CN115475253B - Lapatinib-cancer cell stem inhibitor conjugate, preparation method, pharmaceutical composition and application - Google Patents

Lapatinib-cancer cell stem inhibitor conjugate, preparation method, pharmaceutical composition and application Download PDF

Info

Publication number
CN115475253B
CN115475253B CN202110598974.4A CN202110598974A CN115475253B CN 115475253 B CN115475253 B CN 115475253B CN 202110598974 A CN202110598974 A CN 202110598974A CN 115475253 B CN115475253 B CN 115475253B
Authority
CN
China
Prior art keywords
acid
conjugate
lapatinib
cells
compounds
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202110598974.4A
Other languages
Chinese (zh)
Other versions
CN115475253A (en
Inventor
苟少华
王园江
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Southeast University
Original Assignee
Southeast University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Southeast University filed Critical Southeast University
Priority to CN202110598974.4A priority Critical patent/CN115475253B/en
Publication of CN115475253A publication Critical patent/CN115475253A/en
Application granted granted Critical
Publication of CN115475253B publication Critical patent/CN115475253B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/54—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound
    • A61K47/55—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound the modifying agent being also a pharmacologically or therapeutically active agent, i.e. the entire conjugate being a codrug, i.e. a dimer, oligomer or polymer of pharmacologically or therapeutically active compounds
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/335—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin
    • A61K31/34—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin having five-membered rings with one oxygen as the only ring hetero atom, e.g. isosorbide
    • A61K31/343—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin having five-membered rings with one oxygen as the only ring hetero atom, e.g. isosorbide condensed with a carbocyclic ring, e.g. coumaran, bufuralol, befunolol, clobenfurol, amiodarone
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • A61K31/505—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim
    • A61K31/517—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim ortho- or peri-condensed with carbocyclic ring systems, e.g. quinazoline, perimidine
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/54—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with at least one nitrogen and one sulfur as the ring hetero atoms, e.g. sulthiame
    • A61K31/5415—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with at least one nitrogen and one sulfur as the ring hetero atoms, e.g. sulthiame ortho- or peri-condensed with carbocyclic ring systems, e.g. phenothiazine, chlorpromazine, piroxicam
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D405/00—Heterocyclic compounds containing both one or more hetero rings having oxygen atoms as the only ring hetero atoms, and one or more rings having nitrogen as the only ring hetero atom
    • C07D405/14—Heterocyclic compounds containing both one or more hetero rings having oxygen atoms as the only ring hetero atoms, and one or more rings having nitrogen as the only ring hetero atom containing three or more hetero rings
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D417/00—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and sulfur atoms as the only ring hetero atoms, not provided for by group C07D415/00
    • C07D417/14—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and sulfur atoms as the only ring hetero atoms, not provided for by group C07D415/00 containing three or more hetero rings

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Veterinary Medicine (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Epidemiology (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

The invention discloses a lapatinib-cancer cell stem inhibitor conjugate, a preparation method, a pharmaceutical composition and application. The conjugate has a structure shown in a formula (I), has remarkable anticancer activity on molecular level and cell level, can effectively promote cytotoxicity of a parent compound lapatinib, can effectively inhibit cancer cell stem property, can reverse lapatinib-mediated cell drug resistance, reduces toxicity to normal cells, has potential for preparing a drug for treating breast cancer, and has a simple and convenient synthesis method and easy operation.

