys Phe Ser His Leu Asp Pro Thr Phe Ser Ile Pro Gln

165 170 175

Ala Asn His Ser His Ser Gly Asp Tyr His Cys Thr Gly Asn Ile Gly

180 185 190

Tyr Thr Leu Phe Ser Ser Lys Pro Val Thr Ile Thr Val Gln Val Pro

195 200 205

Ser Met Gly Ser Ser Ser Pro Met Gly Ile Ile Val Ala Val Val Ile

210 215 220

Ala Thr Ala Val Ala Ala Ile Val Ala Ala Val Val Ala Leu Ile Tyr

225 230 235 240

Cys Arg Lys Lys Arg Ile Ser Ala Asn Ser Thr Asp Pro Val Lys Ala

245 250 255

Ala Gln Phe Glu Pro Pro Gly Arg Gln Met Ile Ala Ile Arg Lys Arg

260 265 270

Gln Leu Glu Glu Thr Asn Asn Asp Tyr Glu Thr Ala Asp Gly Gly Tyr

275 280 285

Met Thr Leu Asn Pro Arg Ala Pro Thr Asp Asp Asp Lys Asn Ile Tyr

290 295 300

Leu Thr Leu Pro Pro Asn Asp His Val Asn Ser Asn Asn

305 310 315

<210> 198

<211> 244

<212> PRT

<213> artificial sequence

<220>

<223> human FcRbeta

<400> 198

Met Asp Thr Glu Ser Asn Arg Arg Ala Asn Leu Ala Leu Pro Gln Glu

1 5 10 15

Pro Ser Ser Val Pro Ala Phe Glu Val Leu Glu Ile Ser Pro Gln Glu

20 25 30

Val Ser Ser Gly Arg Leu Leu Lys Ser Ala Ser Ser Pro Pro Leu His

35 40 45

Thr Trp Leu Thr Val Leu Lys Lys Glu Gln Glu Phe Leu Gly Val Thr

50 55 60

Gln Ile Leu Thr Ala Met Ile Cys Leu Cys Phe Gly Thr Val Val Cys

65 70 75 80

Ser Val Leu Asp Ile Ser His Ile Glu Gly Asp Ile Phe Ser Ser Phe

85 90 95

Lys Ala Gly Tyr Pro Phe Trp Gly Ala Ile Phe Phe Ser Ile Ser Gly

100 105 110

Met Leu Ser Ile Ile Ser Glu Arg Arg Asn Ala Thr Tyr Leu Val Arg

115 120 125

Gly Ser Leu Gly Ala Asn Thr Ala Ser Ser Ile Ala Gly Gly Thr Gly

130 135 140

Ile Thr Ile Leu Ile Ile Asn Leu Lys Lys Ser Leu Ala Tyr Ile His

145 150 155 160

Ile His Ser Cys Gln Lys Phe Phe Glu Thr Lys Cys Phe Met Ala Ser

165 170 175

Phe Ser Thr Glu Ile Val Val Met Met Leu Phe Leu Thr Ile Leu Gly

180 185 190

Leu Gly Ser Ala Val Ser Leu Thr Ile Cys Gly Ala Gly Glu Glu Leu

195 200 205

Lys Gly Asn Lys Val Pro Glu Asp Arg Val Tyr Glu Glu Leu Asn Ile

210 215 220

Tyr Ser Ala Thr Tyr Ser Glu Leu Glu Asp Pro Gly Glu Met Ser Pro

225 230 235 240

Pro Ile Asp Leu

<210> 199

<211> 182

<212> PRT

<213> artificial sequence

<220>

<223> human CD3gamma

<400> 199

Met Glu Gln Gly Lys Gly Leu Ala Val Leu Ile Leu Ala Ile Ile Leu

1 5 10 15

Leu Gln Gly Thr Leu Ala Gln Ser Ile Lys Gly Asn His Leu Val Lys

20 25 30

Val Tyr Asp Tyr Gln Glu Asp Gly Ser Val Leu Leu Thr Cys Asp Ala

35 40 45

Glu Ala Lys Asn Ile Thr Trp Phe Lys Asp Gly Lys Met Ile Gly Phe

50 55 60

Leu Thr Glu Asp Lys Lys Lys Trp Asn Leu Gly Ser Asn Ala Lys Asp

65 70 75 80

Pro Arg Gly Met Tyr Gln Cys Lys Gly Ser Gln Asn Lys Ser Lys Pro

85 90 95

Leu Gln Val Tyr Tyr Arg Met Cys Gln Asn Cys Ile Glu Leu Asn Ala

100 105 110

Ala Thr Ile Ser Gly Phe Leu Phe Ala Glu Ile Val Ser Ile Phe Val

115 120 125

Leu Ala Val Gly Val Tyr Phe Ile Ala Gly Gln Asp Gly Val Arg Gln

130 135 140

Ser Arg Ala Ser Asp Lys Gln Thr Leu Leu Pro Asn Asp Gln Leu Tyr

145 150 155 160

Gln Pro Leu Lys Asp Arg Glu Asp Asp Gln Tyr Ser His Leu Gln Gly

165 170 175

Asn Gln Leu Arg Arg Asn

180

<210> 200

<211> 171

<212> PRT

<213> artificial sequence

<220>

<223> human CD3 delta

<400> 200

Met Glu His Ser Thr Phe Leu Ser Gly Leu Val Leu Ala Thr Leu Leu

1 5 10 15

Ser Gln Val Ser Pro Phe Lys Ile Pro Ile Glu Glu Leu Glu Asp Arg

20 25 30

Val Phe Val Asn Cys Asn Thr Ser Ile Thr Trp Val Glu Gly Thr Val

35 40 45

Gly Thr Leu Leu Ser Asp Ile Thr Arg Leu Asp Leu Gly Lys Arg Ile

50 55 60

Leu Asp Pro Arg Gly Ile Tyr Arg Cys Asn Gly Thr Asp Ile Tyr Lys

65 70 75 80

Asp Lys Glu Ser Thr Val Gln Val His Tyr Arg Met Cys Gln Ser Cys

85 90 95

Val Glu Leu Asp Pro Ala Thr Val Ala Gly Ile Ile Val Thr Asp Val

100 105 110

Ile Ala Thr Leu Leu Leu Ala Leu Gly Val Phe Cys Phe Ala Gly His

115 120 125

Glu Thr Gly Arg Leu Ser Gly Ala Ala Asp Thr Gln Ala Leu Leu Arg

130 135 140

Asn Asp Gln Val Tyr Gln Pro Leu Arg Asp Arg Asp Asp Ala Gln Tyr

145 150 155 160

Ser His Leu Gly Gly Asn Trp Ala Arg Asn Lys

165 170

<210> 201

<211> 207

<212> PRT

<213> artificial sequence

<220>

<223> human CD3epsilon

<400> 201

Met Gln Ser Gly Thr His Trp Arg Val Leu Gly Leu Cys Leu Leu Ser

1 5 10 15

Val Gly Val Trp Gly Gln Asp Gly Asn Glu Glu Met Gly Gly Ile Thr

20 25 30

Gln Thr Pro Tyr Lys Val Ser Ile Ser Gly Thr Thr Val Ile Leu Thr

35 40 45

Cys Pro Gln Tyr Pro Gly Ser Glu Ile Leu Trp Gln His Asn Asp Lys

50 55 60

Asn Ile Gly Gly Asp Glu Asp Asp Lys Asn Ile Gly Ser Asp Glu Asp

65 70 75 80

His Leu Ser Leu Lys Glu Phe Ser Glu Leu Glu Gln Ser Gly Tyr Tyr

85 90 95

Val Cys Tyr Pro Arg Gly Ser Lys Pro Glu Asp Ala Asn Phe Tyr Leu

100 105 110

Tyr Leu Arg Ala Arg Val Cys Glu Asn Cys Met Glu Met Asp Val Met

115 120 125

Ser Val Ala Thr Ile Val Ile Val Asp Ile Cys Ile Thr Gly Gly Leu

130 135 140

Leu Leu Leu Val Tyr Tyr Trp Ser Lys Asn Arg Lys Ala Lys Ala Lys

145 150 155 160

Pro Val Thr Arg Gly Ala Gly Ala Gly Gly Arg Gln Arg Gly Gln Asn

165 170 175

Lys Glu Arg Pro Pro Pro Val Pro Asn Pro Asp Tyr Glu Pro Ile Arg

180 185 190

Lys Gly Gln Arg Asp Leu Tyr Ser Gly Leu Asn Gln Arg Arg Ile

195 200 205

<210> 202

<211> 226

<212> PRT

<213> artificial sequence

<220>

<223> human CD79a

<400> 202

Met Pro Gly Gly Pro Gly Val Leu Gln Ala Leu Pro Ala Thr Ile Phe

1 5 10 15

Leu Leu Phe Leu Leu Ser Ala Val Tyr Leu Gly Pro Gly Cys Gln Ala

20 25 30

Leu Trp Met His Lys Val Pro Ala Ser Leu Met Val Ser Leu Gly Glu

35 40 45

Asp Ala His Phe Gln Cys Pro His Asn Ser Ser Asn Asn Ala Asn Val

50 55 60

Thr Trp Trp Arg Val Leu His Gly Asn Tyr Thr Trp Pro Pro Glu Phe

65 70 75 80

Leu Gly Pro Gly Glu Asp Pro Asn Gly Thr Leu Ile Ile Gln Asn Val

85 90 95

Asn Lys Ser His Gly Gly Ile Tyr Val Cys Arg Val Gln Glu Gly Asn

100 105 110

Glu Ser Tyr Gln Gln Ser Cys Gly Thr Tyr Leu Arg Val Arg Gln Pro

115 120 125

Pro Pro Arg Pro Phe Leu Asp Met Gly Glu Gly Thr Lys Asn Arg Ile

130 135 140

Ile Thr Ala Glu Gly Ile Ile Leu Leu Phe Cys Ala Val Val Pro Gly

145 150 155 160

Thr Leu Leu Leu Phe Arg Lys Arg Trp Gln Asn Glu Lys Leu Gly Leu

165 170 175

Asp Ala Gly Asp Glu Tyr Glu Asp Glu Asn Leu Tyr Glu Gly Leu Asn

180 185 190

Leu Asp Asp Cys Ser Met Tyr Glu Asp Ile Ser Arg Gly Leu Gln Gly

195 200 205

Thr Tyr Gln Asp Val Gly Ser Leu Asn Ile Gly Asp Val Gln Leu Glu

210 215 220

Lys Pro

225

<210> 203

<211> 229

<212> PRT

<213> artificial sequence

<220>

<223> human CD79b

<400> 203

Met Ala Arg Leu Ala Leu Ser Pro Val Pro Ser His Trp Met Val Ala

1 5 10 15

Leu Leu Leu Leu Leu Ser Ala Glu Pro Val Pro Ala Ala Arg Ser Glu

20 25 30

Asp Arg Tyr Arg Asn Pro Lys Gly Ser Ala Cys Ser Arg Ile Trp Gln

35 40 45

