CN114752606B

CN114752606B - Transcription regulator PfaR for promoting Shewanella EPA synthesis and application thereof

Info

Publication number: CN114752606B
Application number: CN202210353242.3A
Authority: CN
Inventors: 邱东茹; 魏贺红; 余佃贞
Original assignee: Institute of Hydrobiology of CAS
Current assignee: Institute of Hydrobiology of CAS
Priority date: 2022-04-02
Filing date: 2022-04-02
Publication date: 2023-09-26
Anticipated expiration: 2042-04-02
Also published as: CN114752606A

Abstract

The invention discloses a transcription regulator PfaR for promoting the synthesis of Shewanella eicosapentaenoic acid (EPA, C20:5ω3) and application thereof, wherein the nucleotide sequence of the transcription factor PfaR is shown as SEQ ID NO.1, and gene knockout and real-time fluorescence quantitative PCR (RT-qPCR) prove that PfaR is taken as a forward regulation factor to participate in the regulation of EPA synthesis at low temperature of Shewanella, and meanwhile, the overexpression of the transcription regulator PfaR can improve EPA content at low temperature of Shewanella. Thus, the transcription regulator PfaR promotes the synthesis of EPA by shiva at low temperature and plays an important role in the improvement of the genetic improvement related to the synthesis of EPA by shiva.

Description

Transcription regulator PfaR for promoting Shewanella EPA synthesis and application thereof

Technical Field

The invention belongs to the technical field of molecular microorganisms, and particularly relates to application of a Pfa R transcription regulator in promoting EPA synthesis at a low temperature for regulating Shewanella.

Background

Eicosapentaenoic acid (eicosapentaenoic acid, EPA; C20:5ω3) is an omega 3 long chain polyunsaturated fatty acid, and has good effects in lowering blood pressure and cholesterol, maintaining cardiovascular health, treating rheumatoid arthritis, preventing depression, ensuring prenatal health, and treating osteoporosis. The n-3LC-PUFAs are obtained by eating seafood and other products by common consumers, enough n-3LC-PUFAs can be obtained by eating some deep sea fishes frequently, and human serum level surveys find that most people lack the necessary fatty acids.

The demand of people is increasing to cause excessive fishing, the sustainable development of fishery resources is required to be ensured, and the pollution of the environment causes serious pollution of heavy metals and organic matters in fish oil, the fish oil has heavy fishy smell, and the EPA demand in the markets at home and abroad is increasing, so the development of polyunsaturated fatty acid for replacing raw materials in environmental protection and economy is always a subject of great concern. The microorganism is used as an ideal resource for producing n-3LC-PUFAs single-cell oil because of the advantages of high growth speed, low nutrition requirement, simple metabolic regulation and control and the like. Further understanding the EPA synthesis regulatory mechanism of microorganisms helps to develop microbial engineering strains that efficiently synthesize EPA.

At present, a research on a gene cluster for synthesizing EPA of Guan Xiwa bacteria has been reported, the method for improving the EPA content mainly comprises the steps of changing a carbon source nitrogen source, reducing the temperature and externally expressing the gene cluster, but a method for improving the EPA content by using a transcription regulator Pfa R for EPA synthesis has not been reported, and the positive regulation effect of Pfa R in Shewanella EPA synthesis is proved by gene directional knockout and overexpression for the first time.

Disclosure of Invention

In order to increase the yield of EPA synthesized by Shewanella, the present invention provides a transcription regulator PfaR for promoting the synthesis of EPA by Shewanella.

In order to solve the technical problems, the technical scheme adopted by the invention is as follows:

the application of a transcription regulator PfaR in regulation and control of the EPA synthesis of Shewanella, wherein the nucleotide sequence of the regulator PfaR is shown as SEQ ID NO.1, the amino acid sequence is shown as SEQ ID NO.2, and the overexpression of the transcription regulator PfaR in Shewanella can improve the EPA content of Shewanella at low temperature (4-16 ℃).

Specifically, the application includes the following steps:

(1) Constructing an escherichia coli recombinant expression vector of a transcription regulator PfaR;

(2) E.coli recombinant expression vectors of PfaR were transformed into Shewanella, and PfaR overexpressed strains were screened.

Compared with the prior art, the invention has the beneficial effects that:

through functional verification such as gene knockout, RT-qPCR and over-expression, the biological function of the Shewanella PfaR gene is revealed, and a method capable of improving the yield of the Shewanella EPA is provided.

Drawings

FIG. 1 is a graph showing the effect of knockout of Pfa R on the transcriptional level of EPA synthetic gene clusters. W3-18-1 is wild type, delta 2776 is PfaR gene knockout strain.

FIG. 2 shows the decreased EPA content in the PfaR knockout strain delta 2776 at low temperature.

FIG. 3 is a map of plasmid pBBR1 MCS-5.

