CN114317754A

CN114317754A - Primer, kit, detection method and application suitable for detecting SIGLEC1 gene of digestive tract and immune system

Info

Publication number: CN114317754A
Application number: CN202111660509.5A
Authority: CN
Inventors: 刘佳; 惠薇; 戴文韬; 丁国徽; 卞振昌
Original assignee: Suzhou Ruiming Medical Laboratory Co ltd
Current assignee: Suzhou Ruiming Medical Laboratory Co ltd
Priority date: 2021-12-30
Filing date: 2021-12-30
Publication date: 2022-04-12

Abstract

The invention discloses a primer, a kit, a detection method and application suitable for detecting SIGLEC1 genes of a digestive tract and an immune system, wherein the primer is used for correspondingly detecting SIGLEC1 and comprises a forward primer with a nucleotide sequence shown as SEQ ID No. 1; the reverse primer with the nucleotide sequence shown as SEQ ID No. 2. The invention has the advantages of high sensitivity, high accuracy, good repeatability and stability and high result reliability.

Description

Primer, kit, detection method and application suitable for detecting SIGLEC1 gene of digestive tract and immune system

Technical Field

The invention relates to the technical field of biological detection, in particular to a primer, a kit, a detection method and application suitable for detecting the SIGLEC1 gene of a digestive tract and an immune system.

Background

SIGLEC1, sialoadhesin, is an immunoglobulin superfamily-like adhesion molecule expressed on macrophages of tissues. According to the reports of relevant documents, SIGLEC1 can regulate the secretion of cytokines and promote the generation of inflammatory reaction in the inflammatory reaction; SIGLEC1 promotes viral infection and phagocytosis during viral infection by mediating binding of pathogens to macrophages; SIGLEC1 can inhibit over-expression of IFN-alpha, inhibit innate immunity, and reduce adaptive immunity in the process of regulating immunity.

The existing research has less attention to the effect of SIGLEC1 in the digestive tract, and a detection method aiming at SIGLEC1 specific primers and probes is lacked.

The information disclosed in this background section is only for enhancement of understanding of the general background of the invention and should not be taken as an acknowledgement or any form of suggestion that this information forms the prior art already known to a person skilled in the art.

Disclosure of Invention

The invention aims to provide a primer, a kit, a detection method and application suitable for detecting SIGLEC1 gene, and the primer is optimized aiming at SIGLEC1 gene, so that the detection specificity is high, the sensitivity is strong, and the experimental method is stable. And the stable reference gene is selected for relative quantification, so that the accuracy is greatly improved, and the method has good repeatability and stability and high result reliability.

In order to achieve the above objects, the embodiments of the present invention provide primers suitable for SIGLEC1 gene detection in the digestive tract and immune system, for detecting SIGLEC1, comprising a forward primer having a nucleotide sequence shown in SEQ ID No. 1; the reverse primer with the nucleotide sequence shown as SEQ ID No. 2.

In one or more embodiments of the invention, kits suitable for genetic testing of the digestive tract and immune system include primers as previously described.

In one or more embodiments of the invention, the kit further comprises a primer for the reference gene, wherein the reference gene is SDHA, and the primer for the reference gene comprises a forward primer with a nucleotide sequence shown as SEQ ID No. 3; the reverse primer with the nucleotide sequence shown as SEQ ID No. 4.

In one or more embodiments of the present invention, the method for detecting genes in digestive tract and immune system comprises the following steps: extracting RNA aiming at a target sample and a control sample, and carrying out reverse transcription on the RNA to obtain cDNA, wherein the target tissue sample is selected from a fresh tumor tissue sample preserved in an RNAatter solution, a tumor tissue sample which is quick-frozen by liquid nitrogen and preserved at the temperature of-80 ℃, and a tumor tissue sample fixed by formalin; the control sample is selected from fresh tissue sample beside cancer stored in RNAatter solution, tissue sample beside cancer stored at-80 deg.C and frozen by liquid nitrogen, and tissue sample beside cancer fixed by formalin; forming a PCR reaction system comprising primers suitable for detection of SIGLEC1 gene in the gut and immune system as previously described; performing fluorescence PCR amplification reaction; and (6) judging the result.

In one or more embodiments of the invention, the target sample is derived from a pathological sample of tissue of the alimentary tract, tumor tissue. Preferably, the target sample is derived from colorectal cancer tissue or liver cancer tissue.