Ser Pro Arg Phe Ile Ala Arg Lys Arg Gly Phe Thr Val Lys Met His

50 55 60

Cys Tyr Met Asn Ser Ala Ser Gly Asn Val Ser Trp Leu Trp Lys Gln

65 70 75 80

Glu Met Asp Glu Asn Pro Gln Gln Leu Lys Leu Glu Lys Gly Arg Met

85 90 95

Glu Glu Ser Gln Asn Glu Ser Leu Ala Thr Leu Thr Ile Gln Gly Ile

100 105 110

Arg Phe Glu Asp Asn Gly Ile Tyr Phe Cys Gln Gln Lys Cys Asn Asn

115 120 125

Thr Ser Glu Val Tyr Gln Gly Cys Gly Thr Glu Leu Arg Val Met Gly

130 135 140

Phe Ser Thr Leu Ala Gln Leu Lys Gln Arg Asn Thr Leu Lys Asp Gly

145 150 155 160

Ile Ile Met Ile Gln Thr Leu Leu Ile Ile Leu Phe Ile Ile Val Pro

165 170 175

Ile Phe Leu Leu Leu Asp Lys Asp Asp Ser Lys Ala Gly Met Glu Glu

180 185 190

Asp His Thr Tyr Glu Gly Leu Asp Ile Asp Gln Thr Ala Thr Tyr Glu

195 200 205

Asp Ile Val Thr Leu Arg Thr Gly Glu Val Lys Trp Ser Val Gly Glu

210 215 220

His Pro Gly Gln Glu

225

<210> 204

<211> 93

<212> PRT

<213> artificial sequence

<220>

<223> human DAP10

<400> 204

Met Ile His Leu Gly His Ile Leu Phe Leu Leu Leu Leu Pro Val Ala

1 5 10 15

Ala Ala Gln Thr Thr Pro Gly Glu Arg Ser Ser Leu Pro Ala Phe Tyr

20 25 30

Pro Gly Thr Ser Gly Ser Cys Ser Gly Cys Gly Ser Leu Ser Leu Pro

35 40 45

Leu Leu Ala Gly Leu Val Ala Ala Asp Ala Val Ala Ser Leu Leu Ile

50 55 60

Val Gly Ala Val Phe Leu Cys Ala Arg Pro Arg Arg Ser Pro Ala Gln

65 70 75 80

Glu Asp Gly Lys Val Tyr Ile Asn Met Pro Gly Arg Gly

85 90

<210> 205

<211> 113

<212> PRT

<213> artificial sequence

<220>

<223> human DAP12

<400> 205

Met Gly Gly Leu Glu Pro Cys Ser Arg Leu Leu Leu Leu Pro Leu Leu

1 5 10 15

Leu Ala Val Ser Gly Leu Arg Pro Val Gln Ala Gln Ala Gln Ser Asp

20 25 30

Cys Ser Cys Ser Thr Val Ser Pro Gly Val Leu Ala Gly Ile Val Met

35 40 45

Gly Asp Leu Val Leu Thr Val Leu Ile Ala Leu Ala Val Tyr Phe Leu

50 55 60

Gly Arg Leu Val Pro Arg Gly Arg Gly Ala Ala Glu Ala Ala Thr Arg

65 70 75 80

Lys Gln Arg Ile Thr Glu Thr Glu Ser Pro Tyr Gln Glu Leu Gln Gly

85 90 95

Gln Arg Ser Asp Val Tyr Ser Asp Leu Asn Thr Gln Arg Pro Tyr Tyr

100 105 110

Lys

<210> 206

<211> 220

<212> PRT

<213> artificial sequence

<220>

<223> human CD28

<400> 206

Met Leu Arg Leu Leu Leu Ala Leu Asn Leu Phe Pro Ser Ile Gln Val

1 5 10 15

Thr Gly Asn Lys Ile Leu Val Lys Gln Ser Pro Met Leu Val Ala Tyr

20 25 30

Asp Asn Ala Val Asn Leu Ser Cys Lys Tyr Ser Tyr Asn Leu Phe Ser

35 40 45

Arg Glu Phe Arg Ala Ser Leu His Lys Gly Leu Asp Ser Ala Val Glu

50 55 60

Val Cys Val Val Tyr Gly Asn Tyr Ser Gln Gln Leu Gln Val Tyr Ser

65 70 75 80

Lys Thr Gly Phe Asn Cys Asp Gly Lys Leu Gly Asn Glu Ser Val Thr

85 90 95

Phe Tyr Leu Gln Asn Leu Tyr Val Asn Gln Thr Asp Ile Tyr Phe Cys

100 105 110

Lys Ile Glu Val Met Tyr Pro Pro Pro Tyr Leu Asp Asn Glu Lys Ser

115 120 125

Asn Gly Thr Ile Ile His Val Lys Gly Lys His Leu Cys Pro Ser Pro

130 135 140

Leu Phe Pro Gly Pro Ser Lys Pro Phe Trp Val Leu Val Val Val Gly

145 150 155 160

Gly Val Leu Ala Cys Tyr Ser Leu Leu Val Thr Val Ala Phe Ile Ile

165 170 175

Phe Trp Val Arg Ser Lys Arg Ser Arg Leu Leu His Ser Asp Tyr Met

180 185 190

Asn Met Thr Pro Arg Arg Pro Gly Pro Thr Arg Lys His Tyr Gln Pro

195 200 205

Tyr Ala Pro Pro Arg Asp Phe Ala Ala Tyr Arg Ser

210 215 220

<210> 207

<211> 255

<212> PRT

<213> artificial sequence

<220>

<223> human 4-1BB

<400> 207

Met Gly Asn Ser Cys Tyr Asn Ile Val Ala Thr Leu Leu Leu Val Leu

1 5 10 15

Asn Phe Glu Arg Thr Arg Ser Leu Gln Asp Pro Cys Ser Asn Cys Pro

20 25 30

Ala Gly Thr Phe Cys Asp Asn Asn Arg Asn Gln Ile Cys Ser Pro Cys

35 40 45

Pro Pro Asn Ser Phe Ser Ser Ala Gly Gly Gln Arg Thr Cys Asp Ile

50 55 60

Cys Arg Gln Cys Lys Gly Val Phe Arg Thr Arg Lys Glu Cys Ser Ser

65 70 75 80

Thr Ser Asn Ala Glu Cys Asp Cys Thr Pro Gly Phe His Cys Leu Gly

85 90 95

Ala Gly Cys Ser Met Cys Glu Gln Asp Cys Lys Gln Gly Gln Glu Leu

100 105 110

Thr Lys Lys Gly Cys Lys Asp Cys Cys Phe Gly Thr Phe Asn Asp Gln

115 120 125

Lys Arg Gly Ile Cys Arg Pro Trp Thr Asn Cys Ser Leu Asp Gly Lys

130 135 140

Ser Val Leu Val Asn Gly Thr Lys Glu Arg Asp Val Val Cys Gly Pro

145 150 155 160

Ser Pro Ala Asp Leu Ser Pro Gly Ala Ser Ser Val Thr Pro Pro Ala

165 170 175

Pro Ala Arg Glu Pro Gly His Ser Pro Gln Ile Ile Ser Phe Phe Leu

180 185 190

Ala Leu Thr Ser Thr Ala Leu Leu Phe Leu Leu Phe Phe Leu Thr Leu

195 200 205

Arg Phe Ser Val Val Lys Arg Gly Arg Lys Lys Leu Leu Tyr Ile Phe

210 215 220

Lys Gln Pro Phe Met Arg Pro Val Gln Thr Thr Gln Glu Glu Asp Gly

225 230 235 240

Cys Ser Cys Arg Phe Pro Glu Glu Glu Glu Gly Gly Cys Glu Leu

245 250 255

<210> 208

<211> 277

<212> PRT

<213> artificial sequence

<220>

<223> human OX40

<400> 208

Met Cys Val Gly Ala Arg Arg Leu Gly Arg Gly Pro Cys Ala Ala Leu

1 5 10 15

Leu Leu Leu Gly Leu Gly Leu Ser Thr Val Thr Gly Leu His Cys Val

20 25 30

Gly Asp Thr Tyr Pro Ser Asn Asp Arg Cys Cys His Glu Cys Arg Pro

35 40 45

Gly Asn Gly Met Val Ser Arg Cys Ser Arg Ser Gln Asn Thr Val Cys

50 55 60

Arg Pro Cys Gly Pro Gly Phe Tyr Asn Asp Val Val Ser Ser Lys Pro

65 70 75 80

Cys Lys Pro Cys Thr Trp Cys Asn Leu Arg Ser Gly Ser Glu Arg Lys

85 90 95

Gln Leu Cys Thr Ala Thr Gln Asp Thr Val Cys Arg Cys Arg Ala Gly

100 105 110

Thr Gln Pro Leu Asp Ser Tyr Lys Pro Gly Val Asp Cys Ala Pro Cys

115 120 125

Pro Pro Gly His Phe Ser Pro Gly Asp Asn Gln Ala Cys Lys Pro Trp

130 135 140

Thr Asn Cys Thr Leu Ala Gly Lys His Thr Leu Gln Pro Ala Ser Asn

145 150 155 160

Ser Ser Asp Ala Ile Cys Glu Asp Arg Asp Pro Pro Ala Thr Gln Pro

165 170 175

Gln Glu Thr Gln Gly Pro Pro Ala Arg Pro Ile Thr Val Gln Pro Thr

180 185 190

Glu Ala Trp Pro Arg Thr Ser Gln Gly Pro Ser Thr Arg Pro Val Glu

195 200 205

Val Pro Gly Gly Arg Ala Val Ala Ala Ile Leu Gly Leu Gly Leu Val

210 215 220

Leu Gly Leu Leu Gly Pro Leu Ala Ile Leu Leu Ala Leu Tyr Leu Leu

225 230 235 240

Arg Arg Asp Gln Arg Leu Pro Pro Asp Ala His Lys Pro Pro Gly Gly

245 250 255

Gly Ser Phe Arg Thr Pro Ile Gln Glu Glu Gln Ala Asp Ala His Ser

260 265 270

Thr Leu Ala Lys Ile

275

<210> 209

<211> 199

<212> PRT

<213> artificial sequence

<220>

<223> human ICOS

<400> 209

Met Lys Ser Gly Leu Trp Tyr Phe Phe Leu Phe Cys Leu Arg Ile Lys

1 5 10 15

Val Leu Thr Gly Glu Ile Asn Gly Ser Ala Asn Tyr Glu Met Phe Ile

20 25 30

Phe His Asn Gly Gly Val Gln Ile Leu Cys Lys Tyr Pro Asp Ile Val

35 40 45

Gln Gln Phe Lys Met Gln Leu Leu Lys Gly Gly Gln Ile Leu Cys Asp

50 55 60

Leu Thr Lys Thr Lys Gly Ser Gly Asn Thr Val Ser Ile Lys Ser Leu

65 70 75 80

Lys Phe Cys His Ser Gln Leu Ser Asn Asn Ser Val Ser Phe Phe Leu

85 90 95

Tyr Asn Leu Asp His Ser His Ala Asn Tyr Tyr Phe Cys Asn Leu Ser