Description

Lapatinib-cancer cell stem inhibitor conjugate, preparation method, pharmaceutical composition and application
Technical Field
The invention relates to a lapatinib-cancer cell stem inhibitor conjugate, a preparation method, a pharmaceutical composition and application thereof, in particular to a lapatinib-cancer cell stem inhibitor conjugate which can be prepared into a cancer treatment substance, a preparation method, a pharmaceutical composition and application thereof.
Background
According to the global latest cancer statistics issued by the world health organization international cancer research institute, 226 ten thousand new breast cancer patients worldwide in 2020, more than lung cancer (221 ten thousand) become the first global cancer for the first time. China is a large country of breast cancer, about 42 tens of thousands of new breast cancers occur in the current year, and nearly 12 tens of thousands of patients die. The metastatic Triple Negative Breast Cancer (TNBC) has the characteristics of easy recurrence and metastasis and insensitivity to hormone therapy and targeted therapy due to the lack of effective treatment targets, and shows higher mortality. The treatment methods generally available for early TNBC are generally chemotherapy only, but most patients develop resistance soon, resulting in poor post-healing. With the continuous progress of science and technology and the continuous improvement of medical level, medical researchers have developed a number of new treatment methods aiming at the individuation characteristics of clinical pathology of breast cancer. Although these new treatments have been widely used, many TNBC patients still relapse after healing, with high long-term mortality rates, indicating that current treatments for TNBC remain highly uncertain. It is now generally accepted that intratumoral heterogeneity of breast cancer leads to tumor resistance, metastasis, recurrence and high mortality.
Intratumoral heterogeneity of TNBC is driven by a subpopulation of tumor cells known as Breast Cancer Stem Cells (BCSCs). Unlike general cancer cells, BCSCs are a subpopulation of tumor cells with sustained self-renewal, differentiation and high tumorigenicity, playing a key role in tumorigenesis, drug resistance, recurrence, invasion, metastasis, etc. Worse yet, most clinical chemotherapeutic agents, when used to treat BCSCs, not only increase expression of existing BCSCs markers, but also promote the conversion of non-stem cells to BCSCs.
The Epidermal Growth Factor Receptor (EGFR) is a tyrosine kinase receptor involved in cell growth and survival, and is involved in the processes of proliferation, angiogenesis, tumor invasion, metastasis, apoptosis and the like of tumor cells. It is counted that approximately 50% of TNBC patients overexpress EGFR, resulting in reduced estrogen and poor healing in the patient. Early studies have demonstrated that abnormal activation of EGFR in cancer cells, particularly uncontrolled proliferation, metastasis, invasion and resistance of TNBC cells, can result due to genetic mutations and over-expression of certain proteins. However, EGFR treatment based on kinase inhibitors or monoclonal antibodies alone is difficult to achieve effective therapeutic effects in TNBC treatment. Lapatinib (lapatinib) is a small molecule tyrosine kinase inhibitor targeting HER2 and EGFR and is used to treat advanced or metastatic breast cancer. Recent researches show that lapatinib has a certain capability of inhibiting cancer cell stem property, but has weak inhibition activity, and the lapatinib is difficult to take effect when taken alone.
Disclosure of Invention
The invention aims to: the first object of the invention is to provide a lapatinib-cancer cell stem inhibitor conjugate or pharmaceutically acceptable salt thereof, the second object is to provide a preparation method of the conjugate or pharmaceutically acceptable salt thereof, the third object is to provide a pharmaceutical composition containing the conjugate and/or pharmaceutically acceptable salt thereof, and the fourth object is to provide application of the conjugate or the pharmaceutical composition thereof in preparing medicines for treating cancers or reversing drug resistance.
The technical scheme is as follows: the lapatinib-cancer cell stem inhibitor conjugate has a structure shown in a formula (I), wherein the derivative is an isomer, a diastereoisomer, an enantiomer, a tautomer, a solvate, a salt of a solvate, a pharmaceutically acceptable salt or a mixture of the isomers and the diastereoisomer, the enantiomer, the tautomer, the solvate and the salt of the solvate of the compound:
wherein:
is->
R is chlorine or trifluoromethyl;
n is 1 or 2.
The invention provides a conjugate of lapatinib and a cancer cell stem inhibitor by introducing a derivative with a cancer cell stem inhibiting drug into a parent structure of a known breast cancer targeting drug lapatinib through an amide bond and an ester bond. The compound has obvious anticancer activity, is found to be capable of effectively inhibiting cancer cell stem property, and realizes excellent synergistic effect.
Preferably, in the conjugate structure:
r is chlorine.
More specifically, the coupling agent is any one of the following compounds:
further, the conjugate forms a pharmaceutically acceptable salt with an acid or base, wherein the acid is hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid, methanesulfonic acid, benzenesulfonic acid, p-toluenesulfonic acid, naphthalenesulfonic acid, citric acid, malic acid, tartaric acid, lactic acid, pyruvic acid, acetic acid, maleic acid, succinic acid, fumaric acid, salicylic acid, phenylacetic acid, or mandelic acid, and the base is an inorganic base containing a basic metal cation, alkaline earth metal cation, or ammonium cation salt.
The preparation method of the conjugate or the pharmaceutically acceptable salt thereof comprises the following steps:
any one of the compounds 1-2 and any one of the compounds 3-5 are subjected to esterification reaction to obtain a conjugate (I);
adding corresponding acid or alkali into the solution of the conjugate (I) prepared by the method, and removing the solvent after complete salification to obtain the pharmaceutically acceptable salt of the conjugate.
The preparation method of the compound 5 comprises the following steps:
the 3-butene-2-ketone is subjected to bromination reaction to obtain 1, 2-dibromobutanone, then nucleophilic substitution reaction is carried out with 2-hydroxy-1, 4-naphthoquinone, and then cyclization, oxidation and reduction reaction are carried out to obtain the compound 5.
The preparation method of the compounds 3 to 4 comprises the following steps:
2-chlorophenothiazine (perphenazine) and 2- (trifluoromethyl) phenothiazine (fluphenazine) are taken as raw materials to respectively carry out substitution reaction with 1-bromo-3-chloropropane to obtain an intermediate, and then the intermediate and 1- (2-hydroxyethyl) piperazine are subjected to substitution reaction to obtain the product.
Wherein when r=cl, the resulting product is compound 3; when r=cf 3 In this case, the product obtained is compound 4.
The pharmaceutical composition of the invention comprises the conjugate and/or a pharmaceutically acceptable salt thereof and a pharmaceutically acceptable carrier.
The conjugate and/or pharmaceutically acceptable salt thereof can be added with pharmaceutically acceptable carriers to prepare common medicinal preparations, such as tablets, capsules, syrup, suspending agents or injection, and the preparations can be added with common medicinal auxiliary materials such as perfume, sweetener, liquid/solid filler, diluent and the like.
The conjugate or pharmaceutically acceptable salt thereof and the application of the pharmaceutical composition in preparing medicines for treating cancers or reversing drug resistance; the cancer is breast cancer, especially triple negative breast cancer.
The beneficial effects are that: compared with the prior art, the invention has the following remarkable advantages:
(1) The conjugate has remarkable anticancer activity at molecular level and cell level, and optimally reaches the inhibition level of nanomolar concentration enzyme; can effectively promote cytotoxicity of the parent compound Lapatinib and effectively inhibit cancer cell stem property; but also can reverse the lapatinib-mediated cell drug resistance, reduce the toxicity to normal cells, and has the potential of preparing the medicine for treating breast cancer;
(2) The conjugate and the pharmaceutical composition have wide application, and can be prepared into medicines for treating cancers or reversing drug resistance; the medicine can exert the medicine effect at the molecular level and the cellular level, and has more excellent treatment effect;
(3) The synthesis method of the conjugate is simple and convenient and is easy to operate.
Drawings
