CN115058532A - Reference gene for oat maturity gene expression analysis and application thereof - Google Patents

Reference gene for oat maturity gene expression analysis and application thereof Download PDF

Info

Publication number
CN115058532A
CN115058532A CN202210632707.9A CN202210632707A CN115058532A CN 115058532 A CN115058532 A CN 115058532A CN 202210632707 A CN202210632707 A CN 202210632707A CN 115058532 A CN115058532 A CN 115058532A
Authority
CN
China
Prior art keywords
gene
oat
artificial sequence
genes
asfpgs
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN202210632707.9A
Other languages
Chinese (zh)
Other versions
CN115058532B (en
Inventor
贾举庆
张美俊
任长忠
黄胜雄
杨武德
王娜
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Shanxi Agricultural University
Original Assignee
Shanxi Agricultural University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shanxi Agricultural University filed Critical Shanxi Agricultural University
Priority to CN202210632707.9A priority Critical patent/CN115058532B/en
Publication of CN115058532A publication Critical patent/CN115058532A/en
Application granted granted Critical
Publication of CN115058532B publication Critical patent/CN115058532B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/6851—Quantitative amplification
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/166—Oligonucleotides used as internal standards, controls or normalisation probes

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Molecular Biology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Immunology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Genetics & Genomics (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Botany (AREA)
  • Mycology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention discloses an internal reference gene for oat maturity gene expression analysis and application thereof. Belongs to the technical field of molecular biology. The invention provides a set of mature oat internal reference genes, wherein the internal reference genes are AsFPGS-1D1RF and AsFPGS-1D2 RF. The invention solves the current situation that the prior oat fluorescence quantitative PCR experiment has no reliable reference gene; the screened reference gene is suitable for analyzing the expression level of the functional gene in the mature period of the oat, and can improve the reliability, stability and repeatability of the detection result.