100 105 110

Ile Phe Asp Pro Pro Pro Phe Lys Val Thr Leu Thr Gly Gly Tyr Leu

115 120 125

His Ile Tyr Glu Ser Gln Leu Cys Cys Gln Leu Lys Phe Trp Leu Pro

130 135 140

Ile Gly Cys Ala Ala Phe Val Val Val Cys Ile Leu Gly Cys Ile Leu

145 150 155 160

Ile Cys Trp Leu Thr Lys Lys Lys Tyr Ser Ser Ser Val His Asp Pro

165 170 175

Asn Gly Glu Tyr Met Phe Met Arg Ala Val Asn Thr Ala Lys Lys Ser

180 185 190

Arg Leu Thr Asp Val Thr Leu

195

<210> 210

<211> 370

<212> PRT

<213> artificial sequence

<220>

<223> human 2B4

<400> 210

Met Leu Gly Gln Val Val Thr Leu Ile Leu Leu Leu Leu Leu Lys Val

1 5 10 15

Tyr Gln Gly Lys Gly Cys Gln Gly Ser Ala Asp His Val Val Ser Ile

20 25 30

Ser Gly Val Pro Leu Gln Leu Gln Pro Asn Ser Ile Gln Thr Lys Val

35 40 45

Asp Ser Ile Ala Trp Lys Lys Leu Leu Pro Ser Gln Asn Gly Phe His

50 55 60

His Ile Leu Lys Trp Glu Asn Gly Ser Leu Pro Ser Asn Thr Ser Asn

65 70 75 80

Asp Arg Phe Ser Phe Ile Val Lys Asn Leu Ser Leu Leu Ile Lys Ala

85 90 95

Ala Gln Gln Gln Asp Ser Gly Leu Tyr Cys Leu Glu Val Thr Ser Ile

100 105 110

Ser Gly Lys Val Gln Thr Ala Thr Phe Gln Val Phe Val Phe Glu Ser

115 120 125

Leu Leu Pro Asp Lys Val Glu Lys Pro Arg Leu Gln Gly Gln Gly Lys

130 135 140

Ile Leu Asp Arg Gly Arg Cys Gln Val Ala Leu Ser Cys Leu Val Ser

145 150 155 160

Arg Asp Gly Asn Val Ser Tyr Ala Trp Tyr Arg Gly Ser Lys Leu Ile

165 170 175

Gln Thr Ala Gly Asn Leu Thr Tyr Leu Asp Glu Glu Val Asp Ile Asn

180 185 190

Gly Thr His Thr Tyr Thr Cys Asn Val Ser Asn Pro Val Ser Trp Glu

195 200 205

Ser His Thr Leu Asn Leu Thr Gln Asp Cys Gln Asn Ala His Gln Glu

210 215 220

Phe Arg Phe Trp Pro Phe Leu Val Ile Ile Val Ile Leu Ser Ala Leu

225 230 235 240

Phe Leu Gly Thr Leu Ala Cys Phe Cys Val Trp Arg Arg Lys Arg Lys

245 250 255

Glu Lys Gln Ser Glu Thr Ser Pro Lys Glu Phe Leu Thr Ile Tyr Glu

260 265 270

Asp Val Lys Asp Leu Lys Thr Arg Arg Asn His Glu Gln Glu Gln Thr

275 280 285

Phe Pro Gly Gly Gly Ser Thr Ile Tyr Ser Met Ile Gln Ser Gln Ser

290 295 300

Ser Ala Pro Thr Ser Gln Glu Pro Ala Tyr Thr Leu Tyr Ser Leu Ile

305 310 315 320

Gln Pro Ser Arg Lys Ser Gly Ser Arg Lys Arg Asn His Ser Pro Ser

325 330 335

Phe Asn Ser Thr Ile Tyr Glu Val Ile Gly Lys Ser Gln Pro Lys Ala

340 345 350

Gln Asn Pro Ala Arg Leu Ser Arg Lys Glu Leu Glu Asn Phe Asp Val

355 360 365

Tyr Ser

370

<210> 211

<211> 260

<212> PRT

<213> artificial sequence

<220>

<223> human CD27

<400> 211

Met Ala Arg Pro His Pro Trp Trp Leu Cys Val Leu Gly Thr Leu Val

1 5 10 15

Gly Leu Ser Ala Thr Pro Ala Pro Lys Ser Cys Pro Glu Arg His Tyr

20 25 30

Trp Ala Gln Gly Lys Leu Cys Cys Gln Met Cys Glu Pro Gly Thr Phe

35 40 45

Leu Val Lys Asp Cys Asp Gln His Arg Lys Ala Ala Gln Cys Asp Pro

50 55 60

Cys Ile Pro Gly Val Ser Phe Ser Pro Asp His His Thr Arg Pro His

65 70 75 80

Cys Glu Ser Cys Arg His Cys Asn Ser Gly Leu Leu Val Arg Asn Cys

85 90 95

Thr Ile Thr Ala Asn Ala Glu Cys Ala Cys Arg Asn Gly Trp Gln Cys

100 105 110

Arg Asp Lys Glu Cys Thr Glu Cys Asp Pro Leu Pro Asn Pro Ser Leu

115 120 125

Thr Ala Arg Ser Ser Gln Ala Leu Ser Pro His Pro Gln Pro Thr His

130 135 140

Leu Pro Tyr Val Ser Glu Met Leu Glu Ala Arg Thr Ala Gly His Met

145 150 155 160

Gln Thr Leu Ala Asp Phe Arg Gln Leu Pro Ala Arg Thr Leu Ser Thr

165 170 175

His Trp Pro Pro Gln Arg Ser Leu Cys Ser Ser Asp Phe Ile Arg Ile

180 185 190

Leu Val Ile Phe Ser Gly Met Phe Leu Val Phe Thr Leu Ala Gly Ala

195 200 205

Leu Phe Leu His Gln Arg Arg Lys Tyr Arg Ser Asn Lys Gly Glu Ser

210 215 220

Pro Val Glu Pro Ala Glu Pro Cys His Tyr Ser Cys Pro Arg Glu Glu

225 230 235 240

Glu Gly Ser Thr Ile Pro Ile Gln Glu Asp Tyr Arg Lys Pro Glu Pro

245 250 255

Ala Cys Ser Pro

260

<210> 212

<211> 595

<212> PRT

<213> artificial sequence

<220>

<223> human CD30

<400> 212

Met Arg Val Leu Leu Ala Ala Leu Gly Leu Leu Phe Leu Gly Ala Leu

1 5 10 15

Arg Ala Phe Pro Gln Asp Arg Pro Phe Glu Asp Thr Cys His Gly Asn

20 25 30

Pro Ser His Tyr Tyr Asp Lys Ala Val Arg Arg Cys Cys Tyr Arg Cys

35 40 45

Pro Met Gly Leu Phe Pro Thr Gln Gln Cys Pro Gln Arg Pro Thr Asp

50 55 60

Cys Arg Lys Gln Cys Glu Pro Asp Tyr Tyr Leu Asp Glu Ala Asp Arg

65 70 75 80

Cys Thr Ala Cys Val Thr Cys Ser Arg Asp Asp Leu Val Glu Lys Thr

85 90 95

Pro Cys Ala Trp Asn Ser Ser Arg Val Cys Glu Cys Arg Pro Gly Met

100 105 110

Phe Cys Ser Thr Ser Ala Val Asn Ser Cys Ala Arg Cys Phe Phe His

115 120 125

Ser Val Cys Pro Ala Gly Met Ile Val Lys Phe Pro Gly Thr Ala Gln

130 135 140

Lys Asn Thr Val Cys Glu Pro Ala Ser Pro Gly Val Ser Pro Ala Cys

145 150 155 160

Ala Ser Pro Glu Asn Cys Lys Glu Pro Ser Ser Gly Thr Ile Pro Gln

165 170 175

Ala Lys Pro Thr Pro Val Ser Pro Ala Thr Ser Ser Ala Ser Thr Met

180 185 190

Pro Val Arg Gly Gly Thr Arg Leu Ala Gln Glu Ala Ala Ser Lys Leu

195 200 205

Thr Arg Ala Pro Asp Ser Pro Ser Ser Val Gly Arg Pro Ser Ser Asp

210 215 220

Pro Gly Leu Ser Pro Thr Gln Pro Cys Pro Glu Gly Ser Gly Asp Cys

225 230 235 240

Arg Lys Gln Cys Glu Pro Asp Tyr Tyr Leu Asp Glu Ala Gly Arg Cys

245 250 255

Thr Ala Cys Val Ser Cys Ser Arg Asp Asp Leu Val Glu Lys Thr Pro

260 265 270

Cys Ala Trp Asn Ser Ser Arg Thr Cys Glu Cys Arg Pro Gly Met Ile

275 280 285

Cys Ala Thr Ser Ala Thr Asn Ser Cys Ala Arg Cys Val Pro Tyr Pro

290 295 300

Ile Cys Ala Ala Glu Thr Val Thr Lys Pro Gln Asp Met Ala Glu Lys

305 310 315 320

Asp Thr Thr Phe Glu Ala Pro Pro Leu Gly Thr Gln Pro Asp Cys Asn

325 330 335

Pro Thr Pro Glu Asn Gly Glu Ala Pro Ala Ser Thr Ser Pro Thr Gln

340 345 350

Ser Leu Leu Val Asp Ser Gln Ala Ser Lys Thr Leu Pro Ile Pro Thr

355 360 365

Ser Ala Pro Val Ala Leu Ser Ser Thr Gly Lys Pro Val Leu Asp Ala

370 375 380

Gly Pro Val Leu Phe Trp Val Ile Leu Val Leu Val Val Val Val Gly

385 390 395 400

Ser Ser Ala Phe Leu Leu Cys His Arg Arg Ala Cys Arg Lys Arg Ile

405 410 415

Arg Gln Lys Leu His Leu Cys Tyr Pro Val Gln Thr Ser Gln Pro Lys

420 425 430

Leu Glu Leu Val Asp Ser Arg Pro Arg Arg Ser Ser Thr Gln Leu Arg

435 440 445

Ser Gly Ala Ser Val Thr Glu Pro Val Ala Glu Glu Arg Gly Leu Met

450 455 460

Ser Gln Pro Leu Met Glu Thr Cys His Ser Val Gly Ala Ala Tyr Leu

465 470 475 480

Glu Ser Leu Pro Leu Gln Asp Ala Ser Pro Ala Gly Gly Pro Ser Ser

485 490 495

Pro Arg Asp Leu Pro Glu Pro Arg Val Ser Thr Glu His Thr Asn Asn

500 505 510

Lys Ile Glu Lys Ile Tyr Ile Met Lys Ala Asp Thr Val Ile Val Gly

515 520 525

Thr Val Lys Ala Glu Leu Pro Glu Gly Arg Gly Leu Ala Gly Pro Ala

530 535 540

Glu Pro Glu Leu Glu Glu Glu Leu Glu Ala Asp His Thr Pro His Tyr

545 550 555 560

Pro Glu Gln Glu Thr Glu Pro Pro Leu Gly Ser Cys Ser Asp Val Met