FIG. 1 shows Western blot analysis of intracellular EGFR and downstream signaling pathway related protein expression levels;
in fig. 2: (A) Inhibition profile of the compounds tested for exogenous ALDH1A1 enzyme activity; (B) quantitative analysis of the transcription level of ALDH1A1 gene in MDA-MB-231/lapatinib cells by qRT-PCR;
FIG. 3 shows the expression level of the stem related protein in MDA-MB-231/lapatinib cells by immunoWestern blot analysis;
FIG. 4 shows qRT-PCR analysis of MDA-MB-231/lapatinib CD44+ Intracellular CSCs surface antigen transcript levels;
in fig. 5: (A) MDA-MB-231/lapatinib CD44+ Tumor sphere volume of cellular origin; (B) MDA-MB-231/lapatinib CD44+ Number of cell-derived tumor spheres.
Detailed Description
The technical scheme of the invention is further described below by referring to examples.
All reagents are analytically pure, and nuclear magnetic data used for structural characterization of the compounds are determined by a Bruker ARX-600 nuclear magnetic resonance instrument, and an internal standard is TMS; high resolution mass spectra were determined using an Agilent6224 TOF LC/MS instrument.
Example 1: synthesis of intermediates
(1) Synthesis of Compounds 1-2
Synthesis of Compound 1: 0.6g (1.0 mmol) of lapatinib, 0.2g (1.5 mmol) of succinic anhydride, 0.2g (2.0 mmol) of triethylamine and 15mL of dichloromethane are weighed into a 50mL eggplant-shaped bottle, stirred overnight at room temperature and the reaction is detected to be complete by TLC. The excess solvent was removed by concentrating under reduced pressure, then 30mL of water was added, stirred at 60℃for 2h, suction filtration, and the cake was washed three times with water (10 mL. Times.3) to give a crude product of Compound 1, which was recrystallized from 10mL of methanol to give 0.64g of a bright yellow solid product in 94.0% yield. 1 H NMR(600MHz,DMSO-d 6 )δ12.24(s,1H),10.01(d,J＝23.4Hz,1H),8.77(d,J＝23.3Hz,1H),8.57(s,1H),8.21-8.13(m,1H),8.04(dd,J＝12.2,2.0Hz,1H),7.80(dd,J＝8.6,4.4Hz,1H),7.76(dd,J＝8.6,2.4Hz,1H),7.48(dd,J＝14.2,7.8Hz,1H),7.34(t,J＝9.2Hz,2H),7.30-7.27(m,1H),7.21-7.18(m,1H),7.12-7.06(m,1H),6.60-6.50(m,1H),5.27(s,2H),4.76(s,1H),4.69(s,1H),3.87(t,J＝6.2Hz,1H),3.74(t,J＝4.6Hz,1H),3.59(s,2H),3.07(s,1H),3.03(s,2H),2.86-2.81(m,2H),2.47(dd,J＝6.8,4.8Hz,2H)ppm.HR-MS(m/z)(ESI):calcd for C 33 H 30 ClFN 4 O 7 S[M+H] + :681.1581；found:681.1582.
Synthesis of Compound 2: using 0.6g (1.0 mmol) of lapatinib and 0.2g (1.5 mmol) of glutaric anhydride as raw materials, the synthesis of compound 1 was referenced to give 0.63g of a yellow solid product in 91.2% yield. 1 H NMR(600MHz,DMSO-d 6 )δ12.06(s,1H),9.88(s,1H),8.74(d,J＝4.8Hz,1H),8.57(d,J＝5.5Hz,1H),8.14(t,J＝8.0Hz,1H),8.04(dd,J＝7.1,2.1Hz,1H),7.82(t,J＝8.9Hz,1H),7.75(d,J＝8.8Hz,1H),7.48(dd,J＝14.1,7.7Hz,1H),7.34(t,J＝9.9Hz,2H),7.30(d,J＝9.0Hz,1H),7.22-7.17(m,1H),7.08(dd,J＝15.4,3.1Hz,1H),6.58(dd,J＝59.3,2.9Hz,1H),5.27(s,2H),4.72(d,J＝21.1Hz,2H),3.85-3.74(m,2H),3.59-3.54(m,1H),3.37(dd,J＝14.5,7.4Hz,2H),3.05(d,J＝10.5Hz,3H),2.60(t,J＝7.2Hz,1H),2.35-2.28(m,2H),1.86-1.77(m,2H)ppm.HR-MS(m/z)(ESI):calcd for C 34 H 32 ClFN 4 O 7 S[M+H] + :695.1737；found:695.1734.
(2) Synthesis of Compounds 3 to 4
Synthesis of Compound 3: 0.4g (10.1 mmol) of 60% NaH and 10mL of DMF are weighed into a 50mL eggplant-shaped bottle, 1.2g (5.0 mmol) of 2-chlorophenothiazine solution dissolved in 6mL of DMF is slowly added dropwise into the DMF solution containing NaH, stirring is carried out for 1h at room temperature, 1.6g (10.0 mmol) of 1-bromo-3-chloropropane solution dissolved in 8mL of DMF is slowly added dropwise into the reaction solution at 0 ℃, then the reaction is slowly warmed to room temperature, the reaction is continued for 4-6h, and TLC detects that the 2-chlorophenothiazine reaction is complete. The reaction solution was poured into an appropriate amount of saturated brine, extracted with dichloromethane (10 mL. Times.3), and the organic layer was collected, dried over anhydrous sodium sulfate, and concentrated in vacuo to give a crude product of 2-chloro-10- (3-chloropropyl) phenothiazine without further purification. 0.3g (1.1 mmol) of 2-chloro-10- (3-chloropropyl) phenothiazine and 5mL of DMF are weighed and placed inIn a 50mL eggplant-shaped bottle, 0.2g (1.1 mmol) of 1- (2-hydroxyethyl) piperazine, 0.3g (3.2 mmol) of triethylamine and 0.4g (2.1 mmol) of potassium iodide were slowly added with stirring, then slowly warmed to 80℃and reacted for 2 hours with stirring. After the reaction was completed, 30mL of saturated brine was added, extracted with dichloromethane (20 ml×3), the organic layer was collected, dried over anhydrous sodium sulfate, concentrated in vacuo, purified by column chromatography with DCM: meoh=100:1 to 50:1 as eluent, to finally yield 0.41g of a white solid product in 82.2% yield. 1 H NMR(600MHz,CDCl 3 )δ7.16-7.13(m,1H),7.11(dd,J＝7.6,1.4Hz,1H),7.00(d,J＝8.1Hz,1H),6.92(td,J＝7.5,1.0Hz,1H),6.90-6.86(m,2H),6.84(d,J＝2.0Hz,1H),3.89(t,J＝6.9Hz,2H),3.61-3.57(m,2H),2.79(s,1H),2.62-2.35(m,12H),1.96-1.90(m,2H)ppm.
Synthesis of Compound 4: the synthesis method of the compound 3 is referenced by taking 2- (trifluoromethyl) phenothiazine, 1-bromo-3-chloropropane and 1- (2-hydroxyethyl) piperazine as raw materials, and finally 0.45g of white solid product is obtained, and the yield is 75.4%. 1 H NMR(600MHz,CDCl 3 )δ7.20-7.15(m,2H),7.14(d,J＝8.1Hz,1H),7.11(dd,J＝7.6,1.3Hz,1H),7.04(s,1H),6.95(t,J＝7.5Hz,1H),6.91(d,J＝8.1Hz,1H),3.97(t,J＝6.7Hz,2H),3.65(t,J＝5.3Hz,2H),3.27(s,1H),2.56(ddd,J＝20.5,12.4,6.3Hz,12H),1.95(p,J＝6.9Hz,2H)ppm.
(3) Synthesis of Compound 5
Synthesis of BBI 608: 23.0g (0.14 mol) of liquid bromine and 20mL of anhydrous methylene chloride were weighed into a 100mL eggplant-shaped bottle and cooled to-10 ℃. 10g (0.14 mol) of 3-butene-2-one was dissolved in 20mL of anhydrous dichloromethane, and the solution was slowly added dropwise to a dichloromethane solution of liquid bromine, and after the completion of the dropwise addition, the temperature was slowly raised to 0℃and the reaction was continued for 20 minutes. After the reaction was completed, 50mL of a saturated aqueous sodium thiosulfate solution was added, the organic layer was separated, washed once with water, washed once with saturated brine, dried over anhydrous sodium sulfate, and concentrated under reduced pressure to give a crude 1, 2-dibromo-3-butanone product which was directly used for the next reaction without further purification.
31.6g (0.14 mol) of 1, 2-dibromo-3-butanone and 30mL of DMF were weighed into a 250mL eggplant-shaped bottle and cooled to-10 ℃. 21.9g (0.14 mol) of 1, 8-diazabicyclo undec-7-ene (DBU) was dissolved in 20mL of DMF and slowly added dropwise to a solution of 1, 2-dibromo-3-butanone in DMF at a temperature below 0deg.C. Stirring was continued for 30min after the completion of the dropwise addition, 20.2g (0.12 mol) of 2-hydroxy-1, 4-naphthoquinone was added, then the temperature was raised to 30℃and a DMF solution (10 mL) containing 27.1g (0.16 mol) of DBU was added dropwise, and the reaction temperature was controlled to be not more than 50 ℃. After the completion of the dropwise addition, the reaction was carried out at 50℃for 3 hours. After the reaction, the reaction solution was slowly poured into 1.5L of an ice-water mixture, the reaction temperature was controlled to be below 0 ℃, and the reaction was continued with stirring for 2 hours. Suction filtration, washing of the filter cake once with water (50 mL), washing with 5% aqueous sodium bicarbonate (50 mL), washing with 2% aqueous glacial acetic acid (50 mL), washing with glacial ethanol (50 mL), vacuum drying gave 12.75g of brown solid, which was recrystallized from ethyl acetate to give 7.8g of yellow solid product in 27.0% yield. 1 H NMR(600MHz,DMSO-d 6 )δ8.16-8.11(m,2H),8.03(s,1H),7.93-7.89(m,2H),2.60(s,3H).
Synthesis of Compound 5: 5.0g (20.83 mmol) of BBI608, 40mL of DMF and 2mL of water were placed in a 100mL eggplant-shaped bottle, 0.8g (21.1 mmol) of sodium borohydride was slowly added in portions, the reaction temperature was controlled below 30℃and the reaction was carried out at room temperature for 3 hours after the addition was completed. The reaction solution was poured into 200mL of an aqueous solution containing 2% hydrochloric acid, and the reaction was continued with stirring for 2 hours. The organic layer was collected by extraction with ethyl acetate (20 mL. Times.3), washed once with 30mL of water and 30mL of saturated brine, and the organic layer was concentrated under reduced pressure to give a crude product, which was recrystallized from ethyl acetate to give 4.6g of a yellow solid product in 90.8% yield. 1 H NMR(600MHz,DMSO-d 6 )δ8.10-8.05(m,2H),7.89-7.84(m,2H),6.90(s,1H),5.82(d,J＝5.5Hz,1H),4.88(p,J＝6.4Hz,1H),1.48(d,J＝6.6Hz,3H)ppm.
Example 2: preparation of Compound 6