Description

Reference gene for oat maturity gene expression analysis and application thereof
Technical Field
The invention relates to the technical field of molecular biology, in particular to an internal reference gene for oat maturity gene expression analysis and application thereof.
Background
Although the genome data of oat has been published in recent years, little genetic information is known about oat plants in general, which is not favorable for the discovery of good genes of oat and limits the research on the molecular mechanism of the biological process of the species.
The study of oat gene function requires analysis of gene expression, while the study of expression of related genes requires data correction and normalization of good reference genes. At present, with the development of molecular biology, the research on reference genes in plants is more and more, and the research on the oat single-copy reference genes is only reported, so that the research on the oat gene expression has no single-copy endogenous reference gene as reference quantification.
At present, the research on oat reference genes at home and abroad is very little, which causes great obstruction to the excavation of oat functional genes. The reason for this is probably because oat genome data is gradually improved in recent years, and we can only use transcriptome data in a group of seeds before, and the previous research suggests that the selection of the reference gene should be a gene with a small copy number as much as possible, because each copy of the multi-copy reference gene is often expressed as tissue specificity, and the expression level of the multi-copy reference gene is different in the same tissue or different tissues of the plant, so that the accuracy of the whole multi-copy reference gene is at great risk, but for the polyploid plant oat, the selection of a proper single-copy reference gene is very difficult.
In conclusion, the technical personnel in the field need to solve the problem of how to provide a single-copy reference gene of oat.
Disclosure of Invention
In view of the above, the invention provides an internal reference gene for oat maturity gene expression analysis and application thereof.
The ideal reference gene can be constantly expressed under different stress conditions, different tissues and different periods. However, studies have shown that there are some disadvantages in the conventional reference genes, and the expression levels of these reference genes cannot be kept stable all the time in various states, in other words, there is no universal reference gene suitable for all the subjects. At present, many studies have confirmed the above viewpoints, for example, 10 reference genes such as RPL4, RPB2, 18SRNA, GAPDH, EF1 α are analyzed by pao xiaolong, etc., and 28SRNA gene expression is most stable in different growth periods of poria; in different tissues of poria, 28SRNA and α -TUB are more accurate as a combined result; in different stress environments, GAPDH and ACT are better taken as internal reference combination; the α -TUB gene was most stable in all samples. The four-season rice is characterized in that the four-season rice is mainly composed of 6 common reference genes such as 18SRNA, GAPDH, EF1 alpha and the like, and the expression levels of the three reference genes EF1 alpha, ACT and TUB are most stable in rice leaves infected by rhizoctonia solani. Chenxian et al analyzed 25SRNA, UBC, UBQ-5, etc. 10 common reference genes, and in different days of rice leaf melatonin treatment, the combination of e1F-4a and UBQ-5 was most suitable as reference. Anhongqiang et al screened 26 genes with stable expression and 5 traditional reference genes, and in the developmental period of Dendrobium officinale protocorm, two genes including ASS and APH1L were combined best as reference; in all experimental samples, the stability of the conventional reference gene was inferior to that of the novel reference gene. The quality of woman of payment and the like analyzes 8 internal reference genes such as beta-Actin, Actin2, MSC27 and the like, and under the treatment of different tissues and different stresses of alfalfa, four internal reference genes such as MSC27, Actin2, 18SRNA and EF1 alpha are the genes with the most stable expression quantity. Similar conditions exist in fava beans and hemerocallis.
Based on the phenomenon that reference genes of the same species are different under different stress conditions, in different tissues and at different periods, in order to research the expression of oat ear genes, proper reference genes in different tissues of oat in the mature period need to be screened.
Based on the oat genome data, the invention obtains candidate reference genes by a gene cloning method, respectively extracts roots, stems, leaves and ears of the oat in the mature period, designs proper specific primers, combines with reference gene stability evaluation software geonorm, NormFinder and BestKeeper, screens out the optimal reference gene combination in the mature period of the oat, and provides proper reference genes as reference for the subsequent research of oat gene expression analysis.
