CN115819562B

CN115819562B - Heavy chain and light chain variable regions of anti-pseudorabies virus gB monoclonal antibody and their application

Info

Publication number: CN115819562B
Application number: CN202211426483.2A
Authority: CN
Inventors: 李川敏; 杨晓霞; 杜锦然; 巩玉洁; 赵荣茂; 李金戈
Original assignee: Beijing Nabai Bio Tech Co ltd
Current assignee: Beijing Nabai Bio Tech Co ltd
Priority date: 2022-11-15
Filing date: 2022-11-15
Publication date: 2024-12-10
Anticipated expiration: 2042-11-15
Also published as: CN115819562A

Abstract

The present invention discloses a heavy chain and light chain variable region of an anti-pseudorabies virus gB monoclonal antibody and its application. The gene sequence of the Heavy chain of the gB monoclonal antibody is shown in SEQ ID NO.4, and its amino acid sequence is shown in SEQ ID NO.5; the gene sequence of the Kappa chain of the gB monoclonal antibody is shown in SEQ ID NO.6, and its amino acid sequence is shown in SEQ ID NO.7. The present invention adopts the heavy chain and light chain variable region of the anti-pseudorabies virus gB monoclonal antibody mentioned above, and the monoclonal antibody has the characteristics of strong specificity and high sensitivity, etc., which lays a foundation for the research, development and promotion of ELISA kits and colloidal gold test strips.

Description

Heavy chain and light chain variable region of anti-porcine pseudorabies virus gB monoclonal antibody and application thereof

Technical Field

The invention relates to the technical field of pseudorabies viruses, in particular to a heavy chain and light chain variable region of an anti-porcine pseudorabies virus gB monoclonal antibody and application thereof.

Background

Porcine pseudorabies (Pseudorabies, PR) is a highly contagious disease caused by pseudorabies virus (Pseudorabies virus, PRV). PRV can infect a variety of mammals including pigs, sheep, cattle, with the most susceptible onset of pigs also being the most severe. The disease is characterized by breeding disorder of pigs, dyspnea of adult pigs and death of piglets, and causes serious economic loss to pig industry in China.

The incidence and mortality of PRV depend on the age of the affected pig and the immune status of the herd, and vaccination is a major measure in preventing and controlling this disease. And how to objectively and effectively evaluate the antibody level of PRV is one of the keys to scientifically and effectively prevent and control the disease.

The gB protein is an essential glycoprotein for PRV proliferation, and detection of gB antibodies by ELISA is one of the important ways to detect PRV antibody levels.

The existing domestic and foreign technology mainly comprises a fluorescence PCR method and an immunological analysis method (an enzyme-linked immunoassay method and a colloidal gold immunoassay method) for detecting PRV. Fluorescent RCR instruments are expensive and are prone to contamination. The ELISA has the characteristics of strong specificity and high sensitivity, can obtain test results within 3-4 hours, can detect a large amount of samples at the same time, and is widely used for clinical diagnosis of pseudorabies.

Disclosure of Invention

The invention aims to provide a heavy chain and light chain variable region of a monoclonal antibody against porcine pseudorabies virus gB and application thereof, and the monoclonal antibody has the characteristics of strong specificity, high sensitivity and the like, and lays a foundation for development and popularization of ELISA (enzyme-Linked immuno sorbent assay) kits and colloidal gold test strips.

In order to achieve the aim, the invention provides a Heavy chain and light chain variable region of a gB monoclonal antibody against porcine pseudorabies virus, wherein the gene sequence of the heaven chain of the gB monoclonal antibody is shown as SEQ ID NO.4, the amino acid sequence of the heaven chain of the gB monoclonal antibody is shown as SEQ ID NO.5, the gene sequence of the Kappa chain of the gB monoclonal antibody is shown as SEQ ID NO.6, and the amino acid sequence of the heaven chain of the gB monoclonal antibody is shown as SEQ ID NO. 7.

Preferably, the complementarity determining region sequences of the heavy chain variable region of the gB monoclonal antibody are CDR-H1, CDR-H2 and CDR-H3 respectively, and the amino acid sequences are shown as SEQ ID NO.8, SEQ ID NO.9 and SEQ ID NO.10 respectively.

