CN114507613B

CN114507613B - Yeast engineering bacteria for producing alpha-santalene by fermentation and application thereof

Info

Publication number: CN114507613B
Application number: CN202210093958.4A
Authority: CN
Inventors: 连佳长; 左一萌; 程锦涛
Original assignee: ZJU Hangzhou Global Scientific and Technological Innovation Center
Current assignee: ZJU Hangzhou Global Scientific and Technological Innovation Center
Priority date: 2022-01-26
Filing date: 2022-01-26
Publication date: 2024-02-02
Anticipated expiration: 2042-01-26
Also published as: CN114507613A; WO2023143136A1

Abstract

The invention discloses a yeast engineering bacterium for producing alpha-santalene by fermentation and application thereof, belonging to the field of bioengineering. The yeast is taken as an original strain, and the yeast engineering bacteria for producing the alpha-santalene through fermentation are obtained through the construction of introduced genes. The yeast engineering bacteria can efficiently produce the alpha-santalene, the shake flask fermentation yield is approximately 3.0g/L, and the fermentation yield of a 1L fermentation tank can reach 15g/L. The metabolic flux in the biosynthesis pathway of the alpha-santalene is improved by high expression of key speed-limiting enzymes in the metabolic pathway, enhancement of precursor supply and a multi-copy strategy, and the alpha-santalene is efficiently generated by using pichia pastoris, so that the method has the characteristics of short period, environmental protection and resource conservation. The yeast engineering strain for high-yield alpha-santalene has wide application prospect.

Description

Yeast engineering bacteria for producing alpha-santalene by fermentation and application thereof

Technical Field

The invention relates to the field of bioengineering, in particular to a yeast engineering bacterium for producing alpha-santalene by fermentation and application thereof.

Background

Santalene with molecular formula of C ₁₅ H ₂₄ Belongs to a bicyclo sesquiterpene compound. There are two isomers of α -santalene and β -santalene. The alpha-santalene has a boiling point of 252 ℃ (100.39 kPa) and is present in the santalin volatile oil. Alpha-santalene as santalum albumOne of the main components of the essential oil has lasting fragrance, is widely applied to the industries of essence and spice, has pharmacological activities of antibiosis, antioxidation, anti-tumor and the like, and can be used as a rare health care medicine.

The natural sandalwood oil is mainly from the heart wood part of the sandalwood, natural sandalwood essential oil is prepared by extraction means such as organic reagent extraction, distillation and the like, and the extraction amount of the essential oil is different by mainly using a steam distillation method, an diethyl ether impregnation method, a solvent reflux method and the like. The components of the sandalwood essential oil are greatly different due to different production places and varieties of the sandalwood, and the aroma effect is inconsistent, so that the standard of the sandalwood essential oil cannot be controlled. In addition, due to the special growth characteristics of the sandalwood and the problem of long core maturation period, natural sandalwood resources are gradually exhausted.

Along with the continuous improvement of the human living standard, the demand for sandalwood products is also continuously increased, the early natural sandalwood resources are used up by unreasonable felling of human beings, the update time of the natural sandalwood forest is as long as 30 years or longer, and the factors enable the price of the valuable tree species of the sandalwood to be increased, so that the increasingly-growing market demand cannot be met.

The bioconversion method has no limitation of various conditions and is environment-friendly, and in recent years, with the development of synthetic biology technology, if the microbial cell factory is adopted for heterologous biosynthesis of santalene, the efficiency can be improved, the cost can be reduced, the limitation of natural conditions can be broken, and the contradiction between supply and demand of santalum album essential oil can be effectively relieved.

At present, a literature reports key genes for synthesizing alpha-santalene from santalum album plants, which lays a good foundation for synthesizing the alpha-santalene in a heterologous way. With the development of synthetic biology, many natural products can be expressed in pichia pastoris, like terpenes, flavonoids, etc. Pichia pastoris is taken as a recognized safe strain, and genetic background, metabolic pathways and regulation mechanisms of the Pichia pastoris have been well known for many years. Meanwhile, pichia pastoris is eukaryotic, has high growth speed, high environmental tolerance, simple fermentation conditions and the like, and can be widely used as ideal host bacteria for expressing heterologous proteins and producing bio-based compounds.

Although santalene has a plurality of application prospects, the low yield of santalene currently limits the application of santalene in different fields. The synthesis of plant-derived natural products by microorganisms is a very environment-friendly and efficient way, and no related report on production of santalene by pichia pastoris cell factories exists at present.

Disclosure of Invention

In order to solve the defects in the prior art, the invention provides a yeast engineering bacterium for producing alpha-santalene by fermentation and application thereof.

The yeast engineering strain is obtained by firstly utilizing a gene editing technology to highly express a santalene synthase SAS, secondly, removing the speed limiting step of a mevalonate pathway by highly expressing 3-hydroxy-3-methylglutaryl-CoA reductase 1tHMG1, and then improving the metabolic flux by using a high expression pathway speed limiting enzyme isopentenyl pyrophosphate isomerase IDI1 and a farnesyl pyrophosphate synthase ERG20, then highly expressing an acetyl-CoA synthase ACS and finally increasing the SAS copy number.

The invention provides a yeast engineering bacterium for producing alpha-santalene by fermentation, which is obtained by taking yeast as an original strain and constructing an introduced gene, wherein the introduced gene comprises any one of the following groups:

(1) A coding gene of santalene synthase SAS, a coding gene of 3-hydroxy-3-methylglutaryl-CoA reductase 1tHMG1, a coding gene of isopentenyl pyrophosphate isomerase IDI1, a coding gene of farnesyl pyrophosphate synthase ERG20 and a coding gene of acetyl-CoA synthase ACS;

(2) A coding gene of santalene synthase SAS;

(3) A coding gene of a santalene synthase SAS, a coding gene of 3-hydroxy-3-methylglutaryl coenzyme A reductase 1tHMG1, a coding gene of isopentenyl pyrophosphate isomerase IDI1 and a coding gene of farnesyl pyrophosphate synthase ERG 20.

Preferably, the coding gene of the santalene synthase SAS in the introduced gene is 1 or more copies.

More preferably, the coding gene of the santalene synthase SAS in the introduced gene is 1-3 copies.

Preferably, the starting strain is pichia pastoris, saccharomyces cerevisiae or yarrowia lipolytica.

More preferably, the starting strain is pichia pastoris, for example pichia pastoris GS115 strain.

The coding gene of the santalene synthase SAS is shown as SEQ ID NO.1, the coding gene of 3-hydroxy-3-methylglutaryl coenzyme A reductase 1tHMG1 is shown as SEQ ID NO.2, the coding gene of isopentenyl pyrophosphate isomerase IDI1 is shown as SEQ ID NO.3, the coding gene of farnesyl pyrophosphate synthase ERG20 is shown as SEQ ID NO.4, and the coding gene of acetyl coenzyme A synthase ACS is shown as SEQ ID NO. 5.