Because oats are typical allohexaploid plants, orthologous genes in subgenomic groups have very high similarity on sequences, the invention performs expression analysis on the orthologous genes, reveals the risk of multi-copy reference genes in the polyploid plants oats, and provides more accurate reference genes for future oat gene expression analysis.
In order to achieve the purpose, the invention adopts the following technical scheme:
an internal reference gene for analyzing the gene expression of the mature period of the oat, wherein the internal reference gene is AsFPGS-1D1RF and AsFPGS-1D2 RF; wherein,
the nucleotide sequence of AsFPGS-1D1RF is shown in SEQ ID NO. 1;
TTAACCGTACTGATCCCTTACCAGACGAGTTCATTAAAGGGCTCTCAAGTGCTTCTTTGCAAGGCCGAGCACAAATTGTTCCAGATTCACAAGTAAATTCTGAAGAGAAGGACCGAGATTGTTCTTTA；SEQ ID NO:1；
the nucleotide sequence of AsFPGS-1D2RF is shown as SEQ ID NO. 2;
AGGACCGAGATTGTTCTTTAGTGTTCTATTTGGATGGCGCGCACAGCCCTGAAAGTATGGAAATATGTGCTACATGGTTTTCTCGTGTTACCAAGGAGGATAGAGTACCATCTTCCATGGAGCAGTCTAGGACAGGCGGCAAATCTCGAAAGATTCT；SEQ ID NO:2。
the reference genes AsFPGS-1D1RF and AsFPGS-1D2RF are used as reference genes in analyzing the expression pattern of the mature oat gene.
The traditional reference gene is usually a single reference gene, but Zhanjun discovers that the results of two reference genes RPL13A and UBC are more accurate than the results of using a single traditional reference gene when the two reference genes are jointly used for carrying out normalization analysis on the expression quantity of a target gene by fluorescent quantitative PCR (polymerase chain reaction) through researching human liver cancer cells. Nowadays, many scholars consider that in the gene expression analysis process, two or three reference genes are introduced as a combination, so that the accuracy of the experimental result is higher, and especially, the combination is critical for target genes with small differences. Therefore, the invention combines GeNorm, NormFinder and Bestkeeper to evaluate the stability of candidate reference gene expression, and screens out a proper reference gene combination.
Further, the real-time fluorescent quantitative PCR primer sequence of AsFPGS-1D1RF is shown in SEQ ID NO. 3 and SEQ ID NO. 4;
TTAACCGTACTGATCCCTTA；SEQ ID NO:3；
TAAAGAACAATCTCGGTCCT；SEQ ID NO:4；
the real-time fluorescent quantitative PCR primer sequence of the AsFPGS-1D2RF is shown in SEQ ID NO. 5 and SEQ ID NO. 6;
AGGACCGAGATTGTTCTTTA；SEQ ID NO:5；
AGAATCTTTCGAGATTTGCC；SEQ ID NO:6。
the reference gene is applied to oat gene expression analysis.
According to the technical scheme, compared with the prior art, the invention has the following beneficial effects: the invention screens oat reference genes with the most stable expression from up to 10 candidate reference genes and real-time fluorescent quantitative PCR primers designed based on the reference gene sequences, thereby solving the current situation that no reliable reference genes exist in the existing oat fluorescent quantitative PCR experiments. The screened reference gene is suitable for analyzing the expression level of the functional gene in the mature period of the oat, and can improve the reliability, stability and repeatability of detection data.
Drawings
In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below, it is obvious that the drawings in the following description are only embodiments of the present invention, and for those skilled in the art, other drawings can be obtained according to the provided drawings without creative efforts.
FIG. 1 is a drawing of an electrophoretogram for RNA extraction of oat part tissue in example 1 of the present invention, wherein M: DL2000 DNA Marker; 1: 28S rRNA; 2: 18S rRNA;
FIG. 2 is a drawing of agarose gel electrophoresis detection of oat PCR products of example 1 of the invention, wherein M: DL2000 DNA Marker; 1: AsEF1A-4C1 RF; 2: AsACT11-5D1 RF; 3: AsACT11-5D2 RF; 4: AsTUA5-2C1 RF; 5: AsTUA5-2C3 RF; 6: AsGAPDH-7C1 RF; 7: AsGAPDH-7C2 RF; 8: AsEEF1A-5D1 RF; 9: AsFPGS-1D2 RF; 10: AsTUB6-3D1 RF; 11: AsUCH-4D2 RF; 12: AsFPGS-1D1 RF; 13: AsWDR-3C1 RF; 14: AsTUA5-6 ARF; 15: AsTUA5-7 CRF;
FIG. 3 is a graph showing the melting curves of all genes in example 1 of the present invention;
FIG. 4 is a graph of the results of the GeNorm assay maturation group of example 1 of the present invention, wherein a: analyzing the stability of the candidate reference gene by using a geonorm program; b: analysis of the geonorm program determines the number of the optimal reference genes;
FIG. 5 is a graph showing the results of the NormFinder analysis of the maturity group in example 1 of the present invention;
FIG. 6 shows the alignment of nucleotide sequences of example 1 of the present invention, in which the yellow boxes are the left and right primers of AsTUA5-2C1RF gene; the red frame is left and right primers of the AsTUA5-6ARF gene; the green frame is left and right primers for the AsTUA5-7CRF gene.
Detailed Description
The technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the drawings in the embodiments of the present invention, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.
Plant material:
the test material is hexaploid naked oat 'white swallow No. 2'.
Seeds of oat Baiyan No. 2 are placed in a culture dish paved with wet filter paper, placed in an incubator for germination, transferred into culture soil when the height of the seeds is five centimeters, and cultured in the incubator at 20 ℃. After the oat plant is subjected to stem heading, flowering and pollination, taking roots, stems, leaves and ears of the oat plant, quickly freezing the roots, stems, leaves and ears by liquid nitrogen, and storing the roots, stems, leaves and ears at the temperature of minus 80 ℃ for later use; a total of 4 parts of material.