Preferably, the complementarity determining region sequences of the light chain variable region of the gB monoclonal antibody are CDR-L1, CDR-L2 and CDR-L3 respectively, and the amino acid sequences are shown as SEQ ID NO.11, SEQ ID NO.12 and SEQ ID NO.13 respectively.

A DNA molecule encoding the heavy and light chain variable regions of said anti-porcine pseudorabies virus gB monoclonal antibody.

The application of the heavy chain and light chain variable regions of the anti-porcine pseudorabies virus gB monoclonal antibody in preparing a detection reagent or a kit taking gB as a target point.

The application of the anti-porcine pseudorabies virus gB monoclonal antibody in preparing a genetic engineering antibody or vaccine taking gB as a target spot.

Therefore, the heavy chain and light chain variable regions of the anti-porcine pseudorabies virus gB monoclonal antibody and application thereof are adopted, and the monoclonal antibody has the characteristics of strong specificity, high sensitivity and the like, and lays a foundation for development and popularization of ELISA (enzyme-Linked immuno sorbent assay) kits and colloidal gold test strips.

The technical scheme of the invention is further described in detail through the drawings and the embodiments.

Drawings

FIG. 1 shows the result of gene sequence alignment of heavy chain variable region of monoclonal antibody;

FIG. 2 is an amino acid sequence alignment of the heavy chain variable region of a monoclonal antibody;

FIG. 3 is a sequence alignment of monoclonal antibody light chain variable region genes;

FIG. 4 shows the amino acid sequence alignment of the light chain variable region of a monoclonal antibody.

Detailed Description

The technical scheme of the invention is further described below through the attached drawings and the embodiments.

It will be apparent to those skilled in the art that the present invention is not limited to the details of the exemplary embodiments described below, but that the present invention may be embodied in other specific forms without departing from the spirit or essential characteristics thereof. The present embodiments are therefore to be considered in all respects as illustrative and not restrictive, the scope of the invention being indicated by the appended claims rather than by the following description, and all changes which come within the meaning and range of equivalency of the claims are therefore intended to be embraced therein.

Furthermore, it should be understood that although the present disclosure describes embodiments, not every embodiment is provided with a separate embodiment, and that this description is provided for clarity only, and that the disclosure is not limited to the embodiments described in detail below, and that the embodiments described in the examples may be combined as appropriate to form other embodiments that will be apparent to those skilled in the art. Such other embodiments are also within the scope of the present invention.

It should be further understood that the above-described embodiments are only for explaining the present invention, the protection scope of the present invention is not limited thereto, and any person skilled in the art should be able to substitute or change the technical solution according to the present invention and the inventive concept thereof within the scope of the present invention.

The specific meaning of the above terms in the present invention can be understood by those of ordinary skill in the art according to the specific circumstances. The term "about" as used herein has a meaning well known to those skilled in the art, and preferably means that the term is modified by a value within the range of + -50%, + -40%, + -30%, + -20%, + -10%, + -5% or + -1%.

All terms (including technical or scientific terms) used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs, unless specifically defined otherwise. It will be further understood that terms, such as those defined in commonly used dictionaries, should be interpreted as having a meaning that is consistent with their meaning in the context of the relevant art and will not be interpreted in an idealized or overly formal sense unless expressly so defined herein.

Techniques, methods, and apparatus known to one of ordinary skill in the relevant art may not be discussed in detail, but are intended to be considered part of the specification where appropriate.

The disclosures of the prior art documents cited in the present specification are incorporated by reference in their entirety into the present invention and are therefore part of the present disclosure.

Example 1

Preparation of porcine pseudorabies virus antigen

1. Cell resuscitation

Placing frozen Vero cells in a 37 ℃ water bath, slightly shaking to enable the Vero cells to be melted quickly, centrifuging at 1000r/min for 5min, discarding supernatant, adding 1mL of DMEM (10% HS) to resuspend the cells, inoculating the cells into a T75 culture flask, adding the DMEM (10% HS) to 13 mL/flask, and carrying out stationary culture in a 37 ℃ cell constant temperature incubator.

2. Virus culture

After the cells grow to be full of a monolayer, the supernatant is discarded, the TPRV strain is diluted by DMEM and inoculated into a cell culture bottle, the cell culture bottle is placed in a 37 ℃ cell constant temperature incubator for incubation for 1h, the supernatant is discarded, and the DMEM (10% HS) is added to 15mL for continuous culture.