The invention also provides a construction method of the yeast engineering bacteria for producing alpha-santalene by fermentation, wherein the introduced genes comprise coding genes of santalene synthase SAS, 3-hydroxy-3-methylglutaryl-CoA reductase 1tHMG1, coding genes of isopentenyl pyrophosphate isomerase IDI1, coding genes of farnesyl pyrophosphate synthase ERG20 and coding genes of acetyl CoA synthase ACS, and the construction method comprises the following steps:

(1) Integrating a coding gene sequence of a santalene synthase SAS into a genome of Pichia pastoris GS115-Cas9 (obtained by introducing a Pichia pastoris GS115 strain genome into a Cas9 protein coding gene), so as to obtain a strain Pa-1;

(2) Integrating the coding gene sequence of 3-hydroxy-3-methylglutaryl coenzyme A reductase 1tHMG1, the coding gene sequence of isopentenyl pyrophosphate isomerase IDI1 and the coding gene sequence of farnesyl pyrophosphate synthetase ERG20 into a strain Pa-1 to obtain a strain Pa-2;

(3) Integrating the coding gene sequence of acetyl-CoA synthase ACS into the strain Pa-2 to obtain a strain Pa-3;

(4) 2 coding gene sequences of single copy santalene synthase SAS are integrated into a strain Pa-3 to obtain a strain Pa-4, namely the yeast engineering bacteria for producing alpha-santalene by fermentation.

The promoter used in the construction process is pTEF or pGAP, the nucleotide sequence of the promoter pTEF is shown in SEQ ID NO.6, and the nucleotide sequence of the promoter pGAP is shown in SEQ ID NO. 7; the terminator is tAOX1, and the nucleotide sequence is shown in SEQ ID NO. 8.

The invention also provides application of the yeast engineering bacteria for producing alpha-santalene by fermentation in preparation of the alpha-santalene.

The invention also provides a method for preparing the alpha-santalene, which comprises the steps of fermenting and culturing the yeast engineering bacteria for producing the alpha-santalene by fermentation, and extracting to obtain the alpha-santalene.

The specific fermentation culture method comprises the following steps: the yeast engineering bacteria are inoculated in 50mL YPD culture medium according to the inoculation amount of 1-5 percent by volume percent, and are fermented for 5 days at 30 ℃ and 250rpm, and 2 percent of glucose is added every 24 hours.

Compared with the prior art, the invention has the following advantages:

(1) The yeast engineering bacteria can efficiently produce the alpha-santalene, the shake flask fermentation yield is approximately 3.0g/L, and the fermentation yield of a 1L fermentation tank can reach 15g/L.

(2) The invention improves the metabolic flux in the alpha-santalene biosynthesis pathway by highly expressing key rate-limiting enzymes in the metabolic pathway, enhancing precursor supply and multicopy strategy.

(3) The invention utilizes pichia pastoris to efficiently generate the alpha-santalene, and has the characteristics of short period, environmental protection and resource conservation. The yeast engineering strain for high-yield alpha-santalene has wide application prospect.

Drawings

FIG. 1 is a metabolic scheme for the biosynthesis of santalene.

FIG. 2 is a schematic diagram of a pathway modification key enzyme expression cassette.

FIG. 3 is a map of plasmid Int-pTEF-BamHI-tAOX 1.

FIG. 4 is a map of plasmid Int-pGAP-AatII-tAOX 1.

FIG. 5 is a map of plasmid HZP-sgRNA.

FIG. 6 is a map of plasmid HHP-sgRNA.

FIG. 7 is a map of plasmid HGP-sgRNA.

FIG. 8 is a graph of GC-MS detection mass spectrum ion response values of santalene.

FIG. 9 is a graph showing the comparison of the yields of shake flask cultures of different strains in example 5.

FIG. 10 is a GC-MS detection mass spectrum of santalene.

Detailed Description

The metabolic flow chart of the biosynthesis of santalene is shown in figure 1, the pathway modification key enzyme expression cassette is shown in figure 2, and the detailed synthesis pathway is shown in the examples.

Example 1: construction of Pichia santalene recombinant strain Pa-1

The Int refers to the insertion site of Pichia pastoris GS115 genome, and the auxiliary plasmid Int-pTEF-tAOX1, int-pGAP-tAOX1 used consists of a general skeleton (an ampicillin resistance gene expression cassette plus a replication initiation site ori of a prokaryotic gene plasmid), a 500bp homology arm at the upstream and downstream of the site, pTEF-BamHI-tAOX1 or pGAP-Aat II-tAOX 1 (a plasmid map is shown in figures 3 and 4); helper plasmids HZP-sgRNA, HHP-sgRNA and HGP-sgRNA consist of a general framework, a resistance gene expression cassette, a sgRNA with a corresponding site and a BsaI cleavage site, and Z, H, G respectively represent a bleomycin resistance gene, a hygromycin resistance gene and a G418 resistance gene (plasmid maps are shown in FIG. 5, FIG. 6 and FIG. 7); p is plasmid (plasmid).

Starting from auxiliary plasmid Int2-pTEF-tAOX1 (stored in a laboratory, the left gene PAS_chr1-3_0003 of Int2 and the right gene PAS_chr1-3_0004), introducing a santalene synthase coding gene SAS (shown as SEQ ID NO. 1) by using enzyme cutting site BamHI in the vector to obtain a recombinant vector Int2-pTEF-SAS-tAOX1; starting from helper plasmid HZP-sgRNA (stored in a laboratory), the sgRNA-Int2 is introduced by using enzyme cutting site BsaI in the vector to obtain recombinant vector HZP-sgRNA-Int2. Then, a donor primer is designed by taking a recombinant vector Int2-pTEF-SAS-tAOX1 as a template, PCR is carried out to obtain a corresponding Int2-donor, the corresponding Int2-donor and a corresponding recombinant guide plasmid HZP-sgRNA-Int2 are transformed into a pichia pastoris cell GS115-Cas9 (obtained by introducing a Cas9 protein coding gene into a pichia pastoris GS115 strain genome), and the recombinant strain Pa-1 is obtained, and the specific implementation is as follows:

(1) Construction of santalene synthase recombinant expression vector

The coding gene of the santalene synthase SAS is synthesized by the Kirsrui biotechnology Co-Ltd, a primer SAS-F/SAS-R is designed to amplify a target gene SAS by taking the santalene synthase gene SAS as a template, and the target gene SAS is assembled with a vector Int2-pTEF-tAOX1 after enzyme digestion by using a seamless cloning method and is transformed into an escherichia coli DH5 alpha strain so as to obtain a recombinant vector Int2-pTEF-SAS-tAOX1.

The primer sequences used were as follows:

SAS-F：atacattttagttattcgccaacGatgtctactcaacaagtttcttctg；

SAS-R：CAAATGGCATTCTGACATCCTCTTGAGttagtcgtccaacttaactggg。

(2) Construction of vector HZP-sgRNA-Int2 for recombinant expression of guide RNA

The plasmid HZP-sgRNA is used as a template (the plasmid map is shown in figure 5), primers Int2-sgRNA-F and Int2-sgRNA-R are designed, the Int2-sgRNA is introduced by using enzyme cutting sites BsaI in the vector HZP-sgRNA, and the recombinant vector HZP-sgRNA-Int2 is obtained through T4 enzyme connection.