The main reagents are as follows:
2 × Taq PCRMix was purchased from Bomader Bio Inc;
the agarose gel DNA recovery kit is purchased from Jiangsukang century corporation;
DNA Marker, 6 × Loading Buffer, M13 universal primers were purchased from Beijing all-style gold Biotechnology GmbH;
reverse transcription kitPrimeScript TM RT reagent Kit with gDNA Eraser(Perfect Real Time)RR047A、Pmd TM 18-T Vector Cloning Kit 6011、TB Green TM Premix Ex Taq TM II (Tli RNaseH Plus) RR820A, 1-2X 109Bacteria/ml competent cells (E.coli JM109) were purchased from Takara.
Example 1
Oat tissue RNA quality detection
Four parts of plant material (roots, stems, leaves, ears of oat in mature period) are extracted by Trizol method, and RNA concentration, purity and integrity are detected by using spectrophotometer and agarose electrophoresis.
The extracted oat RNA is subjected to electrophoresis detection (figure 1), and 28S and 18S bands are clear, which shows that the RNA integrity is better.
Detection using a spectrophotometer showed that 260/280 Between 1.9 and 2.1, A 260/230 The purity of the RNA is between 2.0 and 2.2, which shows that the purity of the RNA is better.
After the RNA quality is qualified, according to a reverse transcription kit PrimeScript TM RT reagentKit with gDNA Eraser (Perfect Real Time) RR047A, total RNA in a total amount of 1. mu.g was reverse transcribed to cDNA. The cDNA finally obtained was stored at-20 ℃ until use.
Primer design
The CDS sequences of sequenced Arabidopsis thaliana (Arabidopsis thaliana), maize (Zea mays) and rice (Oryza sativa) common reference genes EF1A, ACT11, TUB6, TUA5, UCH, FPGS, WDR and GAPDH were selected and obtained from NCBI database (https:// www.ncbi.nlm.nih.gov /) according to the corresponding gene numbers. The coding region sequences of the genes are compared with an oat genome OT3098 database (https:// heat. pw. usda. gov /) through local blast, the oat gene with high matching degree is selected, and one copy is specifically amplified in highly similar gene copies to be used as a candidate reference gene. The primers are designed according to the conditions that the GC content is 45-55%, the length of the primers is 20bp, the amplification length is 100-300 bp, and a single gene is specifically amplified, and relevant information of the primers is shown in a table 1. Wherein the two genes AsUCH-4ARF and AsUCH-4CRF are highly similar to AsUCH-4D2 RF; the AsTUA5-7CRF and AsTUA5-6ARF genes are highly similar to AsTUA5-2C1RF, and are used for comparison of expression stability between copies of a multi-copy gene.
TABLE 1 information on primers
Figure BDA0003679371130000061
Figure BDA0003679371130000071
Primer specificity test
And (3) carrying out specificity detection on the candidate reference gene primer by using the obtained cDNA as a template.
The reaction system is as follows: 12.5 μ L of 2 XTaq PCR Mix; 2 μ L of cDNA template; 1 mu L of each primer on the left and the right; 8.5 μ L ddH 2 O; total 25. mu.L.
And (3) amplification procedure: pre-denaturation at 94 ℃ for 4 min; denaturation at 94 ℃ for 45 s; the corresponding annealing temperature in table 1 was 45 s; extension at 72 ℃ for 20 s; 30 cycles, further extension at 72 ℃ for 10 min; storing at 12 deg.C.
After the amplification reaction was completed, the detection was performed by 1% agarose electrophoresis. And (3) performing gel recovery on the gene with a good electrophoresis detection result, operating according to the specification of an agarose gel DNA recovery kit, connecting the recovered target gene with a vector, then converting the target gene into escherichia coli to culture a positive single colony, sending the positive single colony to a Huada gene company for sequencing, wherein a primer with the sequencing result same as the expected result can be used for subsequent experiments.
The result of agarose gel electrophoresis detection using oat cDNA as a template is shown in FIG. 2. The results in FIG. 2 show that the primer specificity is good, the sizes of the 13 candidate reference genes and the AsTUA5-6ARF and AsTUA5-7CRF gene fragments are consistent with the expectation, and the sequencing results are the same as the expectation, which shows that the 13 candidate reference genes and the AsTUA5-6ARF and AsTUA5-7CRF genes can be used for subsequent operations.
Fluorescent quantitative PCR analysis
TB Green from Takara was used TM Premix Ex Taq TM II (Tli RNaseH Plus) RR820A kit, reaction set-up was 3 replicates.
The reaction system is as follows: 10 μ L SYBR Premix Ex Taq II; 2 μ L of cDNA template; the left primer and the right primer are respectively 0.8 mu L; 6.4 μ L ddH 2 O; total 20. mu.L.
The qPCR reaction procedure was: pre-denaturation at 95 ℃ for 30 s; denaturation at 95 ℃ for 5 s; the corresponding annealing temperature in table 1 was 45 s; extension for 20 s; 40 cycles.
After the amplification is finished, the fluorescence signal is collected from the temperature of 60 ℃ to 95 ℃.
