CN115678871A - Protein mutant, recombinant microorganism for producing nucleoside and application thereof - Google Patents

Abstract

The invention relates to the technical field of microorganisms, in particular to a protein mutant, a recombinant microorganism for producing nucleoside and application thereof. The present invention provides a phosphoglycerate kinase mutant comprising a mutation in which valine at position 31 is substituted by an amino acid other than valine, and a pyrimidine-specific carbamoyl phosphate synthase mutant comprising a mutation in which serine at position 160 is substituted by an amino acid other than serine. The protein mutant can obviously improve the nucleoside synthesis capability of microorganisms and effectively promote the accumulation of nucleoside or derivatives thereof. The present invention further provides a recombinant microorganism expressing the above mutant, which is capable of producing nucleoside or its derivatives with high efficiency, and has an important meaning for improving the productivity of strains producing nucleoside or its derivatives.

Description

Protein mutant, recombinant microorganism for producing nucleoside and application thereof

Technical Field

The invention relates to the technical field of microorganisms, in particular to a protein mutant, a recombinant microorganism for producing nucleoside and application thereof.

Background

Nucleosides are general names of glycosides, which are prepared by condensing D-ribose or D-Z-deoxyribose with pyrimidine base or purine base, and are generally colorless crystals, insoluble in common organic solvents, easily soluble in hot water, and have a melting point of 160-240 ℃. Nucleosides are components of nucleic acids and nucleotides, wherein nucleosides produced from D-ribose are called ribonucleosides, involved in RNA, nucleosides produced from D- α -deoxyribose are called deoxyribonucleosides, involved in DNA. The condensation of D-ribose with adenine, guanine, cytosine, thymine or uracil produces the corresponding adenosine, guanosine, cytosine, thymidine and uridine, abbreviated as adenosine (A), guanosine (G), cytidine (C), thymidine (T) and uridine (U), respectively.

Guanosine and inosine have a wide range of roles in the food and pharmaceutical industries. In the food field, guanosine and inosine are important precursors of disodium guanylate and disodium inosinate, respectively, and the disodium guanylate and the disodium inosinate are used in combination as a food freshener and are widely applied to seasonings such as chicken essence, soy sauce and the like. In the field of medicine, guanosine and inosine can be used as medical intermediates of various antiviral drugs, and guanosine such as acyclovir, ribavirin, sodium guanosine triphosphate and the like are used as synthetic raw materials. Inosine is an important precursor of inosinic acid, and inosinic acid is useful as a precursor for the synthesis of Adenosine Monophosphate (AMP) and guanylic acid (GMP), and is suitable for leukopenia, thrombocytopenia, various heart diseases, acute and chronic hepatitis, liver cirrhosis, etc. due to various causes, as well as central retinitis, optic atrophy, etc.

Currently, microbial fermentation is the main method for producing nucleosides, and the main microorganisms used include bacillus subtilis, bacillus amyloliquefaciens, bacillus pumilus and the like. In the breeding and transformation process of the growing strains, the nucleoside high-yield strains are directionally bred by using ultraviolet mutagenesis and diethyl sulfate mutagenesis breeding; or according to the metabolic path and the regulation mechanism of nucleotide in the bacteria, the genetic background and the characteristics of the strain are deeply known, and the strain is purposefully transformed by a metabolic engineering means to obtain a production strain with excellent properties and high nucleoside yield. However, the fermentation performance of the nucleoside strains is still poor at present, the conversion rate of the nucleoside is still low, and the requirements of large-scale industrial production cannot be met.

Disclosure of Invention

The first objective of the invention is to provide a phosphoglycerate kinase mutant, a pyrimidine-specific carbamyl phosphate synthase mutant and application thereof.

The second object of the present invention is to provide a recombinant microorganism producing a nucleoside or a derivative thereof, a method for constructing the same, and use thereof.

It is a third object of the present invention to provide a method for the fermentative production of a nucleoside or a derivative thereof.

Specifically, the invention provides the following technical scheme:

the present invention provides a protein mutant which is a phosphoglycerate kinase mutant and/or a pyrimidine-specific carbamoyl phosphate synthase mutant, the phosphoglycerate kinase mutant containing a mutation in which valine at position 31 is substituted with an amino acid other than valine using Bacillus subtilis wild-type phosphoglycerate kinase as a reference sequence, the pyrimidine-specific carbamoyl phosphate synthase mutant containing a mutation in which serine at position 160 is substituted with an amino acid other than serine using Bacillus subtilis wild-type pyrimidine-specific carbamoyl phosphate synthase as a reference sequence.

The protein mutants described in the present invention may be phosphoglycerate kinase mutants, pyrimidine-specific carbamoyl phosphate synthase mutants, or a combination of both.

In the present invention, phosphoglycerate kinase is encoded by the pgk gene and catalyzes the production of 3-phosphoglycerate from 1, 3-diphosphoglycerate to produce 1 molecule of ATP. The phosphoglycerate kinase mutant is obtained by modifying phosphoglycerate kinase, and can effectively improve the nucleoside synthesis capacity of microorganisms.

Pyrimidine-specific carbamyl phosphate synthase is encoded by the pyrAB gene and catalyzed by NH ₃ 、CO ₂ And synthesizing the carbamyl phosphate with 2 molecules of ATP. The invention obtains the pyrimidine specific carbamyl phosphate synthase mutant by modifying the pyrimidine specific carbamyl phosphate synthase, and the mutant can effectively improve the nucleoside synthesis capability of microorganisms.

Preferably, the wild-type phosphoglycerate kinase of Bacillus subtilis is used as a reference sequence, and the phosphoglycerate kinase mutant contains a mutation for replacing valine at position 31 by isoleucine, leucine or alanine. Using Bacillus subtilis wild-type pyrimidine-specific carbamoyl phosphate synthase as a reference sequence, the pyrimidine-specific carbamoyl phosphate synthase mutant contains a mutation replacing serine at position 160 with isoleucine, leucine or valine.

Specifically, the phosphoglycerate kinase mutant has an amino acid shown in any one of SEQ ID NO. 1-3. The pyrimidine-specific carbamoyl phosphate synthase mutant has an amino acid represented by any one of SEQ ID No. 7-9.

It will be understood by those skilled in the art that addition of a tag protein to the N-terminus or C-terminus of the mutant sequence of the above protein or fusion of the tag protein with other proteins to form a fusion protein is also within the scope of the present invention without altering the activity of the above mutant protein itself.

The invention discovers that the phosphoglycerate kinase mutant and the pyrimidine-specific carbamoyl phosphate synthase mutant can obviously enhance the synthesis of nucleoside or derivatives thereof in microorganisms when being used independently, thereby improving the yield and the conversion rate of the nucleoside or the derivatives thereof. The phosphoglycerate kinase mutant and the pyrimidine-specific carbamyl phosphate synthase mutant have better combined use effect, and the yield and the conversion rate of nucleoside or derivatives thereof can be further improved on the basis of single use of each mutant. In addition, the phosphoglycerate kinase mutant and the pyrimidine-specific carbamyl phosphate synthase mutant can better ensure the growth characteristics of microorganisms.

The invention also provides a gene for coding the protein mutant.

Based on the amino acid sequences of the protein mutants provided above, the skilled person is able to obtain the sequences of the nucleic acids encoding them. Based on the degeneracy of the codon, more than one nucleic acid sequence encoding the above amino acid sequences is included in the scope of the present invention, and all nucleic acids encoding the above protein mutants are included in the scope of the present invention.

As an embodiment of the present invention, the nucleotide sequence of the gene encoding a phosphoglycerate kinase mutant is represented by any one of SEQ ID Nos. 4 to 6. The nucleotide sequence of the gene coding the pyrimidine-specific carbamoyl phosphate synthase mutant is shown in any one of SEQ ID NO. 10-12.

The invention also provides a biological material containing the gene, wherein the biological material is recombinant DNA, a vector or a host cell.

Wherein the recombinant DNA includes a recombinant DNA obtained by linking an element for driving transcription and expression of the gene to the upstream or downstream of the gene.

The vector may be an expression vector or a cloning vector, including but not limited to a plasmid vector, a phage vector, a transposon, etc.

The host cell is a microbial cell.

Based on the functions of the protein mutant, the invention provides any one of the following applications of the protein mutant, the coding gene thereof or the biological material containing the coding gene thereof:

(1) Use in the fermentative production of nucleosides or derivatives thereof;

(2) Use in the construction of a strain producing a nucleoside or a derivative thereof;

(3) Use in increasing the yield and/or conversion of a nucleoside or derivative thereof.

In the present invention, the nucleoside is preferably a purine nucleoside, and more preferably adenosine, inosine, or guanosine.

In the present invention, the nucleoside derivatives are synthesized from nucleosides as precursors, including but not limited to adenine, adenylic acid, inosinic acid, guanine, guanylic acid, hypoxanthine, diacetylguanine, riboflavin, and the like.

It will be appreciated by those skilled in the art that where the nucleoside-synthesizing ability of a microorganism is enhanced, downstream nucleoside-precursor products will likewise have enhanced synthesizing ability due to enhanced supply of their precursors.

The present invention also provides a recombinant microorganism in which the expression level and/or the enzymatic activity of one or two enzymes selected from the group consisting of phosphoglycerate kinase and pyrimidine-specific carbamoyl phosphate synthase is reduced.

Specifically, the expression and/or enzyme activity reduction can be realized by one or more of the following (1) and (2) in combination:

(1) Insertion, deletion or substitution of one or more bases into a gene encoding phosphoglycerate kinase and/or pyrimidine-specific carbamoyl phosphate synthase such that the expression and/or enzymatic activity of phosphoglycerate kinase and/or pyrimidine-specific carbamoyl phosphate synthase is reduced;

(2) Replacing a transcriptional or translational regulatory element of a gene encoding phosphoglycerate kinase and/or a pyrimidine-specific carbamoyl phosphate synthase with a less active regulatory element such that expression and/or enzymatic activity of phosphoglycerate kinase and/or a pyrimidine-specific carbamoyl phosphate synthase is reduced.

Preferably, the recombinant microorganism expresses one or both of the phosphoglycerate kinase mutant and the pyrimidine-specific carbamoyl phosphate synthase mutant, and does not express one or both enzymes selected from the group consisting of phosphoglycerate kinase and pyrimidine-specific carbamoyl phosphate synthase possessed by its original strain.

Specifically, the present invention provides, as one embodiment of the present invention, a recombinant microorganism which expresses the phosphoglycerate kinase mutant and does not express phosphoglycerate kinase possessed by the original strain.

As another embodiment of the present invention, the present invention provides a recombinant microorganism which expresses the pyrimidine-specific carbamoyl phosphate synthase mutant and does not express pyrimidine-specific carbamoyl phosphate synthase possessed by its original strain.

As another embodiment of the present invention, the present invention provides a recombinant microorganism expressing the phosphoglycerate kinase mutant and the pyrimidine-specific carbamoyl phosphate synthase mutant, and not expressing phosphoglycerate kinase and pyrimidine-specific carbamoyl phosphate synthase possessed by its original strain.

Preferably, in said recombinant microorganism, the genes encoding phosphoglycerate kinase and/or pyrimidine-specific carbamoyl phosphate synthase are replaced by genes encoding said protein mutants.

In the present invention, the recombinant microorganism is preferably a bacterium belonging to the genus Bacillus, more preferably Bacillus subtilis, bacillus amyloliquefaciens or Bacillus pumilus.

In the present invention, the starting strain is preferably a strain capable of accumulating nucleosides.

Preferably, the starting strain contains any one of the following mutations:

(1) The 116 th proline of the glycinamide nucleotide synthetase purD is mutated into leucine;

(2) Alanine 65 to aspartic acid of transcription regulator purR;

(3) Glycine 279 of the inosinic acid dehydrogenase gene guaB was mutated to arginine.

The starting strain also includes the following mutations: the upp gene is inactivated.

As an embodiment of the invention, the starting strain is a strain obtained by knocking out upp gene in Bacillus subtilis 168 and mutating proline 116 of glycinamide nucleotide synthetase encoding gene purD on chromosome to leucine.

The recombinant microorganism provided by the invention has remarkably enhanced nucleoside synthesis capability and can efficiently produce nucleoside or derivatives thereof.

The invention also provides a construction method of the recombinant microorganism, which comprises the following steps: inserting, deleting or substituting one or more bases into a gene encoding phosphoglycerate kinase and/or pyrimidine-specific carbamoyl phosphate synthase in the starting strain so that the enzymatic activity of phosphoglycerate kinase and/or pyrimidine-specific carbamoyl phosphate synthase is decreased;

or replacing the transcriptional and/or translational regulatory elements of the gene encoding phosphoglycerate kinase and/or pyrimidine-specific carbamoyl phosphate synthase in the starting strain with less active regulatory elements, such that the expression level of phosphoglycerate kinase and/or pyrimidine-specific carbamoyl phosphate synthase is reduced;

preferably, the method comprises: and (2) mutating genes for coding phosphoglycerate kinase and/or pyrimidine-specific carbamoyl phosphate synthase in the original strain into coding genes of the phosphoglycerate kinase mutant and the pyrimidine-specific carbamoyl phosphate synthase mutant.

The invention also provides any one of the following applications of the recombinant microorganism:

(1) Use in the fermentative production of nucleosides or derivatives thereof;

(2) Use in the construction of a strain producing a nucleoside or a derivative thereof;

(3) Use in increasing the yield and/or conversion of a nucleoside or derivative thereof.

The present invention provides a method for the fermentative production of a nucleoside or a derivative thereof, which comprises the step of culturing the recombinant microorganism.

Specifically, the method for producing a nucleoside or a derivative thereof by fermentation comprises: activating the recombinant microorganism, inoculating the activated thallus into a seed culture medium for seed culture, then inoculating a seed solution into a fermentation culture medium for fermentation, and separating the nucleoside or the derivative thereof in the fermentation product.

Preferably, the fermentation medium comprises the following components: 50-70g/L of glucose, 2-5g/L of yeast powder, 2-4g/L of monopotassium phosphate, 20-30g/L of ammonium sulfate, 0.005-0.02g/L of manganese sulfate, 4-6g/L of magnesium sulfate, 5-15g/L of monosodium glutamate, 12-18g/L of corn steep liquor dry powder and 7.0-7.2 of pH.

Preferably, the seed culture medium comprises the following components: 15-25g/L of glucose, 3-7g/L of yeast powder, 3-7g/L of corn steep liquor dry powder, 2-4g/L of monopotassium phosphate, 0.4-0.6g/L of magnesium sulfate, 0.01-0.03g/L of ferrous sulfate, 0.005-0.02g/L of manganese sulfate and 7.0-7.2 of pH.

The invention has the beneficial effects that: the phosphoglycerate kinase mutant and the pyrimidine-specific carbamyl phosphate synthase mutant are obtained by modifying phosphoglycerate kinase and pyrimidine-specific carbamyl phosphate synthase, and the protein mutant can obviously improve the nucleoside synthesis capacity of microorganisms and effectively promote the accumulation of nucleoside or derivatives thereof. The invention further provides a recombinant microorganism expressing the mutant, the recombinant microorganism can efficiently produce nucleoside or derivatives thereof, and the experimental verification proves that the yield and the conversion rate of adenosine and inosine are both obviously improved.

Detailed Description

The following examples are intended to illustrate the invention, but are not intended to limit the scope of the invention.

The names and sequences of the primers referred to in the following examples are shown in Table 1.

TABLE 1 primer sequences

Primer name	Primer sequences
		pgk V31I -UP-1F	gtcagcaaggccgaatttttc
pgk V31I -UP-1R	aacgttccaatgaaagacggggaaAtaacagacgatacacgtatccgtgctg
		pgk V31I -DN-2F	cacggatacgtgtatcgtctgttaTttccccgtctttcattggaacgttaaagt
pgk V31I -DN-2R	cgtttgcaaaagtacttaacga
		pgk V31L -UP-1R	aacgttccaatgaaagacggggaaCtaacagacgatacacgtatccgtgctg
pgk V31L -DN-2F	cacggatacgtgtatcgtctgttaGttccccgtctttcattggaacgttaaagt
		pgk V31A -UP-1R	acgttccaatgaaagacggggaagCaacagacgatacacgtatccgtgctgc
pgk V31A -DN-2F	gcacggatacgtgtatcgtctgttGcttccccgtctttcattggaacgttaaag
		pyrAB S160I -UP-1F	ctgaacaaacggaaatgtgac
pyrAB S160I -UP-1R	acaatgacagggaatccaatttgaAtgacgaatttttctgcttcttcaaggg
		pyrAB S160I -DN-2F	ttgaagaagcagaaaaattcgtcaTtcaaattggattccctgtcattgtcc
pyrAB S160I -DN-2R	aactgtacgattccgaacagc
		pyrAB S160L -UP-1R	acaatgacagggaatccaatttgaAGgacgaatttttctgcttcttcaaggg
pyrAB S160L -DN-2F	cttgaagaagcagaaaaattcgtcCTtcaaattggattccctgtcattgtcc
		pyrAB S160V -UP-1R	ggacaatgacagggaatccaatttgaACgacgaatttttctgcttcttcaag
pyrAB S160V -DN-2F	cttgaagaagcagaaaaattcgtcGTtcaaattggattccctgtcattgtcc

The starting strain used in the following examples is b.subtilis A1 (hereinafter referred to as A1), in which upp gene is knocked out and proline 116 of a gene purD encoding glycinamide nucleotide synthetase in the chromosome is mutated to leucine in b.subtilis 168. The strain can be constructed by adopting the conventional technical means in the field, and the specific construction method can be seen in Chinese patent application CN201910599510.8.

Example 1: construction of phosphoglycerate kinase mutant Strain pgk ^V31I

Using bacterial strain B.subtilis A1 genome as template and primer pgk ^V31I -UP-1F/pgk ^V31I -UP-1R and pgk ^V31I -DN-2F/pgk ^V31I DN-2R, and Phusion Ultrafidelity polymerase (New England BioLabs) amplified 2 fragments. Using primer pgk ^V31I -UP-1F/pgk ^V31I And (3) fusing the 2 segments by using DN-2R to obtain a recombinant segment ORF region nucleotide sequence shown as SEQ ID NO.4 and an amino acid sequence shown as SEQ ID NO. 1. Will make pgk ^V31I Fragments and pKSU plasmid (pKSU plasmid is given by professor Zhaofuran, university of south China, see A market gene replacement method for B. Amyloliquefaciens LL3 and its use in gene reduction and improvement [ J ] of poly-gamma-glutamic acid reduction]Applied Microbiology and Biotechnology,2014, 98 (21): 8963-8973.Zhang W, gao W, feng J, et al DOI 10.1007/s 00253-014-5824-2) to obtain recombinant plasmid pKSU-pgk after assembly, transformation, etc. ^V31I . Transforming into B.subtilis A1 strain, screening transformants by using LB plate containing 2.5 mu g/mL chloramphenicol at 30 ℃, inoculating the obtained transformants into 5mL LB liquid culture medium, culturing at 42 ℃ and 200rpm for 12h for generation, diluting and coating the mixture on LB plate containing 5 mu g/mL chloramphenicol to obtain primary recombinants; inoculating the primary recombinant to 5ml LB liquid culture medium, culturing at 42 deg.C and 200rpm for 12h and transferring one generation, diluting and coating LB plate containing 0.8 μ M5-FU to screen secondary recombinant, and screening to obtain pgk ^V31I The point mutant strain is named as B.subtilis A747 and is hereinafter referred to as V31I.

Example 2: construction of phosphoglycerate kinase mutant Strain pgk ^V31L And pgk ^V31A

The specific construction procedure was as in example 1, phosphoglycerate kinase mutant pgk ^V31L The primers used were pgk ^V31I -UP-1F/pgk ^V31L -UP-1R and pgk ^V31L -DN-2F/pgk ^V31I DN-2R, and the nucleotide sequence of the ORF region of the obtained recombinant fragment is shown as SEQ ID NO.5, and the amino acid sequence is shown as SEQ ID NO. 2. The plasmid obtained by construction is pKSU-pgk ^V31L The obtained strain was named b.subtilis a748, hereinafter referred to as V31L.

Phosphoglycerate kinase mutant strain pgk ^V31A The primer used was pgk ^V31I -UP-1F/pgk ^V31A -UP-1R and pgk ^V31A -DN-2F/pgk ^V31I DN-2R, and the nucleotide sequence of the ORF region of the obtained recombinant fragment is shown as SEQ ID NO.6, and the amino acid sequence is shown as SEQ ID NO. 3. The plasmid obtained by construction is pKSU-pgk ^V31A The obtained strain was named b.subtilis a749, hereinafter referred to as V31A.

Example 3: construction of pyrimidine-specific carbamoyl phosphate synthase mutant Strain pyrAB ^S160L

The procedure was as in example 1, but the pyrimidine-specific carbamoyl phosphate synthase mutant strain pyrAB ^S160L The primer used was pyrAB ^S160I -UP-1F/pyrAB ^S160L -UP-1R and pyrAB ^S160L -DN-2F/pyrAB ^S160I DN-2R, and the nucleotide sequence of the ORF region of the obtained recombinant fragment is shown in SEQ ID NO.10, and the amino acid sequence is shown in SEQ ID NO.7. The plasmid obtained by construction is pKSU-pyrAB ^S160L The obtained strain was named b.subtilis a711 and hereinafter referred to as S160L. Example 4: construction of pyrimidine-specific carbamoyl phosphate synthase mutant Strain pyrAB ^S160V And pyrAB ^S160I

Pyrimidine-specific carbamoylphosphate synthase mutant strain pyrAB ^S160V The primer used was pyrAB ^S160I -UP-1F/pyrAB ^S160V -UP-1R and pyrAB ^S160V -DN-2F/pyrAB ^S160I DN-2R, and the nucleotide sequence of the ORF region of the obtained recombinant fragment is shown as SEQ ID NO.11, and the amino acid sequence is shown as SEQ ID NO. 8. The plasmid obtained by construction is pKSU-pgk ^V31V The obtained strain was named b.subtilis a712, hereinafter referred to as S160V.

Pyrimidine-specific carbamoylphosphate synthase mutant strain pyrAB ^S160I The primer used was pyrAB ^S160I -UP-1F/pyrAB ^S160I -UP-1R and pyrAB ^S160I -DN-2F/pyrAB ^S160I DN-2R, and the nucleotide sequence of the ORF region of the obtained recombinant fragment is shown as SEQ ID NO.12, and the amino acid sequence is shown as SEQ ID NO. 9. The plasmid obtained by construction is pKSU-pgk ^V31I The obtained strain was named b.subtilis a713, hereinafter referred to as S160I.

Example 5: construction of phosphoglycerate kinase and pyrimidine-specific carbamoyl phosphate synthase double mutant strains

In phosphoglycerate kinase mutant strain B. Subtilis A747 (pgk) ^V31I Mutation) by the addition of a pyrimidine-specific carbamoyl phosphate synthase mutation pyrAB ^S160L 、pyrAB ^S160V 、pyrAB ^S160I 。

The specific construction process was the same as in example 3-4, using the genome of strain B.subtilis A747 as the template, and the constructed strains were named as B.subtilis A751, B.subtilis A752, and B.subtilis A753, hereinafter referred to as V31I-S160L, V31I-S160V, and V31I-S160I, respectively.

Example 6: productivity test of engineered strains

The fermentation experiments were performed on the engineered strains constructed in examples 1-5, and the productivity thereof was examined, specifically as follows:

1. culture medium:

(1) Seed culture medium formula (g/L): 20 portions of glucose, 5 portions of yeast powder, 5 portions of corn steep liquor dry powder, 3 portions of monopotassium phosphate, 0.5 portion of magnesium sulfate, 0.02 portion of ferrous sulfate, 0.01 portion of manganese sulfate, 7.0-7.2 portions of pH value, and 20min of sterilization at 121 ℃.

(2) Fermentation medium formula (g/L): 60 portions of glucose, 3.5 portions of yeast powder, 3 portions of monopotassium phosphate, 25 portions of ammonium sulfate, 0.01 portion of manganese sulfate, 5 portions of magnesium sulfate, 10 portions of monosodium glutamate, 15 portions of corn steep liquor dry powder and 25 portions of calcium carbonate, wherein the pH value is 7.0-7.2, and the sterilization is carried out for 20min at the temperature of 121 ℃.

2. Culture method

(1) Marking a three-region strain on an LB flat plate, and culturing overnight at 37 ℃;

(2) Selecting a single colony, inoculating the single colony into 30mL of seed culture medium, culturing at 110rpm and 36 ℃ for 7-8 h;

(3) Transferring the mixture into 30ml of fermentation medium according to the inoculation amount of 10%, rotating a shaking table at 120rpm, and culturing for 36 hours at 36 ℃.

3. Detection and results

Nucleoside in the fermentation liquid was detected by High Performance Liquid Chromatography (HPLC), the OD of the fermented cell was detected by spectrophotometer at 562nm wavelength, substrate conversion was detected by in vitro enzyme reaction in combination with HPLC and enzyme activity was calculated, and the results are shown in table 2.

TABLE 2 evaluation results of shake flask fermentation productivity of engineering bacteria (triple repeat mean)

In table 2, indicates a significant difference from the results of the starting strain A1.

From the above results, phosphoglycerate kinase mutation (pgk) was found ^V31I 、pgk ^V31L And pgk ^V31A ) Pyrimidine-specific carbamoyl phosphate synthase mutation (pyrAB) ^S160L 、pyrAB ^S160V And pyrAB ^S160I ) The method has a promoting effect on the yield increase of adenosine and inosine, and the mutation superposition effect of the two enzymes is more prominent, the yield of adenosine is increased from 1.2g/L to 3.1g/L, and the yield of inosine is increased from 0.4g/L to 1.3g/L.

Phosphoglycerate kinase mutant strain pgk ^V31I Compared with the original strain A1, the adenosine yield is improved to 2.1g/L from 1.2g/L, and the inosine yield is improved to 0.8g/L from 0.4 g/L. When the 31 st amino acid of phosphoglycerate kinase is mutated from valine (V) to isoleucine (I), leucine (L) or alanine (A), the yield of adenosine and inosine is improved, and the effect is the best when valine is mutated to isoleucine.

Pyrimidine-specific carbamoylphosphate synthase mutant strain pyrAB ^S160L Compared with the original strain A1, the adenosine yield is improved to 2.5g/L from 1.2g/L, and the inosine yield is improved to 0.9g/L from 0.4 g/L. When the 160 th amino acid of pyrimidine-specific carbamyl phosphate synthase is mutated from serine (S) to isoleucine (I), leucine (L) or valine (V), the yield of adenosine and inosine is greatly improved, which indicates that the mutation site is favorable for the production of adenosine and inosine.

Phosphoglycerate kinase mutation pgk ^V31I Mutation with pyrimidine-specific carbamoyl phosphate synthase (pyrAB) ^S160L 、pyrAB ^S160V Or pyrAB ^S160I ) After superposition, the effect of improving the yield of adenosine and inosine is more prominent, and the best production effect is as follows: the adenosine yield is improved from 1.2g/L to 3.1g/L, and the inosine yield is improved from 0.4g/L to 1.3g/L.

The construction of the strain of the present invention, the order of the steps is not limited, and those skilled in the art can achieve the object of the present invention according to the disclosure of the present invention, all of which belong to the protection scope of the present invention.

The strain numbers such as V31I, S160L and V31I-S160L in the present invention are for convenience of description and should not be construed as limiting the present invention. The mutant pgk containing the phosphoglycerate kinase of the bacillus subtilis constructed by the method ^V31I 、pgk ^V31L And pgk ^V31A Pyrimidine-specific carbamoyl phosphate synthase mutant pyrAB ^S160L 、pyrAB ^S160V And pyrAB ^S160I The engineering bacteria include but are not limited to adenosine and inosine.

Although the invention has been described in detail hereinabove with respect to a general description and specific embodiments thereof, it will be apparent to those skilled in the art that modifications or improvements may be made thereto based on the invention. Accordingly, it is intended that all such modifications and alterations be included within the scope of this invention as defined in the appended claims.

Sequence listing

<110> plum blossom (Shanghai) Biotechnology Limited

<120> protein mutant, recombinant microorganism for producing nucleoside and use thereof

<130> KHP211118909.2

<160> 28

<170> SIPOSequenceListing 1.0

<210> 1

<211> 394

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 1

Met Asn Lys Lys Thr Leu Lys Asp Ile Asp Val Lys Gly Lys Val Val

1 5 10 15

Phe Cys Arg Val Asp Phe Asn Val Pro Met Lys Asp Gly Glu Ile Thr

20 25 30

Asp Asp Thr Arg Ile Arg Ala Ala Leu Pro Thr Ile Lys His Leu Ala

35 40 45

Asp Gln Gly Ala Lys Val Leu Leu Ala Ser His Leu Gly Arg Pro Lys

50 55 60

Gly Glu Val Val Glu Glu Leu Arg Leu Thr Pro Val Ala Ala Arg Leu

65 70 75 80

Gly Glu Leu Leu Gly Lys Glu Val Lys Lys Ala Asp Glu Ala Tyr Gly

85 90 95

Asp Ala Val Lys Ala Gln Ile Ser Glu Met Lys Asp Gly Asp Val Leu

100 105 110

Val Leu Glu Asn Val Arg Phe Tyr Pro Gly Glu Glu Lys Asn Asp Pro

115 120 125

Glu Leu Ala Lys Ala Phe Ala Glu Leu Ala Asp Val Tyr Val Asn Asp

130 135 140

Ala Phe Gly Ala Ala His Arg Ala His Ala Ser Thr Ala Gly Ile Ala

145 150 155 160

Glu His Leu Pro Ala Val Ala Gly Phe Leu Met Glu Lys Glu Leu Asp

165 170 175

Val Leu Gly Lys Ala Val Ser Asn Pro Asp Arg Pro Phe Thr Ala Ile

180 185 190

Ile Gly Gly Ala Lys Val Lys Asp Lys Ile Gly Val Ile Glu Ser Leu

195 200 205

Leu Asp Lys Val Asp Asn Leu Ile Ile Gly Gly Gly Leu Ala Tyr Thr

210 215 220

Phe Val Lys Ala Leu Gly Tyr Glu Val Gly Lys Ser Leu Leu Glu Glu

225 230 235 240

Asp Lys Ile Glu Leu Ala Lys Ser Phe Met Asp Arg Ala Lys Glu Lys

245 250 255

Gly Val Asn Phe Tyr Met Pro Glu Asp Val Leu Val Ala Asp Asp Phe

260 265 270

Ser Asn Asp Ala Asn Val Lys Ile Val Pro Ile Ser Glu Ile Pro Ser

275 280 285

Asp Leu Glu Ala Ile Asp Ile Gly Thr Lys Thr Arg Glu Thr Tyr Ala

290 295 300

Asp Val Ile Lys Asn Ser Lys Leu Val Val Trp Asn Gly Pro Met Gly

305 310 315 320

Val Phe Glu Ile Asp Leu Phe Ala Gln Gly Thr Lys Ala Val Ala Glu

325 330 335

Ala Leu Ala Glu Ala Lys Asp Thr Tyr Ser Val Ile Gly Gly Gly Asp

340 345 350

Ser Ala Ala Ala Val Glu Lys Phe Gly Leu Ala Asp Lys Met Ser His

355 360 365

Ile Ser Thr Gly Gly Gly Ala Ser Leu Glu Phe Met Glu Gly Lys Glu

370 375 380

Leu Pro Gly Val Ala Ala Leu Asn Asp Lys

385 390

<210> 2

<211> 394

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 2

Met Asn Lys Lys Thr Leu Lys Asp Ile Asp Val Lys Gly Lys Val Val

1 5 10 15

Phe Cys Arg Val Asp Phe Asn Val Pro Met Lys Asp Gly Glu Leu Thr

20 25 30

Asp Asp Thr Arg Ile Arg Ala Ala Leu Pro Thr Ile Lys His Leu Ala

35 40 45

Asp Gln Gly Ala Lys Val Leu Leu Ala Ser His Leu Gly Arg Pro Lys

50 55 60

Gly Glu Val Val Glu Glu Leu Arg Leu Thr Pro Val Ala Ala Arg Leu

65 70 75 80

Gly Glu Leu Leu Gly Lys Glu Val Lys Lys Ala Asp Glu Ala Tyr Gly

85 90 95

Asp Ala Val Lys Ala Gln Ile Ser Glu Met Lys Asp Gly Asp Val Leu

100 105 110

Val Leu Glu Asn Val Arg Phe Tyr Pro Gly Glu Glu Lys Asn Asp Pro

115 120 125

Glu Leu Ala Lys Ala Phe Ala Glu Leu Ala Asp Val Tyr Val Asn Asp

130 135 140

Ala Phe Gly Ala Ala His Arg Ala His Ala Ser Thr Ala Gly Ile Ala

145 150 155 160

Glu His Leu Pro Ala Val Ala Gly Phe Leu Met Glu Lys Glu Leu Asp

165 170 175

Val Leu Gly Lys Ala Val Ser Asn Pro Asp Arg Pro Phe Thr Ala Ile

180 185 190

Ile Gly Gly Ala Lys Val Lys Asp Lys Ile Gly Val Ile Glu Ser Leu

195 200 205

Leu Asp Lys Val Asp Asn Leu Ile Ile Gly Gly Gly Leu Ala Tyr Thr

210 215 220

Phe Val Lys Ala Leu Gly Tyr Glu Val Gly Lys Ser Leu Leu Glu Glu

225 230 235 240

Asp Lys Ile Glu Leu Ala Lys Ser Phe Met Asp Arg Ala Lys Glu Lys

245 250 255

Gly Val Asn Phe Tyr Met Pro Glu Asp Val Leu Val Ala Asp Asp Phe

260 265 270

Ser Asn Asp Ala Asn Val Lys Ile Val Pro Ile Ser Glu Ile Pro Ser

275 280 285

Asp Leu Glu Ala Ile Asp Ile Gly Thr Lys Thr Arg Glu Thr Tyr Ala

290 295 300

Asp Val Ile Lys Asn Ser Lys Leu Val Val Trp Asn Gly Pro Met Gly

305 310 315 320

Val Phe Glu Ile Asp Leu Phe Ala Gln Gly Thr Lys Ala Val Ala Glu

325 330 335

Ala Leu Ala Glu Ala Lys Asp Thr Tyr Ser Val Ile Gly Gly Gly Asp

340 345 350

Ser Ala Ala Ala Val Glu Lys Phe Gly Leu Ala Asp Lys Met Ser His

355 360 365

Ile Ser Thr Gly Gly Gly Ala Ser Leu Glu Phe Met Glu Gly Lys Glu

370 375 380

Leu Pro Gly Val Ala Ala Leu Asn Asp Lys

385 390

<210> 3

<211> 394

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 3

Met Asn Lys Lys Thr Leu Lys Asp Ile Asp Val Lys Gly Lys Val Val

1 5 10 15

Phe Cys Arg Val Asp Phe Asn Val Pro Met Lys Asp Gly Glu Ala Thr

20 25 30

Asp Asp Thr Arg Ile Arg Ala Ala Leu Pro Thr Ile Lys His Leu Ala

35 40 45

Asp Gln Gly Ala Lys Val Leu Leu Ala Ser His Leu Gly Arg Pro Lys

50 55 60

Gly Glu Val Val Glu Glu Leu Arg Leu Thr Pro Val Ala Ala Arg Leu

65 70 75 80

Gly Glu Leu Leu Gly Lys Glu Val Lys Lys Ala Asp Glu Ala Tyr Gly

85 90 95

Asp Ala Val Lys Ala Gln Ile Ser Glu Met Lys Asp Gly Asp Val Leu

100 105 110

Val Leu Glu Asn Val Arg Phe Tyr Pro Gly Glu Glu Lys Asn Asp Pro

115 120 125

Glu Leu Ala Lys Ala Phe Ala Glu Leu Ala Asp Val Tyr Val Asn Asp

130 135 140

Ala Phe Gly Ala Ala His Arg Ala His Ala Ser Thr Ala Gly Ile Ala

145 150 155 160

Glu His Leu Pro Ala Val Ala Gly Phe Leu Met Glu Lys Glu Leu Asp

165 170 175

Val Leu Gly Lys Ala Val Ser Asn Pro Asp Arg Pro Phe Thr Ala Ile

180 185 190

Ile Gly Gly Ala Lys Val Lys Asp Lys Ile Gly Val Ile Glu Ser Leu

195 200 205

Leu Asp Lys Val Asp Asn Leu Ile Ile Gly Gly Gly Leu Ala Tyr Thr

210 215 220

Phe Val Lys Ala Leu Gly Tyr Glu Val Gly Lys Ser Leu Leu Glu Glu

225 230 235 240

Asp Lys Ile Glu Leu Ala Lys Ser Phe Met Asp Arg Ala Lys Glu Lys

245 250 255

Gly Val Asn Phe Tyr Met Pro Glu Asp Val Leu Val Ala Asp Asp Phe

260 265 270

Ser Asn Asp Ala Asn Val Lys Ile Val Pro Ile Ser Glu Ile Pro Ser

275 280 285

Asp Leu Glu Ala Ile Asp Ile Gly Thr Lys Thr Arg Glu Thr Tyr Ala

290 295 300

Asp Val Ile Lys Asn Ser Lys Leu Val Val Trp Asn Gly Pro Met Gly

305 310 315 320

Val Phe Glu Ile Asp Leu Phe Ala Gln Gly Thr Lys Ala Val Ala Glu

325 330 335

Ala Leu Ala Glu Ala Lys Asp Thr Tyr Ser Val Ile Gly Gly Gly Asp

340 345 350

Ser Ala Ala Ala Val Glu Lys Phe Gly Leu Ala Asp Lys Met Ser His

355 360 365

Ile Ser Thr Gly Gly Gly Ala Ser Leu Glu Phe Met Glu Gly Lys Glu

370 375 380

Leu Pro Gly Val Ala Ala Leu Asn Asp Lys

385 390

<210> 4

<211> 1185

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

atgaataaaa aaactctcaa agacatcgac gtaaaaggca aagttgtatt ctgccgcgtt 60

gactttaacg ttccaatgaa agacggggaa ataacagacg atacacgtat ccgtgctgcg 120

cttccaacaa tcaaacacct tgcagaccaa ggcgcaaaag tccttcttgc gagccactta 180

ggccgcccga aaggcgaagt ggttgaggag cttcgtttaa ctcctgtcgc tgcacgtctc 240

ggcgaactgc ttggcaaaga agtgaaaaaa gcggatgaag catacggcga tgctgtaaaa 300

gcacaaattt ctgagatgaa ggacggagac gttcttgtat tggaaaacgt acgtttctat 360

cctggtgaag agaaaaatga tcctgagctt gcaaaagcat ttgctgagct tgcagatgta 420

tatgtaaatg acgcattcgg tgctgcccac cgtgctcacg catctacagc tggaattgcc 480

gagcatctgc cagcagttgc aggtttctta atggaaaaag agcttgatgt acttggaaaa 540

gcggtttcca atcctgaccg cccgttcaca gcgatcatcg gcggagcgaa agtaaaagac 600

aaaatcggtg taatcgaaag tcttcttgat aaagtagaca acctgatcat cggcggaggt 660

cttgcttata ctttcgtaaa agcgcttggc tatgaagtcg ggaaatctct tcttgaagag 720

gataaaatcg agcttgcgaa atcatttatg gaccgcgcta aagaaaaagg cgttaacttc 780

tacatgcctg aagatgtact cgttgcagat gatttctcta acgatgcaaa cgtgaaaatt 840

gtgccgatct ctgaaatccc tagtgattta gaagcaatcg acattggtac gaaaacacgc 900

gaaacgtatg ctgacgtcat caaaaacagc aaacttgtcg tgtggaacgg accaatgggc 960

gtattcgaaa tcgacttgtt cgctcaagga acaaaagcgg ttgcggaagc attggcagag 1020

gcgaaagata catactctgt catcggcgga ggagactctg cggcagcggt tgaaaaattc 1080

ggccttgctg acaaaatgag ccacatctca acaggcggcg gcgcatccct tgagtttatg 1140

gaaggcaaag agcttccagg ggtagctgca ctgaacgata aataa 1185

<210> 5

<211> 1185

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

atgaataaaa aaactctcaa agacatcgac gtaaaaggca aagttgtatt ctgccgcgtt 60

gactttaacg ttccaatgaa agacggggaa ctaacagacg atacacgtat ccgtgctgcg 120

cttccaacaa tcaaacacct tgcagaccaa ggcgcaaaag tccttcttgc gagccactta 180

ggccgcccga aaggcgaagt ggttgaggag cttcgtttaa ctcctgtcgc tgcacgtctc 240

ggcgaactgc ttggcaaaga agtgaaaaaa gcggatgaag catacggcga tgctgtaaaa 300

gcacaaattt ctgagatgaa ggacggagac gttcttgtat tggaaaacgt acgtttctat 360

cctggtgaag agaaaaatga tcctgagctt gcaaaagcat ttgctgagct tgcagatgta 420

tatgtaaatg acgcattcgg tgctgcccac cgtgctcacg catctacagc tggaattgcc 480

gagcatctgc cagcagttgc aggtttctta atggaaaaag agcttgatgt acttggaaaa 540

gcggtttcca atcctgaccg cccgttcaca gcgatcatcg gcggagcgaa agtaaaagac 600

aaaatcggtg taatcgaaag tcttcttgat aaagtagaca acctgatcat cggcggaggt 660

cttgcttata ctttcgtaaa agcgcttggc tatgaagtcg ggaaatctct tcttgaagag 720

gataaaatcg agcttgcgaa atcatttatg gaccgcgcta aagaaaaagg cgttaacttc 780

tacatgcctg aagatgtact cgttgcagat gatttctcta acgatgcaaa cgtgaaaatt 840

gtgccgatct ctgaaatccc tagtgattta gaagcaatcg acattggtac gaaaacacgc 900

gaaacgtatg ctgacgtcat caaaaacagc aaacttgtcg tgtggaacgg accaatgggc 960

gtattcgaaa tcgacttgtt cgctcaagga acaaaagcgg ttgcggaagc attggcagag 1020

gcgaaagata catactctgt catcggcgga ggagactctg cggcagcggt tgaaaaattc 1080

ggccttgctg acaaaatgag ccacatctca acaggcggcg gcgcatccct tgagtttatg 1140

gaaggcaaag agcttccagg ggtagctgca ctgaacgata aataa 1185

<210> 6

<211> 1185

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

atgaataaaa aaactctcaa agacatcgac gtaaaaggca aagttgtatt ctgccgcgtt 60

gactttaacg ttccaatgaa agacggggaa gcaacagacg atacacgtat ccgtgctgcg 120

cttccaacaa tcaaacacct tgcagaccaa ggcgcaaaag tccttcttgc gagccactta 180

ggccgcccga aaggcgaagt ggttgaggag cttcgtttaa ctcctgtcgc tgcacgtctc 240

ggcgaactgc ttggcaaaga agtgaaaaaa gcggatgaag catacggcga tgctgtaaaa 300

gcacaaattt ctgagatgaa ggacggagac gttcttgtat tggaaaacgt acgtttctat 360

cctggtgaag agaaaaatga tcctgagctt gcaaaagcat ttgctgagct tgcagatgta 420

tatgtaaatg acgcattcgg tgctgcccac cgtgctcacg catctacagc tggaattgcc 480

gagcatctgc cagcagttgc aggtttctta atggaaaaag agcttgatgt acttggaaaa 540

gcggtttcca atcctgaccg cccgttcaca gcgatcatcg gcggagcgaa agtaaaagac 600

aaaatcggtg taatcgaaag tcttcttgat aaagtagaca acctgatcat cggcggaggt 660

cttgcttata ctttcgtaaa agcgcttggc tatgaagtcg ggaaatctct tcttgaagag 720

gataaaatcg agcttgcgaa atcatttatg gaccgcgcta aagaaaaagg cgttaacttc 780

tacatgcctg aagatgtact cgttgcagat gatttctcta acgatgcaaa cgtgaaaatt 840

gtgccgatct ctgaaatccc tagtgattta gaagcaatcg acattggtac gaaaacacgc 900

gaaacgtatg ctgacgtcat caaaaacagc aaacttgtcg tgtggaacgg accaatgggc 960

gtattcgaaa tcgacttgtt cgctcaagga acaaaagcgg ttgcggaagc attggcagag 1020

gcgaaagata catactctgt catcggcgga ggagactctg cggcagcggt tgaaaaattc 1080

ggccttgctg acaaaatgag ccacatctca acaggcggcg gcgcatccct tgagtttatg 1140

gaaggcaaag agcttccagg ggtagctgca ctgaacgata aataa 1185

<210> 7

<211> 1071

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 7

Met Pro Lys Arg Val Asp Ile Asn Lys Ile Leu Val Ile Gly Ser Gly

1 5 10 15

Pro Ile Ile Ile Gly Gln Ala Ala Glu Phe Asp Tyr Ala Gly Thr Gln

20 25 30

Ala Cys Leu Ala Leu Lys Glu Glu Gly Tyr Glu Val Ile Leu Val Asn

35 40 45

Ser Asn Pro Ala Thr Ile Met Thr Asp Thr Glu Met Ala Asp Arg Val

50 55 60

Tyr Ile Glu Pro Leu Thr Pro Glu Phe Leu Thr Arg Ile Ile Arg Lys

65 70 75 80

Glu Arg Pro Asp Ala Ile Leu Pro Thr Leu Gly Gly Gln Thr Gly Leu

85 90 95

Asn Leu Ala Val Glu Leu Ser Glu Arg Gly Val Leu Ala Glu Cys Gly

100 105 110

Val Glu Val Leu Gly Thr Lys Leu Ser Ala Ile Gln Gln Ala Glu Asp

115 120 125

Arg Asp Leu Phe Arg Thr Leu Met Asn Glu Leu Asn Glu Pro Val Pro

130 135 140

Glu Ser Glu Ile Ile His Ser Leu Glu Glu Ala Glu Lys Phe Val Leu

145 150 155 160

Gln Ile Gly Phe Pro Val Ile Val Arg Pro Ala Tyr Thr Leu Gly Gly

165 170 175

Thr Gly Gly Gly Ile Cys Ser Asn Glu Thr Glu Leu Lys Glu Ile Val

180 185 190

Glu Asn Gly Leu Lys Leu Ser Pro Val His Gln Cys Leu Leu Glu Lys

195 200 205

Ser Ile Ala Gly Tyr Lys Glu Ile Glu Tyr Glu Val Met Arg Asp Ser

210 215 220

Gln Asp His Ala Ile Val Val Cys Asn Met Glu Asn Ile Asp Pro Val

225 230 235 240

Gly Ile His Thr Gly Asp Ser Ile Val Val Ala Pro Ser Gln Thr Leu

245 250 255

Ser Asp Arg Glu Tyr Gln Leu Leu Arg Asn Val Ser Leu Lys Leu Ile

260 265 270

Arg Ala Leu Gly Ile Glu Gly Gly Cys Asn Val Gln Leu Ala Leu Asp

275 280 285

Pro Asp Ser Phe Gln Tyr Tyr Ile Ile Glu Val Asn Pro Arg Val Ser

290 295 300

Arg Ser Ser Ala Leu Ala Ser Lys Ala Thr Gly Tyr Pro Ile Ala Lys

305 310 315 320

Leu Ala Ala Lys Ile Ala Val Gly Leu Ser Leu Asp Glu Met Met Asn

325 330 335

Pro Val Thr Gly Lys Thr Tyr Ala Ala Phe Glu Pro Ala Leu Asp Tyr

340 345 350

Val Val Ser Lys Ile Pro Arg Trp Pro Phe Asp Lys Phe Glu Ser Ala

355 360 365

Asn Arg Lys Leu Gly Thr Gln Met Lys Ala Thr Gly Glu Val Met Ala

370 375 380

Ile Gly Arg Thr Leu Glu Glu Ser Leu Leu Lys Ala Val Arg Ser Leu

385 390 395 400

Glu Ala Asp Val Tyr His Leu Glu Leu Lys Asp Ala Ala Asp Ile Ser

405 410 415

Asp Glu Leu Leu Glu Lys Arg Ile Lys Lys Ala Gly Asp Glu Arg Leu

420 425 430

Phe Tyr Leu Ala Glu Ala Tyr Arg Arg Gly Tyr Thr Val Glu Asp Leu

435 440 445

His Glu Phe Ser Ala Ile Asp Val Phe Phe Leu His Lys Leu Phe Gly

450 455 460

Ile Val Gln Phe Glu Lys Glu Leu Lys Ala Asn Ala Gly Asp Thr Asp

465 470 475 480

Val Leu Arg Arg Ala Lys Glu Leu Gly Phe Ser Asp Gln Tyr Ile Ser

485 490 495

Arg Glu Trp Lys Met Lys Glu Ser Glu Leu Tyr Ser Leu Arg Lys Gln

500 505 510

Ala Gly Ile Ala Pro Val Phe Lys Met Val Asp Thr Cys Ala Ala Glu

515 520 525

Phe Glu Ser Glu Thr Pro Tyr Phe Tyr Ser Thr Tyr Glu Glu Glu Asn

530 535 540

Glu Ser Val Val Thr Asp Lys Lys Ser Val Met Val Leu Gly Ser Gly

545 550 555 560

Pro Ile Arg Ile Gly Gln Gly Val Glu Phe Asp Tyr Ala Thr Val His

565 570 575

Ser Val Trp Ala Ile Lys Gln Ala Gly Tyr Glu Ala Ile Ile Val Asn

580 585 590

Asn Asn Pro Glu Thr Val Ser Thr Asp Phe Ser Ile Ser Asp Lys Leu

595 600 605

Tyr Phe Glu Pro Leu Thr Ile Glu Asp Val Met His Ile Ile Asp Leu

610 615 620

Glu Gln Pro Met Gly Val Val Val Gln Phe Gly Gly Gln Thr Ala Ile

625 630 635 640

Asn Leu Ala Asp Glu Leu Ser Ala Arg Gly Val Lys Ile Leu Gly Thr

645 650 655

Ser Leu Glu Asp Leu Asp Arg Ala Glu Asp Arg Asp Lys Phe Glu Gln

660 665 670

Ala Leu Gly Glu Leu Gly Val Pro Gln Pro Leu Gly Lys Thr Ala Thr

675 680 685

Ser Val Asn Gln Ala Val Ser Ile Ala Ser Asp Ile Gly Tyr Pro Val

690 695 700

Leu Val Arg Pro Ser Tyr Val Leu Gly Gly Arg Ala Met Glu Ile Val

705 710 715 720

Tyr His Glu Glu Glu Leu Leu His Tyr Met Lys Asn Ala Val Lys Ile

725 730 735

Asn Pro Gln His Pro Val Leu Ile Asp Arg Tyr Leu Thr Gly Lys Glu

740 745 750

Ile Glu Val Asp Ala Val Ser Asp Gly Glu Thr Val Val Ile Pro Gly

755 760 765

Ile Met Glu His Ile Glu Arg Ala Gly Val His Ser Gly Asp Ser Ile

770 775 780

Ala Val Tyr Pro Pro Gln Ser Leu Thr Glu Asp Ile Lys Lys Lys Ile

785 790 795 800

Glu Gln Tyr Thr Ile Ala Leu Ala Lys Gly Leu Asn Ile Val Gly Leu

805 810 815

Leu Asn Ile Gln Phe Val Leu Ser Gln Gly Glu Val Tyr Val Leu Glu

820 825 830

Val Asn Pro Arg Ser Ser Arg Thr Val Pro Phe Leu Ser Lys Ile Thr

835 840 845

Gly Ile Pro Met Ala Asn Leu Ala Thr Lys Ile Ile Leu Gly Gln Lys

850 855 860

Leu Ala Ala Phe Gly Tyr Thr Glu Gly Leu Gln Pro Glu Gln Gln Gly

865 870 875 880

Val Phe Val Lys Ala Pro Val Phe Ser Phe Ala Lys Leu Arg Arg Val

885 890 895

Asp Ile Thr Leu Gly Pro Glu Met Lys Ser Thr Gly Glu Val Met Gly

900 905 910

Lys Asp Ser Thr Leu Glu Lys Ala Leu Tyr Lys Ala Leu Ile Ala Ser

915 920 925

Gly Ile Gln Ile Pro Asn Tyr Gly Ser Val Leu Leu Thr Val Ala Asp

930 935 940

Lys Asp Lys Glu Glu Gly Leu Ala Ile Ala Lys Arg Phe His Ala Ile

945 950 955 960

Gly Tyr Asn Ile Leu Ala Thr Glu Gly Thr Ala Gly Tyr Leu Lys Glu

965 970 975

Ala Ser Ile Pro Ala Lys Val Val Gly Lys Ile Gly Gln Asp Gly Pro

980 985 990

Asn Leu Leu Asp Val Ile Arg Asn Gly Glu Ala Gln Phe Val Ile Asn

995 1000 1005

Thr Leu Thr Lys Gly Lys Gln Pro Ala Arg Asp Gly Phe Arg Ile Arg

1010 1015 1020

Arg Glu Ser Val Glu Asn Gly Val Ala Cys Leu Thr Ser Leu Asp Thr

1025 1030 1035 1040

Ala Glu Ala Ile Leu Arg Val Leu Glu Ser Met Thr Phe Arg Ala Asp

1045 1050 1055

Gln Met Pro Ala Val Asn Thr Asn Gln Glu Ala Ala Val Thr Ile

1060 1065 1070

<210> 8

<211> 1071

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 8

Met Pro Lys Arg Val Asp Ile Asn Lys Ile Leu Val Ile Gly Ser Gly

1 5 10 15

Pro Ile Ile Ile Gly Gln Ala Ala Glu Phe Asp Tyr Ala Gly Thr Gln

20 25 30

Ala Cys Leu Ala Leu Lys Glu Glu Gly Tyr Glu Val Ile Leu Val Asn

35 40 45

Ser Asn Pro Ala Thr Ile Met Thr Asp Thr Glu Met Ala Asp Arg Val

50 55 60

Tyr Ile Glu Pro Leu Thr Pro Glu Phe Leu Thr Arg Ile Ile Arg Lys

65 70 75 80

Glu Arg Pro Asp Ala Ile Leu Pro Thr Leu Gly Gly Gln Thr Gly Leu

85 90 95

Asn Leu Ala Val Glu Leu Ser Glu Arg Gly Val Leu Ala Glu Cys Gly

100 105 110

Val Glu Val Leu Gly Thr Lys Leu Ser Ala Ile Gln Gln Ala Glu Asp

115 120 125

Arg Asp Leu Phe Arg Thr Leu Met Asn Glu Leu Asn Glu Pro Val Pro

130 135 140

Glu Ser Glu Ile Ile His Ser Leu Glu Glu Ala Glu Lys Phe Val Ile

145 150 155 160

Gln Ile Gly Phe Pro Val Ile Val Arg Pro Ala Tyr Thr Leu Gly Gly

165 170 175

Thr Gly Gly Gly Ile Cys Ser Asn Glu Thr Glu Leu Lys Glu Ile Val

180 185 190

Glu Asn Gly Leu Lys Leu Ser Pro Val His Gln Cys Leu Leu Glu Lys

195 200 205

Ser Ile Ala Gly Tyr Lys Glu Ile Glu Tyr Glu Val Met Arg Asp Ser

210 215 220

Gln Asp His Ala Ile Val Val Cys Asn Met Glu Asn Ile Asp Pro Val

225 230 235 240

Gly Ile His Thr Gly Asp Ser Ile Val Val Ala Pro Ser Gln Thr Leu

245 250 255

Ser Asp Arg Glu Tyr Gln Leu Leu Arg Asn Val Ser Leu Lys Leu Ile

260 265 270

Arg Ala Leu Gly Ile Glu Gly Gly Cys Asn Val Gln Leu Ala Leu Asp

275 280 285

Pro Asp Ser Phe Gln Tyr Tyr Ile Ile Glu Val Asn Pro Arg Val Ser

290 295 300

Arg Ser Ser Ala Leu Ala Ser Lys Ala Thr Gly Tyr Pro Ile Ala Lys

305 310 315 320

Leu Ala Ala Lys Ile Ala Val Gly Leu Ser Leu Asp Glu Met Met Asn

325 330 335

Pro Val Thr Gly Lys Thr Tyr Ala Ala Phe Glu Pro Ala Leu Asp Tyr

340 345 350

Val Val Ser Lys Ile Pro Arg Trp Pro Phe Asp Lys Phe Glu Ser Ala

355 360 365

Asn Arg Lys Leu Gly Thr Gln Met Lys Ala Thr Gly Glu Val Met Ala

370 375 380

Ile Gly Arg Thr Leu Glu Glu Ser Leu Leu Lys Ala Val Arg Ser Leu

385 390 395 400

Glu Ala Asp Val Tyr His Leu Glu Leu Lys Asp Ala Ala Asp Ile Ser

405 410 415

Asp Glu Leu Leu Glu Lys Arg Ile Lys Lys Ala Gly Asp Glu Arg Leu

420 425 430

Phe Tyr Leu Ala Glu Ala Tyr Arg Arg Gly Tyr Thr Val Glu Asp Leu

435 440 445

His Glu Phe Ser Ala Ile Asp Val Phe Phe Leu His Lys Leu Phe Gly

450 455 460

Ile Val Gln Phe Glu Lys Glu Leu Lys Ala Asn Ala Gly Asp Thr Asp

465 470 475 480

Val Leu Arg Arg Ala Lys Glu Leu Gly Phe Ser Asp Gln Tyr Ile Ser

485 490 495

Arg Glu Trp Lys Met Lys Glu Ser Glu Leu Tyr Ser Leu Arg Lys Gln

500 505 510

Ala Gly Ile Ala Pro Val Phe Lys Met Val Asp Thr Cys Ala Ala Glu

515 520 525

Phe Glu Ser Glu Thr Pro Tyr Phe Tyr Ser Thr Tyr Glu Glu Glu Asn

530 535 540

Glu Ser Val Val Thr Asp Lys Lys Ser Val Met Val Leu Gly Ser Gly

545 550 555 560

Pro Ile Arg Ile Gly Gln Gly Val Glu Phe Asp Tyr Ala Thr Val His

565 570 575

Ser Val Trp Ala Ile Lys Gln Ala Gly Tyr Glu Ala Ile Ile Val Asn

580 585 590

Asn Asn Pro Glu Thr Val Ser Thr Asp Phe Ser Ile Ser Asp Lys Leu

595 600 605

Tyr Phe Glu Pro Leu Thr Ile Glu Asp Val Met His Ile Ile Asp Leu

610 615 620

Glu Gln Pro Met Gly Val Val Val Gln Phe Gly Gly Gln Thr Ala Ile

625 630 635 640

Asn Leu Ala Asp Glu Leu Ser Ala Arg Gly Val Lys Ile Leu Gly Thr

645 650 655

Ser Leu Glu Asp Leu Asp Arg Ala Glu Asp Arg Asp Lys Phe Glu Gln

660 665 670

Ala Leu Gly Glu Leu Gly Val Pro Gln Pro Leu Gly Lys Thr Ala Thr

675 680 685

Ser Val Asn Gln Ala Val Ser Ile Ala Ser Asp Ile Gly Tyr Pro Val

690 695 700

Leu Val Arg Pro Ser Tyr Val Leu Gly Gly Arg Ala Met Glu Ile Val

705 710 715 720

Tyr His Glu Glu Glu Leu Leu His Tyr Met Lys Asn Ala Val Lys Ile

725 730 735

Asn Pro Gln His Pro Val Leu Ile Asp Arg Tyr Leu Thr Gly Lys Glu

740 745 750

Ile Glu Val Asp Ala Val Ser Asp Gly Glu Thr Val Val Ile Pro Gly

755 760 765

Ile Met Glu His Ile Glu Arg Ala Gly Val His Ser Gly Asp Ser Ile

770 775 780

Ala Val Tyr Pro Pro Gln Ser Leu Thr Glu Asp Ile Lys Lys Lys Ile

785 790 795 800

Glu Gln Tyr Thr Ile Ala Leu Ala Lys Gly Leu Asn Ile Val Gly Leu

805 810 815

Leu Asn Ile Gln Phe Val Leu Ser Gln Gly Glu Val Tyr Val Leu Glu

820 825 830

Val Asn Pro Arg Ser Ser Arg Thr Val Pro Phe Leu Ser Lys Ile Thr

835 840 845

Gly Ile Pro Met Ala Asn Leu Ala Thr Lys Ile Ile Leu Gly Gln Lys

850 855 860

Leu Ala Ala Phe Gly Tyr Thr Glu Gly Leu Gln Pro Glu Gln Gln Gly

865 870 875 880

Val Phe Val Lys Ala Pro Val Phe Ser Phe Ala Lys Leu Arg Arg Val

885 890 895

Asp Ile Thr Leu Gly Pro Glu Met Lys Ser Thr Gly Glu Val Met Gly

900 905 910

Lys Asp Ser Thr Leu Glu Lys Ala Leu Tyr Lys Ala Leu Ile Ala Ser

915 920 925

Gly Ile Gln Ile Pro Asn Tyr Gly Ser Val Leu Leu Thr Val Ala Asp

930 935 940

Lys Asp Lys Glu Glu Gly Leu Ala Ile Ala Lys Arg Phe His Ala Ile

945 950 955 960

Gly Tyr Asn Ile Leu Ala Thr Glu Gly Thr Ala Gly Tyr Leu Lys Glu

965 970 975

Ala Ser Ile Pro Ala Lys Val Val Gly Lys Ile Gly Gln Asp Gly Pro

980 985 990

Asn Leu Leu Asp Val Ile Arg Asn Gly Glu Ala Gln Phe Val Ile Asn

995 1000 1005

Thr Leu Thr Lys Gly Lys Gln Pro Ala Arg Asp Gly Phe Arg Ile Arg

1010 1015 1020

Arg Glu Ser Val Glu Asn Gly Val Ala Cys Leu Thr Ser Leu Asp Thr

1025 1030 1035 1040

Ala Glu Ala Ile Leu Arg Val Leu Glu Ser Met Thr Phe Arg Ala Asp

1045 1050 1055

Gln Met Pro Ala Val Asn Thr Asn Gln Glu Ala Ala Val Thr Ile

1060 1065 1070

<210> 9

<211> 1071

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 9

Met Pro Lys Arg Val Asp Ile Asn Lys Ile Leu Val Ile Gly Ser Gly

1 5 10 15

Pro Ile Ile Ile Gly Gln Ala Ala Glu Phe Asp Tyr Ala Gly Thr Gln

20 25 30

Ala Cys Leu Ala Leu Lys Glu Glu Gly Tyr Glu Val Ile Leu Val Asn

35 40 45

Ser Asn Pro Ala Thr Ile Met Thr Asp Thr Glu Met Ala Asp Arg Val

50 55 60

Tyr Ile Glu Pro Leu Thr Pro Glu Phe Leu Thr Arg Ile Ile Arg Lys

65 70 75 80

Glu Arg Pro Asp Ala Ile Leu Pro Thr Leu Gly Gly Gln Thr Gly Leu

85 90 95

Asn Leu Ala Val Glu Leu Ser Glu Arg Gly Val Leu Ala Glu Cys Gly

100 105 110

Val Glu Val Leu Gly Thr Lys Leu Ser Ala Ile Gln Gln Ala Glu Asp

115 120 125

Arg Asp Leu Phe Arg Thr Leu Met Asn Glu Leu Asn Glu Pro Val Pro

130 135 140

Glu Ser Glu Ile Ile His Ser Leu Glu Glu Ala Glu Lys Phe Val Val

145 150 155 160

Gln Ile Gly Phe Pro Val Ile Val Arg Pro Ala Tyr Thr Leu Gly Gly

165 170 175

Thr Gly Gly Gly Ile Cys Ser Asn Glu Thr Glu Leu Lys Glu Ile Val

180 185 190

Glu Asn Gly Leu Lys Leu Ser Pro Val His Gln Cys Leu Leu Glu Lys

195 200 205

Ser Ile Ala Gly Tyr Lys Glu Ile Glu Tyr Glu Val Met Arg Asp Ser

210 215 220

Gln Asp His Ala Ile Val Val Cys Asn Met Glu Asn Ile Asp Pro Val

225 230 235 240

Gly Ile His Thr Gly Asp Ser Ile Val Val Ala Pro Ser Gln Thr Leu

245 250 255

Ser Asp Arg Glu Tyr Gln Leu Leu Arg Asn Val Ser Leu Lys Leu Ile

260 265 270

Arg Ala Leu Gly Ile Glu Gly Gly Cys Asn Val Gln Leu Ala Leu Asp

275 280 285

Pro Asp Ser Phe Gln Tyr Tyr Ile Ile Glu Val Asn Pro Arg Val Ser

290 295 300

Arg Ser Ser Ala Leu Ala Ser Lys Ala Thr Gly Tyr Pro Ile Ala Lys

305 310 315 320

Leu Ala Ala Lys Ile Ala Val Gly Leu Ser Leu Asp Glu Met Met Asn

325 330 335

Pro Val Thr Gly Lys Thr Tyr Ala Ala Phe Glu Pro Ala Leu Asp Tyr

340 345 350

Val Val Ser Lys Ile Pro Arg Trp Pro Phe Asp Lys Phe Glu Ser Ala

355 360 365

Asn Arg Lys Leu Gly Thr Gln Met Lys Ala Thr Gly Glu Val Met Ala

370 375 380

Ile Gly Arg Thr Leu Glu Glu Ser Leu Leu Lys Ala Val Arg Ser Leu

385 390 395 400

Glu Ala Asp Val Tyr His Leu Glu Leu Lys Asp Ala Ala Asp Ile Ser

405 410 415

Asp Glu Leu Leu Glu Lys Arg Ile Lys Lys Ala Gly Asp Glu Arg Leu

420 425 430

Phe Tyr Leu Ala Glu Ala Tyr Arg Arg Gly Tyr Thr Val Glu Asp Leu

435 440 445

His Glu Phe Ser Ala Ile Asp Val Phe Phe Leu His Lys Leu Phe Gly

450 455 460

Ile Val Gln Phe Glu Lys Glu Leu Lys Ala Asn Ala Gly Asp Thr Asp

465 470 475 480

Val Leu Arg Arg Ala Lys Glu Leu Gly Phe Ser Asp Gln Tyr Ile Ser

485 490 495

Arg Glu Trp Lys Met Lys Glu Ser Glu Leu Tyr Ser Leu Arg Lys Gln

500 505 510

Ala Gly Ile Ala Pro Val Phe Lys Met Val Asp Thr Cys Ala Ala Glu

515 520 525

Phe Glu Ser Glu Thr Pro Tyr Phe Tyr Ser Thr Tyr Glu Glu Glu Asn

530 535 540

Glu Ser Val Val Thr Asp Lys Lys Ser Val Met Val Leu Gly Ser Gly

545 550 555 560

Pro Ile Arg Ile Gly Gln Gly Val Glu Phe Asp Tyr Ala Thr Val His

565 570 575

Ser Val Trp Ala Ile Lys Gln Ala Gly Tyr Glu Ala Ile Ile Val Asn

580 585 590

Asn Asn Pro Glu Thr Val Ser Thr Asp Phe Ser Ile Ser Asp Lys Leu

595 600 605

Tyr Phe Glu Pro Leu Thr Ile Glu Asp Val Met His Ile Ile Asp Leu

610 615 620

Glu Gln Pro Met Gly Val Val Val Gln Phe Gly Gly Gln Thr Ala Ile

625 630 635 640

Asn Leu Ala Asp Glu Leu Ser Ala Arg Gly Val Lys Ile Leu Gly Thr

645 650 655

Ser Leu Glu Asp Leu Asp Arg Ala Glu Asp Arg Asp Lys Phe Glu Gln

660 665 670

Ala Leu Gly Glu Leu Gly Val Pro Gln Pro Leu Gly Lys Thr Ala Thr

675 680 685

Ser Val Asn Gln Ala Val Ser Ile Ala Ser Asp Ile Gly Tyr Pro Val

690 695 700

Leu Val Arg Pro Ser Tyr Val Leu Gly Gly Arg Ala Met Glu Ile Val

705 710 715 720

Tyr His Glu Glu Glu Leu Leu His Tyr Met Lys Asn Ala Val Lys Ile

725 730 735

Asn Pro Gln His Pro Val Leu Ile Asp Arg Tyr Leu Thr Gly Lys Glu

740 745 750

Ile Glu Val Asp Ala Val Ser Asp Gly Glu Thr Val Val Ile Pro Gly

755 760 765

Ile Met Glu His Ile Glu Arg Ala Gly Val His Ser Gly Asp Ser Ile

770 775 780

Ala Val Tyr Pro Pro Gln Ser Leu Thr Glu Asp Ile Lys Lys Lys Ile

785 790 795 800

Glu Gln Tyr Thr Ile Ala Leu Ala Lys Gly Leu Asn Ile Val Gly Leu

805 810 815

Leu Asn Ile Gln Phe Val Leu Ser Gln Gly Glu Val Tyr Val Leu Glu

820 825 830

Val Asn Pro Arg Ser Ser Arg Thr Val Pro Phe Leu Ser Lys Ile Thr

835 840 845

Gly Ile Pro Met Ala Asn Leu Ala Thr Lys Ile Ile Leu Gly Gln Lys

850 855 860

Leu Ala Ala Phe Gly Tyr Thr Glu Gly Leu Gln Pro Glu Gln Gln Gly

865 870 875 880

Val Phe Val Lys Ala Pro Val Phe Ser Phe Ala Lys Leu Arg Arg Val

885 890 895

Asp Ile Thr Leu Gly Pro Glu Met Lys Ser Thr Gly Glu Val Met Gly

900 905 910

Lys Asp Ser Thr Leu Glu Lys Ala Leu Tyr Lys Ala Leu Ile Ala Ser

915 920 925

Gly Ile Gln Ile Pro Asn Tyr Gly Ser Val Leu Leu Thr Val Ala Asp

930 935 940

Lys Asp Lys Glu Glu Gly Leu Ala Ile Ala Lys Arg Phe His Ala Ile

945 950 955 960

Gly Tyr Asn Ile Leu Ala Thr Glu Gly Thr Ala Gly Tyr Leu Lys Glu

965 970 975

Ala Ser Ile Pro Ala Lys Val Val Gly Lys Ile Gly Gln Asp Gly Pro

980 985 990

Asn Leu Leu Asp Val Ile Arg Asn Gly Glu Ala Gln Phe Val Ile Asn

995 1000 1005

Thr Leu Thr Lys Gly Lys Gln Pro Ala Arg Asp Gly Phe Arg Ile Arg

1010 1015 1020

Arg Glu Ser Val Glu Asn Gly Val Ala Cys Leu Thr Ser Leu Asp Thr

1025 1030 1035 1040

Ala Glu Ala Ile Leu Arg Val Leu Glu Ser Met Thr Phe Arg Ala Asp

1045 1050 1055

Gln Met Pro Ala Val Asn Thr Asn Gln Glu Ala Ala Val Thr Ile

1060 1065 1070

<210> 10

<211> 3216

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

atgccaaaac gcgtagacat taacaaaatt ttagtaatcg gatctggacc gatcatcatc 60

ggccaagcag cagaatttga ctatgcggga acacaagcct gtcttgcttt gaaagaagaa 120

ggctatgaag tcatccttgt caactcaaac cctgcaacga tcatgacaga tacagaaatg 180

gctgaccggg tttacatcga accgctcaca cctgaattcc tgacacgaat catcagaaaa 240

gagcgcccgg atgccattct tcctacactc ggaggccaaa ccggtttgaa tcttgcggtt 300

gagctttctg aaagaggcgt tttggcagaa tgcggcgtcg aagtgcttgg cacgaaactg 360

tctgcgattc agcaagctga agaccgtgac ttgttcagaa cattaatgaa tgaactgaat 420

gaaccggtgc ctgaaagtga gattatccac tcccttgaag aagcagaaaa attcgtcctt 480

caaattggat tccctgtcat tgtccgcccg gcatatacat taggcggaac aggcggaggc 540

atctgctcga atgaaacaga gctaaaagaa atcgttgaga acggcttgaa attaagcccg 600

gtacaccaat gtctgcttga aaaaagcatc gccggctata aagaaatcga gtatgaagtc 660

atgagagaca gccaggatca cgccattgtc gtttgtaaca tggaaaacat tgatccagtt 720

ggaatccata ctggagacag tattgttgtc gcgccgagcc aaacgctcag cgatcgcgaa 780

tatcagctct tgcggaatgt atcgttaaaa ctgattcgcg cgcttgggat cgaaggcgga 840

tgtaatgtcc agctcgcctt agatccagac agcttccaat attacattat tgaagtaaat 900

ccgcgtgtca gccgttcatc tgcccttgca tcaaaagcaa cggggtaccc gattgcaaag 960

ctcgctgcta aaattgcagt cggactttca ttagatgaaa tgatgaaccc ggtgacagga 1020

aaaacatatg cagcatttga acctgctctt gactatgtcg tatccaaaat tccgcgctgg 1080

ccgtttgata agtttgaatc agcaaacaga aagcttggca cgcaaatgaa agcgacaggt 1140

gaggtcatgg caatcggccg cacgcttgaa gagtcattgc tgaaggcagt gcgatcactg 1200

gaagcggatg tgtatcatct tgaattgaag gacgccgctg acatttcaga tgagcttctt 1260

gaaaagcgaa ttaaaaaggc cggtgatgaa cgcttattct acttagctga agcgtacaga 1320

agaggctaca cggtagaaga cctccatgaa ttttccgcta tcgatgtctt cttcttgcat 1380

aagctgttcg gaatcgtaca gtttgaaaaa gaattgaagg ccaatgcggg cgatacagat 1440

gtgctgagac gggcaaaaga actcggcttc tctgatcagt acatcagccg tgaatggaaa 1500

atgaaagaat ctgagcttta cagcttgaga aaacaagcgg ggattgcgcc ggtattcaaa 1560

atggtagata catgcgcggc ggaatttgag tcagaaacgc catacttcta tagcacatat 1620

gaagaagaaa atgaatctgt cgttacagat aagaaaagtg tgatggtgct tggttcgggt 1680

ccgattcgaa tcggtcaggg tgtcgagttc gactatgcga cggttcactc tgtatgggca 1740

attaaacaag caggctatga agccattatt gtcaacaaca acccggaaac cgtttcaaca 1800

gacttcagca tctcagacaa gctgtatttt gaaccgctta cgattgaaga tgtcatgcac 1860

atcattgacc tcgaacagcc aatgggcgtt gtcgtacaat ttggcggaca aactgcgatt 1920

aaccttgctg acgagctttc tgcacgcgga gtgaaaatcc ttggaacttc attagaagat 1980

ttagaccgtg ccgaagaccg ggataaattt gaacaagcgc ttggagaact tggtgttcct 2040

cagccgcttg gcaaaacagc gacatcagtt aatcaggcgg taagcatcgc aagtgatatc 2100

ggttatccgg tactggtacg cccttcctat gtacttggcg gccgggcgat ggagattgtt 2160

taccatgaag aggaactgct tcattacatg aaaaatgcag tcaaaatcaa tccacagcac 2220

cctgtattaa ttgatagata cttgaccgga aaagaaattg aagtcgatgc agtatccgac 2280

ggtgaaacag tcgtcattcc gggaattatg gagcacattg aacgtgcggg cgttcactcc 2340

ggagactcaa tcgctgttta tccgcctcag tctctcacag aggacattaa gaaaaaaatt 2400

gaacaataca cgatcgcatt ggctaaaggg ctgaatattg tcggtttgct caatattcaa 2460

ttcgtcttgt cgcaaggcga ggtgtacgtg ctagaagtga atccgagatc aagcagaacc 2520

gtaccgtttt taagcaaaat tacgggtatc ccaatggcga atctcgcaac aaaaatcatt 2580

cttggtcaaa agctggctgc gtttggctat acagagggcc ttcagcctga acagcaaggt 2640

gtatttgtaa aagcgccggt cttctccttt gccaagctga gaagagtgga tattacgtta 2700

gggcctgaaa tgaaatcaac aggtgaagtc atggggaaag attcgacact tgaaaaggcg 2760

ctctacaaag ccttgatcgc ttcaggtatt caaatcccga actacggttc cgtgctttta 2820

acagtagctg ataaggacaa agaagaaggg cttgccattg ctaagcggtt ccacgcgatc 2880

ggctacaaca ttttagcgac ggaaggaacg gcaggctacc tgaaagaagc ttccattcca 2940

gcgaaggtcg tcggaaaaat cggtcaggat ggcccgaact tgcttgatgt catcagaaac 3000

ggagaagcgc agtttgtcat caatacgctg acaaaaggaa agcagccggc aagagacggt 3060

tttagaatca gacgtgaatc agtagaaaat ggtgttgcct gcctaacatc tttagatacg 3120

gcagaggcga tattgcgagt gctggaaagc atgacattcc gtgctgatca aatgccggca 3180

gtcaacacaa atcaggaggc ggcagtcact atatga 3216

<210> 11

<211> 3216

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

atgccaaaac gcgtagacat taacaaaatt ttagtaatcg gatctggacc gatcatcatc 60

ggccaagcag cagaatttga ctatgcggga acacaagcct gtcttgcttt gaaagaagaa 120

ggctatgaag tcatccttgt caactcaaac cctgcaacga tcatgacaga tacagaaatg 180

gctgaccggg tttacatcga accgctcaca cctgaattcc tgacacgaat catcagaaaa 240

gagcgcccgg atgccattct tcctacactc ggaggccaaa ccggtttgaa tcttgcggtt 300

gagctttctg aaagaggcgt tttggcagaa tgcggcgtcg aagtgcttgg cacgaaactg 360

tctgcgattc agcaagctga agaccgtgac ttgttcagaa cattaatgaa tgaactgaat 420

gaaccggtgc ctgaaagtga gattatccac tcccttgaag aagcagaaaa attcgtcatt 480

caaattggat tccctgtcat tgtccgcccg gcatatacat taggcggaac aggcggaggc 540

atctgctcga atgaaacaga gctaaaagaa atcgttgaga acggcttgaa attaagcccg 600

gtacaccaat gtctgcttga aaaaagcatc gccggctata aagaaatcga gtatgaagtc 660

atgagagaca gccaggatca cgccattgtc gtttgtaaca tggaaaacat tgatccagtt 720

ggaatccata ctggagacag tattgttgtc gcgccgagcc aaacgctcag cgatcgcgaa 780

tatcagctct tgcggaatgt atcgttaaaa ctgattcgcg cgcttgggat cgaaggcgga 840

tgtaatgtcc agctcgcctt agatccagac agcttccaat attacattat tgaagtaaat 900

ccgcgtgtca gccgttcatc tgcccttgca tcaaaagcaa cggggtaccc gattgcaaag 960

ctcgctgcta aaattgcagt cggactttca ttagatgaaa tgatgaaccc ggtgacagga 1020

aaaacatatg cagcatttga acctgctctt gactatgtcg tatccaaaat tccgcgctgg 1080

ccgtttgata agtttgaatc agcaaacaga aagcttggca cgcaaatgaa agcgacaggt 1140

gaggtcatgg caatcggccg cacgcttgaa gagtcattgc tgaaggcagt gcgatcactg 1200

gaagcggatg tgtatcatct tgaattgaag gacgccgctg acatttcaga tgagcttctt 1260

gaaaagcgaa ttaaaaaggc cggtgatgaa cgcttattct acttagctga agcgtacaga 1320

agaggctaca cggtagaaga cctccatgaa ttttccgcta tcgatgtctt cttcttgcat 1380

aagctgttcg gaatcgtaca gtttgaaaaa gaattgaagg ccaatgcggg cgatacagat 1440

gtgctgagac gggcaaaaga actcggcttc tctgatcagt acatcagccg tgaatggaaa 1500

atgaaagaat ctgagcttta cagcttgaga aaacaagcgg ggattgcgcc ggtattcaaa 1560

atggtagata catgcgcggc ggaatttgag tcagaaacgc catacttcta tagcacatat 1620

gaagaagaaa atgaatctgt cgttacagat aagaaaagtg tgatggtgct tggttcgggt 1680

ccgattcgaa tcggtcaggg tgtcgagttc gactatgcga cggttcactc tgtatgggca 1740

attaaacaag caggctatga agccattatt gtcaacaaca acccggaaac cgtttcaaca 1800

gacttcagca tctcagacaa gctgtatttt gaaccgctta cgattgaaga tgtcatgcac 1860

atcattgacc tcgaacagcc aatgggcgtt gtcgtacaat ttggcggaca aactgcgatt 1920

aaccttgctg acgagctttc tgcacgcgga gtgaaaatcc ttggaacttc attagaagat 1980

ttagaccgtg ccgaagaccg ggataaattt gaacaagcgc ttggagaact tggtgttcct 2040

cagccgcttg gcaaaacagc gacatcagtt aatcaggcgg taagcatcgc aagtgatatc 2100

ggttatccgg tactggtacg cccttcctat gtacttggcg gccgggcgat ggagattgtt 2160

taccatgaag aggaactgct tcattacatg aaaaatgcag tcaaaatcaa tccacagcac 2220

cctgtattaa ttgatagata cttgaccgga aaagaaattg aagtcgatgc agtatccgac 2280

ggtgaaacag tcgtcattcc gggaattatg gagcacattg aacgtgcggg cgttcactcc 2340

ggagactcaa tcgctgttta tccgcctcag tctctcacag aggacattaa gaaaaaaatt 2400

gaacaataca cgatcgcatt ggctaaaggg ctgaatattg tcggtttgct caatattcaa 2460

ttcgtcttgt cgcaaggcga ggtgtacgtg ctagaagtga atccgagatc aagcagaacc 2520

gtaccgtttt taagcaaaat tacgggtatc ccaatggcga atctcgcaac aaaaatcatt 2580

cttggtcaaa agctggctgc gtttggctat acagagggcc ttcagcctga acagcaaggt 2640

gtatttgtaa aagcgccggt cttctccttt gccaagctga gaagagtgga tattacgtta 2700

gggcctgaaa tgaaatcaac aggtgaagtc atggggaaag attcgacact tgaaaaggcg 2760

ctctacaaag ccttgatcgc ttcaggtatt caaatcccga actacggttc cgtgctttta 2820

acagtagctg ataaggacaa agaagaaggg cttgccattg ctaagcggtt ccacgcgatc 2880

ggctacaaca ttttagcgac ggaaggaacg gcaggctacc tgaaagaagc ttccattcca 2940

gcgaaggtcg tcggaaaaat cggtcaggat ggcccgaact tgcttgatgt catcagaaac 3000

ggagaagcgc agtttgtcat caatacgctg acaaaaggaa agcagccggc aagagacggt 3060

tttagaatca gacgtgaatc agtagaaaat ggtgttgcct gcctaacatc tttagatacg 3120

gcagaggcga tattgcgagt gctggaaagc atgacattcc gtgctgatca aatgccggca 3180

gtcaacacaa atcaggaggc ggcagtcact atatga 3216

<210> 12

<211> 3216

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

atgccaaaac gcgtagacat taacaaaatt ttagtaatcg gatctggacc gatcatcatc 60

ggccaagcag cagaatttga ctatgcggga acacaagcct gtcttgcttt gaaagaagaa 120

ggctatgaag tcatccttgt caactcaaac cctgcaacga tcatgacaga tacagaaatg 180

gctgaccggg tttacatcga accgctcaca cctgaattcc tgacacgaat catcagaaaa 240

gagcgcccgg atgccattct tcctacactc ggaggccaaa ccggtttgaa tcttgcggtt 300

gagctttctg aaagaggcgt tttggcagaa tgcggcgtcg aagtgcttgg cacgaaactg 360

tctgcgattc agcaagctga agaccgtgac ttgttcagaa cattaatgaa tgaactgaat 420

gaaccggtgc ctgaaagtga gattatccac tcccttgaag aagcagaaaa attcgtcgtt 480

caaattggat tccctgtcat tgtccgcccg gcatatacat taggcggaac aggcggaggc 540

atctgctcga atgaaacaga gctaaaagaa atcgttgaga acggcttgaa attaagcccg 600

gtacaccaat gtctgcttga aaaaagcatc gccggctata aagaaatcga gtatgaagtc 660

atgagagaca gccaggatca cgccattgtc gtttgtaaca tggaaaacat tgatccagtt 720

ggaatccata ctggagacag tattgttgtc gcgccgagcc aaacgctcag cgatcgcgaa 780

tatcagctct tgcggaatgt atcgttaaaa ctgattcgcg cgcttgggat cgaaggcgga 840

tgtaatgtcc agctcgcctt agatccagac agcttccaat attacattat tgaagtaaat 900

ccgcgtgtca gccgttcatc tgcccttgca tcaaaagcaa cggggtaccc gattgcaaag 960

ctcgctgcta aaattgcagt cggactttca ttagatgaaa tgatgaaccc ggtgacagga 1020

aaaacatatg cagcatttga acctgctctt gactatgtcg tatccaaaat tccgcgctgg 1080

ccgtttgata agtttgaatc agcaaacaga aagcttggca cgcaaatgaa agcgacaggt 1140

gaggtcatgg caatcggccg cacgcttgaa gagtcattgc tgaaggcagt gcgatcactg 1200

gaagcggatg tgtatcatct tgaattgaag gacgccgctg acatttcaga tgagcttctt 1260

gaaaagcgaa ttaaaaaggc cggtgatgaa cgcttattct acttagctga agcgtacaga 1320

agaggctaca cggtagaaga cctccatgaa ttttccgcta tcgatgtctt cttcttgcat 1380

aagctgttcg gaatcgtaca gtttgaaaaa gaattgaagg ccaatgcggg cgatacagat 1440

gtgctgagac gggcaaaaga actcggcttc tctgatcagt acatcagccg tgaatggaaa 1500

atgaaagaat ctgagcttta cagcttgaga aaacaagcgg ggattgcgcc ggtattcaaa 1560

atggtagata catgcgcggc ggaatttgag tcagaaacgc catacttcta tagcacatat 1620

gaagaagaaa atgaatctgt cgttacagat aagaaaagtg tgatggtgct tggttcgggt 1680

ccgattcgaa tcggtcaggg tgtcgagttc gactatgcga cggttcactc tgtatgggca 1740

attaaacaag caggctatga agccattatt gtcaacaaca acccggaaac cgtttcaaca 1800

gacttcagca tctcagacaa gctgtatttt gaaccgctta cgattgaaga tgtcatgcac 1860

atcattgacc tcgaacagcc aatgggcgtt gtcgtacaat ttggcggaca aactgcgatt 1920

aaccttgctg acgagctttc tgcacgcgga gtgaaaatcc ttggaacttc attagaagat 1980

ttagaccgtg ccgaagaccg ggataaattt gaacaagcgc ttggagaact tggtgttcct 2040

cagccgcttg gcaaaacagc gacatcagtt aatcaggcgg taagcatcgc aagtgatatc 2100

ggttatccgg tactggtacg cccttcctat gtacttggcg gccgggcgat ggagattgtt 2160

taccatgaag aggaactgct tcattacatg aaaaatgcag tcaaaatcaa tccacagcac 2220

cctgtattaa ttgatagata cttgaccgga aaagaaattg aagtcgatgc agtatccgac 2280

ggtgaaacag tcgtcattcc gggaattatg gagcacattg aacgtgcggg cgttcactcc 2340

ggagactcaa tcgctgttta tccgcctcag tctctcacag aggacattaa gaaaaaaatt 2400

gaacaataca cgatcgcatt ggctaaaggg ctgaatattg tcggtttgct caatattcaa 2460

ttcgtcttgt cgcaaggcga ggtgtacgtg ctagaagtga atccgagatc aagcagaacc 2520

gtaccgtttt taagcaaaat tacgggtatc ccaatggcga atctcgcaac aaaaatcatt 2580

cttggtcaaa agctggctgc gtttggctat acagagggcc ttcagcctga acagcaaggt 2640

gtatttgtaa aagcgccggt cttctccttt gccaagctga gaagagtgga tattacgtta 2700

gggcctgaaa tgaaatcaac aggtgaagtc atggggaaag attcgacact tgaaaaggcg 2760

ctctacaaag ccttgatcgc ttcaggtatt caaatcccga actacggttc cgtgctttta 2820

acagtagctg ataaggacaa agaagaaggg cttgccattg ctaagcggtt ccacgcgatc 2880

ggctacaaca ttttagcgac ggaaggaacg gcaggctacc tgaaagaagc ttccattcca 2940

gcgaaggtcg tcggaaaaat cggtcaggat ggcccgaact tgcttgatgt catcagaaac 3000

ggagaagcgc agtttgtcat caatacgctg acaaaaggaa agcagccggc aagagacggt 3060

tttagaatca gacgtgaatc agtagaaaat ggtgttgcct gcctaacatc tttagatacg 3120

gcagaggcga tattgcgagt gctggaaagc atgacattcc gtgctgatca aatgccggca 3180

gtcaacacaa atcaggaggc ggcagtcact atatga 3216

<210> 13

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

gtcagcaagg ccgaattttt c 21

<210> 14

<211> 52

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

aacgttccaa tgaaagacgg ggaaataaca gacgatacac gtatccgtgc tg 52

<210> 15

<211> 54

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

cacggatacg tgtatcgtct gttatttccc cgtctttcat tggaacgtta aagt 54

<210> 16

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 16

cgtttgcaaa agtacttaac ga 22

<210> 17

<211> 52

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 17

aacgttccaa tgaaagacgg ggaactaaca gacgatacac gtatccgtgc tg 52

<210> 18

<211> 54

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 18

cacggatacg tgtatcgtct gttagttccc cgtctttcat tggaacgtta aagt 54

<210> 19

<211> 52

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 19

acgttccaat gaaagacggg gaagcaacag acgatacacg tatccgtgct gc 52

<210> 20

<211> 54

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 20

gcacggatac gtgtatcgtc tgttgcttcc ccgtctttca ttggaacgtt aaag 54

<210> 21

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 21

ctgaacaaac ggaaatgtga c 21

<210> 22

<211> 52

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 22

acaatgacag ggaatccaat ttgaatgacg aatttttctg cttcttcaag gg 52

<210> 23

<211> 51

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 23

ttgaagaagc agaaaaattc gtcattcaaa ttggattccc tgtcattgtc c 51

<210> 24

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 24

aactgtacga ttccgaacag c 21

<210> 25

<211> 52

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 25

acaatgacag ggaatccaat ttgaaggacg aatttttctg cttcttcaag gg 52

<210> 26

<211> 52

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 26

cttgaagaag cagaaaaatt cgtccttcaa attggattcc ctgtcattgt cc 52

<210> 27

<211> 52

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 27

ggacaatgac agggaatcca atttgaacga cgaatttttc tgcttcttca ag 52

<210> 28

<211> 52

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 28

cttgaagaag cagaaaaatt cgtcgttcaa attggattcc ctgtcattgt cc 52

Claims (10)

1. Protein mutants which are phosphoglycerate kinase mutants and/or pyrimidine-specific carbamoyl phosphate synthase mutants,

using a Bacillus subtilis wild-type phosphoglycerate kinase as a reference sequence, wherein the phosphoglycerate kinase mutant contains a mutation replacing valine at position 31 with an amino acid other than valine,

using Bacillus subtilis wild-type pyrimidine-specific carbamoyl phosphate synthase as a reference sequence, the pyrimidine-specific carbamoyl phosphate synthase mutant contains a mutation in which serine at position 160 is substituted with an amino acid other than serine.

2. The protein mutant according to claim 1, wherein the phosphoglycerate kinase mutant has a mutation in which valine at position 31 is replaced with isoleucine, leucine or alanine, using Bacillus subtilis wild-type phosphoglycerate kinase as a reference sequence,

and/or, a wild-type Bacillus subtilis pyrimidine-specific carbamoyl phosphate synthase mutant comprising a mutation replacing serine at position 160 with isoleucine, leucine or valine as a reference sequence;

preferably, the phosphoglycerate kinase mutant has an amino acid sequence as shown in any one of SEQ ID NO.1-3,

and/or the pyrimidine-specific carbamoyl phosphate synthase mutant has an amino acid represented by any one of SEQ ID No. 7-9.

3. A gene encoding the protein mutant according to claim 1 or 2.

4. A biomaterial containing a gene according to claim 3, characterized in that it is a recombinant DNA, a vector or a host cell.

5. Use of a protein mutant as defined in claim 1 or 2 or a gene as defined in claim 3 or a biomaterial as defined in claim 4 in any one of the following applications:

(1) Use in the fermentative production of nucleosides or derivatives thereof;

(2) Use in the construction of a strain producing a nucleoside or a derivative thereof;

(3) Use in increasing the yield and/or conversion of a nucleoside or derivative thereof.

6. A recombinant microorganism having a reduced expression level and/or enzyme activity of one or two enzymes selected from the group consisting of phosphoglycerate kinase and pyrimidine-specific carbamoyl phosphate synthase.

7. The recombinant microorganism according to claim 6, wherein the recombinant microorganism expresses the protein mutant of claim 1 or 2 without expressing one or two enzymes selected from phosphoglycerate kinase, pyrimidine-specific carbamoyl phosphate synthase, which the starting strain has;

preferably, in said recombinant microorganism, the genes encoding phosphoglycerate kinase and/or pyrimidine-specific carbamoyl phosphate synthase are replaced by the genes according to claim 3;

more preferably, the recombinant microorganism is a bacillus bacterium.

8. The method for constructing a recombinant microorganism according to claim 6 or 7, comprising: inserting, deleting or substituting one or more bases into a gene encoding phosphoglycerate kinase and/or pyrimidine-specific carbamoyl phosphate synthase in the starting strain so that the enzymatic activity of phosphoglycerate kinase and/or pyrimidine-specific carbamoyl phosphate synthase is decreased;

or replacing the transcriptional and/or translational regulatory elements of the gene encoding phosphoglycerate kinase and/or pyrimidine-specific carbamoyl phosphate synthase in the starting strain with less active regulatory elements, such that the expression level of phosphoglycerate kinase and/or pyrimidine-specific carbamoyl phosphate synthase is reduced;

preferably, the method comprises: a method for producing a mutant strain of a microorganism, which comprises mutating a gene encoding phosphoglycerate kinase and/or pyrimidine-specific carbamoyl phosphate synthase to the gene of claim 3.

9. The recombinant microorganism of claim 6 or 7 for use as any one of:

(1) Use in the fermentative production of a nucleoside or derivative thereof;

(2) Use in the construction of a strain producing a nucleoside or a derivative thereof;

(3) Use in increasing the yield and/or conversion of a nucleoside or derivative thereof.

10. A method for producing a nucleoside or a derivative thereof by fermentation, comprising the step of culturing the recombinant microorganism according to claim 6 or 7.