3. Viral protein purification

Placing cells with 80% CPE and supernatant after virus inoculation into a-70 ℃ refrigerator, repeatedly freezing and thawing for 3 times, collecting supernatant, centrifuging at 10000r/min for 30min, and collecting supernatant into sterile glass bottles. Adding inactivating agent beta-propiolactone according to the ratio of 1:1000, and inactivating for 48 hours in a refrigerator at 4 ℃. The inactivated virus supernatant was ultracentrifuged for 3h with a Beckman Type45Ti rotor at 26000 r/min, the virus pellet was resuspended with 6mL sterile PBS, the protein concentration in the supercoiled virus was determined by BCA method to be 1.5mg/mL, and the whole was stored in a-70℃refrigerator after packaging.

Example two

Preparation of monoclonal antibodies

1. Immunization of mice

3 Female Balb/c mice, 6-8 weeks old, were immunized with 50. Mu.g of TPRV virus each. At the time of primary immunization, the TPRV virus and Freund's complete adjuvant are subjected to equal-volume emulsification, and the mice are immunized by subcutaneous multipoint injection. Co-immunization is carried out three times, once every two weeks, and the two-time immunization and the three-time immunization are carried out antigen emulsification by Freund's incomplete adjuvant, so that the immunization dosage and the way are unchanged. Mice were collected at the tail vein one week after three immunizations, serum was taken and their titers were measured, and the results are shown in table 1. 100 μg of TPRV virus was diluted to 200 μl with 1 XPBS and the mice were given impact immunization by intraperitoneal injection, and cell fusion was allowed three days later.

Table 1 mouse serum potency validation

2. Culture of SP2/0 myeloma cells

One SP2/0 myeloma cell frozen in liquid nitrogen is taken out, immediately transferred into a 37 ℃ constant temperature water bath kettle, the frozen tube is gently swayed from time to time, and taken out when the cell is melted to a semi-ice crystal state. And (3) operating in a sterile environment, transferring SP2/0 cells in the cryopreservation tube into a 50mL sterile centrifuge tube, taking 10mL of preheated 1640 complete culture medium, slowly dripping into the centrifuge tube, centrifuging at 1000r/min for 5min, and discarding the supernatant. The cell pellet was gently broken up, 5mL of medium was taken to resuspend the cells and transferred to T75 cell flasks. In addition, 5mL of culture medium is added, the cell bottle is rocked in the cross direction, and the cell bottle is placed into a CO ₂ cell incubator for culture at 37 ℃. The cell status was observed under a microscope, and SP2/0 cells were subcultured at a density of about 80%.

3. Cell fusion

(1) The experimental mice after impact are taken for orbital blood collection, collected in an EP tube, kept stand at 37 ℃ for 2h, centrifuged at 4000rpm for 10min, and serum is collected for subsequent screening of monoclonal antibodies as positive control. Mice were sacrificed by cervical removal and sterilized by soaking in 75% alcohol.

(2) Preparation of spleen cells, namely cutting off the outer skin of a mouse in a biosafety cabinet by using sterilized scissors and forceps, replacing a set of new sterilized scissors forceps to cut off the abdominal cavity of the mouse, carefully taking out the spleen by using a set of sterilized scissors and forceps, and cutting off redundant fat. A sterile 15mL centrifuge tube was prepared, 10mLDMEM media was added, the spleen was placed into the tube, and after wetting the spleen, the excess media was carefully discarded. Then 10mL of DMEM culture medium is sucked and placed in a sterile plate, the spleen is ground by a ground glass plate to prepare single cell suspension, the single cell suspension is filtered into a sterile centrifuge tube through a 200-mesh nylon net, 30mL of DMEM is added into a 50mL sterile centrifuge tube, the nylon net is washed by a suction tube, the centrifuge tube filled with the spleen cell suspension is centrifuged at 1500rpm for 5min, the supernatant is discarded, the cell mass is gently dispersed by hands, 30mL of DMEM culture medium is added for re-suspension, the supernatant is discarded, the cell mass is gently dispersed by hands, and 10mL of DMEM culture medium is added for re-suspension.