The primer sequences used were as follows:

Int2-sgRNA-F：acgctcacggattcaggaaatacg；

Int2-sgRNA-R：AAACcgtatttcctgaatccgtga。

(3) Transformation of Pichia santalene recombinant strain Pa-1

The recombinant vector Int2-pTEF-SAS-tAOX1 is used as a template to design primers Int2-donor-F and Int2-donor-R, PCR is carried out to obtain a corresponding linearized fragment Int2-donor, and the linearized fragment Int2-donor and a corresponding recombinant guide plasmid HZP-sgRNA-Int2 are simultaneously transformed into Pichia pastoris cells GS115-Cas9 to obtain the recombinant strain Pa-1. The resistant plasmid was discarded at the same time as passaging several times.

The primer sequences used were as follows:

Int2-donor-F：agaaggcaaagaatcttctgac；Int2-donor-R：taggctaaaccaagtgatttttc。

example 2: construction of Pichia santalene recombinant strain Pa-2

Respectively constructing expression cassettes of high expression genes tHMG1, IDI1 and ERG20 and corresponding guide plasmids, sequentially transferring the expression cassettes into the recombinant strain Pa-1, and respectively obtaining pichia pastoris recombinant strains Pa-1, pa-1-2 and Pa-2 through round-by-round transformation, wherein the method is specifically implemented as follows:

(1) Construction of tHMG1 recombinant expression vector

The saccharomyces cerevisiae genome is used as a template, primers tHMG1-F/tHMG1-R are designed to amplify a target gene tHMG1 (shown as SEQ ID NO. 2), the target gene tHMG1 is assembled with a vector Int12-pGAP-tAOX1 (Int 12: left gene PAS_chr3_1202 and right gene PAS_chr3_0618) which is subjected to enzyme digestion by an aatII through a seamless cloning method, and an escherichia coli DH5 alpha strain is transformed to obtain a recombinant vector Int12-pGAP-tHMG1-tAOX1.

The primer sequences used were as follows:

tHMG1-F：aatcaattgaacaactatcaaaacacaGATGGCTGCAGACCAATTGGTG；

tHMG1-R：aggcaaatggcattctgacatCCTCTTGAGTTAGGATTTAATGCAGGTG。

(2) Construction of guide RNA recombinant expression vector HZP-sgRNA-Int12

Starting from helper plasmid HZP-sgRNA (plasmid map is shown in FIG. 5), primers Int12-sgRNA-F and Int12-sgRNA-R are designed, the Int12-sgRNA is introduced by using enzyme cutting site BsaI in the vector HZP-sgRNA, and the recombinant vector HZP-sgRNA-Int12 is obtained through T4 enzyme connection.

The primer sequences used were as follows:

Int12-sgRNA-F：acgcggggtttgaataacagacac；

Int12-sgRNA-R：AAACgtgtctgttattcaaacccc。

(3) Construction of Pichia santalene recombinant strain Pa-1-1

The recombinant vector Int12-pGAP-tHMG1-tAOX1 is used as a template to design primers Int12-donor-F and Int12-donor-R, PCR is carried out to obtain a corresponding linearized fragment Int12-donor, and the linearized fragment Int12-donor and a corresponding recombinant guide plasmid HZP-sgRNA-Int12 are simultaneously transformed into Pichia pastoris cells Pa-1 to obtain recombinant strains Pa-1-1. The resistant plasmid was discarded at the same time as passaging several times.

The primer sequences used were as follows:

Int12-donor-F：CTGGGcagtagtgaattggttg；Int12-donor-R：acattgttcgtgaggctaatcc。

(4) Construction of recombinant expression vector for coding gene of isopentenyl pyrophosphate isomerase IDI1

The primers IDI1-F/IDI1-R are designed, a target gene IDI1 (shown as SEQ ID NO. 3) is amplified from the genome of Pichia pastoris GS115, and assembled with a BamHI digested vector Int1-pTEF-tAOX1 (Int 1: left gene PAS_FragB_0066 and right gene PAS_FragB_0067) by a seamless cloning method, and an escherichia coli DH5 alpha strain is transformed to obtain a recombinant vector Int1-pTEF-IDI1-tAOX1.

The primer sequences used were as follows:

IDI1-F：catacattttagttattcgccaacGatgactgccgacaacaatagtatg；

IDI1-R：AAATGGCATTCTGACATCCTCTTGAGttatagcattctatgaatttgcc。

(5) Construction of guide RNA recombinant expression vector HHP-sgRNA-Int1

Starting from helper plasmid HHP-sgRNA (plasmid map is shown in FIG. 6), primers Int1-sgRNA-F and Int1-sgRNA-R are designed, the Int1-sgRNA is introduced by using enzyme cleavage site BsaI in the vector HHP-sgRNA, and the recombinant vector HHP-sgRNA-Int1 is obtained through T4 enzyme ligation.

The primer sequences used were as follows:

Int1-sgRNA-F：acgctatctgaagtatttactggg；

Int1-sgRNA-R：AAACcccagtaaatacttcagata。

(6) Construction of Pichia santalene recombinant strain Pa-1-2

The recombinant vector Int1-pTEF-IDI1-tAOX1 is used as a template to design primers Int1-donor-F and Int1-donor-R, PCR is carried out to obtain a corresponding linearized fragment Int1-donor, and the linearized fragment Int1-donor and a corresponding recombinant guide plasmid HHP-sgRNA-Int1 are simultaneously transformed into Pichia pastoris cells Pa-1-1 to obtain recombinant strains Pa-1-2. The resistant plasmid was discarded at the same time as passaging several times.

The primer sequences used were as follows:

Int1-donor-F：CTGGGcagtagtgaattggttg；Int1-donor-R：acattgttcgtgaggctaatcc。

(7) Construction of recombinant expression vector of encoding gene of farnesyl pyrophosphoric acid synthetase ERG20

The primer ERG20-F/ERG20-R is designed to amplify a target gene ERG20 (shown as SEQ ID NO. 4), the target gene ERG20 is assembled with a vector Int20-pGAP-tAOX1 (Int 20: left gene PAS_chr4_0465 and right gene PAS_chr4_ 0467) which is subjected to enzyme digestion by an Aat II through a seamless cloning method, and an escherichia coli DH5 alpha strain is transformed to obtain a recombinant vector Int20-pGAP-ERG20-tAOX1.

