CN114317498B - Alpha-glucose transglycosylase mutant and application thereof - Google Patents

Abstract

The invention relates to an alpha-glucose transglycosylase mutant, belonging to the technical field of genetic engineering. The amino acid sequence of the alpha-glucosidase mutant is shown as SEQ ID NO.3, SEQ ID NO.4 or SEQ ID NO. 5. On the basis of the deep sea bacillus licheniformis source alpha-glucose transglycosylase, two mutant strains S204L and A307E with improved single-point thermal stability and a combined mutant S204L/A307E are obtained by screening, and the activity of the mutant is not affected while the thermal stability of the mutant is obviously improved. The mutants are more suitable for industrial production than the natural alpha-glucose transglycosylase, and have great application prospect and industrial value.

Description

Alpha-glucose transglycosylase mutant and application thereof

Technical Field

The invention relates to an alpha-glucose transglycosylase mutant and application thereof, belonging to the technical field of genetic engineering.

Background

Isomaltooligosaccharides (IMOs) are a class of functional oligosaccharides consisting of 2-10 α -1, 6-glycosidically linked glucosyl groups, including isomaltose, panose, isomaltotriose and other major functional components. The IMOs can promote the proliferation of probiotics such as bifidobacteria, lactobacillus and the like in human intestinal tracts and regulate intestinal flora; has low caloric value, promotes gastrointestinal motility, improves constipation and lipid metabolism, prevents caries and the like, and therefore, IMOs are widely used as prebiotics, food additives and feed ingredients.

Currently, IMOs are generally produced by enzymatic conversion processes, using α -amylase, β -amylase, pullulanase and glucosidase to catalyze production from starch, a typical production process usually comprising 3 steps: firstly, liquefying, wherein starch is liquefied by thermostable alpha-amylase to produce oligosaccharides and dextrins; saccharification, oligosaccharide and dextrin are saccharified by saccharifying enzymes such as beta-amylase and pullulanase; thirdly, transglycosylation, α -glucosidase (ec 3.2.1.20) catalyzes the release of glucose from the non-reducing end of the substrate and transfers the glucosyl residue to the 6-OH group of the non-reducing glucose unit, yielding IMOs. At present, research and industrial application of commercial alpha-amylase, beta-amylase, pullulanase and the like are mature, and most of the industrially applied alpha-glucosidase is derived from aspergillus niger (Aspergillus niger), and the application of the alpha-glucosidase in large-scale production of IMOs is limited due to the problems of poor thermal stability, low reaction rate, high enzyme purification and recycling cost and the like.

Disclosure of Invention

The invention aims to solve the defects of the prior art and provide an alpha-glucosidase mutant with improved heat stability.

Technical proposal

An alpha-glucosidase mutant is obtained by carrying out site-directed mutagenesis on amino acids at position 204 and/or position 307 of alpha-glucosidase with an amino acid sequence shown as SEQ ID NO.1, wherein serine at position 204 is mutated to leucine, alanine at position 307 is mutated to glutamic acid, and the amino acid sequence of the alpha-glucosidase mutant is shown as SEQ ID NO.3, SEQ ID NO.4 or SEQ ID NO. 5; the nucleotide sequence of the coded alpha-glucosyltransferase is shown as SEQ ID NO. 2.

The use of the above-mentioned alpha-glucosidase mutant for the production of isomaltooligosaccharides.

A method for preparing the alpha-glucosidase mutant:

(1) The nucleotide sequence shown as SEQ ID NO.2 is used as a template, a site-directed mutagenesis primer is designed according to the mutated site, PCR amplification is carried out to obtain a gene containing the mutated site, and then a vector containing the gene for encoding the mutant is constructed.

(2) The gene vector containing the encoded mutant is transformed into a host cell.

(3) Screening and verifying the recombinant cells constructed in the previous step to obtain positive clones, then culturing, fermenting and producing enzymes, centrifuging and collecting cells, crushing the cells by using an ultrasonic cell disrupter, and centrifuging to obtain the alpha-glucose transglycosylase mutant.

A nucleotide sequence of the coding gene is shown as SEQ ID NO.6, SEQ ID NO.7 or SEQ ID NO. 8.

A recombinant expression vector carrying the above gene.

The recombinant expression vector takes a pET-28a (+) vector as an original expression vector.

A genetically engineered bacterium transformed by the recombinant expression vector.

The genetically engineered bacterium takes escherichia coli as a host. The E.coli includes BL21 (DE 3).

The invention has the beneficial effects that:

1) The invention modifies the molecular structure of the alpha-glucosyltransferase by rational design and combining site-directed mutagenesis biotechnology based on the natural alpha-glucosyltransferase, analyzes the influence of the mutated residue on the enzyme thermal stability, and finally obtains mutant strains with improved stability (S204L, A E and S204L/A307E).

2) The half-life of the natural alpha-glucosyltransferase is 18.3h, and the half-life of the alpha-glucosyltransferase mutant S204L (serine at 204 th position is mutated into leucine) provided by the invention reaches 37.4h at 65 ℃ which is 2.06 times that of the natural alpha-glucosyltransferase; the half-life of the alpha-glucosyltransferase mutant A307E (the alanine at 307 th position is mutated to glutamic acid) reaches 28.6h at 65 ℃ which is 1.56 times that of the natural alpha-glucosyltransferase; S204L/A307E (serine at position 204 is mutated to leucine, alanine at position 307 is mutated to glutamic acid) has a half-life of 56.9h at 65℃which is 3.1 times the half-life of the native alpha-glucosidase.

3) The alpha-glucosyltransferase mutant provided by the invention has obviously improved thermostability and simultaneously has the enzyme activity unaffected. Wherein, after heat treatment for 40h at 65 ℃ under the condition that the catalytic activity of the enzyme is basically unchanged, the mutant S204L (serine at position 204 is mutated to leucine) and the mutant A307E (alanine at position 307 is mutated to glutamic acid) and the combined mutant S207L/A307E respectively retain 49.1%,43.2% and 91.2% of relative enzyme activities, and the control group only retains 15.7% of relative enzyme activities.

4) Compared with the wild type, the alpha-glucose transglycosidase mutant obtained by the invention is more suitable for catalyzing maltose to generate isomaltooligosaccharide, and is more beneficial to the flexibility of the production process.

Drawings

FIG. 1 is a SDS-PAGE electrophoresis of pure enzyme solution of wild-type alpha-glucosidase and alpha-glucosidase mutant;

FIG. 2 is a graph showing the residual activity test results of wild-type alpha-glucosidase and its mutant after incubation at 65℃and pH7.0 for 40 hours;

FIG. 3 shows half-life of wild-type α -glucosidase and α -glucosidase mutant S204L, A307E, S L/A307E at 65 ℃;

FIG. 4 shows the enzymatic activity of wild-type α -glucosidase and α -glucosidase mutant S204L, A307E, S L/A307E at different pH values;

FIG. 5 shows the enzymatic activities of wild-type α -glucosidase and α -glucosidase mutant S204L, 307E, S L/A307E at different temperatures.

Detailed Description

The technical scheme of the invention is further described below with reference to the attached drawings and specific embodiments. In the examples below, the pET-28a (+) vector was purchased from Invitrogen; the related culture medium and the formula are as follows:

LB liquid medium: 10g/L peptone, 5g/L yeast powder and 10g/L NaCl.

LB solid medium: 2% agar was added on the basis of LB liquid medium.

The detection method involved in the following examples is as follows:

the method for measuring the enzyme activity of the alpha-glucose transglycosylase comprises the following steps: 100. Mu.L of 0.05mg/ml of pure enzyme was added to 900. Mu.L of a reaction system containing 200g/L of maltose and 50mM of sodium dihydrogen phosphate-disodium hydrogen phosphate buffer pH 7.0; the reaction was carried out in a water bath at 45℃for 10min, then in a boiling water bath at 100℃for 10min, the enzymatic reaction was terminated, the supernatant was centrifuged, and after 20-fold dilution, the content of isomaltooligosaccharide 0 in the reaction solution was detected by HPLC.

Definition of enzyme activity: the amount of enzyme required to catalyze the formation of l. Mu. Mol of isomaltooligosaccharide per minute at 45℃and pH7.0 is defined as one enzyme activity unit U.

Specific enzyme activity: defined as the enzyme activity U/mg of the unit protein.

EXAMPLE 1 construction of recombinant plasmid containing alpha-glucosidase mutant

Constructing a recombinant plasmid containing an alpha-glucosyltransferase mutant:

(1) Construction of recombinant plasmid containing wild-type alpha-glucose transglycosylase GSJ

The wild alpha-glucose transglycosylase GSJ with the nucleotide sequence shown as SEQ ID NO.2 is chemically synthesized, and is connected with a pET-28a (+) vector after being subjected to enzyme digestion by NdeI enzyme and MluI enzyme, so as to prepare the recombinant vector pET-28a (+) -GSJ.

(2) Obtaining recombinant vector containing mutant:

and (3) performing site-directed mutagenesis by using the recombinant vector pET-28a (+) -GSJ prepared in the step (1) as a template by using a full plasmid PCR technology to obtain a recombinant plasmid pET-28a (+) -S204L, pET-28a (+) -I209M, pET-28a (+) -S360L, pET-28a (+) -N441M, pET-28a (+) -G108P, pET-28a (+) -S132F, pET-28a (+) -A307E, pET-28a (+) -S204L/A307E containing mutant genes.

The designed primer sequences were as follows:

S204L-F：AACTGGGAGAATCTCGAAGTG

S204L-R：CTTGGCGCACTTCGAGAT

I209M-F：GCCGAGCTGTACGACATGTTACGCTTCTGGCTG

I209M-R：CAGCCAGAAGCGTAACATGTCGTACAGCTCGGC

S360L-F：CTGCAAGAAAATGCCTTAACCTTAACTTTAGCCCC

S360L-R：GCTAAAGTTAAGGTTAAGGCATTTTCTTGCAGACTCGG

N441M-F：GGCATTTACAAATTAATGCACCACCACCACCA

N441M-R：TGGTGGTGGTGGTGCATTAATTTGTAAATGCC

G108P-F：TTTTGGCGCGACCCGAAACAAGGTCAAGCTCCGAAT

G108P-R：TTGACCTTGTTTCGGGTCGCGCCAAAAGTAGTAGTC

S132F-F：TTCCGCCAAGTTATCTTCCAAACCGATCGTGC

S132F-R：GCACGATCGGTTTGGAAGATAACTTGGCGGAA；

A307E-F：ATCTTTGGTGTTCCGCTGAGCGCCATGCCCGAT；

A307E-R：ATCGGGCATGGCGCTCAGCGGAACACCAAAGAT。

wherein, the PCR amplification procedure was set as follows: firstly, pre-deforming for 5min at 95 ℃; then 30 cycles are entered; denaturation at 95℃for 30S, annealing at 72℃for 30S, extension at 58℃for 3.5min, and incubation at 4 ℃. The PCR products were detected by agarose gel electrophoresis at 0.8%.

The final amplified fragment was subjected to DpnI enzyme in a 37℃water bath for 1h for template removal, and the PCR mixture was then chemically transformed into E.coli JM109 competent cells, the transformation solution was coated on ampicillin (50. Mu.g/mL) LB solid medium, plasmids were extracted and sequenced, and sequencing work was completed by Suzhou Jin Weizhi.

Example 2: construction of recombinant escherichia coli engineering bacteria for producing alpha-glucose transglycosylase mutant and expression, separation and purification of alpha-glucose transglycosylase

The method comprises the following specific steps:

(1) The recombinant plasmids pET-28a (+) -GSJ and pET-28a (+) -S204L, pET-28a (+) -I209M, pET-28a (+) -S360L, pET-28a (+) -N441M, pET-28a (+) -G108P, pET-28a (+) -S132F, pET-28a (+) -A307E, pET-28a (+) -S204L/A307E obtained in example 1 are respectively transformed into E.coli BL21 competent cells to prepare genetically engineered bacteria respectively: e.coli BL21/pET-28a (+) -GSJ, E.coli BL21/pET-28a (+) -S204L, E.coli BL21/pET-28a (+) -I209M, E.coli BL21/pET-28a (+) -S360L, E.coli BL21/pET-28a (+) -N441M, E.coli BL21/pET-28a (+) -G108P, E.coli BL21/pET-28a (+) -S132F, E.coli BL21/pET-28a (+) -A307E, E.coli BL21/pET-28a (+) -S204L/A307E.

(2) Respectively inoculating the genetically engineered bacteria prepared in the step (1) into 10mL of LB liquid medium containing 50 mug/mL kanamycin sulfate, and culturing at 37 ℃ and 200rpm for overnight to prepare seed liquid;

the seed solution obtained by the preparation is transferred into 100mL of LB liquid medium containing 50 mug/mL kanamycin sulfate according to the inoculation amount of 2% (v/v), and the culture is continued for 20 hours at 30 ℃ to obtain fermentation liquor. The resulting fermentation broth was centrifuged at 8000 Xg at 4℃for 5min to obtain cell biomass, and the cells were washed 3 times and resuspended in 10mL of disodium hydrogen phosphate-sodium dihydrogen phosphate buffer (pH 7.0).

Treating the resuspended cells with an ultrasonic breaker under ice bath condition for 30min, centrifuging for 30min (8000 Xg, 4deg.C), and removing supernatant to obtain crude enzyme solution;

the supernatant fraction was filtered through a 0.22- μm filter and then further loaded onto a 1mL Ni affinity column pre-equilibrated with 50mM wash buffer (20 mM Tris and 500mM NaCl,pH 7.4), then the elution buffer (20 mM Tris, 500mM NaCl and 500mM imidazole, pH 7.4) eluted unbound protein and alpha-glucosidase with a linear gradient; preparing pure enzyme liquid containing wild GSJ, pure enzyme liquid containing S204L, pure enzyme liquid containing I209M, pure enzyme liquid containing S360L, pure enzyme liquid containing N441M, pure enzyme liquid containing G108P, pure enzyme liquid containing S132F, pure enzyme liquid containing A307E, and pure enzyme liquid containing S204L/A307E;

the pure enzyme solutions were subjected to sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE), respectively, as shown in FIG. 1, wherein: m, protein maker;1, wild GSJ pure enzyme solution; 2-9 are respectively: contains S204L, I209M, A307E, S360L, S132F, G108P, N441M, S207L/A307E pure enzyme solution. The results show that: a distinct band at 63kDa demonstrated that alpha-glucosidase was expressed.

Performing a thermal stability experiment on the pure enzyme prepared in the step (2), and performing primary screening, wherein the method comprises the following steps: and (2) respectively incubating the pure enzyme prepared in the step (2) in a water bath kettle at 65 ℃ for 40 hours, taking 1mL, measuring the residual enzyme activity of the residual enzyme according to an alpha-glucose transglycosylase enzyme activity measuring method, and taking the enzyme activity of the pure enzyme solution which is not subjected to high temperature treatment as a blank control to obtain the percentage of the residual enzyme activity, wherein the residual activity test result of the wild alpha-glucose transglycosylase and the mutant thereof is shown in figure 2.

As can be seen from fig. 2, mutant S204L retained 49.1% of the relative enzyme activity, whereas the control group retained only 9.7% of the relative enzyme activity; the relative enzyme activities of other mutants are below 18%; the mutant S204L of the present invention is therefore significantly more thermostable than the other mutants.

Performing specific enzyme activity determination on the pure enzyme solution prepared in the step (2)

Detecting the pure enzyme solution containing the wild GSJ prepared in the step (2), the pure enzyme solution containing S204L, the pure enzyme solution containing A307E and the pure enzyme solution containing S204L/A307E respectively, wherein the results are shown in Table 1:

TABLE 1 specific enzymatic activities of different alpha-glucosyltransferases

Example 3: enzymatic Properties of alpha-glucose Transglycosidase mutants

1. Thermal stability

Taking the pure enzyme solution containing the wild GSJ prepared in the step (2) of the example 2, the pure enzyme solution containing S204L, the pure enzyme solution containing A307E, the pure enzyme solution containing S204L/A307E, placing the pure enzyme solution into a constant temperature water bath at 65 ℃ for sampling once at intervals, measuring the residual enzyme activity according to an alpha-glucose transglycosylase enzyme activity measuring method, and comparing the thermal stability of the residual enzyme solution to obtain the half-life results of the wild GSJ and the mutant thereof, wherein the half-life results are shown in figure 3.

2. Optimum pH

The enzyme activity was measured by placing the purified enzyme solution containing wild-type GSJ prepared in step (2) of example 2, the purified enzyme solution containing S204L, the purified enzyme solution containing A307E, and the purified enzyme solution containing S204L/A307E in 50mM buffer containing citric acid/sodium phosphate (pH 5.0 to 9.0) with the initial enzyme activity not incubated being 100%, and the results are shown in FIG. 4.

As can be seen from FIG. 4, the mutant had an optimal pH of 7.0, similar to the wild type.

3. Optimum temperature

The enzyme activity was measured by placing the purified enzyme solution containing wild-type GSJ prepared in step (2) of example 2, the purified enzyme solution containing S204L, the purified enzyme solution containing A307E, the purified enzyme solution containing S204L/A307E in 50mM buffer containing citric acid/sodium phosphate (pH 7.0), setting the reaction temperature at 30 to 60℃and taking the initial enzyme activity without incubation as 100%, and the results are shown in FIG. 5.

As can be seen from FIG. 5, the optimum temperature of the mutant was 45℃and was similar to that of the wild type.

4. Kinetic parameters of alpha-glucose transglycosidase

The pure enzyme solution containing wild GSJ prepared in the step (2) of example 2 was measured under standard measurement conditions using maltose as a substrate, the pure enzyme solution containing S204L, the pure enzyme solution containing A307E, and the kinetic parameters of the pure enzyme solution containing S204L/A307E. Wherein the maltose substrate concentration is 14.6, 29.2, 58.4, 102, 146, 234, 292, and 584mM, respectively; the addition amount of the pure enzyme solution is 10 mug, the reaction is carried out for 10min at 45 ℃, and after the reaction is finished, regression analysis is carried out on experimental data by utilizing GraphPad Prism 8.0 to determine the Vmax and Km values; the results are shown in Table 2:

TABLE 2 kinetic parameters of different alpha-glucosyltransferases

The results show that the mutant showed similar activity compared to the wild type. The mutants have small changes in the dynamic parameters such as Km and Kcat/Km, which indicates that the mutation or the thermal stability has little influence on the catalytic property of the enzyme.

While the invention has been described with reference to the preferred embodiments, it is not limited thereto, and various changes and modifications can be made therein by those skilled in the art without departing from the spirit and scope of the invention as defined in the appended claims.

Sequence listing

SEQ ID NO.1

Amino acid sequence of alpha-glucosyltransferase

KKTWWKEGVAYQIYPRSFMDANGDGIGDLRGIIEKLDYLVELGVDIVWICPIYRSPNADNGYDISDYYAIMDEFGTMDDFDELLAQAHRRGLKVILDLVINHTSDEHPWFIESRSSRDNPKRDWYIWRDGKDGREPNNWESIFGGSAWQYDERTGQYYLHIFDVKQPDLNWENSEVRQALYEMVNWWLDKGIDGFRIDAISHISKKPGLPDLPNPKGLKYVPSFAGHMNQPGIMEYLRELKEQTFARYDIMTVGEANGVTVDEAEQWVGEENGVFNMIFQFEHLGLWERRADGSIDVRRLKRTLTKWQKGLENRGWNALFLENHDLPRSVSTWGNDRDYWAESAKALGALYFFMQGTPFIYQGQEIGMTNVRFDDIRDYRDVSALRLYELERAKGRTHEEAMTIIWKTGRDNSRTPMQWSGASNAGFTTGTPWIKVNENYRTINVEAERRDPNSVWSFYRQMIQLRKANELFVYGTYDLLLENHPSIYAYTRTLGRDRALVVVNLSDRPSLYRYDGFRLQSSDLALSNYPVRPHKNATRFKLKPYEARVYIWKE

SEQ ID NO.2

Nucleotide sequence encoding alpha-glucose transglycosylase

aaaaaaacgtggtggaaagaaggcgtggcgtatcagatctacccgcgtagctttatggacgccaatggcgacggcatcggcgatctgcgtggcatcatcgagaagctcgactatctggttgaactgggcgtggacatcgtttggatctgtccgatctatcgcagtccgaatgccgataacggctacgatatcagcgactactacgccatcatggacgagttcggcaccatggatgacttcgatgagctgctggcgcaagcccatcgtcgtggtctcaaggtgatcctcgatctggtgatcaatcacaccagcgatgaacacccgtggtttatcgaaagtcgcagcagtcgcgacaacccgaagcgcgattggtacatttggcgtgacggcaaagacggccgcgaaccgaacaactgggaaagcattttcggtggcagcgcgtggcagtacgatgaacgcacgggccagtactatctgcacattttcgacgtgaagcagccagatctgaactgggagaatagcgaagtgcgccaagcgctgtacgaaatggtgaactggtggctcgacaagggtatcgatggcttccgcatcgacgccatcagccatatcagcaagaagccgggtctgccggatctgccaaatccgaaaggtctgaaatacgtgccgagctttgccggccacatgaatcagccgggcatcatggaatatctgcgcgagctgaaagagcagaccttcgcccgctatgatatcatgaccgtgggcgaagcgaacggtgtgaccgttgacgaagccgaacagtgggtgggcgaggaaaacggtgtgttcaatatgatcttccaatttgagcatctgggtctctgggaacgtcgcgccgatggcagcatcgatgttcgtcgtctgaaacgcacgctgaccaaggcgcagaaaggcctcgaaaaccgcggttggaatgcgctgtttctggaaaaccacgatctcccgcgcagcgtgagtacgtggggcaatgaccgtgattactgggccgaaagcgcgaaagcgctcggtgcgctctatttcttcatgcaaggcaccccgtttatctaccaaggccaagagatcggcatgaccaatgttcgctttgacgacatccgcgactaccgcgatgttagcgccctccgcctctacgaactggaacgtgccaagggccgcacgcatgaagaggccatgaccatcatctggaaaacgggtcgcgacaacagtcgcacgccgatgcagtggagcggtgccagtaatgccggcttcacgaccggcaccccatggattaaggttaatgaaaactaccgcaccatcaatgtggaagcggaacgtcgcgacccgaacagcgtgtggagcttttatcgccagatgatccagctccgtaaagcgaacgagctgtttgtttacggcacgtacgatctgctgctggagaaccatccgagcatttacgcctatacccgtacgctgggtcgtgatcgtgcgctggtggttgttaatctcagcgaccgcccaagtctgtaccgctatgacggcttccgtctgcagagcagtgatctggcgctgagtaattacccagtgcgcccgcacaagaatgccacgcgcttcaaactcaagccgtacgaggcccgcgtgtacatctggaaggagtaa

SEQ ID NO.3

Amino acid sequence of alpha-glucose transglycosylase mutant S204L

KKTWWKEGVAYQIYPRSFMDANGDGIGDLRGIIEKLDYLVELGVDIVWICPIYRSPNADNGYDISDYYAIMDEFGTMDDFDELLAQAHRRGLKVILDLVINHTSDEHPWFIESRSSRDNPKRDWYIWRDGKDGREPNNWESIFGGSAWQYDERTGQYYLHIFDVKQPDLNWENSEVRQALYEMVNWWLDKGIDGFRIDAISHILKKPGLPDLPNPKGLKYVPSFAGHMNQPGIMEYLRELKEQTFARYDIMTVGEANGVTVDEAEQWVGEENGVFNMIFQFEHLGLWERRADGSIDVRRLKRTLTKWQKGLENRGWNALFLENHDLPRSVSTWGNDRDYWAESAKALGALYFFMQGTPFIYQGQEIGMTNVRFDDIRDYRDVSALRLYELERAKGRTHEEAMTIIWKTGRDNSRTPMQWSGASNAGFTTGTPWIKVNENYRTINVEAERRDPNSVWSFYRQMIQLRKANELFVYGTYDLLLENHPSIYAYTRTLGRDRALVVVNLSDRPSLYRYDGFRLQSSDLALSNYPVRPHKNATRFKLKPYEARVYIWKE

SEQ ID NO.4

Amino acid sequence of alpha-glucosyltransferase mutant A307E

KKTWWKEGVAYQIYPRSFMDANGDGIGDLRGIIEKLDYLVELGVDIVWICPIYRSPNADNGYDISDYYAIMDEFGTMDDFDELLAQAHRRGLKVILDLVINHTSDEHPWFIESRSSRDNPKRDWYIWRDGKDGREPNNWESIFGGSAWQYDERTGQYYLHIFDVKQPDLNWENSEVRQALYEMVNWWLDKGIDGFRIDAISHISKKPGLPDLPNPKGLKYVPSFAGHMNQPGIMEYLRELKEQTFARYDIMTVGEANGVTVDEAEQWVGEENGVFNMIFQFEHLGLWERRADGSIDVRRLKRTLTKEQKGLENRGWNALFLENHDLPRSVSTWGNDRDYWAESAKALGALYFFMQGTPFIYQGQEIGMTNVRFDDIRDYRDVSALRLYELERAKGRTHEEAMTIIWKTGRDNSRTPMQWSGASNAGFTTGTPWIKVNENYRTINVEAERRDPNSVWSFYRQMIQLRKANELFVYGTYDLLLENHPSIYAYTRTLGRDRALVVVNLSDRPSLYRYDGFRLQSSDLALSNYPVRPHKNATRFKLKPYEARVYIWKE

SEQ ID NO.5

Amino acid sequence of alpha-glucose transglycosylase mutant S204L/A307E

KKTWWKEGVAYQIYPRSFMDANGDGIGDLRGIIEKLDYLVELGVDIVWICPIYRSPNADNGYDISDYYAIMDEFGTMDDFDELLAQAHRRGLKVILDLVINHTSDEHPWFIESRSSRDNPKRDWYIWRDGKDGREPNNWESIFGGSAWQYDERTGQYYLHIFDVKQPDLNWENSEVRQALYEMVNWWLDKGIDGFRIDAISHILKKPGLPDLPNPKGLKYVPSFAGHMNQPGIMEYLRELKEQTFARYDIMTVGEANGVTVDEAEQWVGEENGVFNMIFQFEHLGLWERRADGSIDVRRLKRTLTKEQKGLENRGWNALFLENHDLPRSVSTWGNDRDYWAESAKALGALYFFMQGTPFIYQGQEIGMTNVRFDDIRDYRDVSALRLYELERAKGRTHEEAMTIIWKTGRDNSRTPMQWSGASNAGFTTGTPWIKVNENYRTINVEAERRDPNSVWSFYRQMIQLRKANELFVYGTYDLLLENHPSIYAYTRTLGRDRALVVVNLSDRPSLYRYDGFRLQSSDLALSNYPVRPHKNATRFKLKPYEARVYIWKE

SEQ ID NO.6

Nucleotide sequence encoding alpha-glucose transferase mutant S204L

aaaaaaacgtggtggaaagaaggcgtggcgtatcagatctacccgcgtagctttatggacgccaatggcgacggcatcggcgatctgcgtggcatcatcgagaagctcgactatctggttgaactgggcgtggacatcgtttggatctgtccgatctatcgcagtccgaatgccgataacggctacgatatcagcgactactacgccatcatggacgagttcggcaccatggatgacttcgatgagctgctggcgcaagcccatcgtcgtggtctcaaggtgatcctcgatctggtgatcaatcacaccagcgatgaacacccgtggtttatcgaaagtcgcagcagtcgcgacaacccgaagcgcgattggtacatttggcgtgacggcaaagacggccgcgaaccgaacaactgggaaagcattttcggtggcagcgcgtggcagtacgatgaacgcacgggccagtactatctgcacattttcgacgtgaagcagccagatctgaactgggagaatagcgaagtgcgccaagcgctgtacgaaatggtgaactggtggctcgacaagggtatcgatggcttccgcatcgacgccatcagccatatcctgaagaagccgggtctgccggatctgccaaatccgaaaggtctgaaatacgtgccgagctttgccggccacatgaatcagccgggcatcatggaatatctgcgcgagctgaaagagcagaccttcgcccgctatgatatcatgaccgtgggcgaagcgaacggtgtgaccgttgacgaagccgaacagtgggtgggcgaggaaaacggtgtgttcaatatgatcttccaatttgagcatctgggtctctgggaacgtcgcgccgatggcagcatcgatgttcgtcgtctgaaacgcacgctgaccaaggcgcagaaaggcctcgaaaaccgcggttggaatgcgctgtttctggaaaaccacgatctcccgcgcagcgtgagtacgtggggcaatgaccgtgattactgggccgaaagcgcgaaagcgctcggtgcgctctatttcttcatgcaaggcaccccgtttatctaccaaggccaagagatcggcatgaccaatgttcgctttgacgacatccgcgactaccgcgatgttagcgccctccgcctctacgaactggaacgtgccaagggccgcacgcatgaagaggccatgaccatcatctggaaaacgggtcgcgacaacagtcgcacgccgatgcagtggagcggtgccagtaatgccggcttcacgaccggcaccccatggattaaggttaatgaaaactaccgcaccatcaatgtggaagcggaacgtcgcgacccgaacagcgtgtggagcttttatcgccagatgatccagctccgtaaagcgaacgagctgtttgtttacggcacgtacgatctgctgctggagaaccatccgagcatttacgcctatacccgtacgctgggtcgtgatcgtgcgctggtggttgttaatctcagcgaccgcccaagtctgtaccgctatgacggcttccgtctgcagagcagtgatctggcgctgagtaattacccagtgcgcccgcacaagaatgccacgcgcttcaaactcaagccgtacgaggcccgcgtgtacatctggaaggagtaa

SEQ ID NO.7

Nucleotide sequence encoding alpha-glucosyltransferase mutant A307E

aaaaaaacgtggtggaaagaaggcgtggcgtatcagatctacccgcgtagctttatggacgccaatggcgacggcatcggcgatctgcgtggcatcatcgagaagctcgactatctggttgaactgggcgtggacatcgtttggatctgtccgatctatcgcagtccgaatgccgataacggctacgatatcagcgactactacgccatcatggacgagttcggcaccatggatgacttcgatgagctgctggcgcaagcccatcgtcgtggtctcaaggtgatcctcgatctggtgatcaatcacaccagcgatgaacacccgtggtttatcgaaagtcgcagcagtcgcgacaacccgaagcgcgattggtacatttggcgtgacggcaaagacggccgcgaaccgaacaactgggaaagcattttcggtggcagcgcgtggcagtacgatgaacgcacgggccagtactatctgcacattttcgacgtgaagcagccagatctgaactgggagaatagcgaagtgcgccaagcgctgtacgaaatggtgaactggtggctcgacaagggtatcgatggcttccgcatcgacgccatcagccatatcagcaagaagccgggtctgccggatctgccaaatccgaaaggtctgaaatacgtgccgagctttgccggccacatgaatcagccgggcatcatggaatatctgcgcgagctgaaagagcagaccttcgcccgctatgatatcatgaccgtgggcgaagcgaacggtgtgaccgttgacgaagccgaacagtgggtgggcgaggaaaacggtgtgttcaatatgatcttccaatttgagcatctgggtctctgggaacgtcgcgccgatggcagcatcgatgttcgtcgtctgaaacgcacgctgaccaaggaacagaaaggcctcgaaaaccgcggttggaatgcgctgtttctggaaaaccacgatctcccgcgcagcgtgagtacgtggggcaatgaccgtgattactgggccgaaagcgcgaaagcgctcggtgcgctctatttcttcatgcaaggcaccccgtttatctaccaaggccaagagatcggcatgaccaatgttcgctttgacgacatccgcgactaccgcgatgttagcgccctccgcctctacgaactggaacgtgccaagggccgcacgcatgaagaggccatgaccatcatctggaaaacgggtcgcgacaacagtcgcacgccgatgcagtggagcggtgccagtaatgccggcttcacgaccggcaccccatggattaaggttaatgaaaactaccgcaccatcaatgtggaagcggaacgtcgcgacccgaacagcgtgtggagcttttatcgccagatgatccagctccgtaaagcgaacgagctgtttgtttacggcacgtacgatctgctgctggagaaccatccgagcatttacgcctatacccgtacgctgggtcgtgatcgtgcgctggtggttgttaatctcagcgaccgcccaagtctgtaccgctatgacggcttccgtctgcagagcagtgatctggcgctgagtaattacccagtgcgcccgcacaagaatgccacgcgcttcaaactcaagccgtacgaggcccgcgtgtacatctggaaggagtaa

SEQ ID NO.8

Nucleotide sequence encoding alpha-glucosidase mutant S204L/A307E

aaaaaaacgtggtggaaagaaggcgtggcgtatcagatctacccgcgtagctttatggacgccaatggcgacggcatcggcgatctgcgtggcatcatcgagaagctcgactatctggttgaactgggcgtggacatcgtttggatctgtccgatctatcgcagtccgaatgccgataacggctacgatatcagcgactactacgccatcatggacgagttcggcaccatggatgacttcgatgagctgctggcgcaagcccatcgtcgtggtctcaaggtgatcctcgatctggtgatcaatcacaccagcgatgaacacccgtggtttatcgaaagtcgcagcagtcgcgacaacccgaagcgcgattggtacatttggcgtgacggcaaagacggccgcgaaccgaacaactgggaaagcattttcggtggcagcgcgtggcagtacgatgaacgcacgggccagtactatctgcacattttcgacgtgaagcagccagatctgaactgggagaatagcgaagtgcgccaagcgctgtacgaaatggtgaactggtggctcgacaagggtatcgatggcttccgcatcgacgccatcagccatatcctgaagaagccgggtctgccggatctgccaaatccgaaaggtctgaaatacgtgccgagctttgccggccacatgaatcagccgggcatcatggaatatctgcgcgagctgaaagagcagaccttcgcccgctatgatatcatgaccgtgggcgaagcgaacggtgtgaccgttgacgaagccgaacagtgggtgggcgaggaaaacggtgtgttcaatatgatcttccaatttgagcatctgggtctctgggaacgtcgcgccgatggcagcatcgatgttcgtcgtctgaaacgcacgctgaccaaggaacagaaaggcctcgaaaaccgcggttggaatgcgctgtttctggaaaaccacgatctcccgcgcagcgtgagtacgtggggcaatgaccgtgattactgggccgaaagcgcgaaagcgctcggtgcgctctatttcttcatgcaaggcaccccgtttatctaccaaggccaagagatcggcatgaccaatgttcgctttgacgacatccgcgactaccgcgatgttagcgccctccgcctctacgaactggaacgtgccaagggccgcacgcatgaagaggccatgaccatcatctggaaaacgggtcgcgacaacagtcgcacgccgatgcagtggagcggtgccagtaatgccggcttcacgaccggcaccccatggattaaggttaatgaaaactaccgcaccatcaatgtggaagcggaacgtcgcgacccgaacagcgtgtggagcttttatcgccagatgatccagctccgtaaagcgaacgagctgtttgtttacggcacgtacgatctgctgctggagaaccatccgagcatttacgcctatacccgtacgctgggtcgtgatcgtgcgctggtggttgttaatctcagcgaccgcccaagtctgtaccgctatgacggcttccgtctgcagagcagtgatctggcgctgagtaattacccagtgcgcccgcacaagaatgccacgcgcttcaaactcaagccgtacgaggcccgcgtgtacatctggaaggagtaa

Sequence listing

<110> Shandong Hengren industry and trade Co., ltd

<120> an alpha-glucosidase mutant and use thereof

<140> 2022100609531

<141> 2022-01-19

<160> 8

<170> SIPOSequenceListing 1.0

<210> 1

<211> 554

<212> PRT

<213> Artificial sequence (Artificial Sequence)

<400> 1

Lys Lys Thr Trp Trp Lys Glu Gly Val Ala Tyr Gln Ile Tyr Pro Arg

1 5 10 15

Ser Phe Met Asp Ala Asn Gly Asp Gly Ile Gly Asp Leu Arg Gly Ile

20 25 30

Ile Glu Lys Leu Asp Tyr Leu Val Glu Leu Gly Val Asp Ile Val Trp

35 40 45

Ile Cys Pro Ile Tyr Arg Ser Pro Asn Ala Asp Asn Gly Tyr Asp Ile

50 55 60

Ser Asp Tyr Tyr Ala Ile Met Asp Glu Phe Gly Thr Met Asp Asp Phe

65 70 75 80

Asp Glu Leu Leu Ala Gln Ala His Arg Arg Gly Leu Lys Val Ile Leu

85 90 95

Asp Leu Val Ile Asn His Thr Ser Asp Glu His Pro Trp Phe Ile Glu

100 105 110

Ser Arg Ser Ser Arg Asp Asn Pro Lys Arg Asp Trp Tyr Ile Trp Arg

115 120 125

Asp Gly Lys Asp Gly Arg Glu Pro Asn Asn Trp Glu Ser Ile Phe Gly

130 135 140

Gly Ser Ala Trp Gln Tyr Asp Glu Arg Thr Gly Gln Tyr Tyr Leu His

145 150 155 160

Ile Phe Asp Val Lys Gln Pro Asp Leu Asn Trp Glu Asn Ser Glu Val

165 170 175

Arg Gln Ala Leu Tyr Glu Met Val Asn Trp Trp Leu Asp Lys Gly Ile

180 185 190

Asp Gly Phe Arg Ile Asp Ala Ile Ser His Ile Ser Lys Lys Pro Gly

195 200 205

Leu Pro Asp Leu Pro Asn Pro Lys Gly Leu Lys Tyr Val Pro Ser Phe

210 215 220

Ala Gly His Met Asn Gln Pro Gly Ile Met Glu Tyr Leu Arg Glu Leu

225 230 235 240

Lys Glu Gln Thr Phe Ala Arg Tyr Asp Ile Met Thr Val Gly Glu Ala

245 250 255

Asn Gly Val Thr Val Asp Glu Ala Glu Gln Trp Val Gly Glu Glu Asn

260 265 270

Gly Val Phe Asn Met Ile Phe Gln Phe Glu His Leu Gly Leu Trp Glu

275 280 285

Arg Arg Ala Asp Gly Ser Ile Asp Val Arg Arg Leu Lys Arg Thr Leu

290 295 300

Thr Lys Ala Gln Lys Gly Leu Glu Asn Arg Gly Trp Asn Ala Leu Phe

305 310 315 320

Leu Glu Asn His Asp Leu Pro Arg Ser Val Ser Thr Trp Gly Asn Asp

325 330 335

Arg Asp Tyr Trp Ala Glu Ser Ala Lys Ala Leu Gly Ala Leu Tyr Phe

340 345 350

Phe Met Gln Gly Thr Pro Phe Ile Tyr Gln Gly Gln Glu Ile Gly Met

355 360 365

Thr Asn Val Arg Phe Asp Asp Ile Arg Asp Tyr Arg Asp Val Ser Ala

370 375 380

Leu Arg Leu Tyr Glu Leu Glu Arg Ala Lys Gly Arg Thr His Glu Glu

385 390 395 400

Ala Met Thr Ile Ile Trp Lys Thr Gly Arg Asp Asn Ser Arg Thr Pro

405 410 415

Met Gln Trp Ser Gly Ala Ser Asn Ala Gly Phe Thr Thr Gly Thr Pro

420 425 430

Trp Ile Lys Val Asn Glu Asn Tyr Arg Thr Ile Asn Val Glu Ala Glu

435 440 445

Arg Arg Asp Pro Asn Ser Val Trp Ser Phe Tyr Arg Gln Met Ile Gln

450 455 460

Leu Arg Lys Ala Asn Glu Leu Phe Val Tyr Gly Thr Tyr Asp Leu Leu

465 470 475 480

Leu Glu Asn His Pro Ser Ile Tyr Ala Tyr Thr Arg Thr Leu Gly Arg

485 490 495

Asp Arg Ala Leu Val Val Val Asn Leu Ser Asp Arg Pro Ser Leu Tyr

500 505 510

Arg Tyr Asp Gly Phe Arg Leu Gln Ser Ser Asp Leu Ala Leu Ser Asn

515 520 525

Tyr Pro Val Arg Pro His Lys Asn Ala Thr Arg Phe Lys Leu Lys Pro

530 535 540

Tyr Glu Ala Arg Val Tyr Ile Trp Lys Glu

545 550

<210> 2

<211> 1665

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 2

aaaaaaacgt ggtggaaaga aggcgtggcg tatcagatct acccgcgtag ctttatggac 60

gccaatggcg acggcatcgg cgatctgcgt ggcatcatcg agaagctcga ctatctggtt 120

gaactgggcg tggacatcgt ttggatctgt ccgatctatc gcagtccgaa tgccgataac 180

ggctacgata tcagcgacta ctacgccatc atggacgagt tcggcaccat ggatgacttc 240

gatgagctgc tggcgcaagc ccatcgtcgt ggtctcaagg tgatcctcga tctggtgatc 300

aatcacacca gcgatgaaca cccgtggttt atcgaaagtc gcagcagtcg cgacaacccg 360

aagcgcgatt ggtacatttg gcgtgacggc aaagacggcc gcgaaccgaa caactgggaa 420

agcattttcg gtggcagcgc gtggcagtac gatgaacgca cgggccagta ctatctgcac 480

attttcgacg tgaagcagcc agatctgaac tgggagaata gcgaagtgcg ccaagcgctg 540

tacgaaatgg tgaactggtg gctcgacaag ggtatcgatg gcttccgcat cgacgccatc 600

agccatatca gcaagaagcc gggtctgccg gatctgccaa atccgaaagg tctgaaatac 660

gtgccgagct ttgccggcca catgaatcag ccgggcatca tggaatatct gcgcgagctg 720

aaagagcaga ccttcgcccg ctatgatatc atgaccgtgg gcgaagcgaa cggtgtgacc 780

gttgacgaag ccgaacagtg ggtgggcgag gaaaacggtg tgttcaatat gatcttccaa 840

tttgagcatc tgggtctctg ggaacgtcgc gccgatggca gcatcgatgt tcgtcgtctg 900

aaacgcacgc tgaccaaggc gcagaaaggc ctcgaaaacc gcggttggaa tgcgctgttt 960

ctggaaaacc acgatctccc gcgcagcgtg agtacgtggg gcaatgaccg tgattactgg 1020

gccgaaagcg cgaaagcgct cggtgcgctc tatttcttca tgcaaggcac cccgtttatc 1080

taccaaggcc aagagatcgg catgaccaat gttcgctttg acgacatccg cgactaccgc 1140

gatgttagcg ccctccgcct ctacgaactg gaacgtgcca agggccgcac gcatgaagag 1200

gccatgacca tcatctggaa aacgggtcgc gacaacagtc gcacgccgat gcagtggagc 1260

ggtgccagta atgccggctt cacgaccggc accccatgga ttaaggttaa tgaaaactac 1320

cgcaccatca atgtggaagc ggaacgtcgc gacccgaaca gcgtgtggag cttttatcgc 1380

cagatgatcc agctccgtaa agcgaacgag ctgtttgttt acggcacgta cgatctgctg 1440

ctggagaacc atccgagcat ttacgcctat acccgtacgc tgggtcgtga tcgtgcgctg 1500

gtggttgtta atctcagcga ccgcccaagt ctgtaccgct atgacggctt ccgtctgcag 1560

agcagtgatc tggcgctgag taattaccca gtgcgcccgc acaagaatgc cacgcgcttc 1620

aaactcaagc cgtacgaggc ccgcgtgtac atctggaagg agtaa 1665

<210> 3

<211> 554

<212> PRT

<213> Artificial sequence (Artificial Sequence)

<400> 3

Lys Lys Thr Trp Trp Lys Glu Gly Val Ala Tyr Gln Ile Tyr Pro Arg

1 5 10 15

Ser Phe Met Asp Ala Asn Gly Asp Gly Ile Gly Asp Leu Arg Gly Ile

20 25 30

Ile Glu Lys Leu Asp Tyr Leu Val Glu Leu Gly Val Asp Ile Val Trp

35 40 45

Ile Cys Pro Ile Tyr Arg Ser Pro Asn Ala Asp Asn Gly Tyr Asp Ile

50 55 60

Ser Asp Tyr Tyr Ala Ile Met Asp Glu Phe Gly Thr Met Asp Asp Phe

65 70 75 80

Asp Glu Leu Leu Ala Gln Ala His Arg Arg Gly Leu Lys Val Ile Leu

85 90 95

Asp Leu Val Ile Asn His Thr Ser Asp Glu His Pro Trp Phe Ile Glu

100 105 110

Ser Arg Ser Ser Arg Asp Asn Pro Lys Arg Asp Trp Tyr Ile Trp Arg

115 120 125

Asp Gly Lys Asp Gly Arg Glu Pro Asn Asn Trp Glu Ser Ile Phe Gly

130 135 140

Gly Ser Ala Trp Gln Tyr Asp Glu Arg Thr Gly Gln Tyr Tyr Leu His

145 150 155 160

Ile Phe Asp Val Lys Gln Pro Asp Leu Asn Trp Glu Asn Ser Glu Val

165 170 175

Arg Gln Ala Leu Tyr Glu Met Val Asn Trp Trp Leu Asp Lys Gly Ile

180 185 190

Asp Gly Phe Arg Ile Asp Ala Ile Ser His Ile Leu Lys Lys Pro Gly

195 200 205

Leu Pro Asp Leu Pro Asn Pro Lys Gly Leu Lys Tyr Val Pro Ser Phe

210 215 220

Ala Gly His Met Asn Gln Pro Gly Ile Met Glu Tyr Leu Arg Glu Leu

225 230 235 240

Lys Glu Gln Thr Phe Ala Arg Tyr Asp Ile Met Thr Val Gly Glu Ala

245 250 255

Asn Gly Val Thr Val Asp Glu Ala Glu Gln Trp Val Gly Glu Glu Asn

260 265 270

Gly Val Phe Asn Met Ile Phe Gln Phe Glu His Leu Gly Leu Trp Glu

275 280 285

Arg Arg Ala Asp Gly Ser Ile Asp Val Arg Arg Leu Lys Arg Thr Leu

290 295 300

Thr Lys Trp Gln Lys Gly Leu Glu Asn Arg Gly Trp Asn Ala Leu Phe

305 310 315 320

Leu Glu Asn His Asp Leu Pro Arg Ser Val Ser Thr Trp Gly Asn Asp

325 330 335

Arg Asp Tyr Trp Ala Glu Ser Ala Lys Ala Leu Gly Ala Leu Tyr Phe

340 345 350

Phe Met Gln Gly Thr Pro Phe Ile Tyr Gln Gly Gln Glu Ile Gly Met

355 360 365

Thr Asn Val Arg Phe Asp Asp Ile Arg Asp Tyr Arg Asp Val Ser Ala

370 375 380

Leu Arg Leu Tyr Glu Leu Glu Arg Ala Lys Gly Arg Thr His Glu Glu

385 390 395 400

Ala Met Thr Ile Ile Trp Lys Thr Gly Arg Asp Asn Ser Arg Thr Pro

405 410 415

Met Gln Trp Ser Gly Ala Ser Asn Ala Gly Phe Thr Thr Gly Thr Pro

420 425 430

Trp Ile Lys Val Asn Glu Asn Tyr Arg Thr Ile Asn Val Glu Ala Glu

435 440 445

Arg Arg Asp Pro Asn Ser Val Trp Ser Phe Tyr Arg Gln Met Ile Gln

450 455 460

Leu Arg Lys Ala Asn Glu Leu Phe Val Tyr Gly Thr Tyr Asp Leu Leu

465 470 475 480

Leu Glu Asn His Pro Ser Ile Tyr Ala Tyr Thr Arg Thr Leu Gly Arg

485 490 495

Asp Arg Ala Leu Val Val Val Asn Leu Ser Asp Arg Pro Ser Leu Tyr

500 505 510

Arg Tyr Asp Gly Phe Arg Leu Gln Ser Ser Asp Leu Ala Leu Ser Asn

515 520 525

Tyr Pro Val Arg Pro His Lys Asn Ala Thr Arg Phe Lys Leu Lys Pro

530 535 540

Tyr Glu Ala Arg Val Tyr Ile Trp Lys Glu

545 550

<210> 4

<211> 554

<212> PRT

<213> Artificial sequence (Artificial Sequence)

<400> 4

Lys Lys Thr Trp Trp Lys Glu Gly Val Ala Tyr Gln Ile Tyr Pro Arg

1 5 10 15

Ser Phe Met Asp Ala Asn Gly Asp Gly Ile Gly Asp Leu Arg Gly Ile

20 25 30

Ile Glu Lys Leu Asp Tyr Leu Val Glu Leu Gly Val Asp Ile Val Trp

35 40 45

Ile Cys Pro Ile Tyr Arg Ser Pro Asn Ala Asp Asn Gly Tyr Asp Ile

50 55 60

Ser Asp Tyr Tyr Ala Ile Met Asp Glu Phe Gly Thr Met Asp Asp Phe

65 70 75 80

Asp Glu Leu Leu Ala Gln Ala His Arg Arg Gly Leu Lys Val Ile Leu

85 90 95

Asp Leu Val Ile Asn His Thr Ser Asp Glu His Pro Trp Phe Ile Glu

100 105 110

Ser Arg Ser Ser Arg Asp Asn Pro Lys Arg Asp Trp Tyr Ile Trp Arg

115 120 125

Asp Gly Lys Asp Gly Arg Glu Pro Asn Asn Trp Glu Ser Ile Phe Gly

130 135 140

Gly Ser Ala Trp Gln Tyr Asp Glu Arg Thr Gly Gln Tyr Tyr Leu His

145 150 155 160

Ile Phe Asp Val Lys Gln Pro Asp Leu Asn Trp Glu Asn Ser Glu Val

165 170 175

Arg Gln Ala Leu Tyr Glu Met Val Asn Trp Trp Leu Asp Lys Gly Ile

180 185 190

Asp Gly Phe Arg Ile Asp Ala Ile Ser His Ile Ser Lys Lys Pro Gly

195 200 205

Leu Pro Asp Leu Pro Asn Pro Lys Gly Leu Lys Tyr Val Pro Ser Phe

210 215 220

Ala Gly His Met Asn Gln Pro Gly Ile Met Glu Tyr Leu Arg Glu Leu

225 230 235 240

Lys Glu Gln Thr Phe Ala Arg Tyr Asp Ile Met Thr Val Gly Glu Ala

245 250 255

Asn Gly Val Thr Val Asp Glu Ala Glu Gln Trp Val Gly Glu Glu Asn

260 265 270

Gly Val Phe Asn Met Ile Phe Gln Phe Glu His Leu Gly Leu Trp Glu

275 280 285

Arg Arg Ala Asp Gly Ser Ile Asp Val Arg Arg Leu Lys Arg Thr Leu

290 295 300

Thr Lys Glu Gln Lys Gly Leu Glu Asn Arg Gly Trp Asn Ala Leu Phe

305 310 315 320

Leu Glu Asn His Asp Leu Pro Arg Ser Val Ser Thr Trp Gly Asn Asp

325 330 335

Arg Asp Tyr Trp Ala Glu Ser Ala Lys Ala Leu Gly Ala Leu Tyr Phe

340 345 350

Phe Met Gln Gly Thr Pro Phe Ile Tyr Gln Gly Gln Glu Ile Gly Met

355 360 365

Thr Asn Val Arg Phe Asp Asp Ile Arg Asp Tyr Arg Asp Val Ser Ala

370 375 380

Leu Arg Leu Tyr Glu Leu Glu Arg Ala Lys Gly Arg Thr His Glu Glu

385 390 395 400

Ala Met Thr Ile Ile Trp Lys Thr Gly Arg Asp Asn Ser Arg Thr Pro

405 410 415

Met Gln Trp Ser Gly Ala Ser Asn Ala Gly Phe Thr Thr Gly Thr Pro

420 425 430

Trp Ile Lys Val Asn Glu Asn Tyr Arg Thr Ile Asn Val Glu Ala Glu

435 440 445

Arg Arg Asp Pro Asn Ser Val Trp Ser Phe Tyr Arg Gln Met Ile Gln

450 455 460

Leu Arg Lys Ala Asn Glu Leu Phe Val Tyr Gly Thr Tyr Asp Leu Leu

465 470 475 480

Leu Glu Asn His Pro Ser Ile Tyr Ala Tyr Thr Arg Thr Leu Gly Arg

485 490 495

Asp Arg Ala Leu Val Val Val Asn Leu Ser Asp Arg Pro Ser Leu Tyr

500 505 510

Arg Tyr Asp Gly Phe Arg Leu Gln Ser Ser Asp Leu Ala Leu Ser Asn

515 520 525

Tyr Pro Val Arg Pro His Lys Asn Ala Thr Arg Phe Lys Leu Lys Pro

530 535 540

Tyr Glu Ala Arg Val Tyr Ile Trp Lys Glu

545 550

<210> 5

<211> 554

<212> PRT

<213> Artificial sequence (Artificial Sequence)

<400> 5

Lys Lys Thr Trp Trp Lys Glu Gly Val Ala Tyr Gln Ile Tyr Pro Arg

1 5 10 15

Ser Phe Met Asp Ala Asn Gly Asp Gly Ile Gly Asp Leu Arg Gly Ile

20 25 30

Ile Glu Lys Leu Asp Tyr Leu Val Glu Leu Gly Val Asp Ile Val Trp

35 40 45

Ile Cys Pro Ile Tyr Arg Ser Pro Asn Ala Asp Asn Gly Tyr Asp Ile

50 55 60

Ser Asp Tyr Tyr Ala Ile Met Asp Glu Phe Gly Thr Met Asp Asp Phe

65 70 75 80

Asp Glu Leu Leu Ala Gln Ala His Arg Arg Gly Leu Lys Val Ile Leu

85 90 95

Asp Leu Val Ile Asn His Thr Ser Asp Glu His Pro Trp Phe Ile Glu

100 105 110

Ser Arg Ser Ser Arg Asp Asn Pro Lys Arg Asp Trp Tyr Ile Trp Arg

115 120 125

Asp Gly Lys Asp Gly Arg Glu Pro Asn Asn Trp Glu Ser Ile Phe Gly

130 135 140

Gly Ser Ala Trp Gln Tyr Asp Glu Arg Thr Gly Gln Tyr Tyr Leu His

145 150 155 160

Ile Phe Asp Val Lys Gln Pro Asp Leu Asn Trp Glu Asn Ser Glu Val

165 170 175

Arg Gln Ala Leu Tyr Glu Met Val Asn Trp Trp Leu Asp Lys Gly Ile

180 185 190

Asp Gly Phe Arg Ile Asp Ala Ile Ser His Ile Leu Lys Lys Pro Gly

195 200 205

Leu Pro Asp Leu Pro Asn Pro Lys Gly Leu Lys Tyr Val Pro Ser Phe

210 215 220

Ala Gly His Met Asn Gln Pro Gly Ile Met Glu Tyr Leu Arg Glu Leu

225 230 235 240

Lys Glu Gln Thr Phe Ala Arg Tyr Asp Ile Met Thr Val Gly Glu Ala

245 250 255

Asn Gly Val Thr Val Asp Glu Ala Glu Gln Trp Val Gly Glu Glu Asn

260 265 270

Gly Val Phe Asn Met Ile Phe Gln Phe Glu His Leu Gly Leu Trp Glu

275 280 285

Arg Arg Ala Asp Gly Ser Ile Asp Val Arg Arg Leu Lys Arg Thr Leu

290 295 300

Thr Lys Glu Gln Lys Gly Leu Glu Asn Arg Gly Trp Asn Ala Leu Phe

305 310 315 320

Leu Glu Asn His Asp Leu Pro Arg Ser Val Ser Thr Trp Gly Asn Asp

325 330 335

Arg Asp Tyr Trp Ala Glu Ser Ala Lys Ala Leu Gly Ala Leu Tyr Phe

340 345 350

Phe Met Gln Gly Thr Pro Phe Ile Tyr Gln Gly Gln Glu Ile Gly Met

355 360 365

Thr Asn Val Arg Phe Asp Asp Ile Arg Asp Tyr Arg Asp Val Ser Ala

370 375 380

Leu Arg Leu Tyr Glu Leu Glu Arg Ala Lys Gly Arg Thr His Glu Glu

385 390 395 400

Ala Met Thr Ile Ile Trp Lys Thr Gly Arg Asp Asn Ser Arg Thr Pro

405 410 415

Met Gln Trp Ser Gly Ala Ser Asn Ala Gly Phe Thr Thr Gly Thr Pro

420 425 430

Trp Ile Lys Val Asn Glu Asn Tyr Arg Thr Ile Asn Val Glu Ala Glu

435 440 445

Arg Arg Asp Pro Asn Ser Val Trp Ser Phe Tyr Arg Gln Met Ile Gln

450 455 460

Leu Arg Lys Ala Asn Glu Leu Phe Val Tyr Gly Thr Tyr Asp Leu Leu

465 470 475 480

Leu Glu Asn His Pro Ser Ile Tyr Ala Tyr Thr Arg Thr Leu Gly Arg

485 490 495

Asp Arg Ala Leu Val Val Val Asn Leu Ser Asp Arg Pro Ser Leu Tyr

500 505 510

Arg Tyr Asp Gly Phe Arg Leu Gln Ser Ser Asp Leu Ala Leu Ser Asn

515 520 525

Tyr Pro Val Arg Pro His Lys Asn Ala Thr Arg Phe Lys Leu Lys Pro

530 535 540

Tyr Glu Ala Arg Val Tyr Ile Trp Lys Glu

545 550

<210> 6

<211> 1665

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 6

aaaaaaacgt ggtggaaaga aggcgtggcg tatcagatct acccgcgtag ctttatggac 60

gccaatggcg acggcatcgg cgatctgcgt ggcatcatcg agaagctcga ctatctggtt 120

gaactgggcg tggacatcgt ttggatctgt ccgatctatc gcagtccgaa tgccgataac 180

ggctacgata tcagcgacta ctacgccatc atggacgagt tcggcaccat ggatgacttc 240

gatgagctgc tggcgcaagc ccatcgtcgt ggtctcaagg tgatcctcga tctggtgatc 300

aatcacacca gcgatgaaca cccgtggttt atcgaaagtc gcagcagtcg cgacaacccg 360

aagcgcgatt ggtacatttg gcgtgacggc aaagacggcc gcgaaccgaa caactgggaa 420

agcattttcg gtggcagcgc gtggcagtac gatgaacgca cgggccagta ctatctgcac 480

attttcgacg tgaagcagcc agatctgaac tgggagaata gcgaagtgcg ccaagcgctg 540

tacgaaatgg tgaactggtg gctcgacaag ggtatcgatg gcttccgcat cgacgccatc 600

agccatatcc tgaagaagcc gggtctgccg gatctgccaa atccgaaagg tctgaaatac 660

gtgccgagct ttgccggcca catgaatcag ccgggcatca tggaatatct gcgcgagctg 720

aaagagcaga ccttcgcccg ctatgatatc atgaccgtgg gcgaagcgaa cggtgtgacc 780

gttgacgaag ccgaacagtg ggtgggcgag gaaaacggtg tgttcaatat gatcttccaa 840

tttgagcatc tgggtctctg ggaacgtcgc gccgatggca gcatcgatgt tcgtcgtctg 900

aaacgcacgc tgaccaaggc gcagaaaggc ctcgaaaacc gcggttggaa tgcgctgttt 960

ctggaaaacc acgatctccc gcgcagcgtg agtacgtggg gcaatgaccg tgattactgg 1020

gccgaaagcg cgaaagcgct cggtgcgctc tatttcttca tgcaaggcac cccgtttatc 1080

taccaaggcc aagagatcgg catgaccaat gttcgctttg acgacatccg cgactaccgc 1140

gatgttagcg ccctccgcct ctacgaactg gaacgtgcca agggccgcac gcatgaagag 1200

gccatgacca tcatctggaa aacgggtcgc gacaacagtc gcacgccgat gcagtggagc 1260

ggtgccagta atgccggctt cacgaccggc accccatgga ttaaggttaa tgaaaactac 1320

cgcaccatca atgtggaagc ggaacgtcgc gacccgaaca gcgtgtggag cttttatcgc 1380

cagatgatcc agctccgtaa agcgaacgag ctgtttgttt acggcacgta cgatctgctg 1440

ctggagaacc atccgagcat ttacgcctat acccgtacgc tgggtcgtga tcgtgcgctg 1500

gtggttgtta atctcagcga ccgcccaagt ctgtaccgct atgacggctt ccgtctgcag 1560

agcagtgatc tggcgctgag taattaccca gtgcgcccgc acaagaatgc cacgcgcttc 1620

aaactcaagc cgtacgaggc ccgcgtgtac atctggaagg agtaa 1665

<210> 7

<211> 1665

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 7

aaaaaaacgt ggtggaaaga aggcgtggcg tatcagatct acccgcgtag ctttatggac 60

gccaatggcg acggcatcgg cgatctgcgt ggcatcatcg agaagctcga ctatctggtt 120

gaactgggcg tggacatcgt ttggatctgt ccgatctatc gcagtccgaa tgccgataac 180

ggctacgata tcagcgacta ctacgccatc atggacgagt tcggcaccat ggatgacttc 240

gatgagctgc tggcgcaagc ccatcgtcgt ggtctcaagg tgatcctcga tctggtgatc 300

aatcacacca gcgatgaaca cccgtggttt atcgaaagtc gcagcagtcg cgacaacccg 360

aagcgcgatt ggtacatttg gcgtgacggc aaagacggcc gcgaaccgaa caactgggaa 420

agcattttcg gtggcagcgc gtggcagtac gatgaacgca cgggccagta ctatctgcac 480

attttcgacg tgaagcagcc agatctgaac tgggagaata gcgaagtgcg ccaagcgctg 540

tacgaaatgg tgaactggtg gctcgacaag ggtatcgatg gcttccgcat cgacgccatc 600

agccatatca gcaagaagcc gggtctgccg gatctgccaa atccgaaagg tctgaaatac 660

gtgccgagct ttgccggcca catgaatcag ccgggcatca tggaatatct gcgcgagctg 720

aaagagcaga ccttcgcccg ctatgatatc atgaccgtgg gcgaagcgaa cggtgtgacc 780

gttgacgaag ccgaacagtg ggtgggcgag gaaaacggtg tgttcaatat gatcttccaa 840

tttgagcatc tgggtctctg ggaacgtcgc gccgatggca gcatcgatgt tcgtcgtctg 900

aaacgcacgc tgaccaagga acagaaaggc ctcgaaaacc gcggttggaa tgcgctgttt 960

ctggaaaacc acgatctccc gcgcagcgtg agtacgtggg gcaatgaccg tgattactgg 1020

gccgaaagcg cgaaagcgct cggtgcgctc tatttcttca tgcaaggcac cccgtttatc 1080

taccaaggcc aagagatcgg catgaccaat gttcgctttg acgacatccg cgactaccgc 1140

gatgttagcg ccctccgcct ctacgaactg gaacgtgcca agggccgcac gcatgaagag 1200

gccatgacca tcatctggaa aacgggtcgc gacaacagtc gcacgccgat gcagtggagc 1260

ggtgccagta atgccggctt cacgaccggc accccatgga ttaaggttaa tgaaaactac 1320

cgcaccatca atgtggaagc ggaacgtcgc gacccgaaca gcgtgtggag cttttatcgc 1380

cagatgatcc agctccgtaa agcgaacgag ctgtttgttt acggcacgta cgatctgctg 1440

ctggagaacc atccgagcat ttacgcctat acccgtacgc tgggtcgtga tcgtgcgctg 1500

gtggttgtta atctcagcga ccgcccaagt ctgtaccgct atgacggctt ccgtctgcag 1560

agcagtgatc tggcgctgag taattaccca gtgcgcccgc acaagaatgc cacgcgcttc 1620

aaactcaagc cgtacgaggc ccgcgtgtac atctggaagg agtaa 1665

<210> 8

<211> 1665

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 8

aaaaaaacgt ggtggaaaga aggcgtggcg tatcagatct acccgcgtag ctttatggac 60

gccaatggcg acggcatcgg cgatctgcgt ggcatcatcg agaagctcga ctatctggtt 120

gaactgggcg tggacatcgt ttggatctgt ccgatctatc gcagtccgaa tgccgataac 180

ggctacgata tcagcgacta ctacgccatc atggacgagt tcggcaccat ggatgacttc 240

gatgagctgc tggcgcaagc ccatcgtcgt ggtctcaagg tgatcctcga tctggtgatc 300

aatcacacca gcgatgaaca cccgtggttt atcgaaagtc gcagcagtcg cgacaacccg 360

aagcgcgatt ggtacatttg gcgtgacggc aaagacggcc gcgaaccgaa caactgggaa 420

agcattttcg gtggcagcgc gtggcagtac gatgaacgca cgggccagta ctatctgcac 480

attttcgacg tgaagcagcc agatctgaac tgggagaata gcgaagtgcg ccaagcgctg 540

tacgaaatgg tgaactggtg gctcgacaag ggtatcgatg gcttccgcat cgacgccatc 600

agccatatcc tgaagaagcc gggtctgccg gatctgccaa atccgaaagg tctgaaatac 660

gtgccgagct ttgccggcca catgaatcag ccgggcatca tggaatatct gcgcgagctg 720

aaagagcaga ccttcgcccg ctatgatatc atgaccgtgg gcgaagcgaa cggtgtgacc 780

gttgacgaag ccgaacagtg ggtgggcgag gaaaacggtg tgttcaatat gatcttccaa 840

tttgagcatc tgggtctctg ggaacgtcgc gccgatggca gcatcgatgt tcgtcgtctg 900

aaacgcacgc tgaccaagga acagaaaggc ctcgaaaacc gcggttggaa tgcgctgttt 960

ctggaaaacc acgatctccc gcgcagcgtg agtacgtggg gcaatgaccg tgattactgg 1020

gccgaaagcg cgaaagcgct cggtgcgctc tatttcttca tgcaaggcac cccgtttatc 1080

taccaaggcc aagagatcgg catgaccaat gttcgctttg acgacatccg cgactaccgc 1140

gatgttagcg ccctccgcct ctacgaactg gaacgtgcca agggccgcac gcatgaagag 1200

gccatgacca tcatctggaa aacgggtcgc gacaacagtc gcacgccgat gcagtggagc 1260

ggtgccagta atgccggctt cacgaccggc accccatgga ttaaggttaa tgaaaactac 1320

cgcaccatca atgtggaagc ggaacgtcgc gacccgaaca gcgtgtggag cttttatcgc 1380

cagatgatcc agctccgtaa agcgaacgag ctgtttgttt acggcacgta cgatctgctg 1440

ctggagaacc atccgagcat ttacgcctat acccgtacgc tgggtcgtga tcgtgcgctg 1500

gtggttgtta atctcagcga ccgcccaagt ctgtaccgct atgacggctt ccgtctgcag 1560

agcagtgatc tggcgctgag taattaccca gtgcgcccgc acaagaatgc cacgcgcttc 1620

aaactcaagc cgtacgaggc ccgcgtgtac atctggaagg agtaa 1665

Claims (8)

1. The alpha-glucosidase mutant is characterized in that the amino acid sequence of the alpha-glucosidase mutant is shown as SEQ ID NO.3, SEQ ID NO.4 or SEQ ID NO. 5.

2. Use of the α -glucosidase mutant of claim 1 for producing isomaltooligosaccharides.

3. A gene encoding the α -glucosidase mutant of claim 1, wherein the nucleotide sequence of the encoding gene is shown in SEQ ID No.6, SEQ ID No.7 or SEQ ID No. 8.

4. A recombinant expression vector carrying the gene of claim 3.

5. The recombinant expression vector of claim 4, wherein the recombinant expression vector has a pET-28a (+) vector as the original expression vector.

6. A genetically engineered bacterium transformed with the recombinant expression vector of claim 3 or 4.

7. The genetically engineered bacterium of claim 6, wherein the genetically engineered bacterium hosts escherichia coli.

8. The genetically engineered bacterium of claim 7, wherein the escherichia coli comprises BL21 (DE 3).

Images