(3) Cell fusion, 1000rpm,5min centrifugation to collect well grown SP2/0 cells in a 50mL centrifuge tube, gently scattering SP2/0 cell mass, adding 30mL DMEM culture medium to resuspend, centrifuging once again, adding 10mL DMEM culture medium to resuspend, mixing spleen cell suspension with SP2/0 cell suspension, centrifuging at 1000rpm for 5min, discarding supernatant, and gently scattering cell mass. Placing in a 37 ℃ water bath environment, sucking 1mL of PEG fusion agent, dripping into a centrifuge tube, and finishing 1mL of PEG fusion agent within 1min, wherein the cell state is red homogeneous quicksand, and the rotating tube wall feels like frosted glass.

(4) The fusion was terminated by pipetting 9mL of pre-warmed DMEM medium, which was divided into three phases. 1mL is added dropwise in the first stage in the first 1min, 1mL is added dropwise in the second stage in the first 1min, and the rest 7mL of culture medium is added dropwise in the third stage in the third 3 min. Then after settling for 5min in a 37℃water bath, centrifugation was carried out at 800rpm for 5min.

(5) Plating, namely, removing the supernatant, lightly scattering cell clusters, adding HAT culture medium (for example, 5 96-well plates, 200 mu L/well are required to be paved, 50mL of HAT culture medium is required to be added for removing feeder cells paved with 100 mu L/well in advance), uniformly mixing cells, uniformly paving the fused cell suspension in 96-well cell plates added with the feeder cells, 100 mu L/well, and culturing in a CO ₂ cell incubator at 37 ℃.

4. Screening of positive hybridoma cells

Cell supernatants were assayed by indirect ELISA 7 days after cell fusion when a large cell mass was observed. 100 ng/hole TPRV virus is used as antigen for detection, positive control is serum of a fusion mouse, and negative control is PBS immunized mouse serum. And selecting a hole with the strongest color reaction to detect whether the gB antibody is blocked, taking 100 ng/hole TPRV virus as an antigen for detection, taking the primary antibody as cell supernatant, taking the secondary antibody as the gB antibody, and determining the hybridoma cell hole with the blocking as a positive hole. And subcloning the screened positive hybridoma cells by a limiting dilution method. And (3) performing expansion culture on the hybridoma cell strain which can stably secrete the monoclonal antibody and is obtained through subcloning identification, and transferring the hybridoma cell strain into a T75 cell bottle.

5. Ascites preparation

The hybridoma cell strain which is identified after subcloning and can stably secrete monoclonal antibody is subjected to expansion culture, transferred into a T75 cell bottle, and cultured until the cell number is about 80%, and can be collected for preparing ascites. 10mL of sterile 1 XPBS was added to the cell flask, the cell layer was blown down, resuspended and transferred to a 15mL centrifuge tube and centrifuged at 1000r/min for 10min. The supernatant was discarded, and the pellet was resuspended in 1mL of sterile 1 XPBS and aspirated with a 1mL syringe. About 500. Mu.L of the cell suspension was injected into each mouse, and the growth state of the mice was noted, and after one week, ascites was collected after the abdomen of the mice had risen. The ascites of the mice are collected in a centrifuge tube, centrifuged at 8000r/min for 20min and the middle abdominal water layer is sucked.

6. Purification of monoclonal antibodies

And (3) carrying out coarse purification on the collected ascites by an octanoic acid-ammonium sulfate method, and then carrying out secondary purification on the coarse purified monoclonal antibody by using a Protein G pre-packed column.

Example III

Sensitivity and subclass identification of anti-porcine pseudorabies virus gB monoclonal antibody

1. Sensitivity of anti-porcine pseudorabies virus gB monoclonal antibody

And detecting the sensitivity of the purified gB monoclonal antibody by adopting an indirect ELISA method. TPRV virus was coated at 100 ng/well, gB monoclonal antibody at 1mg/mL was subjected to gradient dilution, and sensitivity of gB monoclonal antibody was verified, and the results are shown in Table 2. The sensitivity of the gB monoclonal antibody was 1:100000.