The primer sequences used were as follows:

ERG20-F：caattgaacaactatcaaaacacaGatggcttcagaaaaagaaattagg；

ERG20-R：GCAAATGGCATTCTGACATCCTCTTGAGctatttgcttctcttgtaaac。

(8) Construction of guide RNA recombinant expression vector HGP-sgRNA-Int20

Starting from helper plasmid HGP-sgRNA (plasmid map is shown in figure 7), primers Int20-sgRNA-F and Int20-sgRNA-R are designed, the Int20-sgRNA is introduced by using enzyme cutting site BsaI in the vector HGP-sgRNA, and the recombinant vector HGP-sgRNA-Int20 is obtained through T4 enzyme connection.

The primer sequences used were as follows:

Int20-sgRNA-F：acgcagaagaaaatgcgaaacagg；

Int20-sgRNA-R：AAACcctgtttcgcattttcttct。

(9) Construction of Pichia santalene recombinant strain Pa-2

The recombinant vector Int20-pGAP-ERG20-tAOX1 is used as a template to design primers Int20-donor-F and Int20-donor-R, PCR is carried out to obtain a corresponding linearized fragment Int20-donor, and the linearized fragment Int20-donor and a corresponding recombinant guide plasmid HGP-sgRNA-Int20 are simultaneously transformed into pichia pastoris cells Pa-1-2 to obtain recombinant strains Pa-2. The resistant plasmid was discarded at the same time as passaging several times.

The primer sequences used were as follows:

Int20-donor-F：tccgatcattgcatagatacc；Int20-donor-R：ttggtcagaattacttcacac。

example 3: construction of Pichia santalene recombinant strain Pa-3

Constructing an expression cassette of a coding gene of high-expression acetyl-CoA synthase ACS and a corresponding guide plasmid, electrically converting the expression cassette into the recombinant strain Pa-2 to finally obtain a pichia pastoris recombinant strain Pa-3, and specifically implementing the following steps:

(1) Construction of recombinant expression vector for coding gene of ACS (acetyl-CoA synthase)

The acetyl-CoA synthase ACS plasmid stored in a laboratory is used as a template, a primer ACS-F/ACS-R is designed to amplify a target gene ACS (shown as SEQ ID NO. 5), the target gene ACS is assembled with a BamHI digested vector Int16-pTEF-tAOX1 (Int 16: left gene PAS_chr3_1065 and right gene PAS_chr3_1067) by a seamless cloning method, and an escherichia coli DH5 alpha strain is transformed to obtain a recombinant vector Int16-pTEF-ACS-tAOX1.

The primer sequences used were as follows:

ACS-F：acatacattttagttattcgccaacGatgtcacaaacacacaaacatgc；

ACS-R：AATGGCATTCTGACATCCTCTTGAGtcatgatggcatagcaatagcttg。

(2) Construction of vector HZP-sgRNA-Int16 for recombinant expression of guide RNA

Starting from helper plasmid HZP-sgRNA, designing primers Int16-sgRNA-F and Int16-sgRNA-R, introducing Int16-sgRNA by using enzyme cutting site BsaI in the vector HZP-sgRNA, and connecting by T4 enzyme to obtain recombinant vector HZP-sgRNA-Int16.

The primer sequences used were as follows:

Int16-sgRNA-F：acgcgatatgaagagcaaacacag；

Int16-sgRNA-R：AAACctgtgtttgctcttcatatc。

(3) Construction of Pichia santalene recombinant strain Pa-3

The recombinant vector Int16-pTEF-ACS-tAOX1 is used as a template to design primers Int16-donor-F and Int16-donor-R, PCR is carried out to obtain a corresponding linearized fragment Int16-donor, and the linearized fragment Int16-donor and a corresponding recombinant guide plasmid HZP-sgRNA-Int16 are simultaneously transformed into Pichia pastoris cells Pa-2 to obtain recombinant strains Pa-3. The resistant plasmid was discarded at the same time as passaging several times.

The primer sequences used were as follows:

Int16-donor-F：acaccaccacaaatacctaccaatg；

Int16-donor-R：acctgggagaatgttttcaatctgg。

example 4: construction of multicopy santalene Pichia pastoris recombinant strain Pa-4

Constructing an expression cassette of a coding gene of the santalene synthase SAS and a corresponding guide plasmid, sequentially transferring the expression cassette and the corresponding guide plasmid into the recombinant strain Pa-3, and finally obtaining a recombinant strain Pa-4 through transformation, wherein the method is implemented as follows:

(1) Construction of SAS recombinant expression vector

The coding gene of the santalene synthase SAS in example 1 was assembled with BamHI digested vector Int33-pTEF-tAOX1 (Int 33: left gene PAS_chr1-1_0053, right gene PAS_chr1-1_0054) and Int6-pTEF-tAOX1 (Int 6: left gene PAS_chr2-1_0010, right gene PAS_chr2-1_0011) by a seamless cloning method, and recombinant vectors Int33-pTEF-SAS-tAOX1 and Int6-pTEF-SAS-tAOX1 were obtained after transformation of E.coli DH 5. Alpha. Respectively. The primer sequences used were the same as in example 1.

(2) Construction of guide RNA recombinant expression vectors HGP-sgRNA-Int33 and HHP-sgRNA-Int6

Starting from helper plasmid HGP-sgRNA, designing primers Int33-sgRNA-F and Int33-sgRNA-R, introducing Int33-sgRNA by using enzyme cutting sites BsaI in the vector HGP-sgRNA, and connecting by T4 enzyme to obtain a recombinant vector HGP-sgRNA-Int33; starting from helper plasmid HHP-sgRNA, primers Int6-sgRNA-F and Int6-sgRNA-R are designed, the Int6-sgRNA is introduced by using enzyme cutting sites BsaI in the vector HHP-sgRNA, and the recombinant vector HHP-sgRNA-Int6 is obtained through T4 enzyme connection.

The primer sequences used were as follows:

Int33-sgRNA-F：acgcccgtcactatgaggacaaag；

Int33-sgRNA-R：AAACctttgtcctcatagtgacgg；

Int6-sgRNA-F：gacgctatctgtgtaaagcgacgag；

Int6-sgRNA-R：AAACctcgtcgctttacacagata。

(3) Construction of Pichia santalene recombinant strain Pa-4

The recombinant vector Int33-pTEF-SAS-tAOX1 is used as a template to design primers Int33-donor-F and Int33-donor-R, PCR is carried out to obtain a corresponding linearized fragment Int33-donor, and the linearized fragment Int33-donor and a corresponding recombinant guide plasmid HGP-sgRNA-Int33 are simultaneously transformed into Pichia pastoris cells Pa-3 to obtain recombinant strains Pa-3-1. The recombinant vector Int6-pTEF-SAS-tAOX1 is used as a template to design primers Int6-donor-F and Int6-donor-R, PCR is carried out to obtain a corresponding linearized fragment Int6-donor, and the linearized fragment Int6-donor and a corresponding recombinant guide plasmid HHP-sgRNA-Int6 are simultaneously transformed into Pichia pastoris cells Pa-3-1 to obtain recombinant strains Pa-4. The two rounds of serially transformed resistant plasmid were discarded at the same time as passaging several times. The primer sequences used were as follows:

Int33-donor-F：aaagagagagtctaaaagtggtg；Int33-donor-R：attataattagcacggtgttgc；

Int6-donor-F：agtaagggcagtgtaccatag；Int6-donor-R：acattaagaaccaagatcatgca。

example 5: efficient production of santalene by pichia pastoris engineering strain

The recombinant strains in examples 1-4 were activated by solid YPD plates, single colonies were picked up and cultured in 5mL test tubes, and then transferred to 50mL shake flasks at 1% inoculum size for 5 days, and the post-treated samples were subjected to product analysis. And (3) carrying out fed-batch culture in a fermentation tank by Pa-4 to obtain a high-concentration fermentation product. The specific implementation is as follows:

(1) Cultivation of recombinant strains

GS115-Cas9, pa-1, pa-2, pa-3 and Pa-4 single colonies were picked from the plates, inoculated into 5mL YPD (glucose 20g/L, peptone 20g/L, yeast extract 10 g/L) tubes, cultured at 30℃for 12 hours at 250rpm, then inoculated into 50mL YPD shake flask medium at 1% inoculum size, three strains each in parallel, the medium upper layer was covered with 10% n-dodecane, cultured at 30℃for 5 days at 250rpm, and 2% glucose was supplemented every 24 hours.

(2) Method for detecting santalene

Sample treatment: the upper layer fermentation broth was centrifuged at 12000rpm for 3min, the upper layer organic phase was filtered through a 0.22 μm nylon filter, and the sample was diluted 10-fold with ethyl acetate and subjected to GC-MS detection.

GC-MS detection conditions: chromatographic conditions: DB-5MS capillary chromatographic column; mass spectrometry conditions: EI+ ionization source; electron energy 70eV; the temperature of the ion source is 250 ℃; the temperature of the sample inlet is 250 ℃; delaying the solvent for 10min; full mass spectrum scanning, 40-500m/z. Detection procedure: the initial temperature is 40 ℃, and the temperature is kept for 3min; heating to 130 ℃ at a speed of 10 ℃/min, heating to 180 ℃ at a speed of 3 ℃/min, heating to 300 ℃ at a speed of 50 ℃/min, and maintaining for 10min. And (3) split sampling, wherein the split ratio is 20:1, and the sampling amount is 1 mu L.

(3) Recombinant strain Pa-4 fermentation tank culture

Starting from recombinant strain Pa-4 of Pichia pastoris, inoculating single colony of Pa-4 activated on YPD plate into 5mL YPD test tube, culturing for 12h, inoculating 1% of the strain into 50mL YPD liquid culture medium, culturing for 12h as seed liquid under 30 ℃ and shaking table rotation speed of 250rpm, inoculating 10% of the strain into 1L fermentation tank (liquid loading volume of 600 mL), culturing at 30 ℃ and correcting dissolved oxygen DO to 100%, tank pressure of 0.8 atm, fermenting for 24h, and adding 10% (v/v) sterile filtered n-dodecane. When the mass fraction of glucose in the fermentation tank is reduced to 1%, adding 40% (v/v) of glucose solution, controlling the stirring rotation speed to 200-800rpm, keeping dissolved oxygen above 20%, adding 25% ammonia water and 18% acetic acid in the final fermentation period, adjusting pH value to 5.5-6.0, and ending fermentation after 96 hours.

(4) Recombinant strain santalene yield comparison

TABLE 1

Pichia pastoris engineering strains are cultivated according to the cultivation method described in (1), the santalene yield is determined by the detection method described in (2), the detection mass spectrum is shown in FIG. 8 and FIG. 10, and the yield in shake flasks is shown in Table 1 and FIG. 9. The pichia pastoris engineering strain Pa-4 is subjected to fed-batch fermentation according to the method shown in the step (3), the maximum yield of the santalene in a 1L fermentation tank after 96 hours is about 15g/L, the highest yield reported at present is established, a foundation is laid for the industrial production and application of the alpha-santalene and high-added value derivatives thereof, and reference can be provided for the efficient green biological production of other terpene natural products.

Sequence listing

<110> Hangzhou International science center of Zhejiang university

<120> Yeast engineering bacterium for producing alpha-santalene by fermentation and application thereof