Weigh 0.3g (0.5 mmol) of Compound 1, 0.2g (0.6 mmol) of TBTU and 10 mM LDMF in a 25mL eggplant bottleStirring at 45℃for 10min, adding 0.1g (1.0 mmol) of TEA, stirring for 10min, adding 0.2g (0.5 mmol) of Compound 3, stirring at 45℃for 12-16h, and detecting completion of the reaction by TLC. Then a small amount of 200-300 mesh silica gel was added for sample mixing, column chromatography purification, eluent DCM: meoh=100:1-50:1, finally obtaining 0.34g of yellow solid product with a yield of 63.2%. 1 H NMR(600MHz,DMSO-d 6 )δ9.98(d,J＝17.5Hz,1H),8.85(d,J＝13.2Hz,1H),8.57(d,J＝5.2Hz,1H),8.16(dd,J＝26.9,8.7Hz,1H),8.07(dd,J＝6.4,2.3Hz,1H),7.81(d,J＝8.7Hz,2H),7.47(dd,J＝14.4,7.4Hz,1H),7.34(t,J＝9.3Hz,2H),7.28(d,J＝9.0Hz,1H),7.18(dd,J＝8.0,4.9Hz,3H),7.12(t,J＝8.4Hz,2H),7.05-7.01(m,2H),6.98-6.93(m,2H),6.59(dd,J＝79.9,3.0Hz,1H),5.76(s,1H),5.27(s,2H),4.72(d,J＝40.7Hz,2H),4.06(d,J＝36.4Hz,2H),3.93-3.83(m,3H),3.77-3.73(m,1H),3.61-3.55(m,1H),3.39-3.32(m,3H),3.07(s,1H),3.03(s,2H),2.90(t,J＝6.1Hz,1H),2.80-2.75(m,1H),2.61-2.57(m,2H),2.44(s,2H),2.34(s,6H),1.75(s,2H),1.22(s,1H)ppm. 13 C NMR(150MHz,DMSO-d 6 )δ172.83,172.00,163.49,161.88,158.01,154.87,153.03,151.56,150.18,149.48,146.65,144.34,δ140.13(d,J＝7.5Hz),133.63,132.90,131.05,131.00,128.95,128.47,128.22,127.63,124.74,124.58,123.78,123.41,122.93,122.74,122.49,121.53,117.61,116.69,116.14,115.83,115.23,115.10,114.73,114.56,114.42,111.42,108.38,69.88,61.82,56.30,55.39,54.92,52.08,51.74,44.93,41.87,41.26,41.11,29.42,28.30,27.78ppm.C 54 H 54 Cl 2 FN 7 O 7 S 2 [M+H] + :1066.2960；found:1066.2960.
Example 3: preparation of Compound 7
The synthesis of reference compound 6 finally gave the product as a yellow solid in 57.8% yield. 1 H NMR(600MHz,DMSO-d 6 )δ10.41(d,J＝18.5Hz,1H),9.20(d,J＝34.5Hz,1H),8.56(s,1H),8.22-8.17(m,1H),8.12(t,J＝9.0Hz,1H),7.93(t,J＝9.7Hz,1H),7.80(d,J＝8.6Hz,1H),7.48(dd,J＝14.5,7.4Hz,1H),7.39(d,J＝2.6Hz,1H),7.34(t,J＝8.8Hz,2H),7.27(d,J＝9.1Hz,1H),7.19(t,J＝8.0Hz,2H),7.14-7.10(m,2H),7.05-7.01(m,2H),6.95(dd,J＝9.2,7.9Hz,2H),6.63-6.50(m,1H),5.27(s,2H),4.70(d,J＝20.0Hz,2H),4.08(d,J＝15.2Hz,2H),3.88(dd,J＝14.4,8.3Hz,2H),3.83-3.79(m,1H),3.78-3.75(m,1H),3.60-3.55(m,1H),3.37(d,J＝8.5Hz,2H),3.06(s,1H),3.04(s,2H),2.61(t,J＝7.2Hz,2H),2.54(d,J＝6.7Hz,1H),2.47(d,J＝17.1Hz,3H),2.41-2.38(m,3H),2.36(d,J＝7.4Hz,3H),2.21-2.16(m,1H),1.83(td,J＝13.9,7.1Hz,2H),1.75(s,2H),1.22(s,2H)ppm. 13 C NMR(150MHz,DMSO-d 6 )δ173.12,172.65,163.48,161.87,158.10,154.82,153.03,151.46,150.03,149.40,146.65,144.32,140.18(d,J＝7.6Hz),133.85,132.89,131.05,131.00,128.82,128.56,128.46,128.38,128.22,127.61,124.59,123.78,123.40,122.85,122.48,121.36,118.46,116.69,116.13,115.99,115.19,115.08,114.62,114.56,114.41,111.40,108.79,69.87,61.57,56.37,55.42,54.87,52.02,51.71,44.94,41.29,41.11,33.27,31.91,31.45,29.48,20.63ppm.C 55 H 56 Cl 2 FN 7 O 7 S 2 [M+H] + :1080.3116；found:1080.3118.
Example 4: preparation of Compound 8
The synthesis of reference compound 6 finally gave the product as a yellow solid in 62.8% yield. 1 H NMR(600MHz,DMSO-d 6 )δ9.91(d,J＝17.7Hz,1H),8.78(d,J＝11.5Hz,1H),8.56(d,J＝6.6Hz,1H),8.16(ddd,J＝29.4,8.7,1.3Hz,1H),8.04(dd,J＝5.8,2.5Hz,1H),7.80(dd,J＝8.7,3.5Hz,1H),7.76(dd,J＝8.8,2.0Hz,2H),7.47(dd,J＝14.0,7.9Hz,1H),7.33(t,J＝9.8Hz,2H),7.29(d,J＝9.0Hz,2H),7.19(dd,J＝8.8,2.2Hz,2H),7.17(d,J＝2.5Hz,3H),7.14(d,J＝3.2Hz,1H),7.09(d,J＝3.2Hz,1H),6.58(dd,J＝80.0,3.2Hz,1H),5.27(s,2H),4.72(d,J＝25.5Hz,2H),4.18-4.11(m,2H)，3.87-3.82(m,2H),3.75-3.71(m,2H),3.60-3.55(m,2H),3.57-3.53(m,2H),3.40-3.34(m,2H),3.04(d,J＝12.2Hz,3H),2.83(dt,J＝64.6,6.2Hz,4H),2.59(dd,J＝14.0,7.8Hz,2H),1.94-1.86(m,4H),1.85-1.80(m,2H),1.38-1.32(m,2H)ppm. 13 C NMR(150MHz,DMSO-d 6 )δ173.43,172.03,163.49,161.88,158.02,154.86,152.02,151.57,150.19,149.47,146.05,144.62,143.15,140.16,133.61,131.05,129.96,128.95,128.56,128.36,127.98,127.40,124.75,124.62,123.81,122.79,121.53,119.96,117.57,115.82,115.23,115.09,114.75,114.58,114.43,112.53,111.39,111.18,108.38,69.87,61.11,55.67,54.12,52.05,51.72,44.87,41.87,41.26,41.10,29.30,29.15,28.27,27.80ppm.C 55 H 54 ClF 4 N 7 O 7 S 2 [M+H] + :1100.3224；found:1100.3221.
Example 5: preparation of Compound 9
The synthesis of reference compound 6 finally gave the product as a yellow solid in 59.4% yield. 1 H NMR(600MHz,DMSO-d 6 )δ10.03(s,1H),8.86(m,dd,J＝12.4,8.2Hz,1H),8.57(s,1H),8.13(t,J＝8.9Hz,1H),8.09-8.04(d,J＝9.8Hz,1H),7.95(d,J＝5.5Hz,1H),7.85-7.77(m,2H),7.67(d,J＝5.5Hz,1H),7.48(dd,J＝10.3,5.3Hz,2H),7.38-7.31(m,2H),7.31-7.23(m,2H),7.18(t,J＝5.2Hz,3H),7.10-7.06(m,1H),7.00(t,J＝4.9Hz,1H),6.65-6.50(m,1H),5.27(s,2H),4.71(d,J＝13.9Hz,2H),4.15-4.08(m,2H),3.99(dd,J＝8.6,4.2Hz,2H),3.84-3.74(m,2H),3.61-3.53(m,1H),3.41-3.31(m,2H),3.04(d,J＝6.5Hz,3H),2.70(s,4H),2.60(dd,J＝8.8,4.1Hz,6H),2.38(dt,J＝9.7,4.8Hz,2H),1.94-1.87(m,2H),1.87-1.77(m,2H),1.39(s,1H),1.31-1.17(m,2H)ppm. 13 C NMR(150MHz,DMSO-d 6 )δ173.08,172.65,163.50,161.88,158.07,154.87,152.98,151.70,150.23,149.36,145.91,144.08,143.30,140.12,133.62,131.00,129.88,128.92,128.49,128.23,127.82,127.24,124.71,123.79,123.33,122.85,121.56,119.45,116.97,115.86,115.23,115.09,114.80,114.56,114.42,112.46,111.32,110.29,108.46,69.93,61.19,55.80,54.28,52.07,51.75,45.01,44.73,41.13,33.26,31.91,31.41,26.81,22.52,20.58ppm.C 56 H 56 ClF 4 N 7 O 7 S 2 [M+H] + :1144.3380；found:1114.3381.
Example 6: preparation of Compound 10
The synthesis of reference compound 6 finally gave the product as a yellow solid in 69.1% yield. 1 H NMR(600MHz,DMSO-d 6 )δ10.18(d,J＝28.6Hz,1H),8.98(s,1H),8.51(d,J＝23.8Hz,1H),8.13(t,J＝2.6Hz,1H),8.09-8.05(m,1H),8.02(dd,J＝6.5,2.2Hz,1H),8.01-7.98(m,1H),7.86(d,J＝8.9Hz,1H),7.84-7.80(m,2H),7.71(dd,J＝31.1,8.7Hz,1H),7.48(dd,J＝14.3,7.5Hz,1H),7.33(t,J＝9.6Hz,2H),7.27(dd,J＝8.9,5.6Hz,2H),7.22-7.17(m,1H),7.02(s,1H),6.58(dd,J＝85.2,3.1Hz,1H),6.01(dq,J＝27.9,6.6Hz,1H),5.26(d,J＝5.3Hz,2H),4.76(s,1H),4.70(dd,J＝25.6,15.8Hz,1H),3.90-3.85(m,1H),3.83-3.73(m,2H),3.61-3.55(m,1H),3.07(s,1H),3.05(s,2H),3.00-2.96(m,1H),2.87-2.83(m,1H),2.73-2.66(m,2H),1.60(d,J＝6.7Hz,1H),1.55(d,J＝6.7Hz,2H)ppm. 13 C NMR(150MHz,DMSO-d 6 )δ180.37,173.08,171.98,163.48,161.86,160.75,157.92,154.74,153.02,152.05,151.33,150.02,149.31,140.19,134.61,134.45,133.75,132.95,132.47,131.00,130.83,128.73,128.25,126.83,126.71,124.50,123.79,122.73,121.37,118.06,115.80,115.22,115.08,114.63,114.41,111.56,108.54,106.25,69.83,65.02,51.69,44.75,41.24,41.09,29.58,28.46,18.53ppm.HR-MS(m/z)(ESI):calcd for C 47 H 38 ClFN 4 O 10 S[M+H] + :905.2054；found:905.2057.
Example 7: preparation of Compound 11
The synthesis of reference compound 6 finally gave the product as a yellow solid in 67.6% yield. 1 H NMR(600MHz,DMSO-d 6 )δ10.36(d,J＝18.0Hz,1H),9.12(d,J＝18.2Hz,1H),8.47(d,J＝7.5Hz,1H),8.17(s,1H),8.05(dd,J＝11.1,5.5Hz,1H),8.01(ddd,J＝9.1,5.1,2.7Hz,2H),7.91(d,J＝8.6Hz,1H),7.86-7.79(m,2H),7.70(dd,J＝20.7,8.7Hz,1H),7.47(dd,J＝14.0,7.8Hz,1H),7.36-7.30(m,3H),7.26(d,J＝9.0Hz,1H),7.18(td,J＝8.7,2.2Hz,1H),7.06(s,1H),6.55(dd,J＝46.4,3.1Hz,1H),6.03(p,J＝6.7Hz,1H),5.26(s,2H),4.69(d,J＝16.3Hz,2H),3.82-3.71(m,2H),3.57(t,J＝8.7Hz,1H),3.04(d,J＝9.2Hz,3H),2.64(t,J＝7.2Hz,1H),2.58-2.54(m,1H),2.47(t,J＝7.5Hz,1H),1.91-1.82(m,2H),1.60(d,J＝6.7Hz,1H),1.57(d,J＝6.7Hz,2H),1.22(s,2H)ppm. 13 C NMR(150MHz,DMSO-d 6 )δ180.36,173.15,172.40,163.48,161.86,160.75,158.00,154.72,152.97,152.09,151.32,149.99,149.29,140.22,134.62,134.48,133.82,132.98,132.49,131.07,130.83,128.68,128.24,126.84,126.69,124.57,123.81,122.85,121.30,118.42,115.88,115.22,115.08,114.60,114.43,111.49,108.74,106.29,69.84,64.94,51.65,44.88,41.08,33.24,31.80,29.45,20.58,18.66ppm.HR-MS(m/z)(ESI):calcd for C 48 H 40 ClFN 4 O 10 S[M+H] + :919.2210；found:919.2212.
Example 8: cytotoxic Activity test of Compounds
1. Experimental method
The compounds 6 to 11 of the present invention were tested for cytotoxic activity using the MTT method. Taking cell count in logarithmic growth phase, inoculating into 96-well culture plate, and about 8000-10000 cells per well. After overnight incubation and after cell attachment, the administration was performed, and an administration group and a control group were set, respectively. The compounds to be tested are prepared as stock solutions with DMSO solutions and diluted to a range of concentrations with cell culture medium just prior to use, wherein the final DMSO concentration is no more than 4% per mill (similar to the experiments below). 3 duplicate wells were set for each concentration. After 72 hours of incubation after dosing, 20. Mu.L of MTT at a concentration of 5mg/mL was added, incubated for 4 hours at 37℃and the supernatant removed, and dissolved in 150. Mu.L of DMSO. Measuring OD value of each well at 490nM wavelength with enzyme labeling instrument, calculating inhibition rate, and calculating IC by concentration-inhibition rate curve 50 Values.
2. Experimental results
The target compounds were tested for their cytotoxic activity against human breast cancer cells MCF-7, human triple negative breast cancer cells MDA-MB-231, lapatinib-mediated MDA-MB-231, human umbilical vein endothelial cells HUVEC, using Lapatinib and its equimolar physical mixtures (mix-1, mix-2 and mix-3) with compounds 3, 4 and BBI608, respectively, as positive controls. Observing the inhibition of the compound on the growth of tumor cells at different concentrations, and calculating IC 50 The cytotoxic activity of the drug was evaluated and the results are shown in Table 1.
TABLE 1 in vitro cytotoxicity of Compounds
[a] RF (drug resistance factor) =ic 50 (MDA-MB-231/lapatinib)/IC 50 (MDA-MB-231)。
As can be seen from the data in Table 1, all conjugates of lapatinib and cancer cell stem inhibitor designed and synthesized are effective in increasing cytotoxicity against MCF-7 and MDA-MB-231, and generally more cytotoxic against MDA-MB-231 than against MCF-7 cells, as compared to lapatinib. More importantly, all target compounds can effectively reverse the drug resistance of MDA-MB-231/lapatinib cells, in particular to compound 6, which has an IC (integrated circuit) on MDA-MB-231/lapatinib cells 50 The value is 1.03 mu M, and the cytotoxicity is 28.5 times higher than that of lapatinib and 6.95 times higher than that of mix-1. In addition, the cytotoxicity of the conjugate compound 11 of lapatinib and BBI608 derivatives on MDA-MB-231/lapatinib cells is inferior to that of compound 6, IC thereof 50 The cytotoxicity was 17.69-fold and 3.07-fold higher than that of lapatinib and mix-3, respectively, at a value of 1.69. Mu.M. While compound 6 IC on HUVEC cells 50 The values were 89.23. Mu.M, which is significantly lower than that of lapatinib (47.31. Mu.M) and mix-1 (40.54. Mu.M). Compound 7 has minimal cytotoxicity on HUVEC cells and IC thereof 50 The value was 100.17. Mu.M. The physical mixture of lapatinib and BBI608 has high cytotoxicity Yu Lapa tinib on HUVEC cells, but compound 11 significantly reduces cytotoxicity of the parent compound on HUVEC, its IC 50 The value was 63.31. Mu.M. According to the above, the coupling of lapatinib and cancer cell stem inhibitor can not only enhance the toxicity of lapatinib to cancer cells and reverse lapatinib-mediated MDA-MB-231 cell drug resistance, but also effectively reduce the toxicity of parent compounds to normal cells.
Example 9: effect of Compounds 6 and 11 on EGFR and downstream AKT/ERK signalling pathway
1. Experimental method
The expression levels of the intracellular pEGFR (Y1068) protein and the downstream pAKT1/2/3 (S473) and pERK1/2 (T202/Y204) proteins after 20. Mu.M of compounds 6 and 11 were applied to MDA-MB-231 and MDA-MB-231/lapatinib cells, respectively, for 24 hours were determined by immunoWestern blotting, and the effect of different concentrations of compound 6 on the expression levels of pEGFR (Y1068) and EGFR proteins in two cancer cells. The experimental procedure was as follows:
(a) Protein extraction: each at 6-well plate1mL of the solution was added to the wells at a concentration of 2X 10 5 cell suspensions of cells/mL were placed in a 5% CO solution 2 Incubate in a 37℃cell incubator for 12h. 20. Mu.M of Lapattinib, compounds 6 and 11 and the same volume of DMSO were then added to each well of the 6-well plate and incubation was continued for 24h in a cell incubator. After incubation, cells were collected into a 15mL centrifuge tube, centrifuged at 1500 rpm for 5min, medium removed and washed twice slowly with 2mL PBS. The 15mL centrifuge tube with the collected cells is placed on crushed ice and added with 80 mu L of cell lysate, the cell lysate is lysed for 30min, after the lysis is finished, the cell lysate is transferred into a 2mL centrifuge tube, the 2mL centrifuge tube is placed into a refrigerated centrifuge (4 ℃) and centrifuged for 15min at 15000 revolutions, and the supernatant is taken out and stored in a refrigerator at-20 ℃.
(b) Protein quantification and sample preparation: the protein content was determined on a Varioskan multi-mode microplate spectrophotometer using coomassie brilliant blue G250 method, and then Loading Buffer was added to the extracted protein, and the sample was boiled at 100 ℃ for 15min.
(c) Preparation and loading of SDS-PAGE gels: adding TEMED into 12% of separating gel prepared in advance, blowing uniformly, transferring into concave-convex glass plate of electrophoresis apparatus, and sealing with water. After the gel is completely solidified, removing water, adding 6% of concentrated gel, and inserting into groove teeth. After the gel had completely set, the well was slowly pulled off, and 10. Mu.L of the above sample diluted with SDS was added to the well of the gel, and a marker was added as a reference. And (3) modulating the voltage of the electrophoresis apparatus to 100V, running the gel for 30min, modulating the voltage again to 150V, and stopping when the Loading Buffer runs to the lowest part of the gel after the markers are completely separated.
(d) Transferring: the PVDF membrane was completely soaked with methanol and completely immersed in the transfer solution together with the filter paper. Taking out the gel, completely soaking the part containing the target protein in the transfer membrane liquid for 10min, and then placing the part and the PVDF membrane on a semi-dry transfer membrane instrument, and transferring the membrane under the current of 350mA for 45-60min. After the completion, the PVDF membrane is put into 5% skimmed milk powder and put on a shaking table for sealing for 90min.
(e) Immunization and exposure: the above-mentioned blocked PVDF membrane was placed on a shaker and washed with TBST. Incubation of primary antibody was performed overnight at 4℃and after completion the incubation was washed with TBST on a shaker, repeated five times for 30min each. The secondary antibody was incubated at 37℃for 1h with shaking, and after the completion, washed with TBST on a shaker, and repeated five times for 10min each. Finally, an Odyssey scanning system is used for imaging.
2. Experimental results
The specific experimental results are shown in figure 1.
As shown in fig. 1, both compounds 6 and 11 significantly inhibited the phosphorylation of EGFR (Y1068) and downstream proteins AKT1/2/3 (S473) and ERK1/2 (T202/Y204) in MDA-MB-231 and MDA-MB-231/lapatinib cells, compared to the control group, with compound 6 being the most potent inhibitor and being able to inhibit pEGFR (Y1068) protein expression in a dose dependent manner in both cancer cells. In contrast, lapatinib only shows strong ability to inhibit pEGFR (Y1068), pAKT1/2/3 (S473) and pERK1/2 (T202/Y204) protein expression in MDA-MB-231 cells, while inhibition activity in MDA-MB-231/lapatinib cells is weak. These results indicate that both compounds 6 and 11 retain the inhibitory activity of the parent compound against EGFR and can reverse lapatinib-mediated resistance of MDA-MB-231 cells through AKT/ERK signaling pathways.
Example 10: inhibition test of ALDH1A1 enzyme Activity by Compounds 6 and 11
1. Experimental method
Breast Cancer Stem Cells (BCSCs) must undergo a cyclic genetic process, epithelial-mesenchymal transition (EMT) and mesenchymal-epithelial transition (MET), during which BCSCs migrate first to surrounding tissues and then reattach to the basement membrane matrix, resulting in tumorigenesis. Thus, BCSCs have plasticity, expressing tissue-specific and cell proliferation markers such as CD24, CD44, CD133, SOX2 during EMT, and ALDH in the MET state. First, compounds 6, 11, perphenazine and BBI608 were tested for inhibition of exogenous ALDH1A1 enzyme activity; secondly, quantitatively analyzing the transcription level of ALDH1A1 genes in MDA-MB-231/lapatinib cells after 20 mu M of lapatinib and compounds 6 and 11 are respectively acted for 24 hours by qRT-PCR; finally, 20. Mu.M of lapatinib, compounds 6 and 11, respectively, were subjected to 24h of action by immunoblotting, and the expression levels of ALDH1A1, CD44 and SOX2 proteins in MDA-MB-231/lapatinib cells were tested.
The experimental procedure was as follows:
(1) Detection of ALDH1A1 enzyme inhibition Activity: a commercial ALDH1A1 kinase (humanized) ELISA detection/inhibitor screening assay kit provided by Shanghai pacifying practical company is selected. Taking out the 96-well plate from the kit, putting the kit into a cell culture box at 37 ℃ for thawing, and dividing the 96-well plate into three areas, namely a group to be tested, a positive control group and a blank group. mu.L of 60U/L ALDH1A1 enzyme reaction solution is added to each well of a 96-well plate, 5 gradient concentrations (500.0, 100.0, 20.0, 4.0 and 0.8 nM) of freshly prepared compound 6, 11, lapatinib and BBI608 solutions are added to each well of a test group and a positive control group, and only an equal volume of solvent is added to each well of a blank group. After sealing, the mixture is put into a incubator at 37 ℃ for incubation for 2 hours. After the completion, 50. Mu.L of ALDH1A1 enzyme conjugate was added to each well of the remaining groups except the blank group, incubation was continued for 30min, then 50. Mu.L of the color-developing agent A and 50. Mu.L of the color-developing agent B were added to each well, after light shaking was performed uniformly, incubation was performed in a dark place for 15min, after the completion, 50. Mu.L of the stop solution was added to each well, incubation was performed at room temperature for 10min, finally absorbance value (OD value) was measured at a wavelength of 450nM of the microplate reader, each compound was subjected to three independent experiments in parallel, and as a result, the average value.+ -. SD of the three experiments was obtained, the inhibition ratio was calculated, and the half Inhibition Concentration (IC) of each compound to ALHD1A1 was calculated by SPSS 16.0 software 50 )。