TABLE 2 monoclonal antibody sensitivity verification

Gradient dilution of monoclonal antibody	OD_450nm
		1∶500	2.627
1∶1000	2.606
		1∶2000	2.36
1∶4000	2.082
		1∶6000	1.872
1∶8000	1.614
		1∶10000	1.437
1∶50000	0.534
		1∶100000	0.247
NC	0.097

2. Subclass identification of anti-porcine pseudorabies virus gB monoclonal antibody

Subclasses of anti-porcine pseudorabies virus gB monoclonal antibodies were detected using an IgG subclass detection kit (Sigma, usa) and the results are shown in table 3. The subclass of the gB monoclonal antibodies was identified as IgG2a/Kappa type.

TABLE 3 identification of monoclonal antibody subtypes

Example IV

Monoclonal antibody heavy chain and light chain variable region gene cloning

(1) Hybridoma cell culture and total RNA extraction

The hybridoma cells were cultured in RPMI 1640 complete medium at 37 ℃ under 5% carbon dioxide to obtain the number of cells 1×10 ⁷, and total RNA was extracted from the cells using a total RNA extraction kit (purchased from tencel).

(2) Synthesis of first strand cDNA

The first strand of cDNA was synthesized using a reverse transcription kit (purchased from TAKARA) using the total RNA extracted as an amplification template.

(3) Gene amplification

The Kappa strand, the downstream primer and the upstream universal primer of the Heavy strand were designed.

Primer F AAGCAGTGGTATCAACGCAGA (SEQ ID NO. 1)

Rκ:AACATTGATGTCTTTGGGGTAGAA(SEQ ID NO.2)

RH:AGGGATCCAGAGTTCCAGGT(SEQ ID NO.3)

PCR amplification was performed using the first strand of cDNA as a template, and the reaction system was 50. Mu.L. 3. Mu.L of template, 2.5. Mu.L of upstream primer (10. Mu.M), 2.5. Mu.L of downstream primer (10. Mu.M), 25. Mu.L of 2 XTaq enzyme and 17. Mu.L of sterile water.

The conditions for the drop PCR reaction were 98℃30s, 98℃15s,64℃to 58℃30s, each drop of 0.5℃until 58℃was reached, 10 cycles, 72℃30s, 98℃15s,56℃30s,72℃30s, 15 cycles, and 72℃7min to terminate the procedure.

(4) Cloning and screening of PCR amplified products

The PCR products were subjected to 1.5% agarose gel electrophoresis, kappa and heavies chain amplified fragments were recovered using a PCR product recovery kit (purchased from heaven), the recovered purified fragments of interest were inserted into pLB vector using a pLB zero background rapid cloning kit (purchased from heaven), transformed into DH 5. Alpha. Competent cells (ampicillin resistance), and recombinant positive clones were selected and sequenced.

The PCR products were electrophoresed through a 1.5% agarose gel.

The sequencing results of the Heavy chain and Kappa chain are as follows, the Heavy chain gene is the sequence shown as SEQ ID NO.4, the amino acid thereof is the sequence shown as SEQ ID NO.5, and the Kappa chain gene is the sequence shown as SEQ ID NO.6, the amino acid thereof is the sequence shown as SEQ ID NO. 7.

(5) Variable region amino acid sequence and homology analysis

The heavy chain and light chain gene sequences and the amino acid sequences are respectively subjected to comparison analysis in NCBI database, and the analysis result shows that the heavy chain variable region gene Sequence of the monoclonal antibody has the highest homology with the heavy chain variable region (Sequence ID: BC 092061.1) of the mouse immunoglobulin, the homology is 392/441, the homology percentage is 89%, and the result is shown in figure 1.

The monoclonal antibody heavy chain variable region amino acid Sequence has the highest homology with the amino acid Sequence of the heavy chain variable region of the mouse immunoglobulin (Sequence ID: 4PB9_H), the homology is 122/145, the homology percentage is 84%, and the result is shown in figure 2.

The monoclonal antibody light chain variable region gene Sequence has the highest homology with the mouse immunoglobulin Kappa chain variable region (Sequence ID: EU 159573.1), the homology is 326/438, the homology percentage is 74%, and the result is shown in FIG. 3.

The monoclonal antibody light chain variable region amino acid Sequence has the highest homology with the amino acid Sequence of the mouse immunoglobulin Kappa chain variable region (Sequence ID: 6X78_A), the homology is 140/146, the homology percentage is 96%, and the result is shown in FIG. 4.