FIG. 4 shows that overexpression of Pfa R at low temperature can increase EPA content in Shewanella W3-18-1. W3-18-1/p5 represents wild type W3-18-1 carrying empty vector pBBR1MCS-5, delta2776/p 5 represents PfaR gene knockout strain carrying empty vector pBBR1MCS-5, W3-18-1/p5-pfaR represents wild type W3-18-1 carrying over-expression vector pBBR1MCS-5-pfaR.

Detailed Description

The invention is further described below in connection with specific embodiments.

Example 1: cloning of the Shewanella transcription regulator PfaR Gene

1. Shewanella genome extraction

The experimental material was Shewanella W3-18-1 (Shewanella sp.W3-18-1) cultured in laboratory, and the genome extraction was performed using a hundred OMEGA bacterial DNA extraction kit.

2. PfaR Gene cloning

The genome is used as a template, and an upstream primer and a downstream primer PfaR-F of the PfaR gene are designed: GCCATTTTACGA GAGCACGTC and PfaR-R: ACGATGGCAACAGGCATATCT as primers for the PCR reaction. PCR amplification and reaction conditions were all carried out according to the instructions. After the reaction is finished, the PCR product is separated by 1% agarose gel electrophoresis to obtain a product with the length of about 1050bp, and after purification and recovery, the product is sent to a biological engineering for sequencing, the result is shown as SEQ ID NO.1, the length of the nucleotide sequence is 870bp, the coded protein sequence is shown as SEQ ID NO.2, and the protein consists of 289 amino acids.

Example 2: functional verification of the Shewanella PfaR Gene

1. Effects of PfaR on EPA Synthesis-related genes

1.1 knockout of the PfaR Gene

The pfaR gene in Shewanella W3-18-1 is knocked out by utilizing a gene site-directed knockout technology, and a PfaR upstream and downstream primer PfaR-5O is designed: accgcatgcgatatcgagctcTCGAGCCCTGTTTGTTGCTT, pfaR-5I: AAAGAGTCTCCACGGGTCGAGAGTCTCATCTCAGGCGTGG, pfaR-3I: CCACGCCTGAGATGAGACTCTCGACCCGTGGAGACTCTTT and PfaR-3O: gtggaattcccgggagagctcCTTTGGCGACAATCAGCGAC (italic lower case as homology arm), first, using genome as template, using Pfa R-5O and Pfa R-5I, pfa R-3O and Pfa R-3I as primer to amplify 5 'and 3' fragment, then using 5 'and 3' fragment as template, using Pfa R-5O and Pfa R-3O as primer to make cross-server PCR to obtain Pfa R deletion target fragment ΔpfaR. Single cleavage SacI-treated pDS3.0 (Wan, verBerkmoes et al 2004) was recombined with the fragment of interest ΔpfaR using the non-ligase dependent single fragment rapid cloning kit of Nanjinopran Biotechnology, inc., and ligation products pDS3.0- ΔpfaR transformed E.coli WM3064.

Shewanella W3-18-1 wild type was conjugated to pDS 3.0-. DELTA.pfaR/WM 3064 using LB-Dap (Meso-2, 5-diaminopimelic Acid, diaminopimelic acid, 50 mg/L), single-crossover screening was performed using LB-Gm (gentamicin) 15mg/L, and double-crossover screening was performed using LB-10% S (sucrose, W/v). Mutant Δpfar was verified using both pfaR-5O and pfaR-3O assays.

1.2 Effect of PfaR on EPA synthetic Gene Cluster expression

Culturing wild-type Shewanella W3-18-1 and mutant strain delta 2776 to OD at 28℃using LB liquid medium ₆₀₀ About 0.6 to 0.8, transferring to a low temperature of 16 ℃, sampling after 8 hours, extracting RNA, and carrying out RT-qPCR. RNA extraction and reverse transcription were performed according to the kit instructions. The primers used for RT-qPCR are shown in Table 1, and the reference gene is the 16SrRNA gene.

TABLE 1 primers used for RT-qPCR

As a result, as shown in FIG. 1, the EPA synthetic gene cluster in the Pfa R gene knockout strain Δ2776 at low temperature was transcribed to a low level after knocking out Pfa R, and it was confirmed that Pfa R affects the EPA synthetic gene cluster transcription at low temperature and is a positive regulator.