In one or more embodiments of the invention, the primers suitable for the detection of the SIGLEC1 genes of the digestive tract and the immune system as described above and/or the kit suitable for the detection of genes of the digestive tract and the immune system as described above are used for the detection of gastrointestinal tissues and/or tumors.

The scheme of the invention can be applied to fluorescent quantitative PCR, digital PCR, fluorescent probe detection and the like.

Compared with the prior art, the primer, the kit, the detection method and the application which are suitable for detecting the SIGLEC1 gene are wide in application range, and can be used for cell line samples and clinical tissue samples. SDHA is selected as an internal reference gene, the expression of the internal reference gene is stable, the difference between different samples is small, the expression of SIGLEC1 in paracarcinoma and tumor samples is different, and in three repeated experiments, the data are very stable, and the difference is small. The detection method has the advantages of good specificity, high sensitivity, accurate detection, simple operation, reduction of detection cost and detection time saving.

Detailed Description

The following detailed description is presented in conjunction with specific embodiments of the invention, but it should be understood that the scope of the invention is not limited by the specific embodiments.

Throughout the specification and claims, unless explicitly stated otherwise, the word "comprise", or variations such as "comprises" or "comprising", will be understood to imply the inclusion of a stated element or component but not the exclusion of any other element or component.

Real-time fluorescent quantitative PCR is a method of measuring the total amount of products after each Polymerase Chain Reaction (PCR) cycle in DNA amplification reaction using fluorescent chemicals. A method for quantitatively analyzing a specific DNA sequence in a sample to be detected by an internal reference method or an external reference method. Has higher sensitivity and specificity, and can carry out real-time on-line detection on PCR, thereby avoiding pollution.

Example 1

Primers were designed for SIGLEC1 and SDHA, respectively, based on the mRNA sequence at NCBI, with the sequences shown in the following table:

	sequence (5'to3')
		SEQ ID No.1	CCTCGGGGAGGAACATCCTT
SEQ ID No.2	AGGCGTACCCCATCCTTGA
		SEQ ID No.3	CAAACAGGAACCCGAGGTTTT
SEQ ID No.4	CAGCTTGGTAACACATGCTGTAT

6 colorectal tissue samples (the tissue samples can be fresh tumor tissue samples stored in RNA lator solution or tumor tissue samples which are frozen by liquid nitrogen and stored at-80 ℃ or tumor tissue samples fixed by formalin, and the samples are determined according to requirements), the samples are respectively derived from the tissues beside the cancer (namely, a control sample, recorded as I-cancer and the like, the same below) and the tumor tissues (namely, a target sample, recorded as I-cancer and the like, the same below) of 3 volunteers for RNA extraction, and the extraction method is carried out according to the instruction of an RNA extraction kit. The RNA of the 6 samples was reverse transcribed into cDNA according to the reverse transcription kit instructions, and the obtained cDNA was used in the subsequent real-time fluorescent quantitative PCR. The real-time fluorescent quantitative PCR reaction system comprises 2 XSYBR Green Master Mix 12.5. mu.L, forward primer 0.5. mu.L, reverse primer 0.5. mu. L, cDNA 1. mu.L, RNase-free ultrapure water 10. mu.L and 50 XLow ROX 0.5. mu.L.

The reaction system is mainly, and the rest such as buffer solution, inorganic salt and the like can be selected according to the prior art in the field:

components	Volume of
		2X SYBR Green Master Mix	12.5μL
Forward primer	0.5μL
		Reverse primer	0.5μL
cDNA	1μL
		RNase-free ultrapure water	10μL
50X Low ROX	0.5μL

Reaction procedure

RNA from 6 samples was run in triplicate, with triplicate wells in each experiment.

The experimental results are as follows:

SIGLEC1	i-paratuberculosis	Cancer of the I-type	II-paratope of cancer	II cancer	III paracancer	III cancer
							Overall CV	0.004636462	0.007654213	0.00566184	0.005161712	0.004740968	0.011760944

According to the results, the data are analyzed, and the following results can be seen: the average value of CV coefficients of all reference genes in each sample is lower than 0.01, and the whole body is stable; in 6 clinical samples, the cv value of SIGLEC1 is less than 0.02, which indicates that the existing primers and probes are stable and are suitable for SIGLEC1 quantification of clinical samples of digestive tract tissues.

Analysis is carried out according to the experimental results, the expression quantity of SIGLEC1 is calculated by using a 2-delta-Ct method, so that the difference expression in a paracancer sample and a tumor tissue sample is obvious, and the consistency of results of the same sample in different batches is good (see a table below).