565 570 575

Leu Ser Val Glu Glu Glu Gly Lys Glu Asp Pro Leu Pro Thr Ala Ala

580 585 590

Ser Gly Lys

595

<210> 213

<211> 277

<212> PRT

<213> artificial sequence

<220>

<223> human CD40

<400> 213

Met Val Arg Leu Pro Leu Gln Cys Val Leu Trp Gly Cys Leu Leu Thr

1 5 10 15

Ala Val His Pro Glu Pro Pro Thr Ala Cys Arg Glu Lys Gln Tyr Leu

20 25 30

Ile Asn Ser Gln Cys Cys Ser Leu Cys Gln Pro Gly Gln Lys Leu Val

35 40 45

Ser Asp Cys Thr Glu Phe Thr Glu Thr Glu Cys Leu Pro Cys Gly Glu

50 55 60

Ser Glu Phe Leu Asp Thr Trp Asn Arg Glu Thr His Cys His Gln His

65 70 75 80

Lys Tyr Cys Asp Pro Asn Leu Gly Leu Arg Val Gln Gln Lys Gly Thr

85 90 95

Ser Glu Thr Asp Thr Ile Cys Thr Cys Glu Glu Gly Trp His Cys Thr

100 105 110

Ser Glu Ala Cys Glu Ser Cys Val Leu His Arg Ser Cys Ser Pro Gly

115 120 125

Phe Gly Val Lys Gln Ile Ala Thr Gly Val Ser Asp Thr Ile Cys Glu

130 135 140

Pro Cys Pro Val Gly Phe Phe Ser Asn Val Ser Ser Ala Phe Glu Lys

145 150 155 160

Cys His Pro Trp Thr Ser Cys Glu Thr Lys Asp Leu Val Val Gln Gln

165 170 175

Ala Gly Thr Asn Lys Thr Asp Val Val Cys Gly Pro Gln Asp Arg Leu

180 185 190

Arg Ala Leu Val Val Ile Pro Ile Ile Phe Gly Ile Leu Phe Ala Ile

195 200 205

Leu Leu Val Leu Val Phe Ile Lys Lys Val Ala Lys Lys Pro Thr Asn

210 215 220

Lys Ala Pro His Pro Lys Gln Glu Pro Gln Glu Ile Asn Phe Pro Asp

225 230 235 240

Asp Leu Pro Gly Ser Asn Thr Ala Ala Pro Val Gln Glu Thr Leu His

245 250 255

Gly Cys Gln Pro Val Thr Gln Glu Asp Gly Lys Glu Ser Arg Ile Ser

260 265 270

Val Gln Glu Arg Gln

275

<210> 214

<211> 351

<212> PRT

<213> artificial sequence

<220>

<223> human CD2

<400> 214

Met Ser Phe Pro Cys Lys Phe Val Ala Ser Phe Leu Leu Ile Phe Asn

1 5 10 15

Val Ser Ser Lys Gly Ala Val Ser Lys Glu Ile Thr Asn Ala Leu Glu

20 25 30

Thr Trp Gly Ala Leu Gly Gln Asp Ile Asn Leu Asp Ile Pro Ser Phe

35 40 45

Gln Met Ser Asp Asp Ile Asp Asp Ile Lys Trp Glu Lys Thr Ser Asp

50 55 60

Lys Lys Lys Ile Ala Gln Phe Arg Lys Glu Lys Glu Thr Phe Lys Glu

65 70 75 80

Lys Asp Thr Tyr Lys Leu Phe Lys Asn Gly Thr Leu Lys Ile Lys His

85 90 95

Leu Lys Thr Asp Asp Gln Asp Ile Tyr Lys Val Ser Ile Tyr Asp Thr

100 105 110

Lys Gly Lys Asn Val Leu Glu Lys Ile Phe Asp Leu Lys Ile Gln Glu

115 120 125

Arg Val Ser Lys Pro Lys Ile Ser Trp Thr Cys Ile Asn Thr Thr Leu

130 135 140

Thr Cys Glu Val Met Asn Gly Thr Asp Pro Glu Leu Asn Leu Tyr Gln

145 150 155 160

Asp Gly Lys His Leu Lys Leu Ser Gln Arg Val Ile Thr His Lys Trp

165 170 175

Thr Thr Ser Leu Ser Ala Lys Phe Lys Cys Thr Ala Gly Asn Lys Val

180 185 190

Ser Lys Glu Ser Ser Val Glu Pro Val Ser Cys Pro Glu Lys Gly Leu

195 200 205

Asp Ile Tyr Leu Ile Ile Gly Ile Cys Gly Gly Gly Ser Leu Leu Met

210 215 220

Val Phe Val Ala Leu Leu Val Phe Tyr Ile Thr Lys Arg Lys Lys Gln

225 230 235 240

Arg Ser Arg Arg Asn Asp Glu Glu Leu Glu Thr Arg Ala His Arg Val

245 250 255

Ala Thr Glu Glu Arg Gly Arg Lys Pro His Gln Ile Pro Ala Ser Thr

260 265 270

Pro Gln Asn Pro Ala Thr Ser Gln His Pro Pro Pro Pro Pro Gly His

275 280 285

Arg Ser Gln Ala Pro Ser His Arg Pro Pro Pro Pro Gly His Arg Val

290 295 300

Gln His Gln Pro Gln Lys Arg Pro Pro Ala Pro Ser Gly Thr Gln Val

305 310 315 320

His Gln Gln Lys Gly Pro Pro Leu Pro Arg Pro Arg Val Gln Pro Lys

325 330 335

Pro Pro His Gly Ala Ala Glu Asn Ser Leu Ser Pro Ser Ser Asn

340 345 350

<210> 215

<211> 240

<212> PRT

<213> artificial sequence

<220>

<223> human LIGHT

<400> 215

Met Glu Glu Ser Val Val Arg Pro Ser Val Phe Val Val Asp Gly Gln

1 5 10 15

Thr Asp Ile Pro Phe Thr Arg Leu Gly Arg Ser His Arg Arg Gln Ser

20 25 30

Cys Ser Val Ala Arg Val Gly Leu Gly Leu Leu Leu Leu Leu Met Gly

35 40 45

Ala Gly Leu Ala Val Gln Gly Trp Phe Leu Leu Gln Leu His Trp Arg

50 55 60

Leu Gly Glu Met Val Thr Arg Leu Pro Asp Gly Pro Ala Gly Ser Trp

65 70 75 80

Glu Gln Leu Ile Gln Glu Arg Arg Ser His Glu Val Asn Pro Ala Ala

85 90 95

His Leu Thr Gly Ala Asn Ser Ser Leu Thr Gly Ser Gly Gly Pro Leu

100 105 110

Leu Trp Glu Thr Gln Leu Gly Leu Ala Phe Leu Arg Gly Leu Ser Tyr

115 120 125

His Asp Gly Ala Leu Val Val Thr Lys Ala Gly Tyr Tyr Tyr Ile Tyr

130 135 140

Ser Lys Val Gln Leu Gly Gly Val Gly Cys Pro Leu Gly Leu Ala Ser

145 150 155 160

Thr Ile Thr His Gly Leu Tyr Lys Arg Thr Pro Arg Tyr Pro Glu Glu

165 170 175

Leu Glu Leu Leu Val Ser Gln Gln Ser Pro Cys Gly Arg Ala Thr Ser

180 185 190

Ser Ser Arg Val Trp Trp Asp Ser Ser Phe Leu Gly Gly Val Val His

195 200 205

Leu Glu Ala Gly Glu Lys Val Val Val Arg Val Leu Asp Glu Arg Leu

210 215 220

Val Arg Leu Arg Asp Gly Thr Arg Ser Tyr Phe Gly Ala Phe Met Val

225 230 235 240

<210> 216

<211> 241

<212> PRT

<213> artificial sequence

<220>

<223> human GITR

<400> 216

Met Ala Gln His Gly Ala Met Gly Ala Phe Arg Ala Leu Cys Gly Leu

1 5 10 15

Ala Leu Leu Cys Ala Leu Ser Leu Gly Gln Arg Pro Thr Gly Gly Pro

20 25 30

Gly Cys Gly Pro Gly Arg Leu Leu Leu Gly Thr Gly Thr Asp Ala Arg

35 40 45

Cys Cys Arg Val His Thr Thr Arg Cys Cys Arg Asp Tyr Pro Gly Glu

50 55 60

Glu Cys Cys Ser Glu Trp Asp Cys Met Cys Val Gln Pro Glu Phe His

65 70 75 80

Cys Gly Asp Pro Cys Cys Thr Thr Cys Arg His His Pro Cys Pro Pro

85 90 95

Gly Gln Gly Val Gln Ser Gln Gly Lys Phe Ser Phe Gly Phe Gln Cys

100 105 110

Ile Asp Cys Ala Ser Gly Thr Phe Ser Gly Gly His Glu Gly His Cys

115 120 125

Lys Pro Trp Thr Asp Cys Thr Gln Phe Gly Phe Leu Thr Val Phe Pro

130 135 140

Gly Asn Lys Thr His Asn Ala Val Cys Val Pro Gly Ser Pro Pro Ala

145 150 155 160

Glu Pro Leu Gly Trp Leu Thr Val Val Leu Leu Ala Val Ala Ala Cys

165 170 175

Val Leu Leu Leu Thr Ser Ala Gln Leu Gly Leu His Ile Trp Gln Leu

180 185 190

Arg Ser Gln Cys Met Trp Pro Arg Glu Thr Gln Leu Leu Leu Glu Val

195 200 205

Pro Pro Ser Thr Glu Asp Ala Arg Ser Cys Gln Phe Pro Glu Glu Glu

210 215 220

Arg Gly Glu Arg Ser Ala Glu Glu Lys Gly Arg Leu Gly Asp Leu Trp

225 230 235 240

Val

<210> 217

<211> 417

<212> PRT

<213> artificial sequence

<220>

<223> human DR3

<400> 217

Met Glu Gln Arg Pro Arg Gly Cys Ala Ala Val Ala Ala Ala Leu Leu

1 5 10 15

Leu Val Leu Leu Gly Ala Arg Ala Gln Gly Gly Thr Arg Ser Pro Arg

20 25 30

Cys Asp Cys Ala Gly Asp Phe His Lys Lys Ile Gly Leu Phe Cys Cys

35 40 45

Arg Gly Cys Pro Ala Gly His Tyr Leu Lys Ala Pro Cys Thr Glu Pro

50 55 60

Cys Gly Asn Ser Thr Cys Leu Val Cys Pro Gln Asp Thr Phe Leu Ala

65 70 75 80

Trp Glu Asn His His Asn Ser Glu Cys Ala Arg Cys Gln Ala Cys Asp

85 90 95

Glu Gln Ala Ser Gln Val Ala Leu Glu Asn Cys Ser Ala Val Ala Asp

100 105 110

Thr Arg Cys Gly Cys Lys Pro Gly Trp Phe Val Glu Cys Gln Val Ser