1.3 changes in EPA content after PfaR knockout

Activation of Shewanella with LB liquid MediumWild-type and mutant strain Delta 2776,1% of W3-18-1 were transferred to modified 2216 medium (5 g peptone in 1L, 2g yeast extract, 0.02g Na) ₂ HPO ₄ ，0.05gMgSO ₄ ·7H ₂ O,1g glucose, 20g sea salt) to OD600 of about 0.6-0.8, culturing at 4 ℃,16 ℃ and 28 ℃ for 24h and 48h respectively, and collecting the thalli. After freeze-drying, 20mg of the cells were weighed and subjected to methyl esterification, and the EPA content was measured by GC-MS analysis, and the procedure was as follows: the sample inlet and detector temperatures were maintained at 250 ℃ and 270 ℃, respectively, the oven temperature was increased from 150 ℃ to 240 ℃, the temperature increase rate was 6 ℃/min, and high purity helium was used as the carrier gas. As shown in FIG. 2, the decrease in the amount of Shewanella EPA synthesized at low temperature (4 ℃ C., 16 ℃ C.) after PfaR knockout was demonstrated.

The methyl esterification adopts a sodium hydroxide-methanol method, and comprises the following specific steps:

(1) Weighing about 20mg of cells, grinding the cells into powder, and adding the powder into a COD digestion tube;

(2) 1ml of sodium hydroxide-methanol solution (45 g of sodium hydroxide in 150ml of methanol and 150ml of water) was added thereto, followed by shaking by vortexing for 10s;

(3) Boiling for 5min, swirling for 10s again, and boiling for 25min again;

(4) Cold cutting to room temperature, adding 2ml of hydrochloric acid-methanol-water solution (39:55:26, volume ratio) and mixing well;

(5) Water bath at 80deg.C for 10min, and rapidly cooling with cold water;

(6) 1.25ml of n-hexane is added, the mixture is gently shaken for 10min, 3ml of 1.2% NaOH solution is added, the mixture is gently shaken for 5min, and 300 mu L of saturated NaCl solution is added, the mixture is gently shaken for 5min;

(7) Centrifuging at 2000rpm for 3min, collecting upper layer, and collecting upper layer with anhydrous MgSO ₄ After dehydration, analysis was performed by GC-MS.

2. Shewanella PfaR gene overexpression

2.1 construction of the overexpression vector

The overexpression vector used in the invention is pBBR1MCS-5 (Kovach, phillips et al 1994), the vector map is shown in FIG. 3. The vector is linearized by selecting a suitable endonuclease for double cleavage, and the two endonucleases used in the present invention are KpnI enzyme and HindIII enzyme. Design of homologous recombination primer 2776-p5 (O) -F (KpnI): agggaacaaaagctgggtaccATGACCACTAGCGCAACTGATGAAAAGCCC and 2776-p5 (O) -R (HindIII): caggaattcgatatcaagcttTCATAAAGAGTCTCCACGGGTCGACCTG (italic lowercase homology arm) the PfaR gene was obtained by amplification using the genome as a template.

The recombination reaction uses a non-ligase dependent single fragment rapid cloning kit of Nanjinopran biotechnology company, a positive strain is obtained by converting a ligation product pBBR1MCS-5-PfaR into escherichia coli WM3064, the positive strain is named WM3064/pBBR1MCS-5-PfaR, and plasmid sequencing is obtained by culturing the positive strain and extracting.

2.2 transformation of Shewanella by conjugation

Shewanella W3-18-1 wild type was cultured simultaneously, mutant Delta2776, WM3064/pBBR1MCS-5-PfaR and WM3064/pBBR1MCS-5, and after the W3-18-1 wild type, mutant Delta 27776 and WM3064/pBBR1MCS-5-PfaR and WM3064/pBBR1MCS-5 were ligated with WM3064/pBBR1MCS-5 at LB-Dap50mg/L for 8 hours, positive clones were obtained by screening with LB-Gm15mg/L, respectively.

2.3 phenotype detection of overexpressing strains

Culturing W3-18-1/pBBR1MCS-5, delta 2776/pBBR1MCS-5, W3-18-1/pBBR1MCS-5-PfaR with modified 2216 culture medium (Gm 15 mg/L), culturing at 16 ℃ for 24 hours, collecting thalli, freeze drying, weighing 20mg for methyl esterification, and determining EPA content by GC-MS analysis, wherein the methyl esterification and GC-MS analysis are the same. As shown in FIG. 4, it was demonstrated that overexpression of Pfa R at low temperature increased EPA content in Shewanella W3-18-1.

Reference to the literature

Kovach,M.E.,R.W.Phillips,P.H.Elzer,R.M.Roop,2nd and K.M.Peterson(1994)."pBBR1MCS:a broad-host-range cloning vector."Biotechniques 16(5):800-802.

Wan,X.F.,N.C.VerBerkmoes,L.A.McCue,D.Stanek,H.Connelly,L.J.Hauser,L.Y.Wu,X.D.Liu,T.F.Yan,A.Leaphart,R.L.Hettich,J.Z.Zhou and D.K.Thompson(2004)."Transcriptomic and proteomic characterization of the fur modulon in the metal-reducing bacterium Shewanella oneidensis."Journal of Bacteriology 186(24):8385-8400.

Sequence listing

<110> institute of aquatic organisms at national academy of sciences

<120> transcriptional regulator PfaR promoting Shewanella EPA synthesis and use thereof

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 870

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 1

atgaccacta gcgcaactga tgaaaagccc tcggagaaaa cgggaaagct tggagcgagt 60

cgagaagaaa agcacactca atcgaggcat agcaatgcga ctaccacgcc tgagatgaga 120

ctctttattc agcaatcgga tctgagtgtg agtcagcttg ccaaaattct aaatatcacc 180

gaagccacag ttcgcaaatg gcgtaaacgt gagtcgattg ttgattgtcc caatactccg 240

catcacctca ataccacgct cacaccgatg gaagaatatg tggttgtcgg cctaagatac 300

caattaaaac tccccttaga ccggctacta aaagccactc aaacctttat taatcccaat 360

gtgtcgcgct ccggccttgc ccgctgctta aagcgctacg gcatatcgcg gctcgatgaa 420

tttgaagcac cacaagtacc cgaacgctat tttaatcaat tgcctgtgac gcaaggcagc 480

gatatccaaa cctatacggt caatccagaa accttggcca aagccctcgc attgccgagt 540

accgacggca atactgtggt gcaagtggtg tcactcacca taccgccgca actcactgag 600

caagcgccaa gctcagtact attaggcgta gacacagcaa gtgattggat ttacctcgat 660

atttatcaag acagcaatac ccaagcgacc aatagatata tcgcctatgt cctcagacat 720

gggccgtttc atttacgaaa gttgctcgtt cgcaactatc acaccttctt agcccgtttt 780

cccggtgccc atggcacgcc aaagacaagc gcggctggat cccaaaacaa ggtcaccgta 840

tccaggtcga cccgtggaga ctctttatga 870

<210> 2

<211> 289

<212> PRT

<213> Artificial sequence (Artificial Sequence)

<400> 2

Met Thr Thr Ser Ala Thr Asp Glu Lys Pro Ser Glu Lys Thr Gly Lys

1 5 10 15

Leu Gly Ala Ser Arg Glu Glu Lys His Thr Gln Ser Arg His Ser Asn

20 25 30

Ala Thr Thr Thr Pro Glu Met Arg Leu Phe Ile Gln Gln Ser Asp Leu

35 40 45

Ser Val Ser Gln Leu Ala Lys Ile Leu Asn Ile Thr Glu Ala Thr Val

50 55 60

Arg Lys Trp Arg Lys Arg Glu Ser Ile Val Asp Cys Pro Asn Thr Pro

65 70 75 80

His His Leu Asn Thr Thr Leu Thr Pro Met Glu Glu Tyr Val Val Val

85 90 95

Gly Leu Arg Tyr Gln Leu Lys Leu Pro Leu Asp Arg Leu Leu Lys Ala

100 105 110

Thr Gln Thr Phe Ile Asn Pro Asn Val Ser Arg Ser Gly Leu Ala Arg

115 120 125

Cys Leu Lys Arg Tyr Gly Ile Ser Arg Leu Asp Glu Phe Glu Ala Pro

130 135 140

Gln Val Pro Glu Arg Tyr Phe Asn Gln Leu Pro Val Thr Gln Gly Ser

145 150 155 160

Asp Ile Gln Thr Tyr Thr Val Asn Pro Glu Thr Leu Ala Lys Ala Leu

165 170 175

Ala Leu Pro Ser Thr Asp Gly Asn Thr Val Val Gln Val Val Ser Leu

180 185 190

Thr Ile Pro Pro Gln Leu Thr Glu Gln Ala Pro Ser Ser Val Leu Leu

195 200 205

Gly Val Asp Thr Ala Ser Asp Trp Ile Tyr Leu Asp Ile Tyr Gln Asp

210 215 220

Ser Asn Thr Gln Ala Thr Asn Arg Tyr Ile Ala Tyr Val Leu Arg His

225 230 235 240

Gly Pro Phe His Leu Arg Lys Leu Leu Val Arg Asn Tyr His Thr Phe

245 250 255

Leu Ala Arg Phe Pro Gly Ala His Gly Thr Pro Lys Thr Ser Ala Ala

260 265 270

Gly Ser Gln Asn Lys Val Thr Val Ser Arg Ser Thr Arg Gly Asp Ser

275 280 285

Leu

Claims

1. A method for increasing EPA content in Shewanella W3-18-1 is characterized in that a transcription regulator PfaR is overexpressed in Shewanella W3-18-1, and the nucleotide sequence of the regulator PfaR is shown as SEQ ID NO. 1.

2. The method according to claim 1, wherein the Shewanella over-expressing the transcription regulator PfaR is cultured at 4-16 ℃.