Example 2

Primers were designed for SIGLEC1 and SDHA, respectively, based on the mRNA sequence at NCBI, see example 1.

Selecting 4 liver tissue samples (the tissue samples can be fresh tumor tissue samples stored in RNA later solution or tumor tissue samples which are frozen by liquid nitrogen and stored at-80 ℃ or tumor tissue samples fixed by formalin, and the samples are respectively derived from the cancer adjacent tissues and the tumor tissues of 2 volunteers for RNA extraction according to the instruction of an RNA extraction kit. The RNA of the 4 samples was reverse transcribed into cDNA according to the reverse transcription kit instructions, and the obtained cDNA was used in the subsequent real-time fluorescent quantitative PCR. The real-time fluorescent quantitative PCR reaction system comprises 2 XSYBR Green Master Mix 12.5. mu.L, forward primer 0.5. mu.L, reverse primer 0.5. mu. L, cDNA 1. mu.L, RNase-free ultrapure water 10. mu.L and 50 XLow ROX 0.5. mu.L.

Reaction procedure

RNA from 4 samples was run in triplicate, with triplicate wells in each experiment.

The experimental results are as follows:

SDHA	IV-cancer	IV-paratuber-carcinoma	V-cancer	Paracarcinoma V-V
					Overall CV	0.004926284	0.005213569	0.00467701	0.003355856

SIGLEC1	IV-cancer	IV-paratuber-carcinoma	V-cancer	Paracarcinoma V-V
					Overall CV	0.026420922	0.018704457	0.015535249	0.014290583

According to the results, the data are analyzed, and the following results can be seen: the average value of CV coefficients of all reference genes in each sample is lower than 0.006, and the whole body is stable; in 4 clinical samples, the cv value of SIGLEC1 is less than 0.03, which indicates that the existing primers and probes are stable and are suitable for SIGLEC1 quantification of clinical samples of digestive tract tissues.

The foregoing descriptions of specific exemplary embodiments of the present invention have been presented for purposes of illustration and description. It is not intended to limit the invention to the precise form disclosed, and obviously many modifications and variations are possible in light of the above teaching. The exemplary embodiments were chosen and described in order to explain certain principles of the invention and its practical application to enable one skilled in the art to make and use various exemplary embodiments of the invention and various alternatives and modifications as are suited to the particular use contemplated. It is intended that the scope of the invention be defined by the claims and their equivalents.

Claims

1. A primer suitable for detecting the SIGLEC1 gene of the digestive tract and the immune system is characterized by comprising a forward primer with a nucleotide sequence shown as SEQ ID No. 1; the reverse primer with the nucleotide sequence shown as SEQ ID No. 2.

2. A kit suitable for genetic testing of the digestive tract and immune system comprising the primer of claim 1.

3. The kit suitable for detecting genes of the digestive tract and the immune system as claimed in claim 2, which further comprises a primer aiming at an internal reference gene, wherein the internal reference gene is SDHA, and the primer aiming at the internal reference gene comprises a forward primer with a nucleotide sequence shown as SEQ ID No. 3; the reverse primer with the nucleotide sequence shown as SEQ ID No. 4.

4. The gene detection method suitable for the digestive tract and the immune system is characterized by comprising the following steps:

extracting RNA aiming at a target sample and a control sample, and carrying out reverse transcription on the RNA to obtain cDNA, wherein the target tissue sample is selected from a fresh tumor tissue sample preserved in an RNAatter solution, a tumor tissue sample which is quick-frozen by liquid nitrogen and preserved at the temperature of-80 ℃, and a tumor tissue sample fixed by formalin; the control sample is selected from a fresh tissue sample beside cancer preserved in an RNA later solution, a tissue sample beside cancer which is quickly frozen by liquid nitrogen and preserved at-80 ℃, and a tissue sample beside cancer which is fixed by formalin;

forming a PCR reaction system comprising primers suitable for detection of SIGLEC1 gene of the digestive tract and immune system as claimed in claim 1.

Performing fluorescence PCR amplification reaction;

and (6) judging the result.

5. The method for genetic testing of the digestive tract and immune system according to claim 4, wherein the target sample is derived from a pathological sample of the digestive tract, tumor tissue.

6. Use of the primers for the detection of the SIGLEC1 genes of the digestive tract and immune system according to claim 1 and/or the kit for the detection of genes of the digestive tract and immune system according to claims 2-3 for the detection of gastrointestinal tissues and/or tumors.