<160> 46

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1656

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 1

atgtctactc aacaagtttc ttctgaaaac atcgttagaa acgctgctaa cttccaccca 60

aacatctggg gtaaccactt cttgacttgt ccatctcaaa ctatcgactc ttggactcaa 120

caacaccaca aggaattgaa ggaagaagtt agaaagatga tggtttctga cgctaacaag 180

ccagctcaaa gattgagatt gatcgacact gttcaaagat tgggtgttgc ttaccacttc 240

gaaaaggaaa tcgacgacgc tttggaaaag atcggtcacg acccattcga cgacaaggac 300

gacttgtaca tagttagctt gtgtttcaga ctcttgagac aacacggtat caagatctct 360

tgtgacgttt tcgaaaagtt caaggacgac gacggtaagt tcaaggcttc tttgatgaac 420

gacgttcaag gtatgttgtc tttgtacgaa gctgctcact tggctatcca cggtgaagac 480

atcttggacg aagctatcgt tttcactact actcacttga agtctactgt ttctaactct 540

ccagttaact ctactttcgc tgaacaaatc agacactctt tgagagttcc attgagaaag 600

gctgttccaa gattggaatc tagatacttc ttggacatct actctagaga cgacctccat 660

gacaagacat tgttgaactt cgcgaagttg gacttcaaca tcttgcaagc tatgcaccaa 720

aaggaagctt ctgaaatgac tagatggtgg agagacttcg acttcttgaa gaagttgcca 780

tacatcagag acagagttgt tgaattgtac ttctggatct tggttggtgt ttcttaccaa 840

ccaaagttct ctactggtag aatcttcttg tctaagatca tctgtttgga aactttggtt 900

gacgacactt tcgacgctta cggtactttc gacgaattgg ctatcttcac tgaagctgtt 960

actagatggg acttgggtca cagagacgct ttgccagaat acatgaagtt tatattcaag 1020

actctcatcg acgtttactc tgaagctgaa caagaattgg ctaaggaagg tagatcttac 1080

tctatccact acgctatcag atctttccaa gaattggtta tgaagtactt ctgtgaagct 1140

aagtggttga acaagggtta cgttccatct ttggacgact acaaatctgt gagcttgaga 1200

tctatcggtt tcttgccaat cgctgttgct tctttcgttt tcatgggtga catcgctact 1260

aaggaagttt tcgaatggga aatgaacaac ccaaagatca tcatcgctgc tgaaactatc 1320

ttcagattct tggacgacat cgctggtcac agattcgaac aaaagagaga acactctcca 1380

tctgctatcg aatgttacaa gaaccaacac ggtgtttctg aagaagaagc tgttaaggct 1440

ttgtctttgg aagttgctaa ctcttggaag gacatcaacg aagaattgtt gttgaaccca 1500

atggctatcc cattgccatt gttgcaagtt atcttggact tgtctagatc tgctgacttc 1560

atgtacggta acgctcaaga cagattcact cactctacta tgatgaagga ccaggttgat 1620

ttggtcctga aggacccagt taagttggac gactaa 1656

<210> 2

<211> 1584

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 2

atggctgcag accaattggt gaaaactgaa gtcaccaaga agtcttttac tgctcctgta 60

caaaaggctt ctacaccagt tttaaccaat aaaacagtca tttctggatc gaaagtcaaa 120

agtttatcat ctgcgcaatc gagctcatca ggaccttcat catctagtga ggaagatgat 180

tcccgcgata ttgaaagctt ggataagaaa atacgtcctt tagaagaatt agaagcatta 240

ttaagtagtg gaaatacaaa acaattgaag aacaaagagg tcgctgcctt ggttattcac 300

ggtaagttac ctttgtacgc tttggagaaa aaattaggtg atactacgag agcggttgcg 360

gtacgtagga aggctctttc aattttggca gaagctcctg tattagcatc tgatcgttta 420

ccatataaaa attatgacta cgaccgcgta tttggcgctt gttgtgaaaa tgttataggt 480

tacatgcctt tgcccgttgg tgttataggc cccttggtta tcgatggtac atcttatcat 540

ataccaatgg caactacaga gggttgtttg gtagcttctg ccatgcgtgg ctgtaaggca 600

atcaatgctg gcggtggtgc aacaactgtt ttaactaagg atggtatgac aagaggccca 660

gtagtccgtt tcccaacttt gaaaagatct ggtgcctgta agatatggtt agactcagaa 720

gagggacaaa acgcaattaa aaaagctttt aactctacat caagatttgc acgtctgcaa 780

catattcaaa cttgtctagc aggagattta ctcttcatga gatttagaac aactactggt 840

gacgcaatgg gtatgaatat gatttctaaa ggtgtcgaat actcattaaa gcaaatggta 900

gaagagtatg gctgggaaga tatggaggtt gtctccgttt ctggtaacta ctgtaccgac 960

aaaaaaccag ctgccatcaa ctggatcgaa ggtcgtggta agagtgtcgt cgcagaagct 1020

actattcctg gtgatgttgt cagaaaagtg ttaaaaagtg atgtttccgc attggttgag 1080

ttgaacattg ctaagaattt ggttggatct gcaatggctg ggtctgttgg tggatttaac 1140

gcacatgcag ctaatttagt gacagctgtt ttcttggcat taggacaaga tcctgcacaa 1200

aatgttgaaa gttccaactg tataacattg atgaaagaag tggacggtga tttgagaatt 1260

tccgtatcca tgccatccat cgaagtaggt accatcggtg gtggtactgt tctagaacca 1320

caaggtgcca tgttggactt attaggtgta agaggcccgc atgctaccgc tcctggtacc 1380

aacgcacgtc aattagcaag aatagttgcc tgtgccgtct tggcaggtga attatcctta 1440

tgtgctgccc tagcagccgg ccatttggtt caaagtcata tgacccacaa caggaaacct 1500

gctgaaccaa caaaacctaa caatttggac gccactgata taaatcgttt gaaagatggg 1560

tccgtcacct gcattaaatc ctaa 1584

<210> 3

<211> 867

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 3

atgactgccg acaacaatag tatgccccat ggtgcagtat ctagttacgc caaattagtg 60

caaaaccaaa cacctgaaga cattttggaa gagtttcctg aaattattcc attacaacaa 120

agacctaata cccgatctag tgagacgtca aatgacgaaa gcggagaaac atgtttttct 180

ggtcatgatg aggagcaaat taagttaatg aatgaaaatt gtattgtttt ggattgggac 240

gataatgcta ttggtgccgg taccaagaaa gtttgtcatt taatggaaaa tattgaaaag 300

ggtttactac atcgtgcatt ctccgtcttt attttcaatg aacaaggtga attactttta 360

caacaaagag ccactgaaaa aataactttc cctgatcttt ggactaacac atgctgctct 420

catccactat gtattgatga cgaattaggt ttgaagggta agctagacga taagattaag 480

ggcgctatta ctgcggcggt gagaaaacta gatcatgaat taggtattcc agaagatgaa 540

actaagacaa ggggtaagtt tcacttttta aacagaatcc attacatggc accaagcaat 600

gaaccatggg gtgaacatga aattgattac atcctatttt ataagatcaa cgctaaagaa 660

aacttgactg tcaacccaaa cgtcaatgaa gttagagact tcaaatgggt ttcaccaaat 720

gatttgaaaa ctatgtttgc tgacccaagt tacaagttta cgccttggtt taagattatt 780

tgcgagaatt acttattcaa ctggtgggag caattagatg acctttctga agtggaaaat 840

gacaggcaaa ttcatagaat gctataa 867

<210> 4

<211> 1059

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 4

atggcttcag aaaaagaaat taggagagag agattcttga acgttttccc taaattagta 60

gaggaattga acgcatcgct tttggcttac ggtatgccta aggaagcatg tgactggtat 120

gcccactcat tgaactacaa cactccaggc ggtaagctaa atagaggttt gtccgttgtg 180

gacacgtatg ctattctctc caacaagacc gttgaacaat tggggcaaga agaatacgaa 240

aaggttgcca ttctaggttg gtgcattgag ttgttgcagg cttacttctt ggtcgccgat 300

gatatgatgg acaagtccat taccagaaga ggccaaccat gttggtacaa ggttcctgaa 360

gttggggaaa ttgccatcaa tgacgcattc atgttagagg ctgctatcta caagcttttg 420

aaatctcact tcagaaacga aaaatactac atagatatca ccgaattgtt ccatgaggtc 480

accttccaaa ccgaattggg ccaattgatg gacttaatca ctgcacctga agacaaagtc 540

gacttgagta agttctccct aaagaagcac tccttcatag ttactttcaa gactgcttac 600

tattctttct acttgcctgt cgcattggcc atgtacgttg ccggtatcac ggatgaaaag 660

gatttgaaac aagccagaga tgtcttgatt ccattgggtg aatacttcca aattcaagat 720

gactacttag actgcttcgg taccccagaa cagatcggta agatcggtac agatatccaa 780

gataacaaat gttcttgggt aatcaacaag gcattggaac ttgcttccgc agaacaaaga 840

aagactttag acgaaaatta cggtaagaag gactcagtcg cagaagccaa atgcaaaaag 900

attttcaatg acttgaaaat tgaacagcta taccacgaat atgaagagtc tattgccaag 960