The results of the fluorescent quantitative analysis are shown in FIG. 3, and the results show that the dissolution curves of the 13 pairs of candidate internal reference gene primers and the four pairs of AsUCH-4ARF, AsUCH-4CRF, AsTUA5-6ARF and AsTUA5-7CRF are single peaks, the peaks are basically overlapped, the curves are smooth, no primer dimer is generated, the primer specificity is further shown to be good, and the results of the fluorescent quantitative PCR are reliable.
Analysis of stability of reference Gene
Three internal reference gene evaluation methods of geonorm, NormFinder and BestKeeper are adopted.
The geNorm program can give the M values of the candidate reference genes under different conditions, the candidate reference genes with the M value larger than 1.5 are correspondingly eliminated, the rest candidate reference genes are recalculated after elimination, and the smaller the M value is, the better the stability is. At the same time, the geNorm software also introduces a V value when V is n /V n+1 >When 0.15, the number of the most suitable reference genes is n + 1; when V is n /V n+1 <When 0.15, the number of the most suitable reference genes is n.
The NormFinder analysis can give an optimal reference gene.
The BestKeeper analysis determines stability by giving the Coefficient of Variation (CV) and Standard Deviation (SD), with smaller numbers representing better stability.
And combining the final result with three analysis comprehensive evaluations.
Analysis of maturity results
(1) GeNorm analytical results
In 4 samples of roots, stems, leaves and ears in the mature period of oat, M of the other 11 reference genes except AsTUA5-2C1RF (2.555) and AsTUB6-3D1RF (1.543) is less than 1.5, which indicates that 11 candidate genes meet the basic conditions of the reference, wherein the expression stability of the 11 genes is sequentially (FIG. 4 a): AsFPGS-1D1RF (0.859) > AsFPGS-1D2RF (0.863) > AsWDR-3C1RF (0.864) > AsGAPDH-7C1RF (0.891) > AsUCH-4D2RF (0.925) > AsGAPDH-7C2RF (1.042) > AsACT11-5D1RF (1.135) > AsACT11-5D2RF (1.159) > AsTUA5-2C3RF (1.247) > AsEF1A-4C1RF (1.361) > AsEEF1A-5D1RF (1.417). 11 reference gene pairwise difference analysis (fig. 4 b): v2/3<0.15, so the most stable 2 genes AsFPGS-1D1RF and AsFPGS-1D2RF were used as a combination.
(2) Results of NormFinder analysis
In the maturation phase group of oats, the expression stability of 13 genes was sequentially (fig. 5): AsUCH-4D2RF (0.012) > AsFPGS-1D1RF (0.019) > AsFPGS-1D2RF (0.019) > AsGAPDH-7C1RF (0.020) > AsWDR-3C1RF (0.020) > AsGAPDH-7C2RF (0.036) > AsACT11-5D1RF (0.048) > AsACT11-5D2RF (0.050) > AsEEF1A-5D1RF (0.053) > AsTUA5-2C3RF (0.055) > AsTUB6-3D1RF (0.056) > AsEF1A-4C1RF (0.058) > AsTUA5-2C1RF (0.094) AsUCH-2 RF C1 364932C 1RF (0.094) is most preferred because of the group.
(3) Results of BestKeeper analysis
The results of BestKeeper analysis (Table 2) show that 7 genes, namely AsACT11-5D1RF, AsEF1A-4C1RF, AsEEF1A-5D1RF, AsFPGS-1D2RF, AsACT11-5D2RF, AsFPGS-1D1RF and AsGAPDH-7C2RF have SD values less than 1, and meet the requirements of serving as reference genes.
TABLE 2 BestKeeper analysis maturity group results
Figure BDA0003679371130000091
Figure BDA0003679371130000101
Note: 1-13 are AsGAPDH-7C1RF, AsACT11-5D1RF, AsEF1A-4C1RF, AsEEF1A-5D1RF, AsFPGS-1D2RF, AsACT11-5D2RF, AsFPGS-1D1RF, AsGAPDH-7C2RF, AsWDR-3C1RF, AsUCH-4D2RF, AsTUA5-2C3RF, AsTUA5-2C1RF, AsTUB6-3D1RF, respectively.
According to the analysis results of three major software, the optimum internal reference gene combinations are AsFPGS-1D1RF and AsFPGS-1D2RF in roots, stems, leaves and ears of the mature period of the oats.
Orthologous gene stability analysis
Oats are typical of the allophexaploid plants, and homologous genes in the subgenomic regions have high sequence similarity, and in order to investigate whether these orthologous genes are consistent in expression pattern, we performed expression analysis of homologous genes from different subgenomic regions.
As a result, the two genes AsUCH-4ARF and AsUCH-4CRF are consistent with the homologous gene AsUCH-4D2RF in gene expression stability, while the gene AsTUA5-2C1RF as a candidate reference gene of the invention does not reach the ideal condition as the reference gene in all sample groups in both geNorm analysis and BestKeeper analysis, which indicates that the gene is not ideal in expression stability in all sample groups, but the two genes AsTUA5-7CRF and AsTUA5-6ARF which are homologous with the gene are more stable in expression in all sample groups. The homology of three genes AsTUA5-2C1RF, AsTUA5-7CRF and AsTUA5-6ARF is more than 80 percent, wherein the homology of AsTUA5-2C1RF and AsTUA5-7CRF is as high as 95 percent (figure 6). The SD values of AsTUA5-2C1RF genes in all the sample groups are larger than 1 and do not meet the condition of serving as an internal reference gene through BestKeeper analysis (Table 3), but the SD values of AsTUA5-7CRF and AsTUA5-6ARF are smaller than 1, which shows that the expression stability of AsTUA5-7CRF is better than that of AsTUA5-6ARF and is better than that of AsTUA5-2C1RF in terms of BestKeeper analysis. It can also be seen that even if the gene sequences are very similar, highly homologous, copies, the stability of gene expression may vary greatly.
TABLE 3 BestKeeper analysis stability of expression of 3 genes in all samples
Figure BDA0003679371130000102
