CN114088783B

CN114088783B - Biosensor, preparation method and application thereof, and electrochemical system for detecting ctDNA

Info

Publication number: CN114088783B
Application number: CN202111414807.6A
Authority: CN
Inventors: 赵卉; 李灿鹏; 张亚平; 刘凤
Original assignee: Yunnan University YNU
Current assignee: Yunnan University YNU
Priority date: 2021-11-25
Filing date: 2021-11-25
Publication date: 2022-09-16
Anticipated expiration: 2041-11-25
Also published as: CN114088783A

Abstract

The invention relates to the technical field of ctDNA detection, in particular to a biosensor, a preparation method and application thereof, and an electrochemical system for detecting ctDNA. The probe comprises a substrate electrode, and an Au-CP1 probe layer, an HT layer, a CRSPR/Cas12a system layer and a CP2 probe/magnetic covalent organic framework/Pd-Au/MB layer which are sequentially loaded on the surface of the substrate electrode; the CRSPR/Cas12a system layer comprises crRNA, Cas12a, ssDNA and a sample to be detected, and the CP2 probe/magnetic covalent organic framework/Pd-Au/MB layer comprises a magnetic covalent organic framework, Pd-Au and MB loaded in a pore structure of the magnetic covalent organic framework and a CP2 probe; au in the Pd-Au is bonded with sulfydryl in the CP2 probe, and the biosensor is convenient to carry and can specifically detect ctDNA.

Description

Biosensor, preparation method and application thereof, and electrochemical system for detecting ctDNA

Technical Field

The invention relates to the technical field of ctDNA detection, in particular to a biosensor, a preparation method and application thereof, and an electrochemical system for detecting ctDNA.

Background

The lung cancer is a malignant tumor with high morbidity and mortality which is generally accepted in the world at present, so that accurate and rapid early diagnosis has extremely important significance for clinical treatment and prognosis of lung cancer patients. About 80% of lung cancers are non-small cell lung cancers (NSCLC), which are highly malignant and have a poor prognosis. Clinical studies have shown that over 60% of NSCLCs highly express Epidermal Growth Factor Receptor (EGFR), which has been considered as an important therapeutic target for the treatment of NSCLC. Most EGFR mutations occur in the tyrosine kinase domain in exons 18-21. In most cases, exon 21 mutations (EGFR L858R) account for 40% to 45% of these mutations. EGFR L858R is highly sensitive to targeted drugs, such as Tyrosine Kinase Inhibitors (TKIS) such as gefitinib or erlotinib, and these drugs have significant efficacy in the treatment of oncology patients. Therefore, detection of EGFR L858R mutation in clinical treatment is essential for NSCLC treatment and prognosis.

Currently, the main clinical means for detecting EGFR gene mutation is to sequence excised tissue after surgery, and the method is traumatic and cannot repeatedly sample, so that the method has great limitation. In view of the above problems, the liquid biopsy technique has the advantages of being minimally invasive or non-invasive, capable of dynamically monitoring the tumor change condition, capable of repeatedly sampling, and the like, and has strong potential and development prospect.

Circulating tumor DNA (ctDNA) is an important liquid biopsy tumor marker, can comprehensively reflect the genetic variation condition of tumor cells, can dynamically reflect the change of the tumor cells in the development and treatment processes in real time, and is a blood tumor marker with high sensitivity, high specificity and wide application prospect. The results of the study showed that the sensitivity and specificity of the ctDNA EGFR gene in NSCLC patients were 78% and 100%, respectively. Therefore, the EGFR L858R plays an important role in the treatment guidance, efficacy evaluation and prognosis evaluation of EGFR-TKIS, and therefore, the ctDNA EGFR L858R is a blood tumor marker with wide application prospect.

Currently, the detection methods for ctDNA EGFR of NSCLC patients are mainly divided into two main categories: one broad class is detection methods based on polymerase chain reaction PCR; another class is detection methods based on high-throughput sequencing. Although these methods are sensitive, they rely on thermocycling amplification, expensive instrumentation and professional procedures, which greatly limits the application of detection methods. Therefore, there is an urgent need to develop a new method for point-of-care testing (POCT) that is sensitive, specific, low cost.

Researches in recent years find that the CRISPR/Cas system has unique targeting property, and provides a brand new direction for developing biosensors using nucleic acid as a substrate. The CRISPR/Cas system has unique targeting, wherein the recognition target of the CRISPR/Cas12a system can be RNA or DNA; cas12a protein recognizes RNA or DNA targets when bound to the target under the direction of CRISPR RNA (crRNA), thereby activating Cas nuclease and initiating trans-cleavage activity to indiscriminately cleave nearby single-stranded non-targeted nucleic acids and remain active after 3 hours. In recent two years, nucleic acid detection systems for CRISPR/Cas mostly detect viruses or miRNA by using a fluorescence method. Fluorescence detection requires a large instrument and is not portable.

Disclosure of Invention

The invention aims to provide a biosensor, a preparation method and application thereof, and an electrochemical system for detecting ctDNA.

In order to achieve the above object, the present invention provides the following technical solutions:

the invention provides a biosensor, which comprises a substrate electrode, and an Au-CP1 probe layer, a mercaptoethanol layer (HT layer), a CRISPR/Cas12a system layer and a CP2 probe/magnetic covalent organic framework/Pd-Au/MB layer which are sequentially loaded on the surface of the substrate electrode;

the CRISPR/Cas12a system layer comprises crRNA, Cas12a, ssDNA and a sample to be detected;

the template nucleotide sequence for transcribing the crRNA is shown as SEQ ID No. 1;

the nucleotide sequence of the CP1 probe in the Au-CP1 probe layer is shown as SEQ ID No. 5; the CP1 probe is modified by sulfydryl at the 5' position of the SEQ ID No.5 sequence;

the CP2 probe/magnetic covalent organic framework/Pd-Au/MB layer comprises a magnetic covalent organic framework, Pd-Au and MB loaded in a pore structure of the magnetic covalent organic framework, and a CP2 probe bonded with Au in the Pd-Au through a gold-sulfur bond;

the nucleotide sequence of the CP2 probe is shown as SEQ ID No. 6; the CP2 probe has a sulfhydryl group modification at the 3' position of the SEQ ID No.6 sequence.

Preferably, the sample to be detected is obtained by sequentially extracting a blood sample and carrying out RPA (isothermal amplification) on the blood sample;

the primer pair for RPA isothermal amplification is RPA-F and RPA-R;

the nucleotide sequence of the RPA-F is shown as SEQ ID No. 2;

the nucleotide sequence of the RPA-R is shown in SEQ ID No. 3.

Preferably, the nucleotide sequence of the ssDNA is shown in SEQ ID No. 4.

Preferably, the magnetic covalent organic framework is Fe ₃ O ₄ @COF。

The invention also provides a preparation method of the biosensor, which comprises the following steps:

mixing the magnetic covalent organic framework, Pd-Au, water and MB, and loading to obtain magnetic covalent organic framework/Pd-Au/MB;

mixing the magnetic covalent organic framework/Pd-Au/MB, water and a CP2 probe to obtain a CP2 probe/magnetic covalent organic framework/Pd-Au/MB reaction solution;

mixing the crRNA solution and the Cas12a solution, diluting by adopting a first buffer solution, carrying out precursor recognition on the crRNA, adding a sample to be detected, carrying out recognition on a target object, finally adding a ssDNA solution, carrying out enzymatic reaction, adding protease, carrying out enzyme digestion reaction on Cas12a, and obtaining a CRISPR/Cas12a system reaction solution; the first buffer solution comprises Mg ²⁺ ；

And after gold plating is carried out on the surface of the substrate electrode, sequentially dropwise adding a CP1 probe solution, a CRISPR/Cas12a system reaction solution and a CP2 probe/magnetic covalent organic framework/Pd-Au/MB reaction solution to obtain the biosensor.

Preferably, Mg in the reaction solution of the CRISPR/Cas12a system ²⁺ The concentration of (B) is 5 to 30 mM.

Preferably, the temperature for the recognition of the crRNA precursor is 27-42 ℃;

the time for identifying the target object is 5-30 min;

the third reaction time is 10-60 min;

the volume ratio of the crRNA solution to the Cas12a solution is (8-12): (3-6);

the concentration of the crRNA solution is 1150-1250 ng/mu L, and the concentration of the Cas12a solution is 500 pmol/L.

The invention also provides application of the biosensor in the technical scheme or the biosensor prepared by the preparation method in the technical scheme in detection of ctDNA.

The invention also provides an electrochemical system for detecting ctDNA, which comprises a biosensor, a reference electrode and an auxiliary electrode;

the biosensor is the biosensor prepared by the preparation method or the biosensor prepared by the preparation method in the technical scheme.

The invention provides a biosensor, which comprises a substrate electrode, and an Au-CP1 probe layer, a mercaptoethanol layer, a CRISPR/Cas12a system layer and a CP2 probe/magnetic covalent organic framework/Pd-Au/MB layer which are sequentially loaded on the surface of the substrate electrode; the CRISPR/Cas12a system layer comprises crRNA, Cas12a, ssDNA and a sample to be detected; the nucleotide sequence of a template for transcribing the crRNA is shown as SEQ ID No. 1; the nucleotide sequence of the CP1 probe in the Au-CP1 probe layer is shown as SEQ ID No. 5; the CP1 probe is modified by sulfydryl at the 5' position of the SEQ ID No.5 sequence; the CP2 probe/magnetic covalent organic framework/Pd-Au/MB layer comprises a magnetic covalent organic framework, Pd-Au and MB loaded in a pore structure of the magnetic covalent organic framework, and a CP2 probe bonded with Au in the Pd-Au through a gold-sulfur bond; the nucleotide sequence of the CP2 probe is shown as SEQ ID No. 6; the CP2 probe has a sulfhydryl group modification at the 3' position of the SEQ ID No.6 sequence. The CRISPR/Cas12a system can accurately and specifically recognize TTTGGGCGG base sequences in ctDNA, so that the CRISPR/Cas12a system only encounters the ctDNA containing TTTGGGCGG base sequences. That is, when the target DNA (i.e., ctDNA) is absent, the trans-cleavage activity of Cas12a cannot be activated, the 5 'end of ssDNA in the CRISPR/Cas12a system is connected to the CP1 probe pair, and the 3' end is connected to the CP2 probe pair, so as to form a sufficient circulation path of electrical signals, and then a large response output of MB electrical signals can be detected; in the presence of the target DNA, Cas12a forms a ternary complex with crRNA and the target DNA, the ternary complex activates Cas12a to initiate trans-cleavage activity and cleave ssDNA, so that the cleaved ssDNA cannot form a sufficient circulation path of electrical signals with the CP1 probe and the CP2 probe, the response output of the MB electrical signals of the cleaved ssDNA is reduced, and finally, the specific detection of ctDNA is realized by observing the change of the MB electrical signals (the detection principle is shown in fig. 1).

Drawings

FIG. 1 is a schematic diagram of the preparation process and detection principle of the CP2 probe/magnetic covalent organic framework/Pd-Au/MB and biosensor according to the present invention;

fig. 2 is a schematic diagram of CRISPR/Cas12a recognition site and EGFR mutation site. TTTN is PAM sequence, GGCGGGCC is identified core area;

FIG. 3 shows Fe as described in example 1 ₃ O ₄ @ COF, Pd-Au and Fe ₃ O ₄ Scanning electron micrograph and element distribution map of @ COF/Pd-Au;

FIG. 4 shows Fe as described in example 1 ₃ O ₄ @ COF, Pd-Au and Fe ₃ O ₄ The particle size distribution diagram of @ COF/Pd-Au;

FIG. 5 shows Fe as described in example 1 ₃ O ₄ @ COF, Pd-Au and Fe ₃ O ₄ Zeta potential after preparation of working solution with @ COF/Pd-Au;

FIG. 6 shows Fe as described in example 1 ₃ O ₄ @ COF, Pd-Au and Fe ₃ O ₄ Infrared spectrum of @ COF/Pd-Au;

FIG. 7 shows Fe as described in example 1 ₃ O ₄ @ COF, Pd-Au and Fe ₃ O ₄ XRD pattern of @ COF/Pd-Au;

fig. 8 is a graph of SDS-Page gel electrophoresis visualizing the feasibility of the CRISPR/Cas12a system described in example 1;

FIG. 9 shows the GCE, Au/GCE, CP1/Au/GCE, HT/CP1/Au/GCE, ssDNA/HT/CP1/Au/GCE, and MB/Fe ₃ O ₄ An impedance EIS profile of @ COF/Pd-Au/CP2/ssDNA/HT/CP 1/Au/GCE;

FIG. 10 is a schematic diagram of the sensor feasibility of the test;

FIG. 11 shows the mutations of EGFR L858R sequence at one, two and three sites, and the specificity of the resulting mutated sequences;

FIG. 12 is a graph showing the reproducibility and stability results of the biosensor described in example 1;

FIG. 13 shows the results of reaction condition optimization of the biosensor in example 1;

FIG. 14 is a detection curve of a ctDNA solution tested for a standard concentration using the detection method described in example 1;

FIG. 15 shows the results of detection of EGFR L858R in real samples (25 samples) by the detection method described in example 1;

FIG. 16 is a drawing showing the results of example 1EGFRSanger sequencing results of samples No.9 and No.10 in the L858R actual sample.

Detailed Description

the CRISPR/Cas12a system layer comprises crRNA, Cas12a and ssDNA;

the nucleotide sequence of a template for transcribing the crRNA is shown as SEQ ID No. 1;

the CP2 probe/magnetic covalent organic framework/Pd-Au/MB layer comprises a Magnetic Covalent Organic Framework (MCOF) and Pd-Au and MB loaded in a pore structure of the magnetic covalent organic framework, and also comprises a CP2 probe bonded with Au in the Pd-Au through a gold-sulfur bond;

In the present invention, the substrate electrode is preferably a glassy carbon electrode or a gold electrode, and when the substrate electrode is a gold electrode, the Au layer in the Au-CP1 probe layer may be omitted in the biosensor.

In the invention, the Au-CP1 probe layer preferably comprises a gold layer and a CP1 probe layer which are sequentially arranged on the surface of the glassy carbon electrode; in the present invention, the gold in the gold layer is preferably bonded to the thiol group in the CP1 probe in the CP1 probe layer. The invention has no special limit on the thickness of the gold layer and the CP1 probe layer, and can ensure that the Au-CP1 probe layer completely wraps the glassy carbon electrode. The invention has no special limit on the proportioning relation between the gold in the gold layer and the CP1 probe in the CP1 probe layer, so that the gold can be fully bonded with the CP1 probe.

In the invention, the nucleotide sequence of the CP1 probe is shown as SEQ ID No. 5; the CP1 probe has a sulfhydryl group modification at the 5' position of the SEQ ID No.5 sequence. In the invention, the nucleotide sequence of the CP1 probe is SH-ACACTTGAAGTGTATTTCCTAAATA.

In the present invention, the nucleotide sequence of the CP1 probe is preferably designed based on the nucleotides of ssDNA.

In the present invention, the mercaptoethanol layer serves to block non-specific sites, and in order to avoid some active sites from binding to another probe such as CP2 or other substances when loading CP1, HT is used for blocking. Avoiding the generation of large background or interfering signals.

In the present invention, the CRISPR/Cas12a system layer includes crRNA, Cas12a and ssDNA;

the template nucleotide sequence for transcribing the crRNA is shown as SEQ ID No.1, and the template nucleotide sequence for transcribing the crRNA is specifically AAGTACCCAGCAGTTTGGCCCGCCATCTACACTTAGTAGAAATTCC TATAGTGAGTCGTATTAG. The process of designing the template nucleotide sequence for transcription of the crRNA is preferably: searching an EGFR mutation sequence (GenBank: NG-007726.3) in NCBI, and finding out an EGFR L858R mutation site; then, the requirements that the target sequence should meet when the mutation site is detected according to the CRISPR/Cas12a system (PAM sequence NTTT should be arranged in the region (6 nt) near the mutation site) are designed.

In the present invention, the nucleotide sequence of the ssDNA is preferably shown as SEQ ID No.4, and the nucleotide sequence of the ssDNA is specifically ACATAAAGGATTTATTTTTAATTTTTTAACGTTCATACAT.

In the present invention, the CRISPR/Cas12a system further preferably comprises a sample to be tested; the sample to be detected is preferably obtained by sequentially extracting a blood sample and carrying out RPA isothermal amplification; the extraction process is not particularly limited, and may be performed by a method known to those skilled in the art. In the specific embodiment of the invention, the extraction is preferably performed by using a Circulating Nucleic Acid Kit. After the extraction is finished, the method also preferably comprises the step of detecting that the 260/280 value is between 1.8 and 2.0 by using Nanodrop. In the invention, the primer pair for RPA isothermal amplification is preferably RPA-F and RPA-R; the nucleotide sequence of the RPA-F is shown as SEQ ID No. 2; the nucleotide sequence of the RPA-F is specifically GCATGAACTACTTGGAGGACCGTCGCTTGG; the nucleotide sequence of the RPA-R is shown as SEQ ID No. 3; the nucleotide sequence of the RPA-R is specifically CTCCTTCTGCATGGTATTCTTTCTCTTCCG.

In the invention, the primer pair for RPA isothermal amplification preferably takes the following TS and NTS sequences as templates for amplification, wherein the nucleotide sequence of the NTS is shown as SEQ ID No. 7; the nucleotide sequence of the NTS is specifically TGAATTCGGATGCAGAGCTTCTTCCCATGATGATCTGTCCCTCACAGCAGGGTCTTCTCTGTTTCAGGGCATGAACTACTTGGAGGACCGTCGCTTGGTGCACCGCGACCTGGCAGCCAGGAACGTACTGGTGAAAACACCGCAGCATGTCAAGATCACAGATTTTGGGCGGGCCAAACTGCTGGGTGCGGAAGAGAAAGAATACCATGCAGAAGGAGGCAAAGTAAGGAGGT. In the invention, the nucleotide sequence of the TS is shown as SEQ ID No. 8; the nucleotide sequence of the TS is specifically ACCTCCTTACTTTGCCTCCTTCTGCATGGTATTCTTTCTCTTCCGCACCCAGCAGTTTGGCCCGCCCAAAATCTGTGATCTTGACATGCTGCGGTGTTTTCACCAGTACGTTCCTGGCTGCCAGGTCGCGGTGCACCAAGCGACGGTCCTCCAAGTAGTTCATGCCCTGAAACAGAGAAGACCCTGCTGTGAGGGACAGATCATCATGGGAAGAAGCTCTGCATCCGAATTCA.

In the invention, the process of the RPA isothermal amplification is preferably operated according to the method provided by the RPA kit Twist Amp Basic.

After the RPA isothermal amplification is finished, preferably performing purification recovery, PCR amplification and sequencing verification in sequence; the purification recovery and PCR amplification process of the present invention is not particularly limited, and may be performed by a method known to those skilled in the art. In the present invention, the sequencing verification process is preferably to clone the PCR amplified sequence onto a PMD19 vector for sequencing to verify the existence of EGFR L858R mutation in the actual sample.

In the present invention, the amount ratio of crRNA, Cas12a and ssDNA is 2:1: 2.

In the invention, the nucleotide sequence of the CP2 probe/magnetic covalent organic framework/Pd-Au/MB layer CP2 probe is shown as SEQ ID No. 6; the CP2 probe has a sulfhydryl group modification at the 3' position of the SEQ ID No.6 sequence. In the invention, the sequence of the CP2 probe is specifically AATTGCAAGTATGTAGAAGTTCACA-SH. In the present invention, the nucleotide sequence of the CP2 probe is preferably designed based on the nucleotides of ssDNA. In the present invention, the CP1 probe and the CP2 probe were synthesized by Kunming Biotechnology, Inc.

In the present invention, the CP2 probe/magnetic covalent organic framework/Pd-Au/MB layer comprises a magnetic covalent organic framework and Pd-Au and MB supported in the pore structure of the magnetic covalent organic framework, and further comprises a CP2 probe; au in the Pd-Au is bonded with the sulfydryl in the CP2 probe. In the present invention, the magnetic covalent organic skeleton is preferably Fe ₃ O ₄ @COF。

In the present invention, the ratio of the amount of the magnetic covalent organic skeleton, Pd-Au, MB and CP2 probes was 0.2 mg: 0.2 mg: 0.1 mg: 0.01. mu. mol.

The source of the magnetic covalent organic framework is not particularly limited in the present invention, and can be purchased or prepared from sources well known to those skilled in the art.

In the present invention, the magnetic covalent organic framework is bonded to MB by covalent bond; the magnetic MB has a good enrichment effect, and meanwhile, the magnetic MB also has the capability of easy separation, so that the subsequent recycling is facilitated.

In a particular embodiment of the invention, when the magnetic covalent organic framework is Fe ₃ O ₄ @ COF, the Fe ₃ O ₄ The process for the preparation of @ COF preferably comprises the following steps:

mixing ferric chloride, ethylene glycol, sodium acetate and polyethylene glycol, and carrying out solvothermal reaction to obtain Fe ₃ O ₄ Nano-microspheres;

subjecting said Fe to ₃ O ₄ Mixing the nano-microspheres, benzidine and Tetrahydrofuran (THF), refluxing, adding tetrahydrofuran solution of tri-aldehyde phloroglucinol (TP), and performing template-mediated precipitation reactionTo obtain said Fe ₃ O ₄ @COF。

The invention mixes ferric chloride, glycol, sodium acetate and polyethylene glycol to carry out solvothermal reaction to obtain Fe ₃ O ₄ And (4) nano microspheres.

In the present invention, the ferric chloride is preferably FeCl ₃ .6H ₂ O。

In the invention, the dosage ratio of the ferric chloride, the glycol, the sodium acetate and the polyethylene glycol is preferably (1-2) g: (40-60) mL: (3-4) g: (1-2) g.

In the present invention, the mixing is preferably performed by mixing ferric chloride and ethylene glycol, and then adding sodium acetate and polyethylene glycol.

In the invention, the temperature of the solvothermal reaction is preferably 180 ℃, and the time is preferably 6-8 h, and more preferably 7 h.

After the solvothermal reaction is finished, the method also preferably comprises the steps of cooling, washing and drying which are sequentially carried out; the cooling process is not particularly limited in the present invention, and may be performed by a process known to those skilled in the art. In the present invention, the washing solution used for the washing is preferably ethanol. In the invention, the drying temperature is preferably 60 ℃, and the drying time is preferably 6-8 h.

To obtain Fe ₃ O ₄ After nano-microsphere, the Fe ₃ O ₄ Mixing the nano-microspheres, the benzidine and Tetrahydrofuran (THF), refluxing, adding a tetrahydrofuran solution of the tri-aldehyde phloroglucinol (TP), and performing template-mediated precipitation reaction to obtain Fe ₃ O ₄ @COF。

In the present invention, the Fe ₃ O ₄ The preferable dosage ratio of the nano microspheres, the benzidine and the tetrahydrofuran is (30-40) mg: (30-40) mg: (20-30) mL, more preferably (33-36) mg: (34-35) mg: (22-28) mL.

In the present invention, the order of mixing is preferably such that after mixing benzidine and tetrahydrofuran to obtain a tetrahydrofuran solution of benzidine, the mixture is mixed with the Fe ₃ O ₄ And (4) mixing the nano microspheres.

In the present invention, the mixing is preferably performed under the condition of ultrasound, and the time of ultrasound is preferably 15 min; the present invention does not have any particular limitation on the frequency of the ultrasound, and may be performed using a frequency known to those skilled in the art.

In the present invention, the reflux is preferably carried out under stirring, and the reflux temperature is preferably 50 ℃ and the reflux time is preferably 0.5 h. The stirring conditions are not particularly limited in the present invention, and may be carried out by a method known to those skilled in the art.

In the present invention, the ratio of the mass of the Trialdehyde Phloroglucinol (TP) in the tetrahydrofuran solution of the Trialdehyde Phloroglucinol (TP) to the volume of the tetrahydrofuran solution of the Trialdehyde Phloroglucinol (TP) is preferably (20 to 30) mg: (6-10) mL, more preferably (23-26) mg (7-8) mL.

In the present invention, the Fe ₃ O ₄ The preferable dosage ratio of the nano microspheres to the tetrahydrofuran solution of the Trialdehyde Phloroglucinol (TP) is (30-40) mg: (6-10) mL, more preferably (32-38) mL: (7-8) mL.

In the present invention, the tetrahydrofuran solution of the Trialdehyde Phloroglucinol (TP) is preferably added dropwise; the dripping speed is preferably 6-10 drops/min, and more preferably 7-9 drops/min.

In the invention, the temperature of the template mediated precipitation reaction is preferably 50 ℃, and the time is preferably 10-14 h, and more preferably 12-13 h. In the present invention, the template-mediated precipitation reaction is preferably carried out under stirring conditions; the stirring process is not particularly limited, and may be performed by a method known to those skilled in the art.

After the template mediated precipitation reaction is finished, the method also preferably comprises suction filtration; the process of the suction filtration is not limited in any way, and can be carried out by a process known to those skilled in the art.

In the present invention, the Pd and Au in the Pd — Au are preferably present in the form of metal atoms. In the invention, the mass ratio of Pd to Au in the Pd-Au is preferably (1-5): 1, more preferably (1 to 3): 1. in the present invention, the Pd — Au is preferably a three-dimensional nanosheet of a silver-ear-like structure. In the invention, the Pd-Au has better catalytic performance, plays a role in enhancing the conductivity of a system in the detection process of ctDNA and has a certain catalytic effect on the redox reaction of MB.

The source of the Pd-Au is not limited in any way in the present invention, and any source known to those skilled in the art can be used.

In a specific embodiment of the present invention, the preparation process of Pd-Au preferably comprises the following steps:

na is mixed with ₂ PdCl ₄ 、HAuCl ₄ 、 W(CO) ₆ Mixing acetic acid and tetrahydrofuran, and carrying out redox reaction to obtain the Pd-Au.

In the present invention, the Na is ₂ PdCl ₄ 、HAuCl ₄ 、 W(CO) ₆ The dosage ratio of acetic acid to tetrahydrofuran is preferably (10-15) mg: (2-3) mg: (20-30) mg: (2-4) mL: (6-10) mL, more preferably (12-13) mg: (2.3-2.5) mg: (23-26) mg: (2.4-2.6) mL: (7-8) mL.

In the present invention, the mixing is preferably carried out by separately mixing Na ₂ PdCl ₄ 、HAuCl ₄ 、 W(CO) ₆ And acetic acid was added to tetrahydrofuran.

In the present invention, the mixing is preferably carried out under the condition of ultrasound, and the process of the ultrasound generation is not limited in any way in the present invention, and the process known to those skilled in the art can be adopted until the solution is transparent and clear.

In the invention, the temperature of the oxidation-reduction reaction is preferably 140 ℃, and the time is preferably 1-2 h. In the present invention, the redox reaction is preferably carried out under the condition of an oil bath.

After the redox reaction is completed, the invention also preferably comprises cooling and centrifugation which are sequentially carried out; the cooling and centrifuging process of the present invention is not particularly limited, and may be performed by a process known to those skilled in the art.

In the present invention, the MB undergoes a redox chemical reaction in a detection solution via an electrochemical workstation three-electrode system, and electrons generated therebetween move and are output as an electrical signal through the electrochemical workstation.

As shown in fig. 1, the present invention also provides a method for preparing the biosensor according to the above technical solution, comprising the following steps:

mixing the magnetic covalent organic framework/Pd-Au/MB, water and a CP2 probe to obtain a CP2 probe/magnetic covalent organic framework/Pd-Au/MB reaction solution (shown in figure 1);

mixing a crRNA solution, a Cas12a solution, a sample to be detected, a ssDNA solution and a soluble magnesium salt, and then carrying out enzyme digestion reaction on the Cas12a to obtain a CRISPR/Cas12a system reaction solution;

after gold plating is carried out on the surface of the substrate electrode, a CP1 probe solution, a CRISPR/Cas12a system reaction solution and a CP2 probe/magnetic covalent organic framework/Pd-Au/MB reaction solution are sequentially dripped to obtain the biosensor (shown in figure 1).

The magnetic covalent organic framework/Pd-Au/MB is obtained by mixing and loading the magnetic covalent organic framework, Pd-Au, water and MB.

In the invention, the dosage ratio of the magnetic covalent organic framework, Pd-Au, water and MB is preferably (1-3) mg: (2-4) mg: (3-5) mL: 0.1mg, more preferably (1.5 to 2.5) mg: (2.5-3.5) mg: (3.5-4.5) mL: 0.1 mg.

In the present invention, the supporting process is preferably a process of first mixing the magnetic covalent organic skeleton, Pd-Au and water, and then adding methylene blue for second mixing. In the present invention, the first mixing is preferably performed under the condition of ultrasound; the process of the present invention is not limited in any way to the ultrasound process, and can be performed by a process known to those skilled in the art. In the present invention, the second mixing is preferably performed under stirring conditions, the stirring time is preferably 24 hours, and the temperature is preferably room temperature.

After the load is completed, the present invention preferably further includes magnet separation, and the process of magnet separation is not particularly limited in the present invention and may be performed by a process well known to those skilled in the art.

After the magnetic covalent organic framework/Pd-Au/MB is obtained, the magnetic covalent organic framework/Pd-Au/MB, water and a CP2 probe are mixed to obtain a CP2 probe/magnetic covalent organic framework/Pd-Au/MB reaction solution.

In the present invention, the water is preferably sterile water.

In the present invention, the CP2 probe is preferably an aqueous solution of CP2 probe; the solvent of the aqueous solution of the CP2 probe is preferably sterile water; the concentration of the aqueous solution of the CP2 probe is preferably 10. mu.M.

In the invention, the dosage ratio of the magnetic covalent organic framework/Pd-Au/MB, the water and the CP2 probe is preferably (0.2-0.5) mg: (1-2) mL: 20 μ L.

In the present invention, the mixing is preferably performed under the condition of shaking, and the shaking time is preferably 2 hours; the frequency of the oscillation is not limited in any way, and can be determined by a frequency known to those skilled in the art.

The preparation method further comprises the steps of mixing the crRNA solution and the Cas12a solution, diluting by adopting a first buffer solution, carrying out precursor recognition on the crRNA, adding a sample to be detected, carrying out recognition on a target object, finally adding an ssDNA solution, carrying out enzymatic reaction, adding protease, carrying out enzyme digestion reaction of Cas12a, and obtaining a CRISPR/Cas12a system reaction solution; the first buffer solution comprises Mg ²⁺ 。

In the invention, the concentration of the crRNA solution is preferably 1150-1250 ng/mu L; the solvent of the crRNA solution is preferably sterile water.

In the present invention, the concentration of the Cas12a solution is preferably 500 pmol/L; the solvent of the Cas12a solution is preferably water.

In the present invention, the concentration of the ssDNA solution is preferably 1. mu. mol/L; in the present invention, the ssDNA solution is preferably diluted with a second buffer. In the present invention, the concentration of Tris (hydroxymethyl) aminomethane (Tris) and the concentration of ethylenediaminetetraacetic acid (EDTA) in the diluted solution obtained after the dilution were 10 mM.

In the invention, the volume ratio of the crRNA solution to the Cas12a solution to the sample to be detected to the ssDNA solution is preferably (8-12): (3-6): (3-6): (8-12), more preferably (9-11): (4-5): (4-5): (9-11).

In the present invention, Mg in the first buffer solution ²⁺ The concentration of (B) is preferably 5 to 30mM, more preferably 10 to 25mM, and most preferably 15 to 20 mM. The Mg ²⁺ The corresponding soluble magnesium salt is preferably magnesium chloride.

In the present invention, the first buffer solution further preferably comprises 50mM NaCl, 10mM Tris-HCl, 15mM MgCl ₂ And 100. mu.g/mL BSA. In the invention, the dilution multiple is preferably 4-11, and more preferably 5-9. In the present invention, the temperature for the recognition of the crRNA precursor is preferably 27 to 42 ℃, more preferably 37 ℃, and the time is preferably 5 to 30min, more preferably 10 min. In the invention, the temperature for identifying the target object is preferably 27-42 ℃, more preferably 37 ℃, and the time is preferably 5-30 min, more preferably 10 min. In the invention, the temperature of the enzymatic reaction is preferably 27-42 ℃, more preferably 37 ℃, and the time is preferably 10-60 min, more preferably 30 min. In the invention, the purpose of carrying out the reaction according to the adding sequence is to ensure that the target can be correctly identified and activate the cis-cleavage activity and the trans-cleavage activity of the Cas12a enzyme, and the reactions respectively generated in each step are the precursor identification of crRNA, the identification of the target and the enzymatic activation reaction of Cas12 a.

After the mixing is finished, the protease is preferably added into the obtained mixed system for digestion and decomposition. In the present invention, the protease is preferably a protease solution; the concentration of the protease solution is preferably 200pM, and the solvent is preferably sterile water. The volume ratio of the protease solution to the Cas12a solution is preferably 2: (3-6). The protease of the present invention is not limited in any way, and the Cas12a protein can be effectively decomposed by the protease known to those skilled in the art. In the present invention, the digestion decomposition temperature is preferably 37 ℃ and the time is preferably 5 min.

After the CP2 probe/magnetic covalent organic framework/Pd-Au/MB reaction solution and the CRISPR/Cas12a system reaction solution are obtained, the CP1 probe solution, the CRISPR/Cas12a system reaction solution and the CP2 probe/magnetic covalent organic framework/Pd-Au/MB reaction solution are sequentially dripped after gold plating is carried out on the surface of the glassy carbon electrode, and the biosensor is obtained.

Before gold plating, the glassy carbon electrode is preferably pretreated; the pretreatment process is preferably as follows: wiping the surface of the electrode clean by using a piece of lens wiping paper, sprinkling about 50mg of 0.3 mu m of aluminum oxide polishing powder on a polishing film, uniformly dispersing the aluminum oxide polishing powder on the film by using deionized water, vertically polishing the glassy carbon electrode and the polishing film, and cleaning the electrode by using the deionized water; then, a second grinding was performed with 0.05 μm alumina polishing powder. Washing the electrode with deionized water; and immersing the polished electrode in ethanol for 5s of ultrasonic treatment, then immersing the polished electrode in deionized water for 5s of ultrasonic treatment, washing the polished electrode with the deionized water, and airing the polished electrode in air.

In the present invention, the gold plating solution used for the gold plating is preferably HAuCl of 10mM ₄ And (3) solution. In the present invention, the gold plating method is preferably i-t electrodeposition. The process of i-t electrodeposition is not particularly limited, and may be performed by a process known to those skilled in the art. In a specific embodiment of the present invention, the gold plating is performed by immersing the pretreated substrate electrode in the HAuCl ₄ The i-t electrodeposition is carried out in the solution, the voltage is-0.2V, and the time is 200 s.

In the present invention, the concentration of the CP1 probe solution is preferably 1. mu.M. In the present invention, the CP1 probe solution is preferably dropped on the surface of a substrate electrode having an inner diameter of 3mm and a length of 6.5cm by 10. mu.L. The dropping process is not particularly limited, and may be carried out by a process known to those skilled in the art. After the completion of the dropwise addition, the present invention also preferably includes standing at room temperature for 4 hours. The purpose of the rest was to ensure good bonding of the CP1 probe to the gold layer. After the standing is finished, the invention also preferably comprises cleaning; the cleaning agent adopted for cleaning is preferably deionized water; the present invention is not limited to any particular washing procedure, and can remove the free CP1 probe by procedures well known to those skilled in the art.

After the cleaning process is finished, the method also preferably comprises the step of dropwise adding a mercaptoethanol (HT) solution; the concentration of the HT solution is preferably 1 mM. The dropping amount of the HT solution is preferably 10 mu L on the surface of a substrate electrode with the inner diameter of 3mm and the length of 6.5 cm. The dropping process is not particularly limited, and may be carried out by a process known to those skilled in the art.

After the completion of the dropping of the HT solution, the method also preferably comprises standing for 0.5 h. In the present invention, the purpose of the standing is to perform blocking at nonspecific sites (a gold particle layer is supported on the surface of the electrode, Au is connected with CP1 through-SH, and the excessive action sites on the gold particle layer are blocked by HT to avoid the action of other nucleic acid sequences with Au). After the standing is finished, the invention also preferably comprises the step of washing by using deionized water. In the present invention, the purpose of the washing is to remove free HT.

The process for dropwise adding the CRISPR/Cas12a system reaction solution is not limited in any way, and can be carried out by adopting a process well known by a person skilled in the art. In the invention, the dripping amount of the CRISPR/Cas12a system reaction solution is preferably 10 mu L on the surface of a substrate electrode with the inner diameter of 3mm and the length of 6.5 cm. After the dropwise addition is finished, the method also preferably comprises the processes of room-temperature incubation for 1 hour and washing by using deionized water which are sequentially carried out. In the present invention, the room temperature incubation is performed without controlling the temperature, so that the desired experimental effect can be achieved. The purpose of the washing is to wash away free CRISPR/Cas12a system reaction solution.

The process of the CP2 probe/magnetic covalent organic framework/Pd-Au/MB reaction solution is not limited in any way, and can be carried out by adopting a process well known to a person skilled in the art. In the present invention, the CP2 probe/magnetic covalent organic skeleton/Pd-Au/MB reaction solution is preferably added dropwise in an amount of 10. mu.L onto the surface of a substrate electrode having an inner diameter of 3mm and a length of 6.5 cm. After the dropwise addition is finished, the method also preferably comprises the processes of room-temperature incubation for 1h and washing by using deionized water which are sequentially carried out. In the present invention, the room temperature incubation serves to accomplish the binding of each probe in a simple environment. The purpose of the washing was to wash away free CP2 probe/magnetic covalent organic scaffold/Pd-Au/MB reaction solution.

The invention also provides application of the biosensor in the technical scheme in ctDNA detection.

the biosensor is the biosensor in the technical scheme.

In the present invention, the biosensor is preferably a working electrode of the electrochemical system for detecting ctDNA.

In the present invention, the reference electrode is preferably a calomel electrode; the auxiliary electrode is preferably a platinum electrode.

In the present invention, the electrochemical system for detecting ctDNA further preferably comprises a detection solution; the detection solution preferably comprises 10mM Tris Buffer (Tris Buffer) and 1mM H ₂ O ₂ (containing 100mM NaCl).

In the present invention, the electrochemical system for detecting ctDNA further preferably comprises an electrochemical workstation, and the instrument used by the electrochemical workstation is preferably an electrochemical workstation of shanghai chenhua model number CHI 660E.

The invention also provides a method for detecting ctDNA, which comprises the following steps:

setting a negative control group: the sample to be detected in the CRISPR/Cas12a system in the biosensor in the electrochemical system is water, and the current response value of the test water is marked as I ₁ ；

The electrochemical system of the technical scheme is utilized to test a sample to be tested, and the current response value of the sample to be tested is obtained and recorded as I ₂ ；

Is judged asStandard, said Δ I = I ₂ -I ₁ ；

When the Δ I is greater than 0, the sample to be detected is positive, and when the Δ I is less than or equal to 0, the sample to be detected is negative.

In the invention, the detection temperature is preferably 27-42 ℃, more preferably 35-38 ℃, and most preferably 37 ℃; the time for recording the current response value is preferably 10-60 min, more preferably 20-40 min, and most preferably 30 min.

In the present invention, the method for detecting ctDNA is performed at a ctDNA concentration of 10 ^-17 ~10 ^-10 The M range exhibits a good linear relationship, with the detected current value decreasing with increasing concentration of the target. The linear equation of the current intensity and the concentration of the target is as follows: Δ I (μ a) = 8.954 logC-161.539 (R) ² = 0.9760). Coefficient of correlation R ² To 0.9760, the detection limit LOD was calculated as: 3.3 aM. When the concentration of ctDNA is 10 ^-17 ~10 ^-10 The linearity outside the M range is poor, and the fluctuation is large, but the detection of ctDNA can be realized.

The biosensor, the preparation method and the application thereof, and the electrochemical system for detecting ctDNA provided by the present invention will be described in detail with reference to the following examples, but they should not be construed as limiting the scope of the present invention.

Example 1

Taking 1.35g FeCl ₃ .6H ₂ Mixing O and 40mL of ethylene glycol, adding 3.6g of sodium acetate and 1.0g of polyethylene glycol, stirring for 0.5h, carrying out solvothermal reaction at 180 ℃ for 6h, cooling to room temperature, washing with ethanol for a plurality of times, and drying at 60 ℃ for 4h to obtain Fe ₃ O ₄ (nanospheres);

taking 32mg of the Fe ₃ O ₄ And 22mL of THF solution containing 32mg of BD, sonicated for 15min, and stirred at 50 ℃ under reflux for 0.5 h. Then 8mL of THF solution containing 24mg of TP is added dropwise at the speed of 8 drops/min, stirred at 50 ℃ for 12h and filtered by suction to obtain Fe ₃ O ₄ @COF；

10mg of said Fe ₃ O ₄ Mixing @ COF, 10mg Au-Pd and 10mL deionized water, ultrasonically dispersing, adding 0.1mg methylene blue, and stirring at room temperatureStirring for 24h, centrifuging, collecting precipitate to obtain Fe ₃ O ₄ @ COF/Pd-Au/methylene blue;

adding 10mg of Na ₂ PdCl ₄ ，2.1mg HAuCl ₄ ，30mg W(CO) ₆ Mixing with 2mL of acetic acid, adding into 8mL of DMF, performing ultrasonic treatment until the solution is transparent and clear, reacting for 1h at 140 ℃ under the condition of oil bath, cooling to room temperature, centrifuging, and collecting precipitate to obtain Au-Pd;

0.2mg of Fe is taken ₃ O ₄ Dissolving @ COF/Pd-Au/methylene blue in 1 sterile water, adding 20 μ L of CP2 solution (the sequence of the CP2 probe is specifically AATTGCAAGTATGTAGAAGTTCACA-SH) with the concentration of 10 μ M, oscillating for 2h, and mixing to obtain CP2 probe/Fe ₃ O ₄ @ COF/Pd-Au/MB reaction solution;

after the blood to be detected is extracted by adopting a Circulating Nucleic Acid Kit, detecting that the 260/280 value is between 1.8 and 2.0 by adopting Nanodrop; then, taking RPA-F (nucleotide sequence is specifically GCATGAACTACTTGGAGGACCGTCGCTTGG) and RPA-R (nucleotide sequence is specifically CTCCTTCTGCATGGTATTCTTTCTCTTCCG) as a primer pair, taking an NTS and a TS sequence (nucleotide sequence of the NTS is specifically TGAATTCGGATGCAGAGCTTCTTCCCATGATGATCTGTCCCTCACAGCAGGGTCTTCTCTGTTTCAGGGCATGAACTACTTGGAGGACCGTCGCTTGGTGCACCGCGACCTGGCAGCCAGGAACGTACTGGTGAAAACACCGCAGCATGTCAAGATCACAGATTTTGGGCGGGCCAAACTGCTGGGTGCGGAAGAGAAAGAATACCATGCAGAAGGAGGCAAAGTAAGGAGGT; nucleotide sequence of the TS is specifically ACCTCCTTACTTTGCCTCCTTCTGCATGGTATTCTTTCTCTTCCGCACCCAGCAGTTTGGCCCGCCCAAAATCTGTGATCTTGACATGCTGCGGTGTTTTCACCAGTACGTTCCTGGCTGCCAGGTCGCGGTGCACCAAGCGACGGTCCTCCAAGTAGTTCATGCCCTGAAACAGAGAAGACCCTGCTGTGAGGGACAGATCATCATGGGAAGAAGCTCTGCATCCGAATTCA) as templates, carrying out RPA isothermal amplification according to a method provided by an RPA kit Twist Amp Basic, and after the amplification is finished, carrying out sequencing verification to obtain a sample to be detected;

mu.L of a 5. mu.M solution of crRNA (the template nucleotide sequence for transcription of the crRNA is specifically AAGTACCCAGCAGTTTGGCCCGCCATCTACACTTAGTAGAAATTCC TATAGTGAGTCGTATTAG) was mixed with 5. mu.L of a 500pM solution of Cas12a, and the mixture was buffered with a first buffer (50 mM NaCl, 10mM Tri)s-HCl、15mM MgCl ₂ And 100. mu.g/mL BSA; further comprises magnesium chloride, wherein the concentration of the magnesium chloride is 5mM, 10mM, 15mM, 20mM, 25mM or 30 mM) is diluted to 50 μ L, the reaction is carried out for 10min, then 5 μ L of a sample to be tested (ctDNA solution) is added, and the reaction is carried out for 10min at 37 ℃; then adding 10 μ L ssDNA solution (diluted by second buffer solution comprising 10mM Tris and 10mM EDTA, wherein the nucleotide sequence of ssDNA is specifically ACATAAAGGATTTATTTTTAATTTTTTAACGTTCATACAT), placing at 37 ℃ for reaction for 30min, finally adding 2 μ L protease to digest Cas12a, and placing at 37 ℃ for reaction for 5min to obtain CRISPR/Cas12a system reaction solution.

Wiping the surface of the electrode clean by using a piece of lens wiping paper, sprinkling about 50mg of 0.3 mu m of aluminum oxide polishing powder on a polishing film, uniformly dispersing the aluminum oxide polishing powder on the film by using deionized water, vertically polishing the glassy carbon electrode and the polishing film, and cleaning the electrode by using the deionized water; then, a second grinding was performed with 0.05 μm alumina polishing powder. Washing the electrode with deionized water; immersing the polished electrode in ethanol for 5s of ultrasonic treatment, then immersing the polished electrode in deionized water for 5s of ultrasonic treatment, cleaning the polished electrode with the deionized water, and airing the polished electrode in air to obtain a pretreated glassy carbon electrode for later use;

103mg of tetrachloroauric acid was mixed with 25mL of deionized water to prepare 10mM HAuCl ₄ An aqueous solution.

Immersing the pretreated glassy carbon electrode into the HAuCl ₄ Performing i-t electrodeposition in the solution at-0.2V for 200s to obtain Au/GCE;

dripping 10 muL of CP1 solution (the nucleotide sequence of the CP1 probe is SH-ACACTTGAAGTGTATTTCCTAAATA) with the concentration of 1 muM on the surface of the gold layer, standing for 4 hours at room temperature, and then washing away free CP1 by deionized water to obtain CP 1/Au/GCE;

continuously dropwise adding 10 mu L of HT solution with the concentration of 1mM, standing for 0.5h, performing nonspecific site blocking, and then washing off free HT by using deionized water to obtain HT/CP 1/Au/GCE;

dripping 10 mu L of CRISPR/Cas12a system reaction liquid on the surface of the Au-CP1 layer, incubating for 1h at room temperature, and then washing away free reaction liquid by using deionized water to obtain a CRISPR/Cas12a system/HT/CP 1/Au/GCE;

dripping 10 mu L of CP2 probe/Fe on the surface of the CRISPR/Cas12a system layer ₃ O ₄ Incubation of the reaction solution at room temperature for 1h, washing off free materials by using deionized water to obtain the biosensor;

the biosensor is used as a working electrode, a calomel electrode is used as a reference electrode, a platinum electrode is used as an auxiliary electrode, and 10mM Tris Buffer solution (Tris Buffer) and 1mM H are used ₂ O ₂ The solution (containing 100mM NaCl) is used as a detection solution, an electrochemical workstation of Shanghai Chenhua, model number CHI660E is adopted to jointly form an electrochemical system for detecting ctDNA, the sample is detected by a chronoamperometry, and the test process is as follows:

Let Δ I be the judgment standard, which is ₂ -I ₁ ；

When the Δ I is greater than 0, the sample to be detected is positive, and when the Δ I is less than or equal to 0, the sample to be detected is negative;

the test conditions were: the incubation time of dsDNA and ssDNA was 10 and 30min, respectively; ssDNA incubation temperature was 37 ℃; ssDNA design length is 40 nt; mg in buffer solution 1 ²⁺ The optimal concentration is 15 mM; the preferred mixing volume ratio of crRNA to Cas12a is 2: 1.

FIG. 10 is a schematic diagram of the sensor feasibility of the test; as can be seen from fig. 10, the current was significantly reduced in the presence of the test group (target, with dsDNA) compared to the negative control group (background, without dsDNA). The above results indicate that the preparation of the electrochemical biosensor was successful.

FIG. 14 shows the measurement of standard concentration by the above-mentioned detection methodDetection curve of ctDNA solution. The biosensor is at 10 ^-17 ~10 ^-10 The range of M exhibits a good linear relationship, with the detected current value decreasing with increasing concentration of the target. The linear equation of the current intensity and the concentration of the target is as follows: Δ I (μ a) = 8.954 logC-161.539 (R) ² = 0.9760). Coefficient of correlation R ² To 0.9760, the detection limit LOD was calculated as: 3.3 aM.

FIG. 15 shows the results of detection of EGFR L858R in actual samples (25 cases) by the above-mentioned detection method. As is clear from FIG. 15, among the 25 samples, 22 samples were positive and 3 samples were negative, and the agreement with the ddPCR detection result was 92%. In two cases (No. 9 and No. 10), the result of detection by the electrochemical sensor is positive, but the result of detection by ddPCR is negative, and the result is confirmed by Sanger sequencing;

FIG. 16 is a drawing showingEGFRSanger sequencing results of samples No.9 and No.10 in the L858R actual sample. Since the detection results of Nos. 9 and 10 could not be confirmed, the blood samples of both samples were subjected to ctDNA extraction, RPA isothermal amplification, PCR amplification reaction, and Sanger sequencing. The sequencing results showed that samples No.9 and No.10 were bothEGFRL858R positive. The result shows that the working electrochemical sensor has higher accuracy.

Test example 1

Fe as described in example 1 ₃ O ₄ @ COF, Pd-Au and Fe ₃ O ₄ The results of the test of scanning electron microscope and element distribution of @ COF/Pd-Au are shown in FIG. 3, wherein the graph (A) is Fe ₃ O ₄ @ COF, Pd-Au on graph (B), and Fe on graph (C) ₃ O ₄ @ COF/Pd-Au; as can be seen from FIG. 3, Fe in (A) is ₃ O ₄ The outer layer of the sphere is wrapped with a film COF; (B) Pd-Au is in a silver ear shape in the figure; (C) in the figure, the silver ear-shaped Pd-Au particles are obviously spherical Fe ₃ O ₄ @ COF are bonded together; (C) in the figure, a, b, C, d and e are the distribution conditions of Au, Fe, O, C and Pd in sequence, and the (C) figure shows that Au, Fe, O, C and Pd are in the composite material Fe ₃ O ₄ The @ COF/Pd-Au distribution is uniform. The results show that the material Fe ₃ O ₄ @ COF/Pd-Au has been successfully complexed;

fe as described in example 1 ₃ O ₄ @ COF, Pd-Au and Fe ₃ O ₄ The particle size distribution test of @ COF/Pd-Au showed that the results are shown in FIG. 4, in which (A) is Fe ₃ O ₄ @ COF, Pd-Au on graph (B), and Fe on graph (C) ₃ O ₄ @ COF/Pd-Au; as can be seen from FIG. 4, the Fe ₃ O ₄ The particle size of @ COF is about 300nm, and the particle size of Pd-Au is 250 nm; said Fe ₃ O ₄ The particle size of @ COF/Pd-Au was about 920nm, compared to Fe ₃ O ₄ @ COF of said Fe ₃ O ₄ The particle size of @ COF/Pd-Au is greatly reduced, and may be caused by the residue of a part of/Pd-Au in the material;

fe as described in example 1 ₃ O ₄ @ COF, Pd-Au and Fe ₃ O ₄ Respectively diluting the @ COF/Pd-Au with deionized water to prepare working solutions, wherein the concentration of the working solutions is 1mg/mL, and respectively carrying out Zeta detection on the working solutions; FIG. 5 shows Fe as described in example 1 ₃ O ₄ @ COF, Pd-Au and Fe ₃ O ₄ Zeta results after preparation of working solution of @ COF/Pd-Au, wherein (A) is Fe ₃ O ₄ @ COF, Pd-Au on graph (B), and Fe on graph (C) ₃ O ₄ @ COF/Pd-Au; as can be seen from FIG. 5, the Fe ₃ O ₄ @ COF is substantially 0 in charge; the Zeta potential of the Pd-Au is-17.5 mV; said Fe ₃ O ₄ The Zeta potential of @ COF/Pd-Au is reduced to be near-16.7 mV, which indicates that the composite material is successfully compounded;

fe described in example 1 was added in a mass ratio of 1:1:1 ₃ O ₄ @ COF, Pd-Au and Fe ₃ O ₄ The @ COF/Pd-Au is respectively mixed with the potassium bromide after being roasted, dried and ground by an infrared lamp, and then the mixture is ground, tabletted and then subjected to infrared spectrum test, the test result is shown in figure 6, and figure 6 shows Fe described in example 1 ₃ O ₄ @ COF, Pd-Au and Fe ₃ O ₄ From FIG. 6, it is clear that the infrared spectrum of @ COF/Pd-Au complex is Fe ₃ O ₄ @ COF/Pd-Au containing Fe ₃ O ₄ All functional groups in @ COF and Pd-Au indicate the complex Fe ₃ O ₄ @ COF/Pd-Au has been synthesized successfully;

fe as described in example 1 ₃ O ₄ @ COF, Pd-Au and Fe ₃ O ₄ XRD test was carried out on @ COF/Pd-Au, respectively, and the results are shown in FIG. 7, in which FIG. 7 shows Fe described in example 1 ₃ O ₄ @ COF, Pd-Au and Fe ₃ O ₄ XRD pattern of @ COF/Pd-Au, as can be seen from FIG. 7, Fe ₃ O ₄ The diffraction peak of @ COF is 18.3 ^o 、30.2 ^o 、35.5 ^o 、53.3 ^o 、57.0 ^o And 62.6 ^o Corresponding to the reflection surfaces (210), (220), (311), (422), (511), (440), except for Fe ₃ O ₄ In addition to the diffraction peak of @ COF, in Fe ₃ O ₄ A diffraction peak 39.7 for Pd-Au was observed at @ COF/Pd-Au ^o 、45.0 ^o 、67.5 ^o 、81.4 ^o The material synthesis is successful;

FIG. 8 is an SDS-Page gel electrophoresis to visualize the feasibility of the CRISPR/Cas12a system described in example 1 (test conditions: electrophoresis at 80V for 90 min in TBE electrophoresis buffer). Wherein lane 1 is Cas12a/crRNA/dsDNA/ssDNA, lane 2 is Cas12a/crRNA/dsDNA, lane 3 is Cas12a/crRNA, lane 4 is crRNA, lane 5 is dsDNA, lane 6 is ssDNA, lane 7 is crRNA/dsDNA, lane 8 is crRNA/dsDNA/ssDNA, lane 9 is Cas12 a/crRNA/ssDNA; CRISPR/Cas12a activity was analyzed with 15% non-denaturing nucleic acid pre-gel. Wherein, the length of the dsDNA and the ssDNA is 233 bp and 40nt respectively. Under the condition of the same loading amount, only when Cas12a, crRNA, dsDNA and ssDNA exist simultaneously, a small-fragment band can be obviously seen to appear, which indicates that the CRISPR/Cas12a trans-cleavage activity is activated and ssDNA is sheared; when any one of Cas12a, crRNA, dsDNA and ssDNA is absent, the trans-cleavage activity of CRISPR/Cas12a cannot be normally started;

the preparation process of reference example 1 differs in that: obtaining HT/CP1/Au/GCE, directly dripping 10 mu L ssDNA solution on the obtained HT surface to obtain ssDNA/HT/CP1/Au/GCE, and dripping 10 mu LCP2 Probe/Fe ₃ O ₄ Incubation of the reaction solution at room temperature for 1h, washing off free materials by using deionized water to obtain the electrode MB/Fe ₃ O ₄ @COF/Pd-Au/CP2/ssDNA/HT/CP1/Au/GCE；

The GCE, Au/GCE, CP1/Au/GCE, HT/CP1/Au/GCE, ssDNA/HT/CP1/Au/GCE and MB/Fe ₃ O ₄ Impedance analysis with @ COF/Pd-Au/CP2/ssDNA/HT/CP1/Au/GCE (impedance solution: 1mM [ Fe (CN) ] prepared with 0.1M KCl) ₆ ] ^3−/4− ) (ii) a The test results are shown in FIG. 9, in which FIG. 9 shows the results of the above-mentioned GCE, Au/GCE, CP1/Au/GCE, HT/CP1/Au/GCE, ssDNA/HT/CP1/Au/GCE and MB/Fe ₃ O ₄ An impedance EIS map of @ COF/Pd-Au/CP2/ssDNA/HT/CP1/Au/GCE, wherein (A) is the condition that no target exists in the reaction system, namely the target dsDNA exists in the whole reaction process. CRISPR/Cas12a is present as recognition target and cleavage of ssDNA (curve a corresponds to GCE; curve b corresponds to Au/GCE; curve c corresponds to CP 1/Au/GCE; curve d corresponds to HT/CP 1/Au/GCE; curve e corresponds to ssDNA/HT/CP 1/Au/GCE; curve f corresponds to methylene blue/Fe ₃ O ₄ @ COF/Pd-Au/CP2/ssDNA/HT/CP 1/Au/GCE), (B) is a target substance in the reaction system (curve a corresponds to GCE; curve b corresponds to Au/GCE; the c curve corresponds to CP 1/Au/GCE; the d curve corresponds to HT/CP 1/Au/GCE; the e-curve corresponds to ssDNA/HT/CP 1/Au/GCE; curve f corresponds to methylene blue/Fe ₃ O ₄ @ COF/Pd-Au/CP2/ssDNA/HT/CP 1/Au/GCE); as can be seen from Panel B of FIG. 9, when the target was present, the curves e, f were observed to almost overlap, indicating that the ssDNA had been sheared and failed to act as a bridge, and CP1 could not be connected to the nanocomposite, so there was almost no change in the detected impedance; panel A shows the results obtained when the target substance was not present in the reaction system. When no target is present in the system, the impedance of curve f is significantly increased compared to curve e, indicating that ssDNA connects CP1 well with the nanocomposite, indicating thatEGFRThe L858R biosensor was successfully constructed and could be used to target an objectEGFRDetection of L858R;

the results of the study of the specificity of the obtained mutant sequence by carrying out mutation at one site (g.2570G → T), two sites (g.2566T → G, g.2570G → T) and three sites (g.2566T → G, g.2570G → T, g.2585T → C) on the EGFR L858R sequence show that the detected current value is comparable to that of the negative control group (because the mutation site at this position is mutated on the basis of EGFR L858R, relatively speaking, EGFR L858R is also an unmutated sequence), while the current value detected by the unmutated EGFR L858R sequence is significantly reduced, which indicates that the biosensor has strong specificity;

the 6 biosensors of example 1 were subjected to reproducibility and stability studies, the results of which are shown in fig. 12, wherein (a) is reproducibility and (B) is stability; as can be seen from fig. 12, the current Standard Deviation (SD) of the biosensor was ± 0.63; the biosensor was stored at 4 ℃ for 1 day, 3 days, 7 days, 14 days and 21 days, and the current was measured, and it was found that the current slightly decreased in the first 7 days, but when the storage time reached 21 days, the current response was significantly decreased from the very beginning, and the current response was only 67% of the initial current, which was probably affected by the Cas12a enzyme present in the system;

FIG. 13 shows the results of reaction condition optimization of the biosensor described in example 1. Reaction time optimization for ssDNA and dsDNA:

under the same conditions, the reaction time of ssDNA (the time for adding ssDNA in the CRISPR/Cas12a system reaction) is set to be 10min, 20 min, 30min, 45 min and 60min respectively; the maximum current difference was found for ssDNA reaction times of 30min, so 30min was selected as the optimal ssDNA reaction time (FIG. 13A);

similarly, under the same conditions, the reaction time of the dsDNA (the reaction time after adding the dsDNA) is respectively set to be 5min, 10min, 20 min and 30 min; the maximum current difference was found for a dsDNA reaction time of 10min, so the optimal reaction time for the selected dsDNA was 10min (FIG. 13B);

the length of ssDNA may affect the trans-cleavage activity of the CRISPR/Cas12a system, while the length of ssDNA may also affect its binding efficiency to CP1 and CP 2. The work synthesizes ssDNA with three lengths of 30 nt (ACATAAGGATTTATTTAACGTTCATAT), 40nt, 50 nt (ACATAAGGATTTTTTTTTTTTTTTAACGTTCATATCATA) for experiment, and selects the ssDNA with 40nt as the optimal length according to the actual situation (figure 13C);

since the CRISPR/Cas12a system is an enzymatic reaction, the reaction temperature has a large influence on the activity of the Cas enzyme, the reactions are performed at three temperatures of 27 ℃, 37 ℃ and 42 ℃, respectively, and the maximum current difference is found at 37 ℃, the 37 ℃ is selected as the optimal reaction temperature of the CRISPR/Cas12a system (fig. 13D);

Mg ²⁺ concentration is an important factor affecting the cleavage activity of Cas12 a. For different Mg under otherwise the same conditions ²⁺ Cas12a cleavage activity at concentrations (5 mM, 10mM, 15mM, 20mM, 25mM, 30 mM) was investigated. When Mg ²⁺ The electrochemical sensor detected the largest current response change at a concentration of 15mM (fig. 13E);

binding of crRNA to Cas12a is a prerequisite for specific target recognition. Thus, the present work optimized the volume ratio of crRNA to Cas12a, and the results showed that when the mixing ratio of crRNA to Cas12a was 2:1 had the best catalytic activity (FIG. 13F).

The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.

Sequence listing

<110> university of Yunnan

<120> biosensor, preparation method and application thereof, and electrochemical system for detecting ctDNA

<160> 8

<170> SIPOSequenceListing 1.0

<210> 1

<211> 64

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

aagtacccag cagtttggcc cgccatctac acttagtaga aattcctata gtgagtcgta 60

ttag 64

<210> 2

<211> 30

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

gcatgaacta cttggaggac cgtcgcttgg 30

<210> 3

<211> 30

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

ctccttctgc atggtattct ttctcttccg 30

<210> 4

<211> 40

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

acataaagga tttattttta attttttaac gttcatacat 40

<210> 5

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

acacttgaag tgtatttcct aaata 25

<210> 6

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

aattgcaagt atgtagaagt tcaca 25

<210> 7

<211> 233

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

tgaattcgga tgcagagctt cttcccatga tgatctgtcc ctcacagcag ggtcttctct 60

gtttcagggc atgaactact tggaggaccg tcgcttggtg caccgcgacc tggcagccag 120

gaacgtactg gtgaaaacac cgcagcatgt caagatcaca gattttgggc gggccaaact 180

gctgggtgcg gaagagaaag aataccatgc agaaggaggc aaagtaagga ggt 233

<210> 8

<211> 233

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

acctccttac tttgcctcct tctgcatggt attctttctc ttccgcaccc agcagtttgg 60

cccgcccaaa atctgtgatc ttgacatgct gcggtgtttt caccagtacg ttcctggctg 120

ccaggtcgcg gtgcaccaag cgacggtcct ccaagtagtt catgccctga aacagagaag 180

accctgctgt gagggacaga tcatcatggg aagaagctct gcatccgaat tca 233

Claims

1. A biosensor is characterized by comprising a substrate electrode, and an Au-CP1 probe layer, a mercaptoethanol layer, a CRSPR/Cas12a system layer and a CP2 probe/magnetic covalent organic framework/Pd-Au/MB layer which are sequentially loaded on the surface of the substrate electrode;

the CRSPR/Cas12a system layer comprises crRNA, Cas12a, ssDNA and a sample to be detected;

the nucleotide sequence of the CP2 probe is shown as SEQ ID No. 6; the CP2 probe is modified by sulfydryl at the 3' position of the SEQ ID No.6 sequence;

the Pd-Au is a three-dimensional nanosheet with a similar silver ear-shaped structure.

2. The biosensor of claim 1, wherein the sample to be tested is obtained by sequentially extracting a blood sample and performing RPA isothermal amplification;

the primer pair for RPA isothermal amplification is RPA-F and RPA-R;

the nucleotide sequence of the RPA-F is shown as SEQ ID No. 2;

the nucleotide sequence of the RPA-R is shown in SEQ ID No. 3.

3. The biosensor of claim 1, wherein the ssDNA has a nucleotide sequence as set forth in SEQ ID No. 4.

4. The biosensor in accordance with any one of claims 1 to 3, wherein the magnetic covalent organic framework is Fe ₃ O ₄ @COF。

5. A method for producing the biosensor in accordance with any one of claims 1 to 4, comprising the steps of:

mixing the magnetic covalent organic framework, Pd-Au, water and MB, and loading to obtain the magnetic covalent organic framework/Pd-Au/MB;

mixing a crRNA solution and a Cas12a solution, diluting by adopting a first buffer solution, carrying out precursor recognition on the crRNA, adding a sample to be detected, carrying out recognition on a target object, finally adding a ssDNA solution, carrying out enzymatic reaction, adding protease, carrying out enzyme digestion reaction on Cas12a, and obtaining a CRSPR/Cas12a system reaction solution; the first buffer solution comprises Mg ²⁺ ；

And after gold plating is carried out on the surface of the substrate electrode, sequentially dropwise adding a CP1 probe solution, a CRSPR/Cas12a system reaction solution and a CP2 probe/magnetic covalent organic framework/Pd-Au/MB reaction solution to obtain the biosensor.

6. The method of claim 5, wherein the Mg in the first buffer is present ²⁺ The concentration of (B) is 5 to 30 mM.

7. The method of claim 6, wherein the temperature for the precursor recognition of the crRNA is 27 to 42 ℃;

the time for identifying the target object is 5-30 min;

the enzymatic reaction time is 10-60 min;

the volume ratio of the crRNA solution to the Cas12a solution is (8-12): (3-6);

8. An electrochemical system for detecting ctDNA, which is characterized by comprising a biosensor, a reference electrode and an auxiliary electrode;

the biosensor is the biosensor according to any one of claims 1 to 4 or the biosensor prepared by the preparation method according to any one of claims 5 to 7.