CN112680539A

CN112680539A - Wheat haploid plant screening method induced by wheat TaMTL gene knockout mutant

Info

Publication number: CN112680539A
Application number: CN202110015401.4A
Authority: CN
Inventors: 叶兴国; 唐华丽; 王轲; 刘会云; 林志珊; 贾子苗; 杜丽璞; 邱玉亮; 石磊; 梁小娜
Original assignee: Institute of Crop Sciences of Chinese Academy of Agricultural Sciences
Current assignee: Institute of Crop Sciences of Chinese Academy of Agricultural Sciences
Priority date: 2021-01-05
Filing date: 2021-01-05
Publication date: 2021-04-20

Abstract

The invention discloses a method for screening wheat haploid plants induced by a wheat TaMTL gene knockout mutant. The invention provides a method for identifying whether wheat to be detected is haploid wheat or not, which is to detect whether the genomic DNA of the wheat to be detected contains a bar gene and/or a Cas9 gene or not; if the genomic DNA of the wheat to be detected does not contain the bar gene and the Cas9 gene, the wheat to be detected is haploid wheat or candidate haploid wheat; and if the genomic DNA of the wheat to be detected contains a bar gene and/or a Cas9 gene, determining that the wheat to be detected is non-haploid wheat or candidate non-haploid wheat. The method provided by the invention can be used for quickly identifying the haploid induced by hybridization of the wheat TaMTL homozygous knockout mutant serving as a male parent and other wheat materials, and has important significance on wheat haploid breeding, DH colony construction, gene localization, target gene function research and the like.

Description

Wheat haploid plant screening method induced by wheat TaMTL gene knockout mutant

Technical Field

The invention relates to the technical field of biology, in particular to a method for screening wheat haploid plants induced by a wheat TaMTL gene knockout mutant.

Background

Wheat is one of the three staple food crops and provides about 20% of calories to humans. With the increase of population and social development, the demand of people for grain yield and high-quality special purpose is higher and higher. Therefore, it is important to cultivate new wheat varieties with high yield, high quality and disease resistance. The breeding of an excellent wheat variety in the traditional breeding needs at least 6-7 years, parthenogenesis or androgenesis is adopted for haploid breeding to generate haploids, homozygous doubled haploids are directly generated after doubling, homozygous diploid pure lines with all genes being homogeneous can be generated through one-time culture or induction, yield identification and adaptability tests can be participated after seeds are bred, the breeding process is greatly shortened, and the breeding efficiency is improved.

Wheat haploid plants were first obtained by anther ex vivo culture, after which researchers have gradually established new haploid induction methods such as microspore culture, heterologous species pollen induction (including maize, sorghum, pearl millet, barley, etc.), induction by physical radiation and chemical treatment, delayed pollination induction, etc. In corn, Stock 6, called a haploid inducer line, was found to induce the female parent to produce 2.0-3.0% haploid seeds as the male parent. And then, excellent haploid induction lines such as WS14, MHI, RWS, PHI, BHI306 and CAU5 are cultivated, and the corn haploid plant induction rate reaches 8.0-16.0%. Further, by means of fine positioning, genome sequencing, genetic complementation and the like, haploid induction in the corn is proved to be caused by frame shift mutation of a sperm cytoplasm specific phospholipase MTL coding gene, a corn ZmMTL (ZmPLA1) gene is cloned, and the gene is found to have high conservation in crops such as rice, wheat, barley and the like.

Meanwhile, gene editing technology represented by CRISPR/Cas9 is rapidly developed and widely applied to plants. The ZmPLA1 gene of the corn is knocked out by using a CRISPR/Cas9 technology, the inbred of the plant is knocked out or the plant is used as a male parent to be hybridized with other inbred lines, and the haploid inductivity is 2.0-6.7%. By adopting an embryo specific promoter ZmESP and an endosperm specific promoter HvASP, a double-fluorescence haploid screening and marking identification system of embryo specific expression green fluorescent protein (eGFP) and endosperm specific expression red fluorescent protein (DsRED) is constructed, and the obtained induction system can efficiently induce haploid, and the average induction rate is 7.5%. Aiming at homologous gene OsMTL of ZmMTL gene in rice, target gRNA edited by CRISPR/Cas9 gene is designed for mutation, and the average haploid inductivity in selfed progeny is about 6.0%. Recent studies show that homologous genes TaPLA-4A and TaPLA-4B of ZmMTL in wheat are knocked out by using CRISPR/Cas9 gene editing technology, and the haploid inductivity is 2-3% (Liu et al, Plant Biotechnology Journal, 2020, 18: 316-318). On the basis of optimizing a wheat CRISPR/Cas9 editing system, 3 homologous genes TaMTL-4A, TaMTL-4B, TaMTL-4D of ZmMTL in wheat are knocked out simultaneously by using a wheat TaU6 promoter and a double-target strategy, the haploid induction rate of TaMTL-4A and TaMTL-4D when mutation occurs is about 10 percent, the haploid induction rate of TaMTL-4A, TaMTL-4B, TaMTL-4D when mutation occurs simultaneously is 11.8-31.6 percent, and embryo-free type and embryo-endosperm double-free type grains are found in cereal crops for the first time (Liu et al, Journal of Experimental Botany, 2020, 71: 1337-1349).

The wheat haploids can be identified at the plant level by using methods such as cytology, cytogenetics, genomics, morphology and the like, and comprise guard cell length, chromosome number, total DNA, flow cytoploidy, gene copy number, plant height and the like. Wheat plants induced by anther culture, ovary culture, distant hybridization and other technologies are almost all haploids, and homozygous diploid plants can be obtained by directly carrying out chromosome doubling treatment on all the wheat plants. However, the grains of the wheat induction line created by knocking out the TaMTL gene through the CRISPR/Cas9 technology after being hybridized with other varieties have haploid and diploid, and the grains have no difference in appearance and shape. As the frequency of inducing wheat haploids by a TaMTL gene knockout induction line is lower, from the breeding perspective, haploids need to be identified rapidly and accurately in a large amount in the seedling germination stage so as to carry out chromosome doubling on the haploids in time. However, among the existing methods for identifying wheat haploids, some methods are complex in operation, time-consuming, require special instruments and equipment, some methods require more samples or can be carried out when the plant grows to be large enough, are not suitable for large-scale identification of haploids in the seedling germination stage, and a method for rapidly and accurately identifying haploids induced by a haploidy induction line created by knocking out wheat TaMTL gene by using CRISPR/Cas9 technology in the seedling germination stage needs to be developed.

Disclosure of Invention

The invention aims to solve the technical problem of how to screen haploid plants induced by a haploid induction line created by knocking out wheat TaMTL gene by using CRISPR/Cas9 technology.

In order to solve the technical problems, the invention firstly provides a method for identifying or assisting in identifying whether wheat to be detected is haploid wheat or not, which is to detect whether the genomic DNA of the wheat to be detected contains a bar gene and/or a Cas9 gene or not; if the genomic DNA of the wheat to be detected does not contain the bar gene and the Cas9 gene, the wheat to be detected is haploid wheat or candidate haploid wheat; if the genomic DNA of the wheat to be detected contains a bar gene and/or a Cas9 gene, the wheat to be detected is non-haploid wheat or candidate non-haploid wheat; the nucleotide sequence of the bar gene is shown as SEQ ID NO: 1 is shown in the specification; the nucleotide sequence of the Cas9 gene is shown as SEQ ID NO: 2, respectively.

In the above method, the method for detecting whether the genomic DNA of wheat to be detected contains the bar gene and/or the Cas9 gene is (1) or (2) as follows:

(1) sequencing;

(2) carrying out PCR amplification on a wheat sample to be detected by using a primer combination;

the primer combination consists of a primer pair A (for amplifying a specific fragment of the bar gene) and a primer pair B (for amplifying a specific fragment of the Cas9 gene);

the primer pair A consists of a primer 1 and a primer 2;

the primer 1 is a1) or a2) as follows:

a1) SEQ ID NO: 3, a single-stranded DNA molecule;

a2) a single-stranded DNA molecule which is obtained by carrying out deletion, insertion and/or change of one or more bases on the single-stranded DNA molecule defined by a1) and has the same function as the single-stranded DNA molecule defined by a 1);

the primer 2 is b1) or b2) as follows:

b1) SEQ ID NO: 4, a single-stranded DNA molecule;

b2) a single-stranded DNA molecule which is obtained by carrying out deletion, insertion and/or change of one or more bases on the single-stranded DNA molecule defined by b1) and has the same function as the single-stranded DNA molecule defined by b 1);

the primer pair B consists of a primer 3 and a primer 4;

the primer 3 is the following c1) or c 2):

c1) SEQ ID NO: 5, a single-stranded DNA molecule;

c2) single-stranded DNA molecules obtained by deleting, inserting and/or changing one or more bases of the single-stranded DNA molecules limited by c1) and having the same functions as the single-stranded DNA molecules limited by c 1);

the primer 4 is d1) or d2) as follows:

d1) SEQ ID NO: 6;

d2) the single-stranded DNA molecule with the same function as the single-stranded DNA molecule defined by d1) is obtained by deleting, inserting and/or changing the single-stranded DNA molecule defined by d1) by one or more bases.

In order to solve the technical problem, the invention also provides a method for identifying or assisting in identifying whether the wheat to be detected is haploid wheat, which comprises the following steps: respectively carrying out PCR amplification by using genome DNA of wheat to be detected as a template and using a primer pair A and a primer pair B, detecting the size of an amplification product, and determining whether the wheat to be detected is haploid wheat according to the size of the amplification product by the following method: if the amplification product of the wheat sample to be detected contains a strip with the size of 430bp and/or 706bp, the wheat sample to be detected is non-haploid wheat or candidate non-haploid wheat; if the amplified product of the wheat to be identified does not contain bands with the sizes of 430bp and 706bp, the wheat sample to be detected is haploid wheat or candidate haploid wheat.

In the method, the primer pair A consists of a primer 1 and a primer 2;

the primer 1 is a1) or a2) as follows:

a1) SEQ ID NO: 3, a single-stranded DNA molecule;

the primer 2 is b1) or b2) as follows:

b1) SEQ ID NO: 4, a single-stranded DNA molecule;

the primer pair B consists of a primer 3 and a primer 4;

the primer 3 is the following c1) or c 2):

c1) SEQ ID NO: 5, a single-stranded DNA molecule;

the primer 4 is d1) or d2) as follows:

d1) SEQ ID NO: 6;

In the embodiment of the present invention, the PCR reaction procedures adopted by the PCR amplification are respectively:

PCR reaction program (amplification of bar gene specific fragment) of the primer pair A: pre-denaturation at 95 ℃ for 5 min; the following 3 reaction sequences were then carried out: denaturation: 95 ℃ for 30s, annealing: 60 ℃ 20s, extension: 30s at 72 ℃ for 28 cycles; finally, extension is carried out for 10min at 72 ℃.

PCR reaction procedure for primer pair B (amplification of Cas9 gene specific fragment): pre-denaturation at 95 ℃ for 5 min; the following 3 reaction sequences were then carried out: denaturation: 95 ℃ for 30s, annealing: 56 ℃ 20s, extension: 40s at 72 ℃ for 35 cycles; finally, extension is carried out for 10min at 72 ℃.

In order to solve the technical problems, the invention also provides application of the haploid wheat obtained by the identification method in wheat breeding and/or functional genome research.

The invention also provides a wheat breeding method, namely method A or method B;

the method A comprises the following steps: detecting whether the genome of the wheat to be detected contains a bar gene and a Cas9 gene, and selecting the wheat to be detected, the genome of which does not contain the bar gene and the Cas9 gene, for breeding;

the method B comprises the following steps: the haploid wheat is screened out by the method for breeding.

The invention also develops a primer combination for identifying whether the wheat to be detected is haploid wheat, which consists of a primer pair A and a primer pair B;

the primer pair A consists of a primer 1 and a primer 2;

the primer 1 is a1) or a2) as follows:

a1) SEQ ID NO: 3, a single-stranded DNA molecule;

the primer 2 is b1) or b2) as follows:

b1) SEQ ID NO: 4, a single-stranded DNA molecule;

the primer pair B consists of a primer 3 and a primer 4;

the primer 3 is the following c1) or c 2):

c1) SEQ ID NO: 5, a single-stranded DNA molecule;

the primer 4 is d1) or d2) as follows:

d1) SEQ ID NO: 6;

The invention also provides an application of the primer combination, which is any one of the following (1) to (3):

(1) screening or auxiliary screening wheat haploids;

(2) preparing a product for screening or auxiliary screening of wheat haploids;

(3) and (5) wheat breeding.

In the invention, the wheat to be detected is a filial generation obtained by hybridizing the wheat TaMTL gene knockout homozygous mutant serving as a male parent and a common wheat material serving as a female parent. The filial generation is specifically a filial generation F₁And (4) generation.

The wheat TaMTL gene knockout homozygous mutant is target wheat which is obtained by knocking out a TaMTL gene in wheat by using a CRISPR/Cas9 technology and contains the bar gene and the Cas9 gene.

In order to solve the technical problems, the invention also provides the application of the method in identifying the wheat haploid induced by the haploid induction line; the haploid induction line is obtained by utilizing CRISPR/Cas9 technology to knock out wheat TaMTL gene.

The CRISPR/Cas9 technique employed in particular embodiments of the invention involves two target sequences, CCCGTCCAGCTCCTGCAGCTTGG and CCTCAGCGATGCGGTCACCGCGG, respectively.

More specifically, the invention uses a recombinant vector pWMB110-SpCas9-TaU3-RRU (TaMTL) capable of expressing a guide RNA and Cas 9.

The invention provides a method for rapidly identifying a haploid plant induced by a haploid induction line created by knocking out a wheat TaMTL gene by using a CRISPR/Cas9 technology. Experiments prove that the method can effectively identify the haploid plants induced by the haploid induction line created by knocking out the wheat TaMTL gene by using the CRISPR/Cas9 technology, and is suitable for the rapid identification of large-batch haploid seedlings. Therefore, the method provided by the invention can be used for quickly identifying haploid seedlings induced by hybridization of a wheat TaMTL homozygous knockout mutant (carrying a bar gene and a Cas9 gene) serving as a male parent and other wheat materials serving as a female parent, and has important significance for wheat haploid breeding, DH population construction, gene localization, target gene function research and the like.

Drawings

FIG. 1 shows the Fielder × homozygous TaMTL knockout mutant F of wheat variety by using bar gene specific primers₁Detecting the generation plants; wherein, M: DNAmarker; lane 1: a transgenic plant containing a bar gene is used as a positive control; lane 2: wheat variety Fielder, as negative control; lanes 3-16: wheat variety Fielder x homozygous TaMTL knockout mutant F₁And (5) plant generation.

FIG. 2 shows the hybridization F of Fielder × homozygous TaMTL knockout mutant of wheat variety by using Cas9 gene specific primers₁Detecting the generation plants; wherein, M: DNA marker; lane 1: transgenic plants containing Cas9 gene, as positive control, lane 2: wheat variety Fielder, as negative control; lanes 3-16: wheat variety Fielder x homozygous TaMTL knockout mutant F₁And (5) plant generation.

FIG. 3 shows the wheat variety Fielder × homozygous TaMTL knockout mutant hybrid F₁Detecting the chromosome of the haploid plant in the generation; wherein, a: wheat variety Fielder, the number of chromosomes is 42; b-f: wheat variety Fielder x homozygous TaMTL knockout mutant F₁The number of chromosomes of the detected haploid plants in the generation is 21.

FIG. 4 is a TaMTL gene double-target point fixed-point editing vector pWMB110-SpCas9-TaU3-RRU (TaMTL) map.

Detailed Description

The present invention is described in further detail below with reference to specific embodiments, which are given for the purpose of illustration only and are not intended to limit the scope of the invention. The examples provided below serve as a guide for further modifications by a person skilled in the art and do not constitute a limitation of the invention in any way.

The experimental procedures in the following examples, unless otherwise indicated, are conventional and are carried out according to the techniques or conditions described in the literature in the field or according to the instructions of the products. Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

The wheat variety in the following examples is Fielder (Riaz et al. overexpression of mail ZmC1 and ZmR transcription factors in white translation enzymes in a tissue-specific manager. International Journal of Molecular Science, 2019, 20: 5806; Wang et al. Generation of marker-free transformed genetic maize of Molecular biology in a commercial maize biology variety. plant technology Journal, 2017, 15: 614), available from the institute of agricultural crops for repeating the experiments of the present application, not for other uses.

The vector pWMB110 (Wang et al Generation of marker-free transgenic microorganism in vitro-mediated co-transformation strategy in commercial Chinese plant biology Journal, 2017, 15: 614) in the following examples was publicly available from the institute of agricultural science and crop for the purpose of repeating the experiments of this application and was not usable for other purposes.

Example 1 obtaining of wheat TaMTL knockout mutant Material

Selection of wheat TaMTL gene target site and construction of knockout vector

1. Selection of wheat TaMTL Gene target sites

2 gRNA target spots gM179(sgRNA 1: CCCGTCCAGCTCCTGCAGCTTGG, respectively targeting 192. sup. st 170 + of CDS region of TaMTL-4A gene, 195. sup. th 173 + of CDS region of TaMTL-4B gene, 192. sup. th 170 + of CDS region of TaMTL-4D gene) and gM471(sgRNA 2: CCTCAGCGATGCGGTCACCGCGG, respectively targeting 396. sup. th + of CDS region of TaMTL-4A gene, 374. sup. rd + of CDS region of TaMTL-4B gene, 374. sup. rd + 396. sup. th of CDS region of TaMTL-4D gene) are designed according to the sequences of wheat endogenous genes TaMTL-4A (TravesCS 4A02G018100), TaMTL-4B (TraveCS 4D. sup. th 02 + 195. sup. th + of CDS region of TaMTL-4B gene).

2. Construction of TaMTL Gene site-directed editing vector

The nucleotide sequence is shown as SEQ ID NO: 2, inserting the encoding gene of the SpCas9 shown in the figure into a pWMB110 vector driven by a maize Ubi promoter to construct a pWMB110-SpCas9 vector, and then constructing a TaU3 promoter derived from wheat onto a pWMB110-SpCas9 vector to generate a pWMB110-SpCas9-TaU3 vector. The pWMB110-SpCas9-TaU3 vector is digested by MluI (FD0564, Thermo Fisher Scientific) and SgI (FD1894, Thermo Fisher Scientific), sgRNA1 and sgRNA2 are inserted respectively to construct a TaMTL gene double-target fixed-point editing vector pWMB110-SpCas9-TaU3-RRU (TaMTL) (as shown in FIG. 4, the specific method refers to "Liu et al.

II, obtaining wheat TaMTL knockout mutant material

The site-directed editing vector pWMB110-SpCas9-TaU3-RRU (TaMTL) is transferred into Agrobacterium rhizogenes C58C 1. A genome site-directed editing vector pWMB110-SpCas9-TaU3-RRU (TaMTL) of TaMTL is transformed into a immature embryo of a wheat variety Fielder by an Agrobacterium-mediated method, and a transgenic plant is obtained by callus induction culture, screening culture and differentiation culture (see' Wang et al, Generation of marker-free transgenic maize strain via an Agrobacterium-mediated co-transformation strain in commercial maize genetic maize variant. plant Biotechnology Journal, 2017, 15: 614-.

The obtained transgenic plants are respectively detected by using a specific primer pair Cas9-F/R (Cas 9F: AGGAGACTATCACCCCTTGGAAC; Cas 9R: TTGAAGGTAAGAGAGTCATCGTGG) of a Cas9 gene and a specific primer pair Bar-F/R (Bar-F: ACCATCGTCAACCACTACATCG; Bar-R: GCTGCCAGAAACCCACGTCATG) of a Bar gene. Screening transgenic plants containing Cas9 gene (PCR amplification product is 706bp DNA band) and bar gene (PCR amplification product is 430bp DNA band) as positive transgenic plants.

PCR amplification is carried out on the sequences at TaMTL-4A, TaMTL-4B and TaMTL-4D gene editing target points of positive transgenic plants respectively by using gene-specific primer pairs TaMTL-4A-F and TaMTL-4A-R (TaMTL-4A-F: CTAGCAAACCCACCAATTAC, TaMTL-4A-R: GATCCAAGTATAAAATTAGCATAT), TaMTL-4B-F and TaMTL-4B-R (TaMTL-4B-F: GTCAACCGAGGTGCCGTCAGTTTG, TaMTL-4B-R: CGTCATCGCCACCATCGTCTGC), TaMTL-4D-F and TaMTL-4D-R (TaMTL-4D-F: TTCAATCGATGGCAAGCTACTGGG, TaMTL-4D-R: CGTCATCGCCACCATCGTCTGC), and PCR enzyme digestion detection and PCR detection are carried out on sequencing products respectively by using Pst I (product of Thermo Fisher Scientific, product number FD0614) and PSo 91I (product of Thermo Fisher Scientific, product number FD0394), screening to obtain homozygous mutant TM-17 with TaMTL-4A, TaMTL-4B and TaMTL-4D genes knocked out simultaneously. Sequencing results show that compared with wild wheat (wheat variety Fielder), the homozygous mutant TM-17 has 291 bases (namely between the target points gM179 and gM 471) deleted at the 777-1067 th position of the TaMTL-4A genomic DNA (TramesCS 4A02G018100), has 292 bases (namely between the target points gM179 and gM 471) deleted at the 779-1070 th position of the TaMTL-4B genomic DNA (TramesCS 4B02G286000) and has 1 base (namely at the target point gM 179) deleted at the 775 th position of the TaMTL-4D genomic DNA (TramesCS 4D02G 284700).

Example 2 identification of wheat haploid plants induced by wheat TaMTL knockout mutant

First, wheat variety Fielder X homozygous TaMTL knockout mutant hybrid F₁Obtaining seed generations

The TaMTL homozygous mutant TM-17 containing the bar gene screening marker and the Cas9 gene created in example 1 is used as a male parent to be hybridized with a wheat variety Fielder as a female parent to obtain F₁And (5) seed generation.

Second, wheat variety Fielder x homozygous TaMTL knockout mutant hybrid F₁Detection of haploid plants in generation

(I) PCR-specific primer design

According to the Bar gene (SEQ ID NO: 1) and Cas9 gene sequences (SEQ ID NO: 2), a pair of specific primer pairs of Bar-F/R (consisting of Bar-F and Bar-R) and Cas9-F/R (consisting of Cas9F and Cas 9R) are respectively designed for detecting the wheat variety Fielder x homozygous TaMTL knockout mutant F₁The bar gene and the Cas9 gene in the generation plant. The primer sequences are as follows:

bar-F：ACCATCGTCAACCACTACATCG(SEQ ID NO：3)

bar-R：GCTGCCAGAAACCCACGTCATG(SEQ ID NO：4)

Cas9F：AGGAGACTATCACCCCTTGGAAC(SEQ ID NO：5)

Cas9R：TTGAAGGTAAGAGAGTCATCGTGG(SEQ ID NO：6)

(II) wheat variety Fielder x homozygous TaMTL knockout mutant F₁Plant genome extraction

The wheat variety Fielder x homozygous TaMTL knockout mutant F₁The generation seeds germinate, the extraction of genome DNA is carried out according to a single Plant in the seedling stage, and the specific operation steps are carried out according to the description in the Plant DNA extraction Kit instruction (CW0531M Nuclean Plant Genomic DNA Kit) produced by Jiangsukang, century Biotechnology GmbH.

(III) wheat variety Fielder x homozygous TaMTL knockout mutant F₁Detection of bar gene and Cas9 gene in generation plant

Detection of wheat variety Fielder x homozygous TaMTL knockout mutant F by Bar gene primer Bar-F/R and Cas9 gene primer Cas9-F/R respectively₁In the plant generationAnd a Cas9 gene. The primers were synthesized by Shanghai Sangong; 2 XEs Taq MasterMix (Dye) (CW0690L) was purchased from CWBIO reagent for PCR.

The specific PCR amplification conditions are as follows:

a bar gene: pre-denaturation at 95 ℃ for 5 min; the following 3 reaction sequences were then carried out: (1) denaturation: 95 ℃ for 30s, (2) annealing: 60 ℃ for 20s, (3) extension: 30s at 72 ℃ for 28 cycles; finally, extension is carried out for 10min at 72 ℃.

Cas9 gene: pre-denaturation at 95 ℃ for 5 min; the following 3 reaction sequences were then carried out: (1) denaturation: 95 ℃ for 30s, (2) annealing: 56 ℃ 20s, (3) extension: 40s at 72 ℃ for 35 cycles; finally, extension is carried out for 10min at 72 ℃.

The PCR products were analyzed on a 1% agarose gel.

The electrophoresis results are shown in FIGS. 1 and 2. As can be seen from FIG. 1, the bar gene specific band is not amplified in

lanes

5, 6, 8, 15, 16, and the 430bp band is amplified in

lanes

3, 4, 7, 9-14. As can be seen from FIG. 2, the Cas9 gene differential band was not amplified in any of

lanes

5, 6, 8, 15, and 16, and the band with a fragment size of 706bp was amplified in

lanes

3, 4, 7, and 9-14, which is consistent with the detection result using the bar gene specific primer.

The results show that the samples corresponding to

lanes

5, 6, 8, 15, and 16 are wheat variety Fielder × homozygous TaMTL knockout mutant F₁Haploid in generation, samples corresponding to

lanes

3, 4, 7 and 9-14 of the haploid are wheat variety Fielder x homozygous TaMTL knockout mutant F₁Diploid hybrids in the generation plants.

(IV) wheat variety Fielder x homozygous TaMTL knockout mutant F₁Cytogenetic verification of haploid plants in generations

Dropping the above F₁And carrying out chromosome number identification on the generation plants and the wheat variety Fielder to verify the accuracy of the identification method. The specific operation steps are as follows:

(1) wheat variety Fielder x homozygous TaMTL knockout mutant F₁Soaking the seeds in clear water overnight, transferring to a culture dish with filter paper for germination after germination, and wetting the filter paper with water. Followed by culturingPlacing the dish into an incubator at 25 ℃ for growth, and sampling when the length of the main root is 3-4 cm;

(2) a0.5 ml centrifuge tube was prepared and placed on ice and wetted with a spray can. Shearing about 1cm of main roots, putting the main roots into a centrifuge tube, numbering the main roots corresponding to seeds, and planting germinated seeds and a flowerpot after the root tips are taken; then putting the centrifugal tube filled with the root tip sample into a laughing gas tank, introducing gas for about 3min, closing a gas inlet valve, treating for 2h, taking out the centrifugal tube from the laughing gas tank, and putting the centrifugal tube on ice;

(3) fixing the root tip with 90% acetic acid for 5min, and cleaning with clear water for 3 times; putting into 70% ethanol, and storing in a refrigerator at-20 deg.C.

(4) Taking out the root tip with tweezers, placing on filter paper, sucking water, cutting off milky white part of the root tip on a glass slide, placing in prepared enzymolysis solution, and water-bathing at 37 deg.C for 50 min;

(5) after enzymolysis, the root tip is washed with a small amount of 70% alcohol for 2 times, 60 mul of alcohol is added, and the root tip is smashed by a dissecting needle and dissolved in alcohol in a tube. Centrifuging at 6000rpm for 2min, discarding supernatant, and inverting at room temperature for several minutes;

(6) add 30. mu.l of 100% acetic acid to the tube and place it on a vortex apparatus to gently vortex it to mix it well.

(7) Preparing a paper box in advance, wetting the paper box with clear water, placing a glass slide in the box, sucking 7 mu l of the suspension liquid obtained in the step 6 by using a liquid transfer machine, and dripping the suspension liquid on the glass slide;

(8) after the slide is dried, chromosome observation is carried out under a microscope.

The detection results are shown in fig. 3: a is root tip chromosome of wheat variety Fielder, the number is 42, pictures b, c, d, e, f correspond to 5 haploids identified in fig. 1 and 2, respectively (

lanes

5, 6, 8, 15, 16), and the number of chromosomes is 21.

Verification shows that bar gene and Cas9 gene specific primers are used for amplification to identify wheat material and homozygous TaMTL knockout mutant hybridization F₁The method for generating the monoploid plant is accurate and reliable.

The present invention has been described in detail above. It will be apparent to those skilled in the art that the invention can be practiced in a wide range of equivalent parameters, concentrations, and conditions without departing from the spirit and scope of the invention and without undue experimentation. While the invention has been described with reference to specific embodiments, it will be appreciated that the invention can be further modified. In general, this application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure as come within known or customary practice within the art to which the invention pertains. The use of some of the essential features is possible within the scope of the claims attached below.

Sequence listing

<110> institute of crop science of Chinese academy of agricultural sciences

<120> method for screening wheat haploid plants induced by wheat TaMTL gene knockout mutant

<130> GNCRJ210009

<160> 6

<170> SIPOSequenceListing 1.0

<210> 1

<211> 552

<212> DNA

<213> Artificial sequence

<400> 1

atgagcccag aacgacgccc ggccgacatc cgccgtgcca ccgaggcgga catgccggcg 60

gtctgcacca tcgtcaacca ctacatcgag acaagcacgg tcaacttccg taccgagccg 120

caggaaccgc aggagtggac ggacgacctc gtccgtctgc gggagcgcta tccctggctc 180

gtcgccgagg tggacggcga ggtcgccggc atcgcctacg cgggcccctg gaaggcacgc 240

aacgcctacg actggacggc cgagtcgacc gtgtacgtct ccccccgcca ccagcggacg 300

ggactgggct ccacgctcta cacccacctg ctgaagtccc tggaggcaca gggcttcaag 360

agcgtggtcg ctgtcatcgg gctgcccaac gacccgagcg tgcgcatgca cgaggcgctc 420

ggatatgccc cccgcggcat gctgcgggcg gccggcttca agcacgggaa ctggcatgac 480

gtgggtttct ggcagctgga cttcagcctg ccggtaccgc cccgtccggt cctgcccgtc 540

accgagattt ga 552

<210> 2

<211> 4203

<212> DNA

<213> Artificial Sequence

<400> 2

atggctccta agaagaagcg gaaggttggt attcacgggg tgcctgcggc tgacaagaag 60

tactccatcg gcctcgacat cggcaccaac agcgtcggct gggcggtgat caccgacgag 120

tacaaggtcc cgtccaagaa gttcaaggtc ctgggcaaca ccgaccgcca ctccatcaag 180

aagaacctca tcggcgccct cctcttcgac tccggcgaga cggcggaggc gacccgcctc 240

aagcgcaccg cccgccgccg ctacacccgc cgcaagaacc gcatctgcta cctccaggag 300

atcttctcca acgagatggc gaaggtcgac gactccttct tccaccgcct cgaggagtcc 360

ttcctcgtgg aggaggacaa gaagcacgag cgccacccca tcttcggcaa catcgtcgac 420

gaggtcgcct accacgagaa gtaccccact atctaccacc ttcgtaagaa gcttgttgac 480

tctactgata aggctgatct tcgtctcatc taccttgctc tcgctcacat gatcaagttc 540

cgtggtcact tccttatcga gggtgacctt aaccctgata actccgacgt ggacaagctc 600

ttcatccagc tcgtccagac ctacaaccag ctcttcgagg agaaccctat caacgcttcc 660

ggtgtcgacg ctaaggcgat cctttccgct aggctctcca agtccaggcg tctcgagaac 720

ctcatcgccc agctccctgg tgagaagaag aacggtcttt tcggtaacct catcgctctc 780

tccctcggtc tgacccctaa cttcaagtcc aacttcgacc tcgctgagga cactaagctt 840

cagctctcca aggataccta cgacgatgat ctcgacaacc tcctcgctca gattggagat 900

cagtacgctg atctcttcct tgctgctaag aacctctccg atgctatcct cctttcggat 960

atccttaggg ttaacactga gatcactaag gctcctcttt ctgcttccat gatcaagctc 1020

tacgacgagc accaccagga cctcaccctc ctcaaggctc ttgttcgtca gcagctcccc 1080

gagaagtaca aggagatctt cttcgaccag tccaagaacg gctacgccgg ttacattgac 1140

ggtggagcta gccaggagga gttctacaag ttcatcaagc caatccttga gaagatggat 1200

ggtactgagg agcttctcgt taagcttaac cgtgaggacc tccttaggaa gcagaggact 1260

ttcgataacg gcatcatccc tcaccagatc caccttggtg agcttcacgc catccttcgt 1320

aggcaggagg acttctaccc tttcctcaag gacaaccgtg agaagatcga gaagatcctt 1380

actttccgta ttccttacta cgttggtcct cttgctcgtg gtaactcccg tttcgcttgg 1440

atgactagga agtccgagga gactatcacc ccttggaact tcgagaaggt tgttgacaag 1500

ggtgcttccg cccagtcctt catcgagcgc atgaccaact tcgacaagaa cctccccaac 1560

gagaaggtcc tccccaagca ctccctcctc tacgagtact tcacggtcta caacgagctc 1620

accaaggtca agtacgtcac cgagggtatg cgcaagcctg ccttcctctc cggcgaccag 1680

aagaaggcta tcgttgacct cctcttcaag accaaccgca aggtcaccgt caagcagctc 1740

aaggaggact acttcaagaa gatcgagtgc ttcgactccg tcgagatcag cggcgttgag 1800

gaccgtttca acgcttctct cggtacctac cacgatctcc tcaagatcat caaggacaag 1860

gacttcctcg acaacgagga gaacgaggac atcctcgagg acatcgtcct cactcttact 1920

ctcttcgagg atagggagat gatcgaggag aggctcaaga cttacgctca tctcttcgat 1980

gacaaggtta tgaagcagct caagcgtcgc cgttacaccg gttggggtag gctctcccgc 2040

aagctcatca acggtatcag ggataagcag agcggcaaga ctatcctcga cttcctcaag 2100

tctgatggtt tcgctaacag gaacttcata cagctcatcc acgatgactc tcttaccttc 2160

aaggaggata ttcagaaggc tcaggtgtcc ggtcagggcg actctctcca cgagcacatt 2220

gctaaccttg ctggttcccc tgctatcaag aagggcatcc ttcagactgt taaggttgtc 2280

gatgagcttg tcaaggttat gggtcgtcac aagcctgaga acatcgtcat cgagatggct 2340

cgtgagaacc agactaccca gaagggtcag aagaactcga gggagcgcat gaagaggatt 2400

gaggagggta tcaaggagct tggttctcag atccttaagg agcaccctgt cgagaacacc 2460

cagctccaga acgagaagct ctacctctac tacctccaga acggtaggga tatgtacgtt 2520

gaccaggagc tcgacatcaa caggctttct gactacgacg tcgaccacat tgttcctcag 2580

tctttcctta aggatgactc catcgacaac aaggtcctca cgaggtccga caagaacagg 2640

ggtaagtcgg acaacgtccc ttccgaggag gttgtcaaga agatgaagaa ctactggagg 2700

cagcttctca acgctaagct cattacccag aggaagttcg acaacctcac gaaggctgag 2760

aggggtggcc tttccgagct tgacaaggct ggtttcatca agaggcagct tgttgagacg 2820

aggcagatta ccaagcacgt tgctcagatc ctcgattcta ggatgaacac caagtacgac 2880

gagaacgaca agctcatccg cgaggtcaag gtgatcaccc tcaagtccaa gctcgtctcc 2940

gacttccgca aggacttcca gttctacaag gtccgcgaga tcaacaacta ccaccacgct 3000

cacgatgctt accttaacgc tgtcgttggt accgctctta tcaagaagta ccctaagctt 3060

gagtccgagt tcgtctacgg tgactacaag gtctacgacg ttcgtaagat gatcgccaag 3120

tccgagcagg agatcggcaa ggccaccgcc aagtacttct tctactccaa catcatgaac 3180

ttcttcaaga ccgagatcac cctcgccaac ggcgagatcc gcaagcgccc tcttatcgag 3240

acgaacggtg agactggtga gatcgtttgg gacaagggtc gcgacttcgc tactgttcgc 3300

aaggtccttt ctatgcctca ggttaacatc gtcaagaaga ccgaggtcca gaccggtggc 3360

ttctccaagg agtctatcct tccaaagaga aactcggaca agctcatcgc taggaagaag 3420

gattgggacc ctaagaagta cggtggtttc gactccccta ctgtcgccta ctccgtcctc 3480

gtggtcgcca aggtggagaa gggtaagtcg aagaagctca agtccgtcaa ggagctcctc 3540

ggcatcacca tcatggagcg ctcctccttc gagaagaacc cgatcgactt cctcgaggcc 3600

aagggctaca aggaggtcaa gaaggacctc atcatcaagc tccccaagta ctctcttttc 3660

gagctcgaga acggtcgtaa gaggatgctg gcttccgctg gtgtgctcca gaagggtaac 3720

gagcttgctc ttccttccaa gtacgtgaac ttcctctacc tcgcctccca ctacgagaag 3780

ctcaagggtt cccctgagga taacgagcag aagcagctct tcgtggagca gcacaagcac 3840

tacctcgacg agatcatcga gcagatctcc gagttctcca agcgcgtcat cctcgctgac 3900

gctaacctcg acaaggtcct ctccgcctac aacaagcacc gcgacaagcc catccgcgag 3960

caggccgaga acatcatcca cctcttcacg ctcacgaacc tcggcgcccc tgctgctttc 4020

aagtacttcg acaccaccat cgacaggaag cgttacacgt ccaccaagga ggttctcgac 4080

gctactctca tccaccagtc catcaccggt ctttacgaga ctcgtatcga cctttcccag 4140

cttggtggtg ataagcgtcc tgctgccacc aaaaaggccg gacaggctaa gaaaaagaag 4200

tag 4203

<210> 3

<211> 22

<212> DNA

<213> Artificial sequence

<400> 3

accatcgtca accactacat cg 22

<210> 4

<211> 22

<212> DNA

<213> Artificial sequence

<400> 4

gctgccagaa acccacgtca tg 22

<210> 5

<211> 23

<212> DNA

<213> Artificial sequence

<400> 5

aggagactat caccccttgg aac 23

<210> 6

<211> 24

<212> DNA

<213> Artificial sequence

<400> 6

ttgaaggtaa gagagtcatc gtgg 24

Claims

1. A method for identifying or assisting in identifying whether wheat to be detected is haploid wheat or not is used for detecting whether a genomic DNA of the wheat to be detected contains a bar gene and/or a Cas9 gene or not;

if the genomic DNA of the wheat to be detected does not contain the bar gene and the Cas9 gene, the wheat to be detected is haploid wheat or candidate haploid wheat;

if the genomic DNA of the wheat to be detected contains a bar gene and/or a Cas9 gene, the wheat to be detected is non-haploid wheat or candidate non-haploid wheat;

the nucleotide sequence of the bar gene is shown as SEQ ID NO: 1 is shown in the specification;

the nucleotide sequence of the Cas9 gene is shown as SEQ ID NO: 2, respectively.

2. The method of claim 1, wherein: the method for detecting whether the genomic DNA of the wheat to be detected contains the bar gene and/or the Cas9 gene is (1) or (2) as follows:

(1) sequencing;

(2) respectively carrying out PCR amplification on the wheat samples to be detected by using the primer compositions;

the primer composition consists of a primer pair A and a primer B;

the primer pair A consists of a primer 1 and a primer 2;

the primer 1 is a1) or a2) as follows:

a1) SEQ ID NO: 3, a single-stranded DNA molecule;

the primer 2 is b1) or b2) as follows:

b1) SEQ ID NO: 4, a single-stranded DNA molecule;

the primer pair B consists of a primer 3 and a primer 4;

the primer 3 is the following c1) or c 2):

c1) SEQ ID NO: 5, a single-stranded DNA molecule;

the primer 4 is d1) or d2) as follows:

d1) SEQ ID NO: 6;

3. A method for identifying or assisting in identifying whether wheat to be detected is haploid wheat or not comprises the following steps: taking genome DNA of wheat to be detected as a template, carrying out PCR amplification by using a primer pair A and a primer pair B, detecting the size of an amplification product, and determining whether the wheat to be detected is haploid wheat according to the size of the amplification product by the following method:

if the amplification product contains a band with the size of 430bp and/or 706bp, the wheat sample to be detected is non-haploid wheat or candidate non-haploid wheat;

if the amplified product does not contain bands with the sizes of 430bp and 706bp, the wheat sample to be detected is haploid wheat or candidate haploid wheat;

the primer pair A consists of a primer 1 and a primer 2;

the primer 1 is a1) or a2) as follows:

a1) SEQ ID NO: 3, a single-stranded DNA molecule;

the primer 2 is b1) or b2) as follows:

b1) SEQ ID NO: 4, a single-stranded DNA molecule;

the primer pair B consists of a primer 3 and a primer 4;

the primer 3 is the following c1) or c 2):

c1) SEQ ID NO: 5, a single-stranded DNA molecule;

the primer 4 is d1) or d2) as follows:

d1) SEQ ID NO: 6;

4. Use of haploid wheat identified by the method of any one of claims 1 to 3 for wheat breeding and/or functional genome research.

5. The breeding method of wheat is method A or method B;

the method B comprises the following steps: haploid wheat is selected for breeding by the method of any one of claims 1 to 3.

6. A primer combination, which consists of a primer pair A and a primer pair B;

the primer pair A consists of a primer 1 and a primer 2;

the primer 1 is a1) or a2) as follows:

a1) SEQ ID NO: 3, a single-stranded DNA molecule;

the primer 2 is b1) or b2) as follows:

b1) SEQ ID NO: 4, a single-stranded DNA molecule;

the primer pair B consists of a primer 3 and a primer 4;

the primer 3 is the following c1) or c 2):

c1) SEQ ID NO: 5, a single-stranded DNA molecule;

the primer 4 is d1) or d2) as follows:

d1) SEQ ID NO: 6;

7. The primer combination of claim 6, which is any one of the following (1) to (3):

(1) screening or auxiliary screening wheat haploids;

(2) preparing a product for screening or auxiliary screening of wheat haploids;

(3) and (5) wheat breeding.

8. The method of claim 1 or 2 or 3 or 5, further characterized by: the wheat to be detected is a wheat TaMTL gene knockout homozygous mutant serving as a male parent, and a common wheat material serving as a female parent, and hybridization is carried out to obtain filial generations.

9. The method of claim 8, further characterized by: the wheat TaMTL gene knockout homozygous mutant is target wheat which is obtained by knocking out a TaMTL gene in wheat by using a CRISPR/Cas9 technology and contains the bar gene and the Cas9 gene.

10. Use of the method of any one of claims 1 to 3 to identify wheat haploids induced by a haploid inducer line; the haploid induction line is obtained by utilizing CRISPR/Cas9 technology to knock out wheat TaMTL gene.