CN114507672A - Application of OsSLT1 gene in controlling salt tolerance of rice - Google Patents

Abstract

The invention belongs to the field of rice genetic engineering and disclosesOsSLT1Application of gene in controlling salt tolerance of rice and the geneOsSLT1The genome DNA sequence of the gene is shown as SEQ ID NO. 1. The applicant locates the candidate gene through whole genome association analysis, and no relevant report exists at present whether the stress resistance of the rice can be improved. Thus, it was isolated from riceOsSLT1The gene and the identification of the functions of the gene in improving the stress resistance of the rice have very important significance for cultivating new stress-resistant rice varieties. The invention firstly provides that the gene for coding the protein shown by SEQ ID NO.6 can control the salt tolerance of rice, and the identification of the salt stress phenotype in the seedling stage shows that the rice has the salt tolerance when the gene fragment is deletedThe salt stress capability is reduced, and the function and application approach of the gene are proved.

Description

Application of OsSLT1 gene in controlling salt tolerance of rice

Technical Field

The invention belongs to the field of rice genetic engineering, and particularly relates to application of an OsSLT1 gene in controlling rice salt tolerance, wherein the CDS sequence of the OsSLT1 gene is shown in SEQ ID No. 2.

Background

The plants are influenced by a plurality of abiotic stresses in the growth process, wherein the soil salinization not only limits the growth range of the rice, but also limits the yield of the rice, and the identification of genes related to the salt tolerance of the rice and the deep research on biochemical molecules and the like have great significance.

The stress of the salt in the soil to the plants can be divided into two stages: osmotic stress phase and ionic stress phase. Osmotic stress of salt to plants occurs in the early stage, resulting in dehydration of cells, reduction of cell turgor and root growth rate, inhibition of photosynthesis and aerial part growth rate; ionic stress causes excessive Na + and Cl-accumulation in plant cells, reducing growth rate and yield. Salt stress has many adverse effects on plants, and also there are many types of ways in which plants tolerate salt stress, which can be mainly classified into three categories: (1) osmotic stress tolerance. Osmotic stress can immediately reduce cell expansion of young leaves and root tips and cause stomata to close. The reduction of response to osmotic stress can increase the conductance of leaves and stomata, but the increase of the area of the leaves only plays a beneficial role under the condition that plants have sufficient soil water; (2) na + is discharged, and Na + in the leaves is discharged through the roots. Na + does not exclude that plants will show toxic effects after days or weeks and will cause premature wilting of old leaves; (3) tissue tolerance, allowing toxic ions to enter the vacuole or specific tissues, and localizing salts (Munns and Tester, mechanics of saline tumor. Annu Rev Plant biol.59:651- "81, 2008).

Many genes involved in salt tolerance have been identified in plants. Some of these have increased the effectiveness of the plant tolerance by producing osmoregulatory substances, such as sugars (Cao et al, Reduced expression of a gene encoding a gold localized monosacchare transporter (OsG MST1) genes hypersensory to salt plant (Oryza sativa), J Exp Bot,62: 4595. 4604,2011), proline (Igarashi et al, mutagenesis of the gene for 1-pyroline-5-carboxyplate synthase and catalysis enzyme expression of the gene and lysis of the enzyme L. plant Mol Biol,33: 857. 865,1997), and betaine (kamoto et al, metabolism of the enzyme expressing strain L. plant Mol Biol, 1998), and the plant tolerance of the strain of the enzyme modification of the strain, 1998. Many regulatory proteins, including protein kinases, phosphorylases, calmodulin, transcription factors and signaling factors, have also been shown to be involved in the regulation of salt tolerance in plants. Overexpression of the Ca2+ -dependent protein kinase OsCDPK7(Saijo et al, Over-expression of a single Ca2+ -dependent protein kinase bath color and salt/delivery tolerance on plant J,23:319-327,2000), OsCPK21(Asano et al, Functional characterization of OsCPK21, a calcium-driven protein enzyme that protein kinase enzyme soluble tolerance in plant Mol Biol,75:179-191, 191) can improve the salt tolerance of rice 2011. Similarly, some transcription factors are also involved in activating the Expression of various stress-related genes and improving the salt tolerance of rice, such as bZIP (divergent et al, mutation of OsbZIP23 as a key plane of the basic rice transformation factor in rice plant physical, 148: 1938-gene 1952,2008), DREB (Malikarjuna et al, Expression of OsDREB2A transformation factor expressed and transformed gene Expression and plasmid Expression vector in rice plant specific, 2006: origin L.Biotechnology, Lett 33: technique 9, 1689. type NAC, 2011-gene Expression and Expression vector in rice plant, 11. and 16. Expression of rice plant, Expression of OsbZIP23 as well as gene Expression of rice plant, 12. and rice plant, 12. A. and P. for rice plant, rice plant Expression, rice plant, rice, 51:617-630,2007).