The results of homology analysis of the gene sequences and amino acid sequences encoding the heavy and light chain variable regions of the monoclonal antibodies revealed that the same sequences as in the present invention were not found. This result is consistent with the identification of monoclonal antibodies as IgG2a/Kappa using the IgG subclass detection kit (Sigma Co., USA).

(6) CDR analysis

The sequences of the heavy chain variable region and the light chain variable region were analyzed at https:// www.novopro.cn/tools/cdr.html to obtain the CDR regions.

Antibody heavy chain CDR regions:

CDR-H1:DYNIH(SEQ ID NO.8)

CDR-H2:YIYPYNGDTAYNQKFKN(SEQ ID NO.9)

CDR-H3:GNYDYVVDYTMDY(SEQ ID NO.10)

antibody light chain CDR regions:

CDR-L1:YLN(SEQ ID NO.11)

CDR-L2:LVSKLDS(SEQ ID NO.12)

CDR-L3:WQGTHFPT(SEQ ID NO.13)

Example five

The porcine pseudorabies virus gB blocking ELISA antibody detection kit is prepared, 24 porcine serum samples are detected, and compared with the outsourced porcine pseudorabies virus gB blocking ELISA antibody detection kit of a certain company, the detailed results are shown in Table 4. The conformity rate of the overall yin and yang sample is 96%.

Table 4 sample compliance comparison

Note that the nano hundred kit judging standard is that the average value of negative control (N) OD _450nm and positive control OD _450nm is more than or equal to 0.3, S/N=sample OD _450nm average value/negative control OD _450nm average value, the judging standard is that S/N is more than 0.7, the judgment is negative, the judgment is that S/N is more than 0.60 and less than or equal to 0.7, the judgment is suspicious, and S/N is less than or equal to 0.6, and the judgment is positive.

The detection kit for the pig pseudorabies virus gB blocking ELISA antibody of a outsourcing company has the judgment standard that the average value of negative control (N) OD _450nm -positive control OD _450nm is more than or equal to 0.3, the average value of S/N=sample OD _450nm average value/negative control OD _450nm average value, the judgment standard S/N is more than 0.7, the judgment is negative, the judgment is that S/N is more than 0.60 and less than or equal to 0.7, the judgment is suspicious, and S/N is less than or equal to 0.6, and the judgment is positive.

Sensitive quality control serum samples were selected for the lowest detection study. The research result shows that the test porcine pseudorabies virus gB blocking ELISA antibody detection kit can detect 16-fold diluted sensitivity samples, and the outsourced porcine pseudorabies virus gB blocking ELISA antibody detection kit for a certain company can also detect 16-fold diluted sensitivity samples. The detailed results are shown in Table 5. From the results, the test porcine pseudorabies virus gB blocking ELISA antibody detection side kit has good sensitivity.

TABLE 5 detection results of sensitive quality control

5 Negative samples are detected by using a test porcine pseudorabies virus gB blocking ELISA antibody detection kit and a purchased porcine pseudorabies virus gB blocking ELISA antibody detection kit of a certain company respectively, and the results are negative, and are shown in Table 6. Therefore, the test porcine pseudorabies virus gB blocking ELISA antibody detection kit has good specificity.

TABLE 6 detection results of specific property controls

It should be noted that the above-mentioned embodiments are merely for illustrating the technical solution of the present invention and not for limiting the same, and although the present invention has been described in detail with reference to the preferred embodiments, it should be understood by those skilled in the art that the technical solution of the present invention may be modified or substituted by the same, and the modified or substituted technical solution may not deviate from the spirit and scope of the technical solution of the present invention.

Claims

1. A gB monoclonal antibody for resisting porcine pseudorabies virus is characterized by comprising a heavy chain variable region and a light chain variable region, wherein the gene sequence of the heavy chain of the gB monoclonal antibody is shown as SEQ ID NO.4, the amino acid sequence of the heavy chain of the gB monoclonal antibody is shown as SEQ ID NO.5, the gene sequence of the light chain of the gB monoclonal antibody is shown as SEQ ID NO.6, and the amino acid sequence of the light chain of the gB monoclonal antibody is shown as SEQ ID NO. 7.

2. A DNA molecule encoding the anti-porcine pseudorabies virus gB monoclonal antibody of claim 1.

3. Use of the anti-porcine pseudorabies virus gB monoclonal antibody of claim 1 in the preparation of a detection reagent or kit targeting gB.