According to the invention, the expression stability of homologous genes of AsUCH-4ARF, AsUCH-4CRF and AsUCH-4D2RF is very similar by comparing the expression stability of two groups of highly similar genes of oat, but the expression stability difference exists among the homologous genes of AsTUA5-7CRF, AsTUA5-6ARF and AsTUA5-6 ARF. The AsTUA5-2C1RF has poor stability in all sample groups and even does not reach the standard of an ideal reference gene, but the AsTUA5-7CRF gene and the AsTUA5-6ARF gene are stable, and the expression stability of the highly homologous genes is different. We hypothesized that differences in the promoters of the AsTUA5-7CRF, AsTUA5-6ARF, and AsTUA5-6ARF genes may result in differences in gene transcription levels. Therefore, the homologous genes of different subgenomic groups are considered separately in selection as reference genes, so that the situation of differential expression of the homologous genes is avoided, and the accuracy of the gene expression analysis result is further influenced.
The embodiments in the present description are described in a progressive manner, each embodiment focuses on differences from other embodiments, and the same and similar parts among the embodiments are referred to each other.
The previous description of the disclosed embodiments is provided to enable any person skilled in the art to make or use the present invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the generic principles defined herein may be applied to other embodiments without departing from the spirit or scope of the invention. Thus, the present invention is not intended to be limited to the embodiments shown herein but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.
Sequence listing
<110> Shanxi university of agriculture
<120> reference gene for oat maturity gene expression analysis and application thereof
<160> 36
<170> SIPOSequenceListing 1.0
<210> 1
<211> 128
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
ttaaccgtac tgatccctta ccagacgagt tcattaaagg gctctcaagt gcttctttgc 60
aaggccgagc acaaattgtt ccagattcac aagtaaattc tgaagagaag gaccgagatt 120
gttcttta 128
<210> 2
<211> 157
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
aggaccgaga ttgttcttta gtgttctatt tggatggcgc gcacagccct gaaagtatgg 60
aaatatgtgc tacatggttt tctcgtgtta ccaaggagga tagagtacca tcttccatgg 120
agcagtctag gacaggcggc aaatctcgaa agattct 157
<210> 3
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
ttaaccgtac tgatccctta 20
<210> 4
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
taaagaacaa tctcggtcct 20
<210> 5
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
aggaccgaga ttgttcttta 20
<210> 6
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
agaatctttc gagatttgcc 20
<210> 7
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 7
ccaccaaata ctactgcacg 20
<210> 8
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 8
catccatctt gttgcagcag 20
<210> 9
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 9
ccctttgaga tccacatctg 20
<210> 10
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 10
tgctggaatc catgagacca 20
<210> 11
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 11
ttacgagtct acaaggtaca 20
<210> 12
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 12
aacagatgtg gatctcaaag 20
<210> 13
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 13
tttccaacag tgtagtggcc 20
<210> 14
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 14
caacacgttc ttcagcgaga 20
<210> 15
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 15
agttggagta gcacacgatg 20
<210> 16
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 16
tttccaacag tgtagtggcc 20
<210> 17
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 17
tgcccagcga tacctctgtt 20
<210> 18
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 18
gggagatgag ctgctctgta 20
<210> 19
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 19
ggccactaca ctgttggaaa 20
<210> 20
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 20
agttccacca ccaacagcat 20
<210> 21
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 21
agctttggag acctgaacca 20
<210> 22
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 22
cggcacacat catgttcttc 20
<210> 23
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 23
ccgagtacat gacctacatg 20
<210> 24
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 24
tggactccac gacatagtct 20
<210> 25
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 25
tccagagcga ggatgtcgag 20
<210> 26
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 26
ttcctcaggg ttcctgacgc 20
<210> 27
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 27
cctccttcct tcgagtttgt 20
<210> 28
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 28
cacgcatact tgaacgacct 20
<210> 29
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 29
agaggacatg tggtattgcc 20
<210> 30
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 30
gttggacatc tgcctgcttt 20
<210> 31
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 31
agaggacatg tggtattgcc 20
<210> 32
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 32
ttggacatct gcccgctttt 20
<210> 33
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 33
agaggacatg tggtattgcc 20
<210> 34
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 34
ttggatatct gcccgcttct 20
<210> 35
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 35
cctggacatg ctcagagtat 20
<210> 36
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 36
gacttctgct gcgaaattcc 20

Claims (3)

1. An internal reference gene for analyzing the gene expression of the mature period of the oat, which is characterized in that the internal reference gene is AsFPGS-1D1RF and AsFPGS-1D2 RF; wherein,
the nucleotide sequence of AsFPGS-1D1RF is shown as SEQ ID NO. 1;
TTAACCGTACTGATCCCTTACCAGACGAGTTCATTAAAGGGCTCTCAAGTGCTTCTTTGCAAGGCCGAGCACAAATTGTTCCAGATTCACAAGTAAATTCTGAAGAGAAGGACCGAGATTGTTCTTTA；SEQ ID NO:1；
the nucleotide sequence of AsFPGS-1D2RF is shown as SEQ ID NO. 2;
AGGACCGAGATTGTTCTTTAGTGTTCTATTTGGATGGCGCGCACAGCCCTGAAAGTATGGAAATATGTGCTACATGGTTTTCTCGTGTTACCAAGGAGGATAGAGTACCATCTTCCATGGAGCAGTCTAGGACAGGCGGCAAATCTCGAAAGATTCT；SEQ ID NO:2。
2. the reference gene for analyzing the gene expression of the oat in the mature period according to claim 1, wherein the real-time fluorescent quantitative PCR primer sequence of AsFPGS-1D1RF is shown in SEQ ID NO. 3 and SEQ ID NO. 4;
TTAACCGTACTGATCCCTTA；SEQ ID NO:3；
TAAAGAACAATCTCGGTCCT；SEQ ID NO:4；
the real-time fluorescent quantitative PCR primer sequence of the AsFPGS-1D2RF is shown in SEQ ID NO. 5 and SEQ ID NO. 6;
AGGACCGAGATTGTTCTTTA；SEQ ID NO:5；
AGAATCTTTCGAGATTTGCC；SEQ ID NO:6。
3. the use of the reference gene of claim 1 in oat gene expression analysis.
CN202210632707.9A 2022-06-06 2022-06-06 Internal reference gene for oat mature period gene expression analysis and application Active CN115058532B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202210632707.9A CN115058532B (en) 2022-06-06 2022-06-06 Internal reference gene for oat mature period gene expression analysis and application