115 120 125

Gln Cys Val Ser Ser Ser Pro Phe Tyr Cys Gln Pro Cys Leu Asp Cys

130 135 140

Gly Ala Leu His Arg His Thr Arg Leu Leu Cys Ser Arg Arg Asp Thr

145 150 155 160

Asp Cys Gly Thr Cys Leu Pro Gly Phe Tyr Glu His Gly Asp Gly Cys

165 170 175

Val Ser Cys Pro Thr Ser Thr Leu Gly Ser Cys Pro Glu Arg Cys Ala

180 185 190

Ala Val Cys Gly Trp Arg Gln Met Phe Trp Val Gln Val Leu Leu Ala

195 200 205

Gly Leu Val Val Pro Leu Leu Leu Gly Ala Thr Leu Thr Tyr Thr Tyr

210 215 220

Arg His Cys Trp Pro His Lys Pro Leu Val Thr Ala Asp Glu Ala Gly

225 230 235 240

Met Glu Ala Leu Thr Pro Pro Pro Ala Thr His Leu Ser Pro Leu Asp

245 250 255

Ser Ala His Thr Leu Leu Ala Pro Pro Asp Ser Ser Glu Lys Ile Cys

260 265 270

Thr Val Gln Leu Val Gly Asn Ser Trp Thr Pro Gly Tyr Pro Glu Thr

275 280 285

Gln Glu Ala Leu Cys Pro Gln Val Thr Trp Ser Trp Asp Gln Leu Pro

290 295 300

Ser Arg Ala Leu Gly Pro Ala Ala Ala Pro Thr Leu Ser Pro Glu Ser

305 310 315 320

Pro Ala Gly Ser Pro Ala Met Met Leu Gln Pro Gly Pro Gln Leu Tyr

325 330 335

Asp Val Met Asp Ala Val Pro Ala Arg Arg Trp Lys Glu Phe Val Arg

340 345 350

Thr Leu Gly Leu Arg Glu Ala Glu Ile Glu Ala Val Glu Val Glu Ile

355 360 365

Gly Arg Phe Arg Asp Gln Gln Tyr Glu Met Leu Lys Arg Trp Arg Gln

370 375 380

Gln Gln Pro Ala Gly Leu Gly Ala Val Tyr Ala Ala Leu Glu Arg Met

385 390 395 400

Gly Leu Asp Gly Cys Val Glu Asp Leu Arg Ser Arg Leu Gln Arg Gly

405 410 415

Pro

<210> 218

<211> 400

<212> PRT

<213> artificial sequence

<220>

<223> human CD43

<400> 218

Met Ala Thr Leu Leu Leu Leu Leu Gly Val Leu Val Val Ser Pro Asp

1 5 10 15

Ala Leu Gly Ser Thr Thr Ala Val Gln Thr Pro Thr Ser Gly Glu Pro

20 25 30

Leu Val Ser Thr Ser Glu Pro Leu Ser Ser Lys Met Tyr Thr Thr Ser

35 40 45

Ile Thr Ser Asp Pro Lys Ala Asp Ser Thr Gly Asp Gln Thr Ser Ala

50 55 60

Leu Pro Pro Ser Thr Ser Ile Asn Glu Gly Ser Pro Leu Trp Thr Ser

65 70 75 80

Ile Gly Ala Ser Thr Gly Ser Pro Leu Pro Glu Pro Thr Thr Tyr Gln

85 90 95

Glu Val Ser Ile Lys Met Ser Ser Val Pro Gln Glu Thr Pro His Ala

100 105 110

Thr Ser His Pro Ala Val Pro Ile Thr Ala Asn Ser Leu Gly Ser His

115 120 125

Thr Val Thr Gly Gly Thr Ile Thr Thr Asn Ser Pro Glu Thr Ser Ser

130 135 140

Arg Thr Ser Gly Ala Pro Val Thr Thr Ala Ala Ser Ser Leu Glu Thr

145 150 155 160

Ser Arg Gly Thr Ser Gly Pro Pro Leu Thr Met Ala Thr Val Ser Leu

165 170 175

Glu Thr Ser Lys Gly Thr Ser Gly Pro Pro Val Thr Met Ala Thr Asp

180 185 190

Ser Leu Glu Thr Ser Thr Gly Thr Thr Gly Pro Pro Val Thr Met Thr

195 200 205

Thr Gly Ser Leu Glu Pro Ser Ser Gly Ala Ser Gly Pro Gln Val Ser

210 215 220

Ser Val Lys Leu Ser Thr Met Met Ser Pro Thr Thr Ser Thr Asn Ala

225 230 235 240

Ser Thr Val Pro Phe Arg Asn Pro Asp Glu Asn Ser Arg Gly Met Leu

245 250 255

Pro Val Ala Val Leu Val Ala Leu Leu Ala Val Ile Val Leu Val Ala

260 265 270

Leu Leu Leu Leu Trp Arg Arg Arg Gln Lys Arg Arg Thr Gly Ala Leu

275 280 285

Val Leu Ser Arg Gly Gly Lys Arg Asn Gly Val Val Asp Ala Trp Ala

290 295 300

Gly Pro Ala Gln Val Pro Glu Glu Gly Ala Val Thr Val Thr Val Gly

305 310 315 320

Gly Ser Gly Gly Asp Lys Gly Ser Gly Phe Pro Asp Gly Glu Gly Ser

325 330 335

Ser Arg Arg Pro Thr Leu Thr Thr Phe Phe Gly Arg Arg Lys Ser Arg

340 345 350

Gln Gly Ser Leu Ala Met Glu Glu Leu Lys Ser Gly Ser Gly Pro Ser

355 360 365

Leu Lys Gly Glu Glu Glu Pro Leu Val Ala Ser Glu Asp Gly Ala Val

370 375 380

Asp Ala Pro Ala Pro Asp Glu Pro Glu Gly Gly Asp Gly Ala Ala Pro

385 390 395 400

<210> 219

<211> 458

<212> PRT

<213> artificial sequence

<220>

<223> human CD4

<400> 219

Met Asn Arg Gly Val Pro Phe Arg His Leu Leu Leu Val Leu Gln Leu

1 5 10 15

Ala Leu Leu Pro Ala Ala Thr Gln Gly Lys Lys Val Val Leu Gly Lys

20 25 30

Lys Gly Asp Thr Val Glu Leu Thr Cys Thr Ala Ser Gln Lys Lys Ser

35 40 45

Ile Gln Phe His Trp Lys Asn Ser Asn Gln Ile Lys Ile Leu Gly Asn

50 55 60

Gln Gly Ser Phe Leu Thr Lys Gly Pro Ser Lys Leu Asn Asp Arg Ala

65 70 75 80

Asp Ser Arg Arg Ser Leu Trp Asp Gln Gly Asn Phe Pro Leu Ile Ile

85 90 95

Lys Asn Leu Lys Ile Glu Asp Ser Asp Thr Tyr Ile Cys Glu Val Glu

100 105 110

Asp Gln Lys Glu Glu Val Gln Leu Leu Val Phe Gly Leu Thr Ala Asn

115 120 125

Ser Asp Thr His Leu Leu Gln Gly Gln Ser Leu Thr Leu Thr Leu Glu

130 135 140

Ser Pro Pro Gly Ser Ser Pro Ser Val Gln Cys Arg Ser Pro Arg Gly

145 150 155 160

Lys Asn Ile Gln Gly Gly Lys Thr Leu Ser Val Ser Gln Leu Glu Leu

165 170 175

Gln Asp Ser Gly Thr Trp Thr Cys Thr Val Leu Gln Asn Gln Lys Lys

180 185 190

Val Glu Phe Lys Ile Asp Ile Val Val Leu Ala Phe Gln Lys Ala Ser

195 200 205

Ser Ile Val Tyr Lys Lys Glu Gly Glu Gln Val Glu Phe Ser Phe Pro

210 215 220

Leu Ala Phe Thr Val Glu Lys Leu Thr Gly Ser Gly Glu Leu Trp Trp

225 230 235 240

Gln Ala Glu Arg Ala Ser Ser Ser Lys Ser Trp Ile Thr Phe Asp Leu

245 250 255

Lys Asn Lys Glu Val Ser Val Lys Arg Val Thr Gln Asp Pro Lys Leu

260 265 270

Gln Met Gly Lys Lys Leu Pro Leu His Leu Thr Leu Pro Gln Ala Leu

275 280 285

Pro Gln Tyr Ala Gly Ser Gly Asn Leu Thr Leu Ala Leu Glu Ala Lys

290 295 300

Thr Gly Lys Leu His Gln Glu Val Asn Leu Val Val Met Arg Ala Thr

305 310 315 320

Gln Leu Gln Lys Asn Leu Thr Cys Glu Val Trp Gly Pro Thr Ser Pro

325 330 335

Lys Leu Met Leu Ser Leu Lys Leu Glu Asn Lys Glu Ala Lys Val Ser

340 345 350

Lys Arg Glu Lys Ala Val Trp Val Leu Asn Pro Glu Ala Gly Met Trp

355 360 365

Gln Cys Leu Leu Ser Asp Ser Gly Gln Val Leu Leu Glu Ser Asn Ile

370 375 380

Lys Val Leu Pro Thr Trp Ser Thr Pro Val Gln Pro Met Ala Leu Ile

385 390 395 400

Val Leu Gly Gly Val Ala Gly Leu Leu Leu Phe Ile Gly Leu Gly Ile

405 410 415

Phe Phe Cys Val Arg Cys Arg His Arg Arg Arg Gln Ala Glu Arg Met

420 425 430

Ser Gln Ile Lys Arg Leu Leu Ser Glu Lys Lys Thr Cys Gln Cys Pro

435 440 445

His Arg Phe Gln Lys Thr Cys Ser Pro Ile

450 455

<210> 220

<211> 235

<212> PRT

<213> artificial sequence

<220>

<223> human CD8

<400> 220

Met Ala Leu Pro Val Thr Ala Leu Leu Leu Pro Leu Ala Leu Leu Leu

1 5 10 15

His Ala Ala Arg Pro Ser Gln Phe Arg Val Ser Pro Leu Asp Arg Thr

20 25 30

Trp Asn Leu Gly Glu Thr Val Glu Leu Lys Cys Gln Val Leu Leu Ser

35 40 45

Asn Pro Thr Ser Gly Cys Ser Trp Leu Phe Gln Pro Arg Gly Ala Ala

50 55 60

Ala Ser Pro Thr Phe Leu Leu Tyr Leu Ser Gln Asn Lys Pro Lys Ala

65 70 75 80

Ala Glu Gly Leu Asp Thr Gln Arg Phe Ser Gly Lys Arg Leu Gly Asp

85 90 95

Thr Phe Val Leu Thr Leu Ser Asp Phe Arg Arg Glu Asn Glu Gly Tyr

100 105 110

Tyr Phe Cys Ser Ala Leu Ser Asn Ser Ile Met Tyr Phe Ser His Phe

115 120 125

Val Pro Val Phe Leu Pro Ala Lys Pro Thr Thr Thr Pro Ala Pro Arg

130 135 140

Pro Pro Thr Pro Ala Pro Thr Ile Ala Ser Gln Pro Leu Ser Leu Arg

145 150 155 160

Pro Glu Ala Cys Arg Pro Ala Ala Gly Gly Ala Val His Thr Arg Gly

165 170 175

Leu Asp Phe Ala Cys Asp Ile Tyr Ile Trp Ala Pro Leu Ala Gly Thr

180 185 190

Cys Gly Val Leu Leu Leu Ser Leu Val Ile Thr Leu Tyr Cys Asn His

195 200 205

Arg Asn Arg Arg Arg Val Cys Lys Cys Pro Arg Pro Val Val Lys Ser

210 215 220

Gly Asp Lys Pro Ser Leu Ser Ala Arg Tyr Val

225 230 235

Claims

1. An antibody or antigen-binding fragment thereof that specifically binds mesothelin, comprising:

(a) A light chain variable region (VL) comprising

(1) A light chain CDR1 (VL CDR 1) having an amino acid sequence selected from the group consisting of SEQ ID NOs 1-15;

(2) A light chain CDR2 (VL CDR 2) having an amino acid sequence selected from the group consisting of SEQ ID NOs 16-29;

(3) A light chain CDR3 (VL CDR 3) having an amino acid sequence selected from the group consisting of SEQ ID NOs 30-44;

or a variant thereof having up to about 5 amino acid substitutions, additions and/or deletions in the VL CDR;

and/or

(b) A heavy chain variable region (VH) comprising

(1) A heavy chain CDR1 (VH CDR 1) having an amino acid sequence selected from the group consisting of SEQ ID NOS: 45-57;

(2) A heavy chain CDR2 (VH CDR 2) having an amino acid sequence selected from the group consisting of SEQ ID NOs 58-70;

(3) A heavy chain CDR3 (VH CDR 3) having an amino acid sequence selected from the group consisting of SEQ ID NOs 71-85;

or a variant thereof having up to about 5 amino acid substitutions, additions and/or deletions in the VH CDRs.

2. The antibody or antigen-binding fragment of claim 1, wherein:

(a) The VL CDR1, CDR2 and CDR3 each have

(1) 1, 16 and 30;

(2) The amino acid sequences shown as SEQ ID NO 2, 17 and 31;

(3) Amino acid sequences shown as SEQ ID NO 3, 18 and 32;

(4) Amino acid sequences shown as SEQ ID NOS 4, 19 and 33;

(5) Amino acid sequences shown as SEQ ID NOS 5, 20 and 34;

(6) The amino acid sequences shown as SEQ ID NO 6, 21 and 35;

(7) The amino acid sequences shown as SEQ ID NO. 7, 22 and 36;

(8) Amino acid sequences shown as SEQ ID NOS 8, 23 and 37;

(9) The amino acid sequences shown as SEQ ID NO 9, 24 and 38;

(10) 10, 25 and 39, respectively;

(11) 11, 26 and 40, respectively;

(12) 12, 27 and 41;

(13) 13, 28 and 42;

(14) 14, 29 and 43, respectively; or

(15) Amino acid sequences shown as SEQ ID NOS 15, 18 and 44;

and/or

(b) The VH CDR1, CDR2 and CDR3 respectively have

(1) Amino acid sequences shown as SEQ ID NOS 45, 58 and 71;

(2) 46, 59 and 72;

(3) Amino acid sequences shown as SEQ ID NOS 47, 60 and 73;

(4) The amino acid sequences shown as SEQ ID NOS 48, 61 and 74;

(5) Amino acid sequences shown as SEQ ID NOS 49, 62 and 75;

(6) Amino acid sequences shown as SEQ ID NOS: 50, 63 and 76;

(7) Amino acid sequences shown as SEQ ID NOS 51, 64 and 77;

(8) The amino acid sequences shown as SEQ ID NOS 52, 65 and 78;

(9) 53, 66 and 79;

(10) Amino acid sequences shown as SEQ ID NOS 48, 61 and 80;

(11) Amino acid sequences shown as SEQ ID NOS 54, 67 and 81;

(12) 53, 66 and 82;

(13) Amino acid sequences shown as SEQ ID NOS: 55, 68 and 83;

(14) 56, 69 and 84; or

(15) Amino acid sequences shown as SEQ ID NOS: 57, 70 and 85;

3. The antibody or antigen-binding fragment of claim 1, wherein

(1) The VL CDR1, CDR2 and CDR3 have amino acid sequences shown in SEQ ID NO. 1, 16 and 30 respectively; and/or the VH CDR1, the CDR2 and the CDR3 have amino acid sequences shown in SEQ ID NO. 45, 58 and 71 respectively;

(2) The VL CDR1, CDR2 and CDR3 have amino acid sequences shown in SEQ ID NO 2, 17 and 31, respectively; and/or, the VH CDR1, CDR2 and CDR3 have amino acid sequences shown in SEQ ID NO 46, 59 and 72, respectively;

(3) The VL CDR1, CDR2 and CDR3 have amino acid sequences shown in SEQ ID NO. 3, 18 and 32 respectively; and/or the VH CDR1, the CDR2 and the CDR3 have amino acid sequences shown in SEQ ID NO 47, 60 and 73 respectively;

(4) The VL CDR1, CDR2 and CDR3 have amino acid sequences shown in SEQ ID NO 4, 19 and 33 respectively; and/or, the VH CDR1, CDR2 and CDR3 have amino acid sequences shown in SEQ ID NO 48, 61 and 74 respectively;

(5) The VL CDR1, CDR2 and CDR3 have amino acid sequences shown in SEQ ID NO. 5, 20 and 34 respectively; and/or the VH CDR1, CDR2 and CDR3 have amino acid sequences shown in SEQ ID NO. 49, 62 and 75 respectively;

(6) The VL CDR1, CDR2 and CDR3 have amino acid sequences shown in SEQ ID NO 6, 21 and 35 respectively; and/or the VH CDR1, CDR2 and CDR3 have amino acid sequences shown in SEQ ID NO 50, 63 and 76 respectively;

(7) The VL CDR1, CDR2 and CDR3 have amino acid sequences shown in SEQ ID NO 7, 22 and 36 respectively; and/or the VH CDR1, CDR2 and CDR3 have amino acid sequences shown in SEQ ID NO 51, 64 and 77 respectively;

(8) The VL CDR1, CDR2 and CDR3 have amino acid sequences shown in SEQ ID NO 8, 23 and 37 respectively; and/or said VH CDR1, CDR2 and CDR3 have amino acid sequences shown in SEQ ID NOs 52, 65 and 78, respectively;

(9) The VL CDR1, CDR2 and CDR3 have amino acid sequences shown in SEQ ID NO 9, 24 and 38 respectively; and/or the VH CDR1, CDR2 and CDR3 have amino acid sequences shown in SEQ ID NO:53, 66 and 79, respectively;

(10) The VL CDR1, CDR2 and CDR3 have amino acid sequences shown in SEQ ID NO 10, 25 and 39 respectively; and/or said VH CDR1, CDR2 and CDR3 have amino acid sequences shown in SEQ ID NO 48, 61 and 80, respectively;

(11) The VL CDR1, CDR2 and CDR3 have amino acid sequences shown in SEQ ID NO. 11, 26 and 40 respectively; and/or the VH CDR1, CDR2 and CDR3 have amino acid sequences shown in SEQ ID NO:54, 67 and 81 respectively;

(12) The VL CDR1, CDR2 and CDR3 have amino sequences shown in SEQ ID NO 12, 27 and 41, respectively; and/or said VH CDR1, CDR2 and CDR3 have amino acid sequences shown in SEQ ID NO 53, 66 and 82, respectively;

(13) The VL CDR1, CDR2 and CDR3 have amino acid sequences shown in SEQ ID NO 13, 28 and 42 respectively; and/or said VH CDR1, CDR2 and CDR3 have amino acid sequences shown in SEQ ID NO:55, 68 and 83, respectively;

(14) The VL CDR1, CDR2 and CDR3 have amino acid sequences shown in SEQ ID NO. 14, 29 and 43, respectively; and/or said VH CDR1, CDR2 and CDR3 have amino acid sequences shown in SEQ ID NOs 56, 69 and 84, respectively; or

(15) The VL CDR1, CDR2 and CDR3 have amino acid sequences shown in SEQ ID NO 15, 18 and 44 respectively; and/or the VH CDR1, CDR2 and CDR3 have amino acid sequences shown in SEQ ID NO:57, 70 and 85, respectively.

4. The antibody or antigen-binding fragment of claim 1, comprising a VL CDR1, VL CDR2, VL

CDR3, VH CDR1, VH CDR2 and VH CDR3, wherein

(a) The VL CDR1, CDR2 and CDR3 have amino acid sequences shown in SEQ ID NO 5, 20 and 34 respectively; and

(b) The VH CDR1, CDR2 and CDR3 have amino acid sequences shown in SEQ ID NO 49, 62 and 75 respectively.

5. The antibody or antigen binding fragment of claim 1, comprising a VL CDR1, VL CDR2, VL

CDR3, VH CDR1, VH CDR2 and VH CDR3, wherein

(a) The VL CDR1, CDR2 and CDR3 have amino acid sequences shown in SEQ ID NO 10, 25 and 39 respectively; and

(b) The VH CDR1, CDR2 and CDR3 have amino acid sequences shown in SEQ ID NO 48, 61 and 80 respectively.

6. The antibody or antigen binding fragment of claim 1, comprising a VL CDR1, VL CDR2, VL

CDR3, VH CDR1, VH CDR2 and VH CDR3, wherein

(a) The VL CDR1, CDR2 and CDR3 have amino acid sequences shown in SEQ ID NO. 14, 29 and 43, respectively; and

(b) The VH CDR1, CDR2 and CDR3 have amino acid sequences shown in SEQ ID NO 56, 69 and 84 respectively.

7. An antibody or antigen-binding fragment thereof that specifically binds mesothelin, comprising:

(a) A VL having at least 85%, at least 90%, at least 95%, at least 98% or 100% sequence identity to an amino acid sequence selected from the group consisting of SEQ ID NOs 86-100; and/or

(b) VH having at least 85%, at least 90%, at least 95%, at least 98% or 100% sequence identity to an amino acid sequence selected from the group consisting of SEQ ID NOS 101-115.

8. The antibody or antigen-binding fragment of claim 7, comprising a VL and a VH, wherein the VL and VH have, respectively

(1) Amino acid sequences shown as SEQ ID NO 86 and 101;

(2) 87 and 102, or a pharmaceutically acceptable salt thereof;

(3) 88 and 103, respectively;

(4) 89 and 104 of SEQ ID NO;

(5) The amino acid sequences shown as SEQ ID NO 90 and 105;

(6) The amino acid sequences shown as SEQ ID NO 91 and 106;

(7) The amino acid sequences shown as SEQ ID NO 92 and 107;

(8) 93 and 108;

(9) Amino acid sequences shown as SEQ ID NO 94 and 109;

(10) Amino acid sequences shown as SEQ ID NOS 95 and 110;

(11) Amino acid sequences shown as SEQ ID NOS 96 and 111;

(12) The amino acid sequences shown as SEQ ID NOS: 97 and 112;

(13) Amino acid sequences shown as SEQ ID NOS 98 and 113;

(14) 99 and 114 in SEQ ID NO; or

(15) Amino acid sequences shown as SEQ ID NO 100 and 115.

9. The antibody or antigen-binding fragment of claim 7, comprising a VL and a VH, wherein the VL and VH have the amino acid sequences set forth in SEQ ID NOS 90 and 105, respectively.

10. The antibody or antigen-binding fragment of claim 7, comprising a VL and a VH, wherein the VL and VH have the amino acid sequences shown in SEQ ID NOS 95 and 110, respectively.

11. The antibody or antigen-binding fragment of claim 7, comprising a VL and a VH, wherein the VL and VH have the amino acid sequences shown in SEQ ID NOS 99 and 114, respectively.

12. An antibody or antigen-binding fragment thereof that specifically binds mesothelin, comprising

(a) A VL comprising a VL CDR1, CDR2, and CDR3, said VL CDR1, CDR2, and CDR3 derived from a VL having an amino acid sequence selected from the group consisting of SEQ ID NOs 86-100; and/or

(b) A VH comprising VH CDR1, CDR2, and CDR3, said VH CDR1, CDR2, and CDR3 derived from a VH having an amino acid sequence selected from the group consisting of SEQ ID NOs 101-115.

13. The antibody or antigen binding fragment of claim 12, comprising

(1) A VL comprising a VL CDR1, CDR2 and CDR3, said VL CDR1, CDR2 and CDR3 derived from a VL having an amino acid sequence as set forth in SEQ ID No. 86, and/or a VH comprising a VH CDR1, CDR2 and CDR3, said VH CDR1, CDR2 and CDR3 derived from a VH having an amino acid sequence as set forth in SEQ ID No. 101;

(2) A VL comprising a VL CDR1, CDR2 and CDR3, said VL CDR1, CDR2 and CDR3 derived from a VL having the amino acid sequence shown in SEQ ID No. 87, and/or a VH comprising a VH CDR1, CDR2 and CDR3, said VH CDR1, CDR2 and CDR3 derived from a VH having the amino acid sequence shown in SEQ ID No. 102;

(3) A VL comprising a VL CDR1, CDR2 and CDR3, said VL CDR1, CDR2 and CDR3 being derived from a VL having an amino acid sequence as set forth in SEQ ID No. 88, and/or a VH comprising a VH CDR1, CDR2 and CDR3, said VH CDR1, CDR2 and CDR3 being derived from a VH having an amino acid sequence as set forth in SEQ ID No. 103;

(4) A VL comprising a VL CDR1, CDR2 and CDR3, said VL CDR1, CDR2 and CDR3 derived from a VL having the amino acid sequence shown in SEQ ID No. 89, and/or a VH comprising a VH CDR1, CDR2 and CDR3, said VH CDR1, CDR2 and CDR3 derived from a VH having the amino acid sequence shown in SEQ ID No. 104;

(5) A VL comprising a VL CDR1, CDR2 and CDR3, said VL CDR1, CDR2 and CDR3 derived from a VL having an amino acid sequence as set forth in SEQ ID No. 90, and/or a VH comprising a VH CDR1, CDR2 and CDR3, said VH CDR1, CDR2 and CDR3 derived from a VH having an amino acid sequence as set forth in SEQ ID No. 105;

(6) A VL comprising VL CDR1, CDR2 and CDR3, said VL CDR1, CDR2 and CDR3 derived from a VL having an amino acid sequence as set forth in SEQ ID No. 91, and/or a VH comprising VH CDR1, CDR2 and CDR3, said VH CDR1, CDR2 and CDR3 derived from a VH having an amino acid sequence as set forth in SEQ ID No. 106;

(7) A VL comprising VL CDR1, CDR2 and CDR3, said VL CDR1, CDR2 and CDR3 derived from a VL having an amino acid sequence shown in SEQ ID No. 92, and/or a VH comprising VH CDR1, CDR2 and CDR3, said VH CDR1, CDR2 and CDR3 derived from a VH having an amino acid sequence shown in SEQ ID No. 107;

(8) A VL comprising a VL CDR1, CDR2 and CDR3, said VL CDR1, CDR2 and CDR3 derived from a VL having an amino acid sequence shown in SEQ ID No. 93, and/or a VH comprising a VH CDR1, CDR2 and CDR3, said VH CDR1, CDR2 and CDR3 derived from a VH having an amino acid sequence shown in SEQ ID No. 108;

(9) A VL comprising VL CDR1, CDR2 and CDR3, said VL CDR1, CDR2 and CDR3 being derived from a VL having an amino acid sequence as depicted in SEQ ID NO. 94, and/or a VH comprising VH CDR1, CDR2 and CDR3, said VH CDR1, CDR2 and CDR3 being derived from a VH having an amino acid sequence as depicted in SEQ ID NO. 109;

(10) A VL comprising a VL CDR1, CDR2 and CDR3, said VL CDR1, CDR2 and CDR3 derived from a VL having an amino acid sequence as set forth in SEQ ID No. 95, and/or a VH comprising a VH CDR1, CDR2 and CDR3, said VH CDR1, CDR2 and CDR3 derived from a VH having an amino acid sequence as set forth in SEQ ID No. 110;

(11) A VL comprising a VL CDR1, CDR2 and CDR3, said VL CDR1, CDR2 and CDR3 being derived from a VL having the amino acid sequence shown in SEQ ID No. 96, and/or a VH comprising a VH CDR1, CDR2 and CDR3, said VH CDR1, CDR2 and CDR3 being derived from a VH having the amino acid sequence shown in SEQ ID No. 111;

(12) A VL comprising a VL CDR1, CDR2 and CDR3, said VL CDR1, CDR2 and CDR3 derived from a VL having an amino acid sequence as set forth in SEQ ID No. 97, and/or a VH comprising a VH CDR1, CDR2 and CDR3, said VH CDR1, CDR2 and CDR3 derived from a VH having an amino acid sequence as set forth in SEQ ID No. 112;

(13) A VL comprising a VL CDR1, CDR2 and CDR3, said VL CDR1, CDR2 and CDR3 derived from a VL having an amino acid sequence as set forth in SEQ ID NO:98, and/or a VH comprising a VH CDR1, CDR2 and CDR3, said VH CDR1, CDR2 and CDR3 derived from a VH having an amino acid sequence as set forth in SEQ ID NO: 113;

(14) A VL comprising a VL CDR1, CDR2 and CDR3, said VL CDR1, CDR2 and CDR3 being derived from a VL having the amino acid sequence shown in SEQ ID No. 99, and/or a VH comprising a VH CDR1, CDR2 and CDR3, said VH CDR1, CDR2 and CDR3 being derived from a VH having the amino acid sequence shown in SEQ ID No. 114; or

(15) A VL comprising VL CDR1, CDR2 and CDR3, said VL CDR1, CDR2 and CDR3 derived from a VL having an amino acid sequence as set forth in SEQ ID No. 100, and/or a VH comprising VH CDR1, CDR2 and CDR3, said VH CDR1, CDR2 and CDR3 derived from a VH having an amino acid sequence as set forth in SEQ ID No. 115.

14. The antibody or antigen-binding fragment of claim 12, which comprises a VL and a VH, wherein the VL comprises a VL CDR1, CDR2, and CDR3, the VL CDR1, CDR2, and CDR3 are derived from a VL having the amino acid sequence set forth in SEQ ID No. 90; and, the VH comprises a VH CDR1, CDR2, and CDR3, the VH CDR1, CDR2, and CDR3 are derived from a VH having the amino acid sequence shown in SEQ ID NO: 105.

15. The antibody or antigen-binding fragment of claim 12, which comprises a VL and a VH, wherein the VL comprises a VL CDR1, CDR2, and CDR3, the VL CDR1, CDR2, and CDR3 are derived from a VL having the amino acid sequence set forth in SEQ ID No. 95; and, the VH comprises a VH CDR1, CDR2, and CDR3, the VH CDR1, CDR2, and CDR3 are derived from a VH having the amino acid sequence set forth in SEQ ID NO: 110.

16. The antibody or antigen-binding fragment of claim 12, which comprises a VL and a VH, wherein the VL comprises a VL CDR1, CDR2, and CDR3, the VL CDR1, CDR2, and CDR3 are derived from a VL having the amino acid sequence set forth in SEQ ID No. 99; and, the VH comprises a VH CDR1, CDR2, and CDR3, the VH CDR1, CDR2, and CDR3 are derived from a VH having the amino acid sequence set forth in SEQ ID NO: 114.

17. An antibody or antigen-binding fragment that competes for binding to mesothelin with the antibody or antigen-binding fragment of any one of claims 1 to 16.

18. The antibody or antigen-binding fragment of any one of claims 1 to 17, which is a monoclonal antibody or antigen-binding fragment.

19. The antibody or antigen-binding fragment of any one of claims 1 to 18, which is a bispecific antibody or a multispecific antibody.

20. The antibody or antigen-binding fragment of claim 19, which is a bispecific T cell engager (BiTE).

21. The antibody or antigen-binding fragment of any one of claims 1 to 20, which is selected from the group consisting of an IgG1 antibody, an IgG2 antibody, an IgG3 antibody, and an IgG4 antibody.

22. The antibody or antigen binding fragment of any one of claims 1 to 20 selected from the group consisting of Fab, fab', and F(ab') ₂ 、Fv、scFv、(scFv) ₂ Single domain antibodies (sdabs) and heavy chain antibodies (hcabs).

23. The antibody or antigen-binding fragment of claim 22, which is an scFv.

24. The antibody or antigen-binding fragment of any one of claims 1 to 23, which is a chimeric antibody or antigen-binding fragment, a humanized antibody or antigen-binding fragment, or a human antibody or antigen-binding fragment.

25. The antibody or antigen-binding fragment of claim 24, which is a human antibody or antigen-binding fragment.

26. A polynucleotide encoding the antibody or antigen-binding fragment of any one of claims 1 to 25.

27. The polynucleotide of claim 26, which is a messenger RNA (mRNA).

28. A vector comprising the polynucleotide of claim 26.

29. A host cell comprising the polynucleotide of claim 26 or 27 or the vector of claim 28.

30. A Chimeric Antigen Receptor (CAR) that specifically binds mesothelin, comprising from N-terminus to C-terminus:

(a) A mesothelin binding domain comprising the antibody or antigen binding fragment of any one of claims 1-25;

(b) A transmembrane domain; and

(c) A cytoplasmic domain.

31. The CAR of claim 30, wherein the transmembrane domain is derived from CD8, CD28, CD3 ζ, CD4, 4-1BB, OX40, ICOS, CTLA-4, PD-1, LAG-3, 2B4, BTLA, TCR α chain, TCR β chain, or TCR ζ chain, CD3 ε, CD45, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, or CD154.

32. The CAR of claim 30, wherein the transmembrane domain comprises a CD8 transmembrane region or a CD28 transmembrane region.

33. The CAR of any one of claims 30-32, wherein the cytoplasmic domain comprises a signaling domain derived from CD3 ζ, fcR γ, fcyriia, fcR β, CD3 γ, CD3 δ, CD3 epsilon, CD5, CD22, CD79a, CD79b, DAP10, DAP12, or any combination thereof.

34. The CAR of claim 33, wherein the cytoplasmic domain further comprises a co-stimulatory domain derived from CD28, 4-1BB (CD 137), OX40, ICOS, DAP10, 2B4, CD27, CD30, CD40, CD2, CD7, LIGHT, GITR, TLR, DR3, CD43, or any combination thereof.

35. The CAR of any one of claims 30-34, wherein the cytoplasmic domain comprises a CD3 zeta signaling domain and a 4-1BB co-stimulatory domain.

36. The CAR of any one of claims 30-34, wherein the cytoplasmic domain comprises a CD3 zeta signaling domain and a CD28 costimulatory domain.

37. The CAR of any one of claims 30 to 36, further comprising a CD8 hinge, the CD8 hinge being located between the antibody or antigen-binding fragment and the transmembrane domain.

38. A CAR that specifically binds mesothelin comprising an amino acid sequence selected from the group consisting of SEQ ID NOs 161-175.

39. A polynucleotide encoding the CAR of any one of claims 30 to 38.

40. The polynucleotide of claim 39 which is mRNA.

41. A vector comprising the polynucleotide of claim 39.

42. A cell comprising the polynucleotide of claim 39 or 40 or the vector of claim 41.

43. The cell of claim 42, which is an immune effector cell.

44. The cell of claim 43, which is derived from a cell isolated from peripheral blood or bone marrow.

45. The cell of claim 43, which is derived from a cell differentiated in vitro from a stem cell or progenitor cell selected from the group consisting of a T cell progenitor, a hematopoietic stem/progenitor, a hematopoietic pluripotent progenitor, an embryonic stem cell, and an induced pluripotent cell.

46. The cell of any one of claims 42-45, which is a T cell or NK cell.

47. The cell of claim 46, which is a cytotoxic T cell, a helper T cell, a γ δ T cell, a CD4+/CD8+ double positive T cell, a CD4+ T cell, a CD8+ T cell, a CD4/CD8 double negative T cell, a CD3+ T cell, a naive T cell, an effector T cell, a helper T cell, a memory T cell, a regulatory T cell, a Th0 cell, a Th1 cell, a Th2 cell, a Th3 (Treg) cell, a Th9 cell, a Th17 cell, a Th α β helper cell, a Tfh cell, a stem cell memory TSCM cell, a central memory TCM cell, an effector memory cell, or an effector memory TEMRA cell.

48. The cell of claim 46 which is a cytotoxic T cell.

49. A cell population comprising the cells of claim 42, wherein said cell population is derived from Peripheral Blood Mononuclear Cells (PBMCs), peripheral Blood Lymphocytes (PBLs), tumor Infiltrating Lymphocytes (TILs), cytokine induced killer Cells (CIKs), lymphokine activated killer cells (LAKs), or bone Marrow Infiltrating Lymphocytes (MILs).

50. A pharmaceutical composition comprising a therapeutically effective amount of the antibody or antigen-binding fragment of any one of claims 1-25, and a pharmaceutically acceptable carrier.

51. A pharmaceutical composition comprising a therapeutically effective amount of the cell or cell population of any one of claims 42-49, and a pharmaceutically acceptable carrier.

52. Use of the antibody or antigen-binding fragment of any one of claims 1 to 25, the cell or population of cells of any one of claims 43 to 49, or the pharmaceutical composition of claim 50 or 51 in the treatment of cancer.

53. Use of the antibody or antigen-binding fragment of any one of claims 1 to 25, the cell or population of cells of any one of claims 43 to 49, or the pharmaceutical composition of claim 50 or 51 in the preparation of a medicament for the treatment of cancer.

54. The use of claim 52 or 53, wherein the cell, population of cells, or pharmaceutical composition is used in combination with an additional therapy.

55. A method of treating cancer in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of the antibody or antigen-binding fragment of any one of claims 1-25, or the pharmaceutical composition of claim 50 or 51.

56. A method of treating cancer in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of the cell or population of cells of any one of claims 43-49.

57. The method of claim 56, wherein the cell or population of cells is a cell or population of cells autologous to the subject.

58. The method of claim 57, further comprising: obtaining cells from the subject.

59. The method of any one of claims 55 to 58, further comprising: administering an additional therapy to the subject.

60. The method of any one of claims 55 to 59, wherein the subject is a human.

61. The use or method of any one of claims 52-60, wherein the cancer is a mesothelin-expressing cancer.

62. The use or method of any one of claims 52-61, wherein the cancer is a solid tumor or a hematological cancer.

63. The use or method of any one of claims 52-62, wherein the cancer is mesothelioma.

64. The use or method of claim 63, wherein the mesothelioma is pleural mesothelioma, peritoneal mesothelioma, or pericardial mesothelioma.

65. The use or method of any one of claims 52 to 62, wherein the cancer is pancreatic cancer.

66. The use or method of claim 65, wherein the pancreatic cancer is ductal pancreatic cancer.

67. The use or method of any one of claims 52 to 62, wherein the cancer is ovarian cancer.

68. The use or method according to claim 67, wherein the ovarian cancer is ovarian epithelial cancer.

69. A method of making a cell capable of expressing a CAR that specifically binds mesothelin, comprising transferring the polynucleotide of claim 39 or 40 to the cell.

70. The method of claim 69, wherein said polynucleotide is transferred by electroporation.

71. The method of claim 69, wherein the polynucleotide is transferred by viral transduction.

72. The method of claim 71, comprising viral transduction using a lentivirus, retrovirus, adenovirus, or adeno-associated virus.

73. The method of claim 69, wherein the polynucleotide is transferred using a transposome system.

74. The method of claim 73, wherein the transposable subsystem is beauty-sleeping or PiggyBac.

75. The method of claim 69, wherein said polynucleotide is transferred by gene editing.

76. The method of claim 75, wherein the polynucleotide is transferred by a CRISPR-Cas system, a ZFN system, or a TALEN system.

77. The method of any one of claims 69 to 76, wherein the cell is selected from the group consisting of a T cell, an NK cell, an NKT cell, a macrophage, a neutrophil, and a granulocyte.