(2) Quantitative analysis of transcription level of ALDH1A1 gene: 1mL of a 2X 10 concentration was added to each well of a 6-well plate 5 cell suspensions of cells/mL were placed in a 5% CO solution 2 Incubate in a 37℃cell incubator for 12h. 20. Mu.M of Lapattinib, compounds 6 and 11 and the same volume of DMSO were then added to each well of the 6-well plate and incubation was continued for 24h in a cell incubator. After incubation, cells were collected into a 15mL centrifuge tube, centrifuged at 1500 rpm for 5min, medium removed and washed twice slowly with 2mL PBS. RNA was extracted from MDA-MB-231/lapatinib cells by TRIZOL reagent, then reverse transcribed into cDNA (GeneAmp 9600, PERKINELMER) with the same concentration using a reverse transcription kit, and then a real-time fluorescent quantitative PCR experiment (ABI stepone plus, ABI) was performed using the cDNA as a template. The circulation steps are as follows: pre-denatured at 95℃for 3min, denatured at 95℃for 10s, and extended at 60℃for 30s for 39 thermal cycles. Real worldIn the experiment, the amplification of a specific single product is confirmed by melting curve analysis, and beta-actin is taken as an internal reference. Relative expression of genes as 2 -ΔΔCt Is expressed as a multiple of (a). The primer sequences of ALDH1A1 are: fwd TCCACATTCCAGTTTGGCCC, rev TTCGAAGGAGTGTTGAGCG; the primer sequences of beta-actin are: fwd CTTAGTTGCGTTACACCCTTTCTTG, rev CTGTCACCTTCACCGTTCCAGTTT.
(3) Immunowestern blot analysis: the effect on the expression levels of ALDH1A1, CD44 and SOX2 proteins in MDA-MB-231/lapatinib cells after 24h of 20. Mu.M of lapatinib, compound 6 and 11, respectively, was investigated by reference to the above-described Western blotting method.
2. Experimental results
The specific experimental results are shown in fig. 2 and 3.
Aldehyde dehydrogenase (ALDH) is one of the markers of CSCs' specific expression in MET processes, particularly the aldehyde dehydrogenase 1 family member A1 (ALDH 1 A1) subtype, and is considered to be one of the strongest markers of CSCs, playing a critical role in maintaining the stem properties of breast cancer cells. And using the compound 3 and BBI608 as positive controls and adopting an ALDH1A1 enzyme-linked immunosorbent assay kit to detect the inhibition of the exogenous ALDH1A1 enzyme activity by the compounds 6 and 11. As shown in FIG. 2A, each of the tested compounds inhibited ALDH1A1 enzyme activity in a dose-dependent manner, wherein Compound 6 was the most inhibitory, IC 50 The value was 86.42nM, 4.92 times that of Compound 3. Compound 11 exhibits only moderate inhibition of ALDH1A1 enzymatic activity, IC 50 The value was 134.58nM, 3.16 times BBI 608. Compounds 6 and 11 also significantly reduced the transcriptional level of the ALDH1A1 gene in MDA-MB-231/lapatinib cells compared to lapatinib (fig. 2B).
The result of immunoWestern Blot analysis (Western Blot) shows that after being treated by the compounds 6 and 11, compared with a control group, the expression level of ALDH1A1 protein and CD44 and SOX2 proteins in MDA-MB-231/lapatinib cells is remarkably reduced, and particularly the inhibition capability of the compound 6 is strongest. In contrast, lapatinib has a weak ability to inhibit the expression of ALDH1A1, CD44 and SOX2 proteins in MDA-MB-231/lapatinib cells (FIG. 3). These results indicate that compounds 6 and 11 also show a strong inhibition of intracellular transcription of the ALDH1A1 gene and ALDH1A1 protein expression.
Example 11: inhibition test of cancer cell Stem Properties by Compounds 6 and 11
1. Experimental method
First, the MDA-MB-231/lapatinib intracellular CD44 is sorted by a flow cytometer + Cell subsets designated MDA-MB-231/lapatinib CD44+ Cells were then quantitatively analyzed by qRT-PCR and after 24h of action with 20. Mu.M of lapatinib, compounds 6 and 11, respectively, MDA-MB-231/lapatinib CD44+ Transcription levels of intracellular stem cell transcription factors Nanog, OCT4, SOX2 and kif genes; finally, after 5. Mu.M of lapatinib and compounds 6 and 11, respectively, have been tested for 10 days, MDA-MB-231/lapatinib CD44+ Cell-derived tumor spheres form volume and number.
The experimental procedure was as follows:
(1)MDA-MB-231/lapatinib CD44+ cell sorting: taking 2X 10 5 MDA-MB-231/lapatinib cells were added, 5mL of sterile PBS was slowly blown off, centrifuged at 2000 rpm for 5min at room temperature, the supernatant was discarded, 500. Mu.L of sterile PBS was added to resuspend cells and 2.5. Mu.L of FITC-CD44 antibody, incubated at 4℃for 30min, centrifuged at 2000 rpm for 5min, and the supernatant was removed. The stained cells were resuspended in 0.5% BSA-PBS and the CD44+ cell subsets within the MDA-MB-231/lapatinib cells were detected by flow cytometry and sorted.
(2) Quantitative analysis of stem cell transcription factor transcription level: with reference to the quantitative analysis experimental method, 20 mu M of lapatinib and compounds 6 and 11 are respectively acted for 24 hours and then MDA-MB-231/lapatinib is subjected to research CD44+ Influence of transcription levels of intracellular Nanog, OCT4, SOX2 and kif4 genes.
(3)MDA-MB-231/lapatinib CD44+ Cell-derived tumor sphere formation experiments: MDA-MB-231/lapatinib CD44+ Cells were inoculated into serum-free DMEM medium containing B27 (1:50, 17504044, invitrogen), EGF (20 ng/mL, AF-100-15, peprotech) and beta-FGF (10 ng/mL,100-18B, peprotech) at a density of 800 cells per well. Cells were then treated with 5 μm lapatinib, compounds 6 and 11, respectively, and an equal volume of DMSO for 10 days. After completion the number and shape of tumor spheres were measured on a microscopeA state.
2. Experimental results
The specific experimental results are shown in fig. 4 and 5.
The expression of CSCs surface antigens plays a critical role in promoting tumor invasiveness and recurrence, and in solid cancers CSCs are defined as CD44 + A population of cells. First, a flow cytometer is used to measure CD44 in MDA-MB-231/lapatinib cells + Cell populations were sorted and designated MDA-MB-231/lapatinib CD44+ And (3) cells. To further evaluate the ability of the compounds tested to inhibit cancer cell stem activity, MDA-MB-231/lapatinib was quantitatively analyzed CD44+ Transcription levels of intracellular stem cell transcription factors. As shown in FIG. 4, there was a significant difference in the expression level of transcription factors in cells after the treatment with the tested compounds. Lapatinib preferentially attacks non-stem cells, thus, on MDA-MB-231/lapatinib CD44+ Intracellular CSCs transcription factor has low inhibitory activity. Whereas compounds 6 and 11 vs MDA-MB-231/lapatinib CD44+ The intracellular Nanog, SOX-2, OCT4 and kif gene transcript levels exhibited a strong inhibitory capacity, with Compound 6 being the most inhibitory. In addition, the Lapattinib, compound 6 and 11 pairs derived from MDA-MB-231/lapatinib were evaluated CD44+ Tumor sphere forming ability of cells. As shown in FIG. 5, the administration group was derived from MDA-MB-231/lapatinib, as compared with the control group CD44+ The tumor spheres of the cells all had obvious phenotypic changes, with minimal tumor sphere volume and minimal number after treatment with compound 6. The volume and the number of tumor spheres treated by the compound 11 are inferior to those of the compound 6, the inhibition effect of lapatinib is weaker, and the volume and the number of the treated tumor spheres are larger. The results show that the compounds 6 and 11 can strongly inhibit cancer cell stem property in MDA-MB-231/lapatinib cells.
Based on lapatinib and three different cancer cell stem inhibitors, the invention designs and synthesizes a class of conjugates of lapatinib and cancer cell stem inhibitors, and explores the capability of the conjugates for reversing drug resistance and inhibiting the stem of triple negative breast cancer cells. In vitro bioactivity studies indicate that these conjugates are effective in increasing cytotoxicity of the parent compound and in reversing lapatinib-mediated MDA-MB-231 cell resistance, with compounds 6 and 11 performing best. The related research shows that the compounds 6 and 11 not only retain the inhibition activity of the parent compound lapatinib on EGFR, but also can strongly inhibit the activity of ALDH1A1 enzyme overexpressed by breast cancer stem cells in the processes of EMT and MET and breast cancer stem cell genes Nanog, OCT4, SOX2 and Kif4. In summary, the compounds designed by the invention have the potential of being prepared into medicaments for treating triple negative breast cancer.

Claims (9)

1. A lapatinib-cancer cell stem inhibitor conjugate, wherein the conjugate has the structure of formula (I):
wherein:
is->
R is chlorine or trifluoromethyl;
n is 1 or 2.
2. The conjugate of claim 1, wherein in the conjugate structure:
r is chlorine.
3. The conjugate of claim 1, wherein the conjugate is any one of the following compounds:
4. a conjugate according to any one of claims 1 to 3, wherein the conjugate forms a pharmaceutically acceptable salt with an acid or base, wherein the acid is hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid, methanesulfonic acid, benzenesulfonic acid, p-toluenesulfonic acid, naphthalenesulfonic acid, citric acid, malic acid, tartaric acid, lactic acid, pyruvic acid, acetic acid, maleic acid, succinic acid, fumaric acid, salicylic acid, phenylacetic acid or mandelic acid, and the base is an inorganic base comprising a basic metal cation, alkaline earth metal cation or ammonium cation salt.
5. A process for the preparation of a conjugate according to any one of claims 1 to 4, or a pharmaceutically acceptable salt thereof, wherein the process comprises:
any one of the compounds 1-2 and any one of the compounds 3-5 are subjected to esterification reaction to obtain a conjugate (I);
adding corresponding acid or alkali into the solution of the conjugate (I) prepared by the method, and removing the solvent after complete salification to obtain the pharmaceutically acceptable salt of the conjugate.
6. A pharmaceutical composition comprising the conjugate of any one of claims 1 to 4 or a pharmaceutically acceptable salt thereof and a pharmaceutically acceptable carrier.
7. Use of a conjugate according to any one of claims 1 to 4, or a pharmaceutically acceptable salt thereof, in the manufacture of a medicament for the treatment of breast cancer.
8. Use of the pharmaceutical composition of claim 6 in the preparation of a medicament for treating breast cancer.
9. The use according to claim 7 or 8, wherein the breast cancer is a triple negative breast cancer.
CN202110598974.4A 2021-05-31 2021-05-31 Lapatinib-cancer cell stem inhibitor conjugate, preparation method, pharmaceutical composition and application Active CN115475253B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202110598974.4A CN115475253B (en) 2021-05-31 2021-05-31 Lapatinib-cancer cell stem inhibitor conjugate, preparation method, pharmaceutical composition and application

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202110598974.4A CN115475253B (en) 2021-05-31 2021-05-31 Lapatinib-cancer cell stem inhibitor conjugate, preparation method, pharmaceutical composition and application

Publications (2)

Publication Number Publication Date
CN115475253A CN115475253A (en) 2022-12-16
CN115475253B true CN115475253B (en) 2023-09-29

Family

ID=84419284

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202110598974.4A Active CN115475253B (en) 2021-05-31 2021-05-31 Lapatinib-cancer cell stem inhibitor conjugate, preparation method, pharmaceutical composition and application

Country Status (1)

Country Link
CN (1) CN115475253B (en)

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2012088441A1 (en) * 2010-12-23 2012-06-28 Alkermes, Inc. Multi- api loading prodrugs
WO2019204154A1 (en) * 2018-04-18 2019-10-24 Reyoung Corporation Compositions and methods for treating liver cancer
CN111303129A (en) * 2020-03-18 2020-06-19 东南大学 Multi-target kinase inhibitor with antitumor activity and preparation method thereof
CN111939269A (en) * 2020-07-06 2020-11-17 东南大学 Magnetic targeting cell membrane modification ligand, drug-loaded material, preparation method and application thereof

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2012088441A1 (en) * 2010-12-23 2012-06-28 Alkermes, Inc. Multi- api loading prodrugs
WO2019204154A1 (en) * 2018-04-18 2019-10-24 Reyoung Corporation Compositions and methods for treating liver cancer
CN111303129A (en) * 2020-03-18 2020-06-19 东南大学 Multi-target kinase inhibitor with antitumor activity and preparation method thereof
CN111939269A (en) * 2020-07-06 2020-11-17 东南大学 Magnetic targeting cell membrane modification ligand, drug-loaded material, preparation method and application thereof

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
Engineering a sustained release vaccine with a pathogen-mimicking manner for robust and durable immune responses;Yingying Hou等;Journal of Controlled Release;第333卷;第162-175页 *

Also Published As

Publication number Publication date
CN115475253A (en) 2022-12-16

Similar Documents

Publication Publication Date Title
EP3070089B1 (en) Aminomethyl tryptanthrin derivative, preparation method and application thereof
CN115175679A (en) Methods of treating estrogen receptor-related disorders
CN109942595B (en) Oxygen-bridged bicyclo- [2.2.1] -heptene compounds containing different functional side chain structures and preparation and application thereof
CN109678923B (en) Tripterine (iso) ferulic acid ester derivative and preparation method and application thereof
JP2021519828A (en) Diaryl macrocycles, pharmaceutical compositions and their uses
JP2019523245A (en) Ligands for orphan nuclear receptor Nur77 and uses thereof
CN101624376A (en) Substituted hydrazide compound and application thereof
WO2019037742A1 (en) Imidazolone androgen receptor antagonist, preparation method therefor and use thereof
CN114195814B (en) Hydroxy naphthalenone-phenylboronic acid compound, preparation method and application
KR20130138776A (en) 6-substituted demethyl-estradiol derivatives as er-beta agonists
CN111484504B (en) Optical isomer of ACC inhibitor and application thereof
CN113387957B (en) Spirocyclic indolone-pyrrolidine carbonate compound and composition, preparation method and application thereof
CN115475253B (en) Lapatinib-cancer cell stem inhibitor conjugate, preparation method, pharmaceutical composition and application
CN104327097A (en) Triazole derivatives of rapamycin and application
CN111303053B (en) Cyclopenta [ d ] pyrimidine compound and pharmaceutically acceptable salt, solvate or prodrug thereof and application
CN109734676A (en) Benzodiazepines derivative and its preparation method and application
CN111943947B (en) 1H-pyrrole [2,3-b ] pyridine derivative and synthesis method and application thereof
CN116354823A (en) Preparation method and application of compound
CN115872996B (en) Estrogen receptor degradation agent compound and preparation method and application thereof
CN111484495A (en) Preparation method and application of derivative containing dihydropteridine diketone framework
CN109748891B (en) Docetaxel derivative, pharmaceutical composition and application thereof
Zou et al. Photocaged probes for spatiotemporal imaging
CN114456184B (en) 3-aryl isoquinoline derivative and preparation and application thereof
CN114394959B (en) Diketopiperazine derivatives, synthesis method and application thereof
CN115894485B (en) Heteroaryl piperidine derivatives, preparation method thereof and application thereof in medicines

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant