CN113061647A - Library construction method for balancing library concentration and application thereof - Google Patents
Library construction method for balancing library concentration and application thereof Download PDFInfo
- Publication number
- CN113061647A CN113061647A CN202110296224.1A CN202110296224A CN113061647A CN 113061647 A CN113061647 A CN 113061647A CN 202110296224 A CN202110296224 A CN 202110296224A CN 113061647 A CN113061647 A CN 113061647A
- Authority
- CN
- China
- Prior art keywords
- library
- concentration
- downstream primer
- construction method
- magnetic
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6806—Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6869—Methods for sequencing
-
- C—CHEMISTRY; METALLURGY
- C40—COMBINATORIAL TECHNOLOGY
- C40B—COMBINATORIAL CHEMISTRY; LIBRARIES, e.g. CHEMICAL LIBRARIES
- C40B50/00—Methods of creating libraries, e.g. combinatorial synthesis
- C40B50/06—Biochemical methods, e.g. using enzymes or whole viable microorganisms
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Analytical Chemistry (AREA)
- Microbiology (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Physics & Mathematics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biotechnology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- General Chemical & Material Sciences (AREA)
- Medicinal Chemistry (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a library construction method for balancing library concentration, which is characterized by comprising the following steps: the steps of nucleic acid fragmentation, adaptor addition and library amplification are characterized in that the concentration of each sample library is balanced mainly through the step of library amplification. The invention also discloses application of the library construction method for balancing the library concentration, which comprises library amplification purification and recovery and on-machine sequencing. The library construction method for balancing the library concentration disclosed by the invention is simple and rapid, the output library is high in quality and consistent in concentration level, the subsequent library quantitative process and sample mixing process are simplified, and the method is suitable for the field of sequencing of various platforms.
Description
Technical Field
The invention belongs to the technical field of high-throughput sequencing, and particularly relates to a library amplification method for balancing the concentration of multiple libraries and application thereof.
Background
Since the discovery of DNA duplex structure, nucleic acid detection technology has advanced significantly in studying the complexity and diversity of health and disease-related genomes. With the continuous development of sequencing technology, the performance of the sequencing technology is continuously improved, and particularly since the appearance of high-throughput sequencing technology, the accuracy and the flux of the sequencing technology are continuously improved, and the cost is continuously reduced, so that the sequencing technology is successfully applied in various fields, including tumor screening, gene detection, pathogen screening and other fields.
Although great advances have been made in high throughput sequencing technologies, new deficiencies and challenges still exist with these advances. The advent of new technologies does not mean that existing problems will be solved well, even more so and new problems may arise. The high-throughput sequencing platform can provide massive sequencing data, but the quality of obtaining the data is determined by the quality of the early sample preparation and library construction. Nucleic acid samples obtained from different sample types and different sample preparation methods vary greatly. In the conventional sequencing process, the minimum sample loading is usually limited, so that the nucleic acid concentration prepared by certain sample types or sample preparation methods is difficult to meet the sample loading requirement, and the sequencing result quality is poor, even data is unavailable, especially when a plurality of samples are detected in one Run. The huge difference of the sample input amount not only makes the library mixing a huge challenge, but also causes the sample output data to have huge difference, and the data analysis requirement is difficult to achieve.
Based on the difficulties faced in the high-pass sequencing technology, the invention provides a library construction method for balancing the library concentration of a plurality of samples with different concentrations. By adopting the method, the library with the same concentration can be finally output through the process of constructing the library by using samples with different concentrations. In the later stage, the constructed library is only required to be subjected to equal-volume sample mixing, so that the final output data volume of each sample is balanced at a uniform level, and the difference is within 5%. The library building technology is particularly suitable for the field of pathogen sequencing detection, the field has various detection sample types, the composition difference of each sample type is large, the sample preparation methods are various, the finally prepared nucleic acid concentration difference is large, the balance of the library amount of each sample is necessary for detecting the samples of a plurality of sample types by using one Run, and the requirements can be met through the library building technology of the balanced library. The technology provides a new research idea for the high-throughput sequencing detection of the pathogen, so that the high-throughput sequencing technology can be better applied to the sequencing detection of the pathogen.
Disclosure of Invention
The invention mainly aims to provide a library construction method for balancing library concentration, which can be used for constructing libraries of different concentrations of samples to finally obtain libraries with similar concentrations and is used for solving the technical problems of poor library construction quality, high operation difficulty and difficult copying operation of low-quality or low-concentration nucleic acid in the existing method.
In order to achieve the above purposes, the technical scheme adopted by the invention is as follows: a method of library construction for equalizing library concentration, comprising: the steps of nucleic acid fragmentation, adaptor addition and library amplification are characterized in that the concentration of each sample library is balanced mainly through the step of library amplification.
Further, the specific operation steps of nucleic acid fragmentation and linker addition are as follows: performing nucleic acid fragmentation and linker addition according to the requirements of different sequencing platforms, wherein the fragmentation can adopt conventional fragmentation methods, including a mechanical fragmentation method and an enzymatic fragmentation method; the initial nucleic acid concentration may be 0.1pg/μ L to 100ng/μ L; the nucleic acid with the linker added thereto was purified using 1.8 Xmagnetic beads.
Further, the specific operation steps of library amplification are as follows: the amplification system is a 50-mu-L reaction system, nuclease-free water, 20 mu-L of a product added with a linker, 10 mu-L of 5 XFidelity Buffer, 1.5 mu-L of dNTPs (10mM), 1.5 mu-L of an upstream primer (10 mu M), 5 mu-L of a downstream primer magnetic bead and 1 mu-L of LKAPA HiFi Hotstar DNA polymerase are sequentially added according to requirements, mixed uniformly and placed in a PCR instrument for reaction.
Further, the reaction procedure of the reaction is as follows: 3min at 95 ℃; 20s at 98 deg.C → 15s at 60 deg.C → 20s at 72 deg.C, and circulating for 25-30 times at 72 deg.C for 1 min.
Further, the downstream primer magnetic beads are streptavidin magnetic beads, and the concentration of the streptavidin magnetic beads is 10 mg/mL; a downstream primer is combined on the surface of the magnetic bead, and the downstream primer is combined with streptavidin on the surface of the magnetic bead through biotin; the concentration of the primer bound to the magnetic beads was 0.2 pmol/. mu.L.
Further, the preparation process of the downstream primer magnetic beads comprises the following steps:
step S1: taking 100 mu L of uniformly mixed streptavidin magnetic beads, adding 1mL of 1 XB & W buffer solution, and uniformly mixing;
step S2: placing the reaction tube on a magnetic frame for 2min, and discarding the supernatant;
step S3: taking the reaction tube off the magnetic frame, adding 100 mu L of 1 XB & W buffer solution, and resuspending the magnetic beads;
step S4: repeating the step 2-3 twice, and repeating the step 3 times in total;
step S5: placing the accommodating tube on a magnetic frame for 2min, and removing the supernatant;
step S6: adding 200. mu.L of 2 XB & W buffer solution, adding the equal volume of 10. mu.M downstream primer, and incubating for 10min at room temperature;
step S7: placing the reaction tube on a magnetic frame, standing for 5min until the solution becomes clear, and discarding the supernatant;
step S8: washing with 1 XB & W buffer for 2 times;
step S9: and (5) resuspending the magnetic beads by 1000 mu L of nuclease-free water to obtain the downstream primer magnetic beads.
Further, the 2 xb & W buffer consists of: 10mM Tris-HCl (pH7.5), 1mM EDTA; 2M NaCl.
Further, the 1 XB & W buffer is obtained by diluting 2 XB & W buffer to half of the original concentration.
Furthermore, biotin is modified on the 5' of the downstream primer.
Further, the upstream primer and the downstream primer magnetic beads have different primer sequences according to different selected library building platforms; if an Illumina sequencing platform is adopted, the sequence of the upstream primer is S1: AATGATACGGCGACCACCGAGATCT, respectively; the downstream primer magnetic bead sequence is A1-B: Biotin-TTTTT (C3spacer) TUCAAGCAGAAGACGGCATACGAGAT.
Further, the upstream primer and the downstream primer magnetic beads have different primer sequences according to different selected library building platforms; if an Ion Torrent sequencing platform is adopted, the sequence of the upstream primer is S2: CCATCTCATCCCTGCGTGTCTCCGAC; the downstream primer magnetic bead sequence is A2-B: Biotin-TTTTT (C3spacer) TUCCACTACGCCTCCGCTTTCCTCTC.
Furthermore, in the downstream primer, Biotin represents a Biotin label, and C3 spcaer is modified by C3 and is used for terminating amplification; the U base in the downstream primer can be cut by the action of USER enzyme, so that the synthesized double-stranded nucleic acid is separated from the streptavidin magnetic bead and is used for recovering the constructed library.
Another objective of the present invention is to provide an application of the library construction method for equalizing library concentration, which is characterized by comprising library amplification purification and recovery and on-machine sequencing.
Further, the purification and recovery of the amplification library specifically comprises the following steps:
(1) after the reaction is finished, placing the reaction tube on a magnetic frame/plate, standing for 5-10min until the solution becomes clear, and discarding the supernatant;
(2) adding 200 μ L of 70% ethanol, standing at room temperature for 1min, and removing supernatant;
(3) repeating the previous step once;
(4) placing the reaction tube on a magnetic frame/plate, opening the cover and placing for 3-5min until the magnetic beads are dried;
(5) adding 18 μ L of 1X CutSmart buffer and 2 μ L of USER enzyme, mixing, and incubating at 37 deg.C for 15 min;
(6) placing the reaction tube on a magnetic frame, and standing for 5-10min until the solution becomes clear.
(7) The supernatant was transferred to a new centrifuge tube, purified by adding 1.8 Xmagnetic beads, and eluted with 50. mu.L of nuclease-free water.
Further, the above-mentioned sequencing specifically comprises: mixing the prepared library according to the equal volume, and performing on-machine sequencing according to the requirement of the selected sequencing platform; and counting the output data volume of each sample; the amount of data produced by each sample of the library prepared by this technique varied by no more than 10%.
Due to the application of the technical scheme, compared with the prior art, the invention has the following advantages:
(1) according to the library construction method for balancing the library concentration, nucleic acid with 10000 times of concentration difference of input nucleic acid (not less than 0.0001 ng/mu L) can be constructed and input, and the finally output library concentration is kept at a concentration level, so that subsequent library mixing is uniform.
(2) The library construction method for balancing the library concentration is simple and rapid, high in output library quality and consistent in concentration level, simplifies subsequent library quantitative flow and sample mixing flow, and is suitable for the field of sequencing of various platforms.
(3) The invention discloses a library construction method for balancing library concentration, provides a technology for finally obtaining libraries with similar concentrations by constructing libraries for samples with different concentrations, and can be used for solving the technical problems of poor library construction quality, high operation difficulty and difficult copying operation of low-quality or low-concentration nucleic acid in the existing method.
(4) According to the library construction method for balancing the library concentration, disclosed by the invention, the library with the same concentration can be finally output from samples with different concentrations through the library construction process by adopting the technology. In the later stage, the constructed library is only required to be subjected to equal-volume sample mixing, so that the final output data volume of each sample is balanced at a uniform level, and the difference is within 5%.
(5) The library construction technology is particularly suitable for the field of pathogen sequencing detection, the field is wide in detection sample types, the composition difference of each sample type is large, the sample preparation methods are various, the concentration difference of finally prepared nucleic acid is large, the library quantity of each sample is indispensable for detecting the samples of a plurality of sample types by one Run, and the library construction technology of the balanced library can meet the requirement. The technology provides a new research idea for the high-throughput sequencing detection of the pathogen, so that the high-throughput sequencing technology can be better applied to the sequencing detection of the pathogen.
(6) According to the library construction method for balancing the library concentration and the application, the library with the same concentration can be finally output by nucleic acids with different input quantities. The library construction process is simplified, the input quantity of each sample library does not need to be calculated, and the concentration of the output library is equivalent, so that the subsequent library process flow is simplified, and the library can be mixed according to the equal volume. Provides a new library construction method for pathogen sequencing detection of different sample types.
Detailed Description
The following description is presented to disclose the invention so as to enable any person skilled in the art to practice the invention. The preferred embodiments in the following description are given by way of example only, and other obvious variations will occur to those skilled in the art.
The experimental methods used in the following examples are all conventional methods unless otherwise specified; the following examples relate to apparatus comprising: an ultra-clean workbench, a centrifuge, a qubit4.0, a PCR instrument, a pipettor, a magnetic frame and the like; materials, reagents and the like used in the following examples are commercially available unless otherwise specified.
Example 1
Preparation of magnetic beads for downstream primer
First, material preparation
Streptavidin M-270 magnetic beads (manufacturer: Thermo Fisher Cat: 65001); the downstream primer is biosynthesized by Shanghai life, the dissolving concentration is 50 mu M, and the downstream primer is diluted to 1 mu M by nuclease-free water when in use; the primer sequence is as follows, Illumina sequencing platform A1-B: Biotin-TTTTT (C3spacer) TUCAAGCAGAAGACGGCATACGAGAT; ion Torrent sequencing platform: A2-B: Biotin-TTTTT (C3spacer) TUCCACTACGCCTCCGCTTTCCTCTC.
Second, preparation of downstream primer magnetic beads
(1) Taking out the streptavidin C1 magnetic beads, balancing for 30min at room temperature, and uniformly mixing to completely resuspend the magnetic beads;
(2) taking 100 mu L of streptavidin C1 magnetic beads to a new 1.5mL centrifuge tube;
(3) adding 1mL of 1 XB & W buffer solution into the centrifuge tube, and uniformly mixing;
(4) placing the reaction tube on a magnetic frame for 2min until the solution becomes clear, and discarding the supernatant;
(5) taking the reaction tube off the magnetic frame, adding 100 mu L of 1 XB & W buffer solution, and resuspending the magnetic beads;
(6) placing the reaction tube on a magnetic frame for 2min until the solution becomes clear, and discarding the supernatant;
(7) repeating the step 5-6 twice for 3 times;
(8) the reaction tube was removed from the magnetic frame, 200. mu.L of 2 XB & W buffer solution was added to resuspend the magnetic beads, an equal volume (200. mu.L) of 1. mu.M downstream primer was added, and incubation was carried out at room temperature for 10 min;
(9) placing the reaction tube on a magnetic frame, standing for 5min until the solution becomes clear, and discarding the supernatant;
(10) washing with 1 XB & W buffer for 2 times;
(11) and (5) resuspending the magnetic beads by 1000 mu L of nuclease-free water to obtain the downstream primer magnetic beads.
Example 2
Library construction techniques that equalize multiple library concentrations
This example is illustrated by library construction and on-machine sequencing on an Ion Torrent sequencing platform.
First, library construction
Fragmentation of nucleic acids
The nucleic acid is fragmented by an enzyme method, and the fragmentation enzyme is KAPA fragmentation enzyme. The specific process is as follows:
(1) taking 30 mu L of DNA nucleic acid with 10 different concentrations (each sample is repeated for 2 times), adding 5 mu L of fragmentation enzyme, 5 mu L of fragmentation Buffer, and supplementing to 50 mu L with water;
(2) mixing evenly, centrifuging instantaneously, and placing the reaction tube in a PCR instrument for reaction;
(3) the reaction procedure is as follows: 4 ℃, 1 min; at 37 ℃ for 40 min; 4 ℃, Hold;
(4) after the reaction is finished, adding 5 mu L of termination buffer solution, mixing uniformly in a vortex mode, and centrifuging instantaneously;
(5) purification was performed using 1.8 × AMPure XP magnetic beads, and the nucleic acids were eluted with 13 μ L of nuclease-free water.
Add-on and shell-missing repair
(6) Taking 12.5. mu.L of the fragmented nucleic acid
(7) mu.L of nuclease-free water, 5. mu.L of ligase Buffer, 1. mu.L of dNTP, 1. mu.L of ligase, 4. mu.L of shell-missing repair enzyme, 1. mu.L of universal linker, 1. mu.L of linker containing Barcode X (each sample using a different Barcode) were added in sequence
(8) Mixing, instantaneous centrifuging, and placing the reaction tube in a PCR instrument
(9) Reaction procedure: at 25 ℃ for 20 min; 72 ℃ for 5 min; hold at 4 deg.C
(10) After the reaction is finished, purifying by using 1.5 multiplied by AMPure XP magnetic beads; nucleic acids were eluted with 21. mu.L of nuclease-free water.
Library amplification
(11) mu.L of the above product was taken, 10. mu.L of 5 XFidelity Buffer, 1.5. mu.L of dNTPs (10mM), 1.5. mu.L of the forward primer (10. mu.M), 5. mu.L of the magnetic bead of the reverse primer, and 1. mu.L of LKAPA HiFi Hotstar DNA polymerase were added thereto, and 50. mu.L was supplemented with nuclease-free water, mixed well, subjected to flash centrifugation, and the reaction tube was set in a PCR apparatus. (12) The reaction procedure is as follows: pre-denaturation at 95 ℃ for 3 min; circulating phase at 98 deg.C for 20s → 60 deg.C for 15s → 72 deg.C for 20s, circulating for 25 times, and extending at 72 deg.C for 1 min; 4 ℃ and Hold.
(12) After the reaction is finished, placing the reaction tube on a magnetic frame/plate, standing for 5-10min until the solution becomes clear, and discarding the supernatant;
(13) adding 200 μ L of 70% ethanol, standing at room temperature for 1min, and removing supernatant;
(14) repeating the previous step once;
(15) placing the reaction tube on a magnetic frame/plate, opening the cover and placing for 3-5min until the magnetic beads are dried;
(16) adding 18 μ L of 1X CutSmart buffer and 2 μ L of USER enzyme, mixing, and incubating at 37 deg.C for 15 min;
(17) placing the reaction tube on a magnetic frame, and standing for 5-10min until the solution becomes clear.
(18) The supernatant was transferred to a new centrifuge tube, purified by adding 1.5 Xmagnetic beads, and eluted with 20. mu.L of nuclease-free water. Quantification was performed using Qubit and fluorescent quantitative PCR.
Second, computer sequencing
The library prepared above was taken in 10 samples at the initial concentration and mixed in equal volumes, e.g., 5. mu.L each. Then quantifying, and taking a proper volume to perform emulsion PCR, template preparation and on-machine sequencing according to a quantitative result.
Third, the detection result
The results are shown in Table 1, comparing the concentration of the library constructed from each sample with the amount of data generated by sequencing. Wherein the library concentration includes the results of quantification with the Qubit and the results of quantification with the qPCR. As can be seen from Table 1, when the initial input concentration of nucleic acid is 0.0001 ng/. mu.L or more, even if the concentration difference of the library is 10000 times, the concentration difference of the finally generated library is within 5%, i.e., the precision of the generated library is less than 5%. The final yield data amount difference is within 5%. It can be seen that even though the initial input nucleic acid concentration is greatly different, the output library concentration can be controlled to a similar level by using the library construction method. The method brings convenience to library construction, and the conditions of insufficient library concentration and nucleic acid input quantity and the like do not need to be considered when library construction is started. The library construction process is simplified.
Real-time example 3
Application of the invention in pathogen sequencing detection
Clinical pathogen sequencing detection involves a wide variety of clinical specimen types, including peripheral blood, alveolar lavage fluid, sputum, pus, cerebrospinal fluid, urine, pleural fluid, ascites, tissues, and the like. The number of cells contained in different sample types is very different, and the concentration of extracted nucleic acid is very different. The traditional sequencing detection technology has complex operation flow, needs strict sample quantification and has long detection period.
The invention can detect nucleic acids of different sample types simultaneously in one detection. In the invention, 2 samples of five types of samples, namely peripheral blood, cerebrospinal fluid, alveolar lavage fluid, pus and urine, are selected, 10 samples are subjected to chip sequencing detection, and all the samples come from clinical hospitals. The detection process is as follows
Firstly, extracting nucleic acid
The nucleic acid extraction and the quantification are carried out by adopting a conventional extraction technology, and the quantification result of the Qubit is shown in Table 2, so that the nucleic acid concentration difference of some sample types is large, and the concentration of some samples cannot meet the nucleic acid input quantity of the conventional library building sample.
TABLE 1 comparison of sample libraries at different concentrations
TABLE 2 concentration of nucleic acids extracted from different samples
| Sample numbering | Extracting a sample volume | Qubit concentration (ng/. mu.L) |
| Peripheral blood-1 | 1mL | 98.2 |
| Peripheral blood-2 | 0.5mL | 54.3 |
| Cerebrospinal fluid-1 | 2mL | 10.2 |
| Cerebrospinal fluid-2 | 1mL | 0.18 |
| Alveolar lavage fluid-1 | 0.5mL | 20.3 |
| Alveolar lavage fluid-2 | 0.5mL | 120.5 |
| Pus-1 | 0.2mL | 5.5 |
| Pus-2 | 0.5mL | 18.9 |
| Urine 1 | 3mL | 0.5 |
| Urine-2 | 5mL | 1.58 |
Second, library construction
Library construction Using two methods
The first method is to adopt the method of the invention to construct the library and carry out the sequencing on a computer, and the operation method refers to the example 2.
The second method is to construct the library by adopting an Ion Torrent library construction operation process, wherein the operation method comprises the following steps:
fragmentation
(1) Taking 50ng of DNA nucleic acid prepared by the sample (taking the maximum volume of the sample less than 10 ng), adding 5 uL FRG-MTX (provided in MAPMIM sample preparation kit), 5 uL fragmentation Buffer and 10 uL fragmentation enzyme, and supplementing to 50 uL with water;
(2) mixing evenly, centrifuging instantaneously, and placing the reaction tube in a PCR instrument for reaction;
(3) the reaction procedure is as follows: 4 ℃, 1 min; at 37 ℃ for 40 min; 4 ℃ and Hold.
(4) After the reaction is finished, adding 5 mu L of termination buffer solution, mixing uniformly in a vortex mode, and centrifuging instantaneously;
(5) purifying with 1.8 × AMPure XP magnetic bead; eluting the nucleic acid with 13 μ L nuclease-free water;
(6) adding a joint;
(7) taking 12.5 mu L of the fragmented nucleic acid;
(8) adding 24.5 μ L of nuclease-free water, 5 μ L of ligase Buffer, 1 μ L of dNTP, 1 μ L of LDNA ligase, 4 μ L of shell-lacking repair enzyme, 1 μ L of universal linker, and 1 μ L of linker containing Barcode X (each sample adopts different Barcode);
(9) mixing evenly, centrifuging instantaneously, and placing the reaction tube in a PCR instrument;
(10) reaction procedure: at 25 ℃ for 20 min; 72 ℃ for 5 min; hold at 4 ℃;
(11) after the reaction is finished, purifying by using 1.5 multiplied by AMPure XP magnetic beads; elute the nucleic acid with 14. mu.L TE;
(12) library amplification
(13) Adding 50 mul PCR mixed solution and 2.5 mul amplification primer into 12.5 mul nucleic acid solution with adaptor;
(14) mixing evenly, centrifuging instantaneously, and placing the reaction tube in a PCR instrument;
(15) reaction procedure: pre-denaturation at 95 deg.C for 5 min; circulating phase (7 cycles) at 95 deg.C for 15s, 58 deg.C for 15s, and 70 deg.C for 1 min; 4 ℃, Hold;
(16) after the reaction is finished, purifying by using 1.5 multiplied by AMPure XP magnetic beads; quantification was performed with 20 μ L nuclease-free, with Qubit and qPCR, and the corresponding concentrations were recorded.
Sequencing on machine
Library mixing: library mixing was performed at equivalent quantitative concentrations of material according to qPCR quantitation concentrations, and the library was diluted to 100 pM.
Emulsion PCR: a20. mu.L portion of the mixed library was collected and processed according to the emulsion PCR protocol.
Preparing an upper machine template: enriching and purifying the emulsion PCR product, and denaturing into single chains;
chip Loading and on-machine sequencing: and operating the prepared single-chain library according to the chip Loading operation flow, and operating the single-chain library on a computer to start a sequencing related program.
Three, two database construction methods for comparing sequencing results
Two library construction methods are adopted for library construction and on-machine sequencing, and the data volume produced by sequencing is shown in Table 3. Through comparison, the final output data volume distribution of different types of samples is relatively uniform, the data volume distribution difference is within 5%, while the final sample output data volume difference is relatively large and close to 80% by adopting a traditional library building method, and the difference between the reads numbers (the maximum value: 25154932 and the minimum value 1215646) of the maximum data volume sample and the minimum data volume sample is 24M is more than 1 order of magnitude. Therefore, the method of the invention can effectively balance the built library. Can be better applied to the fields of pathogen sequencing and the like.
TABLE 3 comparison of the Balanced library construction method with the conventional library construction method
The foregoing is directed to embodiments of the present invention and, more particularly, to a method and apparatus for controlling a power converter in a power converter, including a power converter, a power.
Claims (10)
1. A library construction method for equalizing library concentrations, comprising: the steps of nucleic acid fragmentation, adaptor addition and library amplification are characterized in that the concentration of each sample library is balanced mainly through the step of library amplification.
2. The library construction method for equalizing library concentration according to claim 1, wherein the nucleic acid fragmentation and linker addition are performed by the following steps: performing nucleic acid fragmentation and linker addition according to the requirements of different sequencing platforms, wherein the fragmentation can adopt conventional fragmentation methods, including a mechanical fragmentation method and an enzymatic fragmentation method; the initial nucleic acid concentration may be 0.1pg/μ L to 100ng/μ L; the nucleic acid with the linker added thereto was purified using 1.8 Xmagnetic beads.
3. The library construction method for equalizing the concentration of the library according to claim 1, wherein the specific operation steps of library amplification are as follows: the amplification system is a 50-mu-L reaction system, nuclease-free water, 20 mu-L of a product added with a linker, 10 mu-L of 5 XFidelity Buffer, 1.5 mu-L of dNTPs (10mM), 1.5 mu-L of an upstream primer (10 mu M), 5 mu-L of a downstream primer magnetic bead and 1 mu-L of LKAPA HiFi Hotstar DNA polymerase are sequentially added according to requirements, mixed uniformly and placed in a PCR instrument for reaction.
4. The library construction method for equalizing the concentration of the library according to claim 3, wherein the reaction procedure of the reaction is as follows: 3min at 95 ℃; 20s → 60 deg.C 15s → 72 deg.C 20s at 98 deg.C, circulating for 25-30 times, and 72 deg.C for 1 min; the downstream primer magnetic beads are streptavidin magnetic beads, and the concentration of the streptavidin magnetic beads is 10 mg/mL; a downstream primer is combined on the surface of the magnetic bead, and the downstream primer is combined with streptavidin on the surface of the magnetic bead through biotin; the concentration of the primer bound to the magnetic beads was 0.2 pmol/. mu.L.
5. The library construction method for equalizing library concentration according to claim 4, wherein the preparation process of the downstream primer magnetic beads comprises the following steps:
step S1: taking 100 mu L of uniformly mixed streptavidin magnetic beads, adding 1mL of 1 XB & W buffer solution, and uniformly mixing;
step S2: placing the reaction tube on a magnetic frame for 2min, and discarding the supernatant;
step S3: taking the reaction tube off the magnetic frame, adding 100 mu L of 1 XB & W buffer solution, and resuspending the magnetic beads;
step S4: repeating the step 2-3 twice, and repeating the step 3 times in total;
step S5: placing the accommodating tube on a magnetic frame for 2min, and removing the supernatant;
step S6: adding 200. mu.L of 2 XB & W buffer solution, adding the equal volume of 10. mu.M downstream primer, and incubating for 10min at room temperature;
step S7: placing the reaction tube on a magnetic frame, standing for 5min until the solution becomes clear, and discarding the supernatant;
step S8: washing with 1 XB & W buffer for 2 times;
step S9: and (5) resuspending the magnetic beads by 1000 mu L of nuclease-free water to obtain the downstream primer magnetic beads.
6. The library construction method for equalizing library concentration according to claim 5, wherein the 2 XB & W buffer consists of: 10mM Tris-HCl (pH7.5), 1mM EDTA; 2M NaCl; the 1 XB & W buffer solution is obtained by diluting a2 XB & W buffer solution to half of the original concentration; the 5' of the downstream primer is modified with biotin.
7. The library construction method for equalizing library concentration according to claim 3, wherein the upstream primer and the downstream primer magnetic beads have different primer sequences according to the selected library construction platform; if an Illumina sequencing platform is adopted, the sequence of the upstream primer is S1: AATGATACGGCGACCACCGAGATCT, respectively; the downstream primer magnetic bead sequence is A1-B: Biotin-TTTTT (C3spacer) TUCAAGCAGAAGACGGCATACGAGAT; if an Ion Torrent sequencing platform is adopted, the sequence of the upstream primer is S2: CCATCTCATCCCTGCGTGTCTCCGAC; the downstream primer magnetic bead sequence is A2-B: Biotin-TTTTT (C3spacer) TUCCACTACGCCTCCGCTTTCCTCTC.
8. The library construction method for equalizing library concentration according to claim 5, wherein, in the downstream primer, Biotin represents a Biotin label, and C3 spcaer is a C3 modification for terminating the amplification reaction; the U base in the downstream primer can be cut by the action of USER enzyme, so that the synthesized double-stranded nucleic acid is separated from the streptavidin magnetic bead and is used for recovering the constructed library.
9. Use of a library construction method according to any of claims 1 to 8 for equalizing the concentration of a library, comprising amplification of the library for purification and recovery and on-machine sequencing.
10. The method of claim 1, wherein the library purification and recovery comprises the following steps:
(1) after the reaction is finished, placing the reaction tube on a magnetic frame/plate, standing for 5-10min until the solution becomes clear, and discarding the supernatant;
(2) adding 200 μ L of 70% ethanol, standing at room temperature for 1min, and removing supernatant;
(3) repeating the previous step once;
(4) placing the reaction tube on a magnetic frame/plate, opening the cover and placing for 3-5min until the magnetic beads are dried;
(5) adding 18 μ L of 1X CutSmart buffer and 2 μ L of USER enzyme, mixing, and incubating at 37 deg.C for 15 min;
(6) placing the reaction tube on a magnetic frame, and standing for 5-10min until the solution becomes clear.
(7) Transferring the supernatant into a new centrifuge tube, adding 1.8 Xmagnetic beads for purification, and eluting with 50. mu.L nuclease-free water;
the computer sequencing specifically comprises the following steps: mixing the prepared library according to the equal volume, and performing on-machine sequencing according to the requirement of the selected sequencing platform; and counting the output data volume of each sample; the amount of data produced by each sample of the library prepared by this technique varied by no more than 10%.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110296224.1A CN113061647A (en) | 2021-03-19 | 2021-03-19 | Library construction method for balancing library concentration and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110296224.1A CN113061647A (en) | 2021-03-19 | 2021-03-19 | Library construction method for balancing library concentration and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN113061647A true CN113061647A (en) | 2021-07-02 |
Family
ID=76562445
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110296224.1A Withdrawn CN113061647A (en) | 2021-03-19 | 2021-03-19 | Library construction method for balancing library concentration and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113061647A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112458544A (en) * | 2020-01-22 | 2021-03-09 | 微岩医学科技(北京)有限公司 | Library construction method for balancing library concentration |
| CN113588392A (en) * | 2021-07-28 | 2021-11-02 | 北京金匙基因科技有限公司 | Quantitative sample mixing method for improving sequencing sample mixing uniformity |
-
2021
- 2021-03-19 CN CN202110296224.1A patent/CN113061647A/en not_active Withdrawn
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112458544A (en) * | 2020-01-22 | 2021-03-09 | 微岩医学科技(北京)有限公司 | Library construction method for balancing library concentration |
| CN112458544B (en) * | 2020-01-22 | 2022-10-28 | 微岩医学科技(北京)有限公司 | Library construction method for balancing library concentration |
| CN113588392A (en) * | 2021-07-28 | 2021-11-02 | 北京金匙基因科技有限公司 | Quantitative sample mixing method for improving sequencing sample mixing uniformity |
| CN113588392B (en) * | 2021-07-28 | 2022-03-04 | 北京金匙基因科技有限公司 | Quantitative sample mixing method for improving sequencing sample mixing uniformity |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107190329B (en) | Fusion based on DNA is quantitatively sequenced and builds library, detection method and its application | |
| CN113061647A (en) | Library construction method for balancing library concentration and application thereof | |
| CN110114472A (en) | The method that linear sequencing library is converted into cyclic annular sequencing library | |
| CN108998508B (en) | Construction method of amplicon sequencing library, primer group and kit | |
| CN104480214B (en) | Methylolation and the long sequence label sequencing technologies that methylate | |
| CN109486923B (en) | Primer system for sequencing multiple amplicons, application thereof and method for constructing sequencing library | |
| CN108517567B (en) | Adaptor, primer group, kit and library construction method for cfDNA library construction | |
| CN108103164B (en) | Method for detecting copy number variation by using multiple fluorescent competitive PCR | |
| CN106011230A (en) | Primer composition for detecting fragmentized DNA target area and application thereof | |
| WO2016023431A1 (en) | Wash solution and washing method for hybrid-enrichment-capture dna sequencing library | |
| CN111748628B (en) | Primer and kit for detecting thyroid cancer prognosis related gene variation | |
| CN111979307A (en) | Targeted sequencing method for detecting gene fusion | |
| EP3536803A1 (en) | Quantitative cluster analysis method of target protein by using next-generation sequencing and use thereof | |
| CN109295500B (en) | Single cell methylation sequencing technology and application thereof | |
| CN112646859B (en) | Macrogenomics-based respiratory tract pharynx swab sample database building method and pathogen detection method | |
| CN106906210A (en) | A kind of fusion primer combination of rapid build amplification sublibrary | |
| CN112458544B (en) | Library construction method for balancing library concentration | |
| WO2012083845A1 (en) | Methods for removal of vector fragments in sequencing library and uses thereof | |
| CN114277114B (en) | Method for adding unique identifier in amplicon sequencing and application | |
| CN116463408A (en) | ABO gene amplification primer, amplification system, amplification method, sequencing library construction method and sequencing method | |
| CN111926394B (en) | Database building method and detection kit based on metagenomics | |
| CN107904297B (en) | Primer group, joint group and sequencing method for microbial diversity research | |
| CN114657247A (en) | DNA methylation biomarker or combination for early liver cancer detection and application thereof | |
| WO2020135650A1 (en) | Method for constructing a gene sequencing library | |
| CN113046415A (en) | Construction method and application of RNA sequencing library |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WW01 | Invention patent application withdrawn after publication |
Application publication date: 20210702 |
|
| WW01 | Invention patent application withdrawn after publication |