gatttgaagg ccaaaatttc tcaggtcgat gagtctcgtg gcttcaaagc tgatgtctta 1020

actgcgttct tgaacaaagt ttacaagaga agcaaatag 1059

<210> 5

<211> 1959

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 5

atgtcacaaa cacacaaaca tgctattcct gcgaatatcg ctgacaggtg cttaatcaac 60

cctgaacaat acgaaacgaa gtacaagcag tctatcaacg atcctgatac tttctggggc 120

gagcaaggta agatactcga ttggattact ccatatcaaa aggtcaaaaa cacatccttt 180

gctcctggaa atgtgtcaat caagtggtac gaggacggca ctctaaacct agctgctaat 240

tgcttggatc gacacctcca ggaaaatggt gacagaacgg caatcatttg ggaaggtgat 300

gatacttctc aatctaagca catctcctac agagagttac acagagatgt ttgcagattc 360

gcgaatactt tactggacct gggtatcaaa aagggcgatg ttgtggcaat ctacatgcct 420

atggtcccag aggcagctgt ggcaatgttg gcctgtgcca gaataggagc agtccatagc 480

gttatctttg gcggattctc ccctgaagcc gttgctggga gaatcattga ctcatcaagt 540

agattagtta tcactgccga cgaaggtgtt agagcaggta gatccatccc attgaagaaa 600

aacgttgatg acgcgttgaa aaacccaaac gttacgagtg tggagcatgt aattgtacta 660

aagcgtaccg gctctgatat agactggcag gaaggtaggg atttgtggtg gagagatctt 720

attgagaaag caagtccaga acaccaacca gaagcaatga atgcggaaga tccattgttc 780

atcttgtata catctgggtc aactggcaaa ccaaaaggtg ttttgcatac aacaggtggt 840

tatctcgtat acgccgcaac aacctttaag tacgtttttg attaccatcc aggtgatatc 900

tactggtgta ccgctgatgt cggttgggtt actggtcata gttacctgct ttacggtcca 960

ctggcatgcg gcgcaaccac tttgatgttt gaaggagtac caaactggcc aaccccagcc 1020

aggatgtgtc aagtggtcga taaacaccaa gtgaacatat tgtacacagc cccaaccgcc 1080

attagagcgc taatggccga aggagataag gcgattgagg gaacagatag aagtagccta 1140

cgtatcttag gatccgttgg cgagccaatc aatccagaag cttgggaatg gtattggaaa 1200

aagattggta aggaaaagtg tccagtagtg gatacatggt ggcaaactga aacaggtgga 1260

ttcatgatta cacctcttcc aggtgcaata gaattgaagg ctgggtctgc tactaggcct 1320

ttcttcggcg tccaacctgc tttagtagac aacgaagggc atccacaaga gggggcaaca 1380

gaaggcaatc tagtgataac tgattcctgg cctggtcagg ctagaacatt gtttggtgat 1440

cacgaaagat tcgaacaaac ctatttctca actttcaaaa acatgtattt cagcggtgac 1500

ggtgcgagaa gagacgaaga tgggtactac tggattaccg gcagagtaga tgacgtcctt 1560

aacgtatctg gacatcgtct gggtacagct gagattgagt cagctttagt tgctcatcct 1620

aagattgctg aagctgcagt cgttggcatc ccacacgcta tcaagggtca agccatatac 1680

gcatatgtta cactcaacca tggtgaggaa ccatctccag agctatacgc agaggtcaga 1740

aattgggttc gaaaggaaat agggccttta gccacaccag atgttttgca ttggacagat 1800

tcattgccta agacaagatc tggaaagatt atgagacgta tacttagaaa gatcgccgcc 1860

ggagatacgt ctaacttagg tgatacttct actcttgccg atccaggcgt ggtcgaaaaa 1920

cctttagagg aaaaacaagc tattgctatg ccatcatga 1959

<210> 6

<211> 424

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 6

ataactgtcg cctcttttat ctgccgcact gcatgaggtg tccccttagt gggaaagagt 60

actgagccaa ccctggagga cagcaaggga aaaataccta caacttgctt cataatggtc 120

gtaaaaacaa tccttgtcgg atataagtgt tgtagactgt cccttatcct ctgcgatgtt 180

cttcctctca aagtttgcga tttctctcta tcagaattgc catcaagaga ctcaggacta 240

atttcgcagt cccacacgca ctcgtacatg attggctgaa atttccctaa agaatttctt 300

tttcacgaaa attttttttt tacacaagat tttcagcaga tataaaatgg agagcaggac 360

ctccgctgtg actcttcttt tttttctttt attctcacta catacatttt agttattcgc 420

caac 424

<210> 7

<211> 1000

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 7

ctgctactct ggtcccaagt gaaccacctt ttggacccta ttgaccggac cttaacttgc 60

caaacctaaa cgcttaatgc ctcagacgtt ttaatgcctc tcaacacctc caaggttgct 120

ttcttgagca tgcctactag gaactttaac gaactgtggg gttgcagaca gtttcaggcg 180

tgtcccgacc aatatggcct actagactct ctgaaaaatc acagttttcc agtagttccg 240

atcaaattac catcgaaatg gtcccataaa cggacatttg acatccgttc ctgaattata 300

gtcttccacc gtggatcatg gtgttccttt ttttcccaaa gaatatcagc atcccttaac 360

tacgttaggt cagtgatgac aatggaccaa attgttgcaa ggtttttctt tttctttcat 420

cggcacattt cagcctcaca tgcgactatt atcgatcaat gaaatccatc aagattgaaa 480

tcttaaaatt gcccctttca cttgacagga tccttttttg tagaaatgtc ttggtgtcct 540

cgtccaatca ggtagccatc tctgaaatat ctggctccgt tgcaactccg aacgacctgc 600

tggcaacgta aaattctccg gggtaaaact taaatgtgga gtaatggaac cagaaacgtc 660

tcttcccttc tctctccttc caccgcccgt taccgtccct aggaaatttt actctgctgg 720

agagcttctt ctacggcccc cttgcagcaa tgctcttccc agcattacgt tgcgggtaaa 780

acggaggtcg tgtacccgac ctagcagccc agggatggaa aagtcccggc cgtcgctggc 840

aataatagcg ggcggacgca tgtcatgaga ttattggaaa ccaccagaat cgaatataaa 900

aggcgaacac ctttcccaat tttggtttct cctgacccaa agactttaaa tttaatttat 960

ttgtccctat ttcaatcaat tgaacaacta tcaaaacaca 1000

<210> 8

<211> 247

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 8

tcaagaggat gtcagaatgc catttgcctg agagatgcag gcttcatttt tgatactttt 60

ttatttgtaa cctatatagt ataggatttt ttttgtcatt ttgtttcttc tcgtacgagc 120

ttgctcctga tcagcctatc tcgcagctga tgaatatctt gtggtagggg tttgggaaaa 180

tcattcgagt ttgatgtttt tcttggtatt tcccactcct cttcagagta cagaagatta 240

agtgaga 247

<210> 9

<211> 49

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 9

atacatttta gttattcgcc aacgatgtct actcaacaag tttcttctg 49

<210> 10

<211> 49

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 10

caaatggcat tctgacatcc tcttgagtta gtcgtccaac ttaactggg 49

<210> 11

<211> 24

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 11

acgctcacgg attcaggaaa tacg 24

<210> 12

<211> 24

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 12

aaaccgtatt tcctgaatcc gtga 24

<210> 13

<211> 22

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 13

agaaggcaaa gaatcttctg ac 22

<210> 14

<211> 23

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 14

taggctaaac caagtgattt ttc 23

<210> 15

<211> 49

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 15

aatcaattga acaactatca aaacacagat ggctgcagac caattggtg 49

<210> 16

<211> 49

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 16

aggcaaatgg cattctgaca tcctcttgag ttaggattta atgcaggtg 49

<210> 17

<211> 24

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 17

acgcggggtt tgaataacag acac 24

<210> 18

<211> 24

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 18

aaacgtgtct gttattcaaa cccc 24

<210> 19

<211> 22

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 19

ctgggcagta gtgaattggt tg 22

<210> 20

<211> 22

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 20

acattgttcg tgaggctaat cc 22

<210> 21

<211> 49

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 21

catacatttt agttattcgc caacgatgac tgccgacaac aatagtatg 49

<210> 22

<211> 49

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 22

aaatggcatt ctgacatcct cttgagttat agcattctat gaatttgcc 49

<210> 23

<211> 24

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 23

acgctatctg aagtatttac tggg 24

<210> 24

<211> 24

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 24

aaaccccagt aaatacttca gata 24

<210> 25

<211> 22

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 25

ctgggcagta gtgaattggt tg 22

<210> 26

<211> 22

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 26

acattgttcg tgaggctaat cc 22

<210> 27

<211> 49

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 27

caattgaaca actatcaaaa cacagatggc ttcagaaaaa gaaattagg 49

<210> 28

<211> 49

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 28

gcaaatggca ttctgacatc ctcttgagct atttgcttct cttgtaaac 49

<210> 29

<211> 24

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 29

acgcagaaga aaatgcgaaa cagg 24

<210> 30

<211> 24

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 30

aaaccctgtt tcgcattttc ttct 24

<210> 31

<211> 21

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 31

tccgatcatt gcatagatac c 21

<210> 32

<211> 21

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 32

ttggtcagaa ttacttcaca c 21

<210> 33

<211> 49

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 33

acatacattt tagttattcg ccaacgatgt cacaaacaca caaacatgc 49

<210> 34

<211> 49

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 34

aatggcattc tgacatcctc ttgagtcatg atggcatagc aatagcttg 49

<210> 35

<211> 24

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 35

acgcgatatg aagagcaaac acag 24

<210> 36

<211> 24

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 36

aaacctgtgt ttgctcttca tatc 24

<210> 37

<211> 25

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 37

acaccaccac aaatacctac caatg 25

<210> 38

<211> 25

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 38

acctgggaga atgttttcaa tctgg 25

<210> 39

<211> 24

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 39

acgcccgtca ctatgaggac aaag 24

<210> 40

<211> 24

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 40

aaacctttgt cctcatagtg acgg 24

<210> 41

<211> 25

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 41

gacgctatct gtgtaaagcg acgag 25

<210> 42

<211> 24

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 42

aaacctcgtc gctttacaca gata 24

<210> 43

<211> 23

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 43

aaagagagag tctaaaagtg gtg 23

<210> 44

<211> 22

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 44

attataatta gcacggtgtt gc 22

<210> 45

<211> 21

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 45

agtaagggca gtgtaccata g 21

<210> 46

<211> 23

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 46

acattaagaa ccaagatcat gca 23

Claims

1. The yeast engineering bacteria for producing alpha-santalene by fermentation is characterized in that pichia pastoris is used as an original strain, the yeast engineering bacteria are obtained by constructing an introduced gene, and the introduced gene comprises any one of the following groups:

(1) A coding gene for santalene synthase SAS, a coding gene for 3-hydroxy-3-methylglutaryl-coa reductase 1 tgmg 1, a coding gene for isopentenyl pyrophosphate isomerase IDI1, a coding gene for farnesyl pyrophosphate synthase ERG20, and a coding gene for acetyl-coa synthase ACS;

(2) A coding gene of santalene synthase SAS, a coding gene of 3-hydroxy-3-methylglutaryl coenzyme A reductase 1tHMG1, a coding gene of isopentenyl pyrophosphate isomerase IDI1 and a coding gene of farnesyl pyrophosphate synthase ERG 20;

the coding gene of the santalene synthase SAS is shown as SEQ ID NO.1, the coding gene of the 3-hydroxy-3-methylglutaryl coenzyme A reductase 1tHMG1 is shown as SEQ ID NO.2, the coding gene of the isopentenyl pyrophosphate isomerase IDI1 is shown as SEQ ID NO.3, the coding gene of the farnesyl pyrophosphate synthase ERG20 is shown as SEQ ID NO.4, and the coding gene of the acetyl coenzyme A synthase ACS is shown as SEQ ID NO. 5;

the pichia pastoris is pichia pastoris GS115-Cas9, and is obtained by introducing a Cas9 protein coding gene into a genome of a pichia pastoris GS115 strain;

the coding genes of the santalene synthase SAS in the introduced genes are 3 copies, and other coding genes are single copies;

the promoter used in the yeast engineering bacteria is pTEF or pGAP obtained by introducing gene construction; the terminator is tAOX1.

2. The method for constructing a yeast engineering bacterium for producing α -santalene by fermentation according to claim 1, wherein the introduced genes include a coding gene for santalene synthase SAS, a coding gene for 3-hydroxy-3-methylglutaryl-coa reductase 1 tgmg 1, a coding gene for isopentenyl pyrophosphate isomerase IDI1, a coding gene for farnesyl pyrophosphate synthase ERG20, and a coding gene for acetyl-coa synthase ACS, the method comprising the steps of:

(1) Integrating a coding gene sequence of a santalene synthase SAS into a genome of Pichia pastoris GS115-Cas9 to obtain a strain Pa-1;

3. The use of a yeast engineering bacterium for producing α -santalene by fermentation according to claim 1 in the preparation of α -santalene.

4. A method for preparing alpha-santalene, which is characterized in that the yeast engineering bacteria for producing the alpha-santalene by fermentation in claim 1 are cultivated by fermentation, and the alpha-santalene is extracted.

5. The method for preparing alpha-santalene according to claim 4, wherein the fermentation tank is used for fermenting yeast engineering bacteria for producing alpha-santalene, and the culturing method comprises the following steps: transferring the seed solution of the yeast engineering strain into a 1L fermentation tank with 10% of inoculation amount, culturing at 30 ℃, correcting dissolved oxygen DO to be 100%, fermenting at 24h and adding 10% of sterile filtered n-dodecane; and (3) when the mass fraction of glucose in the fermentation tank is reduced to 1%, feeding a glucose solution with the mass fraction of 40%, controlling the stirring rotation speed to be 200-800rpm, keeping dissolved oxygen to be more than 20%, feeding ammonia water with the volume fraction of 25% and acetic acid with the volume fraction of 18% in the later fermentation period, and finishing fermentation after regulating the pH value in the fermentation tank to be 5.5-6.0 and 96 and h.