There are also a number of genes that transport ions involved in the salt response process. High affinity potassium transporters (HKT) (Ali et al, TsHKT 1; 2, a HKT1 hololog from The expression of The expression enzymes relative to The culture cells, strain K + specificity in The expression of NaCl. Plant physiology, 158: 1463. sup. 1474, 2012; Byt et al, HKT 1; 5-like transport proteins linked to Na + e expression in The genome, Nax2 and Knay 1.Plant physiology, 143. mu.m. 1918. 2007; Davenport et al, Na + transport proteins ATT 1; 1control strain Na + expression proteins linked to strain K20. mu.m. 2007, strain K and strain K, strain K2007, strain K and strain K507. mu.g for strain A. multidrug strain, strain K # for strain K # and strain K # for strain K for strain K # for strain K for strain K # for strain K for strain K for strain K for strain K for strain K for strain K for strain K for strain K for strain K for strain, 14: 660-; horie et al, calcium m regulation of sodium hydrosilicities of sos3 and athkt1 variants. plant Cell Physiol,47: 622-; plant et al, Nomenclature for HKT transporters, key determinants of great sales company. trends Plant Sci,11:372-374, 2006; xue et al, AtHKT 1; 1media n involved sodium channel transport properties in Arabidopsis across plos One,6: e24725,2011) and SOS (salt sensitive) gene families play an important role in regulating Na + transport (Barragan et al, Ion exchanges NHX1 and NHX2 medium active site in Na + transport to cells and Cell function in Arabidopsis Cell,24:1127 1142, 2012; bassil et al, The Arabidopsis intercellular Na +/H + antiporters NHX5 and NHX6, area endosome associated and recycled for plant growth and development, plant Ce ll,23: 224-; bassil et al, The Arabidopsis Na +/H + antiporters NHX1 and NHX2 c control vacuum pH and K + homenosis to regulatory growth, flower definition, and reproduction. Ji et al, The Salt excess Sensitive (SOS) pathway: affected and engineering plants, mol Plant,6: 275-; mahajan et al, Calcium-and salt-stress signalling in plants, editing light on SOS pathway. Arch Biochem Biophys,471:146 158, 2008; qia et al, Regulation of SOS1, a plasma membrane Na +/H + exchange in Arabidopsis thaliana, by SOS2 and SOS3.Proc Natl Acad Sci USA,99:8436-8441, 2002; shi et al, Overexpression of a plasma membrane Na +/H + antiporter gene both salt to space in Arabidopsis thaliana. Nat Biotechnol,21:81-85,2003; yang et al, Overexpression of SOS (Salt excess Sensitive) genes in production and tolerance in transgenic Arabidopsis. M.ol.plant, 2:22-31,2009. In addition, increasing The number of Na +/H + antiporters (NHX) in The vacuole contributes to increased salt tolerance in The aerial parts (Barragan et al, Ion exchanges NHX1 and NHX2 medium active spot ammonium uptake into vacuoles to regulated Cell regulators and storage functions in Arabidopsis. plant t Cell,24: 1127. plant 1142, 2012; Basil et al, The Arabidopsis intercell Na +/H + antigens N HX5 and NHX6, isomer association and processing for plant growth and development. plant Cell,23: 224. 239, 2011).

The expression of NtSLT1 from tobacco with truncated N end CaN inhibit calcineurin (CaN) deficient yeast mutant. And the truncated NtSLT1 can increase the salt tolerance of wild-type yeast. NtSLT1 encodes a protein of unknown function, but it was confirmed by experiments in yeast as a salt tolerance determinant. The homologous protein of NtSLT1 in Arabidopsis thaliana, AtSLT1, which contains a self-inhibitory domain at the N-terminus, also inhibits the salt-sensitive phenotype of yeast CaN-deficient mutants (Matsumoto et al, Tobacand Arabidopsis SLT1 medium loss of yeast, Plant Molecular Biology,45: 489-one 500, 2001).

Disclosure of Invention

The invention aims to provide the application of the OsSLT1 gene in controlling the salt tolerance of rice; the CDS sequence of the OsSLT1 gene is SEQ NO: 2, the amino acid sequence of the encoded protein is SEQ ID NO: and 6. In order to achieve the above object, the present invention adopts the following technical measures:

the application process of the OsSLT1 gene in controlling the salt tolerance of rice comprises the step of controlling the expression of the OsSLT1 gene by utilizing the conventional scheme of the invention to control the salt tolerance of rice, wherein the sequence of the OsSLT1 gene is shown in SEQ ID No.1, the sequence of CDS is shown in SEQ ID No.2, and the sequence of the encoded protein is shown in SEQ ID No.6

In the above application, preferably, the gene is knocked out by selecting a target site in the OsSLT1 gene by a CRISPR/Cas9 method, and the obtained rice mutant is salt-sensitive rice;

in the above application, the salt-sensitive rice preferably comprises a nucleotide sequence shown in SEQ ID NO.3 or SEQ ID NO. 4.

Compared with the prior art, the invention has the following advantages:

the invention firstly provides that the gene for coding the protein shown by SEQ ID NO.6 can control the salt tolerance of rice, and the identification of the salt stress phenotype at the seedling stage shows that the salt stress tolerance of the rice is reduced when the gene fragment is deleted, thereby confirming the function and application approach of the gene.

Drawings

FIG. 1 is a schematic diagram of salt stress experiments in the seedling stage of OsSLT1-1 of wild rice and rice OsSLT1 CRISPR mutant OsSLT;

the control wild type risjing (C087) was on the left of each round pot and the CRISPR mutant osslt1-1 was on the right.

FIG. 2 is a schematic diagram of salt stress experiments in the seedling stage of OsSLT1-17 of wild rice and rice OsSLT1 CRISPR mutant OsSLT;

the control wild type risjing (C087) was on the left of each round pot and the CRISPR mutant osslt1-17 was on the right.

Detailed Description

The following examples define and describe the invention in constructing CRISPR mutant material of OsSLT1, identifying the genotype thereof to obtain homozygous mutants, and performing the salt stress phenotype identification at the seedling stage. From the following description of all or part of the implementation steps, the technicians in this field can determine the basic characteristics of the invention, and without departing from the spirit and scope of the invention, can make various changes and modifications to the invention, so as to adapt it to different uses and conditions.

The technical schemes of the invention are conventional schemes in the field if not particularly stated; the reagents or materials, if not specifically mentioned, are commercially available.

Example 1:

obtaining an OsSLT1 gene and constructing a CRISPR target vector OsSLT 1-TKC:

the gene OsSLT1 is shown as SEQ ID NO. 1.

Construction of OsSLT 1-TKC:

first, target sequences were designed and selected: the sgRNA target sequence of U6-promoted OsSLT1 gene was designed to be GGCCTCTCCATGGATCCCGCCGG.

Second, primers for CRISPR synthesis:

01g05790U6-F：GCCTCTCCATGGATCCCGCCgttttagagctagaaatagcaagtta

01g05790U6-R：GGCGGGATCCATGGAGAGGCaacctgagcctcagcgcagc

boundary primers: the primers partially overlapped with the sequences at both sides of the enzyme cutting site of the TKC plasmid Pme I are as follows:

OsU6P-F：gtcgtttcccgccttcagtttatgtacagcattacgtagg

OsU6T-R：CTGTCAAACACTGATAGTTTAAACgatggtgcttactgtttag

third, the transcription elements of the sgrnas were PCR amplified.

The first round of PCR was performed in two tubes, and the template was TKC plasmid ((He et al, Programmed selection-inactivation of the CRISPR/Cas9 constrained growth plasmids the isolation of estimated and transformed-free sites. mol Plant,11(9):1210-1213, 2018)):

PCR1：OsU6P-F+01g05790U6-R

PCR2：OsU6T-R+01g05790U6-F

in the second round of PCR, 0.5. mu.L of each of the PCR1 and PCR2 products was collected by tapping and collected, and then was amplified using Os U6P-F + OsU6T-R as a primer.

Fourthly, the PCR product of the second round is recovered by gel cutting and then is connected with the TKC vector which is completely cut by the Pme I enzyme. And finally, transforming the escherichia coli to obtain positive transformants, and sequencing to obtain the OsSLT1-TKC vector.

Sequencing primers flanking TKC were ZRP _390(GAACGGATAAACCTTTTCACGCCC), ZRP _395-2 (tggcgtaatagcgaagaggc).

Example 2:

agrobacterium-mediated genetic transformation

(1) And (3) electric conversion: the final CRISPR target vector OsSLT1-TKC is transformed into Agrobacterium EHA105 strain by electricity with 1800v voltage, and the Agrobacterium EHA105 strain is coated on LA culture medium with corresponding resistance selection, and positive clones are screened and used for transformation callus.

(2) Callus induction: removing hull from mature RIXINGJINGZHU rice seed, sequentially treating with 70% ethanol for 1 min, and 0.15% mercuric chloride (HgCl)₂) Disinfecting the surface of the seeds for 15 minutes; washing the seeds with sterilized water for 4-5 times; placing the sterilized seeds on an induction medium; and (3) placing the inoculated callus induction culture medium in a dark place for culturing for 4 weeks at the temperature of 25 +/-1 ℃.

(3) Callus subculture: the bright yellow, compact and relatively dry embryogenic calli were selected and placed on subculture medium for 2 weeks in the dark at 25 + -1 deg.C.

(4) Pre-culturing: compact and relatively dry embryogenic calli were selected and placed on pre-culture medium for 2 weeks in the dark at 25 + -1 deg.C.

(5) And (3) culturing agrobacterium: pre-culturing agrobacterium tumefaciens EHA105 (derived from CAMBIA, a commercial strain carrying the CRISPR vector OsSLT1-TKC of the invention) on LA culture medium with corresponding resistance selection, and culturing at 28 ℃ for two days; transferring the agrobacterium to a suspension culture medium, and culturing for 2-3 hours on a shaking table at 28 ℃.

(6) Infection of agrobacterium: transferring the pre-cultured callus into a sterilized bottle; adjusting the suspension of Agrobacterium to OD₆₀₀0.8-1.0; soaking the callus in agrobacterium tumefaciens suspension for 30 minutes; transferring the callus to sterilized filter paper and sucking to dry; then, the cells were cultured on a co-culture medium at a temperature of 19 to 20 ℃ for 3 days.

(7) Callus washing and selective culture: washing the callus with sterilized water until no agrobacterium is visible; soaking in sterilized water containing 400ppm Carbenicillin (CN) for 30 min; transferring the callus to sterilized filter paper and sucking to dry; the calli were transferred to selection medium for 2-3 selection 2 weeks each (carbenicillin concentration 400ppm for the first selection, 250ppm after the second selection, hygromycin concentration 250 ppm).

(8) Differentiation: transferring the resistant callus to a dark place on a pre-differentiation culture medium for culturing for 5-7 weeks; transferring the pre-differentiation cultured callus to a differentiation culture medium, and culturing under illumination at 26 ℃.

(9) Rooting: cutting off roots generated during differentiation; then transferred to rooting medium and cultured for 2-3 weeks under illumination at 26 ℃.

(10) Transplanting: residual medium on the roots was washed off and seedlings with good root system were transferred to the greenhouse while keeping the water moist for the first few days.

Example 3: gene type detection of CRISPR mutant of OsSLT1

After the constructed OsSLT1-TKC vector is transformed into seedlings, the transgenic materials of the seedlings are detected by a PCR method. The primer is F: AGGAGGAGCAAGAGGTGGAA; GTCCTGGATGCGCAGATTCA is added. Extracting DNA sample from transgenic material, performing PCR with the above primers, pre-denaturing at 95 deg.C for 5min, denaturing at 95 deg.C for 30s, annealing at 57 deg.C for 30s, extending at 72 deg.C for 30s, performing 32 cycles, extending at 72 deg.C for 5min, and keeping the temperature at 25 deg.C. And (3) carrying out agarose gel electrophoresis on the PCR product, sending the amplified fragment to a sequencing company for sequencing, and comparing the sequencing result with a wild type sequence (shown in SEQ ID NO. 5) to determine the genotype.

Example 4 identification of CRISPR mutant Miao salt stress phenotype

The rice seeds of the homozygous CRISPR mutant (two strains of osslt1-1 and osslt1-17, which respectively contain the sequences shown in SEQ ID NO.3 and SEQ ID NO.4, and the wild type family (containing the sequence shown in SEQ ID NO. 5)) with the identified genotype are germinated and directly sown into a small barrel. And in the seedling stage, the salt stress is planted by adopting small blue barrels for soil culture, and the weight and compactness of the soil in each blue barrel are consistent. 4 per mill salt stress is carried out on the plants in four-leaf stage of healthy growth (saline water with the same volume and the same concentration and 4 per mill is the mass ratio of NaCl to soil), and when obvious difference appears at the left side and the right side, photographing is started

CRISPR homozygous plants showed a drought sensitive phenotype compared to the wild type control (fig. 1 and 2). The two panels of FIG. 1 represent two replicates of the transgenic line osslt1-1, and the three panels of FIG. 2 represent three replicates of the transgenic line osslt 1-17; in FIGS. 1 and 2, wild-type rice was planted on the left side of each round pot; the right is planted with mutants.

Sequence listing

<110> university of agriculture in Huazhong

Application of OsSLT1 gene in controlling salt tolerance of rice

<160> 15

<170> SIPOSequenceListing 1.0

<210> 1

<211> 2872

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

tcctccattg ttcccctcct ccccttctct cccctctcct cctcgcttcc ggcgagaagc 60

tccggcgagg cgaagcctcc agaaccttca ggagagctcc tcaccgaagg gacaaggggc 120

cttctagaac cttgctgctt cctcccccaa aggttagatc agagcaaggg cagctgctct 180

ttcttctttc tttcttcctc gtttgtcttc gtttccacct tccagcgagg attctttgtg 240

tgtttaatgg gattttcgag gtgtggtacg gcttgattgg agaaaatatt gttgttttcg 300

tgacgaaatt tagtgaggta ttgtggggaa atcgagtggc ctttttagcg aaaggaagtg 360

ttttttttta cttgatctgt atttcgaggt atgtgtgcat caacatgctg ttaatttggt 420

agtaagtctg ataaattgct tttctttttt tttgtctctg gatttttcta ggcttgcagc 480

gctggattgg ctccgaagat cttaattttg ctccaaagga aggatccccc atcgcaaatc 540

ttgatctgtg ggtggatttg gtgggttgaa aactccatct tttatggggc aaggctatgc 600

gaaatccttg atgctcccat ggagttctcc tcccatgggg caagaggtga agaggcagta 660

gatagaggag gagcaagagg tggaagcgaa gagaagtagg tgagaatagg aaggacgaag 720

gataaggaga ggagggagct ctccatggga gagcccctcc tcaccaccct gtccatggag 780

aacaccaaca gccatccctg cacccgcctc tccatggatc ccgccgggtc gcacgcggcc 840

tcgggtgact cctccggtgg cggtggaggt ggcggcagca ccggtgccgg tggtggtggt 900

ggtggtggcg gtggtgacag ggaattgttc atcattccgc ggcgtgaatc tgcgcatcca 960

ggaccaccgg acattaacct gcccctttct gcagacccct caccaccacc gccgccgcat 1020

ccgccgtcgt ggggtatcga ccagttcgac atgcttgatg tcggtctcgg cacgcagact 1080

tatgagtctg aggttgcgct cacgcttcca aagttgactg gcaatggcaa cactgcggtt 1140

ggcgtcggtg cgaggaagtg tgccaagagg ggggacagca tttggggtgc atggttcttc 1200

ttcaatcact acttcaaacc tgcacttgtg gaaaagccga agggcaaggt gacacgggac 1260

tcttctggga gcgtttcggg ctttgagaag tctgatcttc gccttgatgt cttcctggtg 1320

cagcatgaca tggagaacat gtacatgtgg gtttttaagg aacggcctga caatgccctc 1380

gggaagatgc agctccggag cttcatgaat gggcattcca agcatggtga gccatccttt 1440

ccattcagtg cagataaggg ctttgcaagg tcacaccgca tgcaacgaaa gcactatcga 1500

gggctgtcca acccacaatg ccttcatggg atagagattg tgagttcacc aaatctgtca 1560

gctgttcctg aagctgaaat gaaaaggtgg gcggaactta caggaagaga acttaatttc 1620

tcaattcctc ctgaagcaag tgactttgaa tcatggagga atcttccaag cactgatttc 1680

gaacttgata ggccactgcc actgtcatca aagattacac atggctctca cagtcacaaa 1740

aaggcactga atggttcagg tcttaacctt tctacgccac catcatcaga cgatgggatg 1800

gacctttcac caaaatgcgc caagcgacgg aaggacttct ttgctcatgg tgcagatgag 1860

gattgcgtga tggcaaataa ttcttgttct gacagagagc aagagataga agttcacaca 1920

ggtgagccgt catggatgca tgagttcact ggtgtagcaa aacatgcaag tggacctgtt 1980

acggctgcca agacaatata tgaggacgat gaaggctact taatcatggt gagcatgctc 2040

ttctctgatc ctcacagtgt caaggtctct tggaggaaca cattgacaca tggcattgtg 2100

aagatatcgt gtgtgagcac tgctcgaatg ccctttgtta agagacatga caggacattc 2160

aagttgactg atcctttccc tgagcactgc cctcctggag aatttgtgag agagatacct 2220

ttggctacaa ggattccaga agatgcaaag ctcgaagcgt attatgacga gactggcact 2280

ggactggaaa tcatggtccc caagcaccga gttggacccg aagagcatga agtccaggtt 2340

tgcatgaggc ccccacacct tggtgaaaac gatcttcttt tatcatagaa cagaaaacag 2400

tttagtcttt agatcttcct gtgtcatgcc atgatatgca ggaaagtaac aagtgatgcc 2460

atggatattt tgctgctaaa catttagctg aaattccttt ctcagtagtg ttggtgattt 2520

aggcaaaaaa gttaccactt tgttgattct cccctgtact ttttacacta gcaccactat 2580

attggagatc ttgatttcta tggaacatgg caaagttaaa attctgtata tatatctgat 2640

gatcaagttc aacggttcat tactccataa taatgtcgac agctacttac gactagaagt 2700

tcggaactgt gttgtcaatt tcagcaattg tttgtaatcg ctgtcttaat catttcaatg 2760

tgctgtacta caatactact ggctggatcg ctttcaactg aaaccaaaaa ctcgatccca 2820

ttgctgtact aacttcatga tcgatatgct cctatgcgaa ttccgtttgg tg 2872

<210> 2

<211> 1644

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

atgggagagc ccctcctcac caccctgtcc atggagaaca ccaacagcca tccctgcacc 60

cgcctctcca tggatcccgc cgggtcgcac gcggcctcgg gtgactcctc cggtggcggt 120

ggaggtggcg gcagcaccgg tgccggtggt ggtggtggtg gtggcggtgg tgacagggaa 180

ttgttcatca ttccgcggcg tgaatctgcg catccaggac caccggacat taacctgccc 240

ctttctgcag acccctcacc accaccgccg ccgcatccgc cgtcgtgggg tatcgaccag 300

ttcgacatgc ttgatgtcgg tctcggcacg cagacttatg agtctgaggt tgcgctcacg 360

cttccaaagt tgactggcaa tggcaacact gcggttggcg tcggtgcgag gaagtgtgcc 420

aagagggggg acagcatttg gggtgcatgg ttcttcttca atcactactt caaacctgca 480

cttgtggaaa agccgaaggg caaggtgaca cgggactctt ctgggagcgt ttcgggcttt 540

gagaagtctg atcttcgcct tgatgtcttc ctggtgcagc atgacatgga gaacatgtac 600

atgtgggttt ttaaggaacg gcctgacaat gccctcggga agatgcagct ccggagcttc 660

atgaatgggc attccaagca tggtgagcca tcctttccat tcagtgcaga taagggcttt 720

gcaaggtcac accgcatgca acgaaagcac tatcgagggc tgtccaaccc acaatgcctt 780

catgggatag agattgtgag ttcaccaaat ctgtcagctg ttcctgaagc tgaaatgaaa 840

aggtgggcgg aacttacagg aagagaactt aatttctcaa ttcctcctga agcaagtgac 900

tttgaatcat ggaggaatct tccaagcact gatttcgaac ttgataggcc actgccactg 960

tcatcaaaga ttacacatgg ctctcacagt cacaaaaagg cactgaatgg ttcaggtctt 1020

aacctttcta cgccaccatc atcagacgat gggatggacc tttcaccaaa atgcgccaag 1080

cgacggaagg acttctttgc tcatggtgca gatgaggatt gcgtgatggc aaataattct 1140

tgttctgaca gagagcaaga gatagaagtt cacacaggtg agccgtcatg gatgcatgag 1200

ttcactggtg tagcaaaaca tgcaagtgga cctgttacgg ctgccaagac aatatatgag 1260

gacgatgaag gctacttaat catggtgagc atgctcttct ctgatcctca cagtgtcaag 1320

gtctcttgga ggaacacatt gacacatggc attgtgaaga tatcgtgtgt gagcactgct 1380

cgaatgccct ttgttaagag acatgacagg acattcaagt tgactgatcc tttccctgag 1440

cactgccctc ctggagaatt tgtgagagag atacctttgg ctacaaggat tccagaagat 1500

gcaaagctcg aagcgtatta tgacgagact ggcactggac tggaaatcat ggtccccaag 1560

caccgagttg gacccgaaga gcatgaagtc caggtttgca tgaggccccc acaccttggt 1620

gaaaacgatc ttcttttatc atag 1644

<210> 3

<211> 100

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

atgggagagc ccctcctcac caccctgtcc atggagaaca ccaacagcca tccctgcacc 60

cgcctctcca tgccgggtcg cacgcggcct cgggtgactc 100

<210> 4

<211> 105

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

atgggagagc ccctcctcac caccctgtcc atggagaaca ccaacagcca tccctgcacc 60

cgcctctcca tggatcgccg ggtcgcacgc ggcctcgggt gactc 105

<210> 5

<211> 107

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

atgggagagc ccctcctcac caccctgtcc atggagaaca ccaacagcca tccctgcacc 60

cgcctctcca tggatcccgc cgggtcgcac gcggcctcgg gtgactc 107

<210> 6

<211> 547

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 6

Met Gly Glu Pro Leu Leu Thr Thr Leu Ser Met Glu Asn Thr Asn Ser

1 5 10 15

His Pro Cys Thr Arg Leu Ser Met Asp Pro Ala Gly Ser His Ala Ala

20 25 30

Ser Gly Asp Ser Ser Gly Gly Gly Gly Gly Gly Gly Ser Thr Gly Ala

35 40 45

Gly Gly Gly Gly Gly Gly Gly Gly Gly Asp Arg Glu Leu Phe Ile Ile

50 55 60

Pro Arg Arg Glu Ser Ala His Pro Gly Pro Pro Asp Ile Asn Leu Pro

65 70 75 80

Leu Ser Ala Asp Pro Ser Pro Pro Pro Pro Pro His Pro Pro Ser Trp

85 90 95

Gly Ile Asp Gln Phe Asp Met Leu Asp Val Gly Leu Gly Thr Gln Thr

100 105 110

Tyr Glu Ser Glu Val Ala Leu Thr Leu Pro Lys Leu Thr Gly Asn Gly

115 120 125

Asn Thr Ala Val Gly Val Gly Ala Arg Lys Cys Ala Lys Arg Gly Asp

130 135 140

Ser Ile Trp Gly Ala Trp Phe Phe Phe Asn His Tyr Phe Lys Pro Ala

145 150 155 160

Leu Val Glu Lys Pro Lys Gly Lys Val Thr Arg Asp Ser Ser Gly Ser

165 170 175

Val Ser Gly Phe Glu Lys Ser Asp Leu Arg Leu Asp Val Phe Leu Val

180 185 190

Gln His Asp Met Glu Asn Met Tyr Met Trp Val Phe Lys Glu Arg Pro

195 200 205

Asp Asn Ala Leu Gly Lys Met Gln Leu Arg Ser Phe Met Asn Gly His

210 215 220

Ser Lys His Gly Glu Pro Ser Phe Pro Phe Ser Ala Asp Lys Gly Phe

225 230 235 240

Ala Arg Ser His Arg Met Gln Arg Lys His Tyr Arg Gly Leu Ser Asn

245 250 255

Pro Gln Cys Leu His Gly Ile Glu Ile Val Ser Ser Pro Asn Leu Ser

260 265 270

Ala Val Pro Glu Ala Glu Met Lys Arg Trp Ala Glu Leu Thr Gly Arg

275 280 285

Glu Leu Asn Phe Ser Ile Pro Pro Glu Ala Ser Asp Phe Glu Ser Trp

290 295 300

Arg Asn Leu Pro Ser Thr Asp Phe Glu Leu Asp Arg Pro Leu Pro Leu

305 310 315 320

Ser Ser Lys Ile Thr His Gly Ser His Ser His Lys Lys Ala Leu Asn

325 330 335

Gly Ser Gly Leu Asn Leu Ser Thr Pro Pro Ser Ser Asp Asp Gly Met

340 345 350

Asp Leu Ser Pro Lys Cys Ala Lys Arg Arg Lys Asp Phe Phe Ala His

355 360 365

Gly Ala Asp Glu Asp Cys Val Met Ala Asn Asn Ser Cys Ser Asp Arg

370 375 380

Glu Gln Glu Ile Glu Val His Thr Gly Glu Pro Ser Trp Met His Glu

385 390 395 400

Phe Thr Gly Val Ala Lys His Ala Ser Gly Pro Val Thr Ala Ala Lys

405 410 415

Thr Ile Tyr Glu Asp Asp Glu Gly Tyr Leu Ile Met Val Ser Met Leu

420 425 430

Phe Ser Asp Pro His Ser Val Lys Val Ser Trp Arg Asn Thr Leu Thr

435 440 445

His Gly Ile Val Lys Ile Ser Cys Val Ser Thr Ala Arg Met Pro Phe

450 455 460

Val Lys Arg His Asp Arg Thr Phe Lys Leu Thr Asp Pro Phe Pro Glu

465 470 475 480

His Cys Pro Pro Gly Glu Phe Val Arg Glu Ile Pro Leu Ala Thr Arg

485 490 495

Ile Pro Glu Asp Ala Lys Leu Glu Ala Tyr Tyr Asp Glu Thr Gly Thr

500 505 510

Gly Leu Glu Ile Met Val Pro Lys His Arg Val Gly Pro Glu Glu His

515 520 525

Glu Val Gln Val Cys Met Arg Pro Pro His Leu Gly Glu Asn Asp Leu

530 535 540

Leu Leu Ser

545

<210> 7

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

ggcctctcca tggatcccgc cgg 23

<210> 8

<211> 46

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

gcctctccat ggatcccgcc gttttagagc tagaaatagc aagtta 46

<210> 9

<211> 40

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

ggcgggatcc atggagaggc aacctgagcc tcagcgcagc 40

<210> 10

<211> 40

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

gtcgtttccc gccttcagtt tatgtacagc attacgtagg 40

<210> 11

<211> 43

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

ctgtcaaaca ctgatagttt aaacgatggt gcttactgtt tag 43

<210> 12

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

gaacggataa accttttcac gccc 24

<210> 13

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

tggcgtaata gcgaagaggc 20

<210> 14

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

aggaggagca agaggtggaa 20

<210> 15

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

gtcctggatg cgcagattca 20

Claims (4)

1.OsSLT1The application of the gene in controlling the salt tolerance of rice; saidOsSLT1The amino acid sequence of the protein encoded by the CDS of the gene is SEQ ID NO: and 6.

2. The use of claim 1, saidOsSLT1The CDS sequence of the gene is shown as SEQ ID NO. 1.

3. The use according to claim 1, wherein the application is carried out by CRISPR/Cas9 methodOsSLT1Knocking out genes to obtain the salt stress sensitive rice.

4. The use according to claim 3, wherein the drought sensitive rice comprises the nucleotide sequence shown in SEQ ID No.3 or SEQ ID No. 4.

Images