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202210632707.9A CN115058532B (en) 2022-06-06 2022-06-06 Internal reference gene for oat mature period gene expression analysis and application

Publications (2)

Publication Number Publication Date
CN115058532A true CN115058532A (en) 2022-09-16
CN115058532B CN115058532B (en) 2024-03-19

Family

ID=83199721

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202210632707.9A Active CN115058532B (en) 2022-06-06 2022-06-06 Internal reference gene for oat mature period gene expression analysis and application

Country Status (1)

Country Link
CN (1) CN115058532B (en)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2017180587A2 (en) * 2016-04-11 2017-10-19 Obsidian Therapeutics, Inc. Regulated biocircuit systems
CN114250223A (en) * 2021-12-16 2022-03-29 吉林省白城市农业科学院(吉林省向日葵研究所) Rapid extraction method of oat leaf chip genome

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2017180587A2 (en) * 2016-04-11 2017-10-19 Obsidian Therapeutics, Inc. Regulated biocircuit systems
CN114250223A (en) * 2021-12-16 2022-03-29 吉林省白城市农业科学院(吉林省向日葵研究所) Rapid extraction method of oat leaf chip genome

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
ZHANG MEI-JUN等: "Functional diversity of soil microbial communities in response to supplementing 50% of the mineral N fertilizer with organic fertilizer in an oat field", JOURNAL OF INTEGRATIVE AGRICULTURE, vol. 20, no. 8, 31 December 2021 (2021-12-31), pages 2255, XP086686089, DOI: 10.1016/S2095-3119(20)63331-7 *
王娜等: "燕麦内参基因的筛选及裸粒相关基因AsMADS1的克隆", CNKI, 31 December 2022 (2022-12-31) *

Also Published As

Publication number Publication date
CN115058532B (en) 2024-03-19

Similar Documents

Publication Publication Date Title
EP2173882A2 (en) Secondary wall forming genes from maize and uses thereof
CN111778265B (en) Mutant gene, mutant, expression vector and application of zearalenone oxidase
CN111333707B (en) Plant grain type related protein and coding gene and application thereof
CN104995301A (en) Plant regulatory elements and uses thereof
US9024141B2 (en) Maize ERECTA genes for improving plant growth, transpiration, efficiency and drought tolerance in crop plants
CN111321241B (en) Molecular marker of wheat thousand-grain weight and grain length gene TaGS3-4A and application thereof
CN110396556B (en) ISSR-SCAR marker for identifying Oenanthe Javanica and identification method thereof
CN101857633A (en) Leaf-shaped control gene SRNL1 of rice and application thereof
WO2024148764A1 (en) Rice tillering promoting gene and use thereof
CN110885813B (en) Application of rice histone deacetylase gene HDA710 in delaying leaf senescence
CN115058532A (en) Reference gene for oat maturity gene expression analysis and application thereof
CN115058533B (en) Internal reference gene for analysis of gene expression in oat stem and application thereof
CN109207485A (en) Application of the OsAPS1 gene in improvement Rice Resistance characteristic of disease
WO2018196744A1 (en) Transgenic soybean event gc1-1 exogenous insert flanking sequence and application thereof
CN113736900B (en) Method for screening single copy T-DNA transgenic plants
CN116694799A (en) Site of InDel related to rice essential amino acid accumulation in rice OsAUX5 gene and application
US20120227132A1 (en) Cell number polynucleotides and polypeptides and methos of use thereof
JP5849317B2 (en) Variety identification marker of vegetative propagation crop
CN110656196A (en) Primer group capable of accurately determining nucleotide sequence of primula thunbergii ITS, synthesis and rapid molecular identification
LU506426B1 (en) Poplar sugar transporter protein gene pagsweet15b, coding protein and an application thereof
US20100132072A1 (en) Method to Increase Crop Grain Yield Utilizing Complementary Paired Growth and Yield Genes
Pan et al. cDNA-AFLP profiling for the fiber development stage of secondary cell wall synthesis and transcriptome mapping in cotton
CN112322622B (en) Application of lncRNA17978 in improvement of disease resistance of rice
CN118291676B (en) Primer group, kit and method for detecting passion flower lignified virus
CN112941083B (en) Rice lesion senescence regulation gene and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant