CN112646017A - Soybean CS1 gene and application thereof - Google Patents

Abstract

The invention discloses a soybean CS1 gene and application thereof. The invention provides the application of any substance of the following 1) to 3) in the following a to e; 1) protein CS 1; 2) a nucleic acid molecule encoding protein CS 1; 3) a recombinant vector, expression cassette or recombinant bacterium comprising a nucleic acid molecule encoding protein CS 1; a) regulating and controlling the lodging resistance of the plant; b) regulating and controlling the plant height of the plant; c) regulating and controlling the thickness of plant stems; d) regulating and controlling the stalk strength of the plant. e) And (4) improving the plant germplasm resources. The present inventors cloned the gene sequence of soybean CS1 by using a gene cloning method and studied the function thereof. The soybean CS1 gene is involved in the biological process of regulating the height and lodging resistance of plants. Therefore, the invention provides the application of the soybean CS1 gene in regulating and controlling the height and lodging resistance of plants, and has good application prospect in the technical field of plant breeding.

Description

Soybean CS1 gene and application thereof

Technical Field

The invention belongs to the field of genetic engineering and biotechnology, and particularly relates to a soybean CS1 (growing Stem1) gene and application thereof.

Background

With the improvement of the living standard of people, the total amount of soybean consumption demand of China is increased year by year, and the domestic soybeans are far from self-sufficiency and have the external dependence degree close to 90 percent. Therefore, the yield of the soybean is greatly improved in China. The lodging phenomenon is one of the main limiting factors for restricting the high and stable yield of the soybean, however, genes capable of improving the lodging resistance of the soybean are rarely reported, and mining the genes related to the lodging resistance has important application value for cultivating new varieties of the soybean with high and stable yield.

The soybean plant with improved target gene obtained by using a transgenic technology becomes a main means for researching soybean gene function, and the method for obtaining the target gene editing mutant by using a CRISPR/Cas9 system-mediated gene editing technology becomes an effective way for researching the soybean gene function. The beneficial combination of the two can more fully research various changes of target genes under the condition of reduction and increase, thereby providing more comprehensive data for mechanism exploration.

The genome sequence of the soybean Glyma.19G186900 gene is 36186bp in length, and a protein with 1710 amino acids is coded. There are no functional annotations and domains other than 6 HEAT (Huntingin, excitation factor 3, A-subintiat of protein phosphatase 2A and TOR1) repeat units.

Disclosure of Invention

An object of the present invention is to provide use of any one of the following 1) to 3).

The invention provides the application of any substance in the following 1) to 3) in the following a to e;

1) protein CS 1;

2) a nucleic acid molecule encoding protein CS 1;

3) a recombinant vector, expression cassette or recombinant bacterium comprising a nucleic acid molecule encoding protein CS 1;

the protein CS1 is (1) or (2) or (3) as follows:

(1) a protein consisting of an amino acid sequence shown in the 253-th and 1962 sites of the sequence 2 in the sequence table;

(2) a protein formed by adding a label at the tail end of an amino acid sequence shown in the 1 st-1962 nd site of a sequence 2 in a sequence table;

(3) a protein which is derived from the protein (1) or (2) and has the same function by substituting and/or deleting and/or adding one or more amino acid residues in the amino acid sequence shown in the 253-friendly 1962 site of the sequence 2 in the sequence table;

a) regulating and controlling the lodging resistance of the plant; in particular to the improvement of the lodging resistance of plants;

b) regulating and controlling the plant height of the plant; in particular to the reduction of plant height;

c) regulating and controlling the thickness of plant stems; in particular to increase the thickness of plant stems;

d) regulating and controlling the strength of the plant stalks; in particular to increase the strength of the plant stalks;

e) and (4) improving the plant germplasm resources.

In the application, the protein CS1 is a fusion protein obtained by adding an e-YFP label at the N end of the CS1 protein, and the fusion protein is a protein consisting of an amino acid sequence shown in a sequence 2 in a sequence table.

In the above application, the nucleic acid molecule encoding the protein CS1 is a DNA molecule of any one of the following 1) to 3):

the nucleic acid molecule encoding the protein CS1 is a DNA molecule of any one of the following 1) to 4):

1) the coding region is a DNA molecule shown in the 757-5886 th site of the sequence 1 in the sequence table;

2) the coding region is a DNA molecule shown as a sequence 1 in a sequence table;

3) DNA molecules which hybridize under stringent conditions with the DNA sequences defined in 1) or 2) and which code for proteins having the same function;

4) a DNA molecule having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% homology to the DNA sequence defined in 1) or 2) and encoding a protein having the same function.

The application of the substances in cultivating plants with improved lodging resistance, low stalk, thick stalk and/or high stalk strength is also within the scope of the invention.

The application of the substance for reducing the activity or content of the protein CS1 in any one of the following 1) to 5) is also within the protection scope of the invention;

or, the application of the substance for inhibiting the expression of the nucleic acid molecule for coding the protein CS1 in any one of the following 1) to 5) is also the protection scope of the invention;

1) the lodging resistance of the plants is reduced;

2) the thickness of the plant stalks is reduced;

3) the strength of the plant stem is reduced;

4) cultivating plants with low fine stalk and/or stalk strength;

5) cultivating lodging-resistant and reduction-reducing plants;

the protein CS1 is (1) or (2) or (3) as follows:

(1) a protein consisting of an amino acid sequence shown in sequence No. 253-1962 in the sequence table;

(2) a protein formed by adding a label at the tail end of an amino acid sequence shown in a sequence 2 in a sequence table;

(3) protein which is derived from the amino acid sequence shown in the (1) or (2) through substitution and/or deletion and/or addition of one or more amino acid residues and has the same function;

in the application, the substance is a CRISPR/Cas9 system;

the CRISPR/Cas9 system includes the following 1) or 2):

1) an sgRNA that is sgRNA1 or sgRNA 2;

the sgRNA1 targets at position 306-325 of the sequence 3,

the sgRNA2 targets at position 306-325 of the sequence 4;

2) a CRISPR/Cas9 vector expressing the sgRNA1 or the sgRNA 2.

It is another object of the present invention to provide a method for breeding transgenic plants with high lodging resistance, low stalk, thick stalk and/or stalk strength.

The method provided by the invention is 1) or 2):

1) the method comprises the following steps: improving the content and/or activity of protein CS1 in the target plant to obtain a transgenic plant;

2) the method comprises the following steps: improving the expression of a nucleic acid molecule of the encoding protein CS1 in a target plant to obtain a transgenic plant;

the lodging resistance of the transgenic plant is higher than that of the target plant;

or, the transgenic plant has a lower plant height than the plant of interest;

or the thickness of the stem of the transgenic plant is higher than that of the target plant;

or the stem strength of the transgenic plant is higher than that of the target plant;

the protein CS1 is (1) or (2) or (3) as follows:

(1) a protein consisting of an amino acid sequence shown in sequence No. 253-1962 in the sequence table;

(2) a protein formed by adding a label at the tail end of an amino acid sequence shown in a sequence 2 in a sequence table;

(3) and (3) the protein which is derived from the protein (1) or (2) and has the same function, wherein the protein is obtained by substituting and/or deleting and/or adding one or more amino acid residues in the amino acid sequence shown in the (1) or (2).

In the above method, the method for increasing the content and/or activity of the protein CS1 in the plant of interest or the method for increasing the expression of the nucleic acid molecule encoding the protein CS1 in the plant of interest is performed by introducing the nucleic acid molecule encoding the protein CS1 into the plant of interest.

The overexpression of the CS1 gene can be achieved by various methods, such as a method for mediating gene overexpression by a plant virus vector, a method for mediating and transforming an overexpression vector by agrobacterium, optimization and modification of a gene coding frame, optimization of a gene promoter to achieve an overexpression effect, and the like. The method of overexpressing a gene in the present invention is not limited to the above-mentioned methods as long as the CS1 gene can be overexpressed.

When the CS1 gene of the present invention is constructed into a plant expression vector, any enhancer promoter or inducible promoter may be added before the transcription initiation nucleotide. In order to facilitate the identification and screening of transgenic plant cells or plants, vectors to be used may be processed, for example, by adding a plant selectable marker (GUS gene, luciferase gene, etc.) or an antibiotic marker having resistance (gentamicin, kanamycin, etc.). The plant host to be transformed may be either a monocotyledonous or dicotyledonous plant, such as: soybean, arabidopsis, tobacco, corn, rice, wheat, cucumber, tomato, poplar, turf grass or alfalfa and the like. The expression vector carrying the CS1 gene of the present invention can be used to transform plant cells or tissues by conventional biological methods using Ti plasmid, Ri plasmid, plant viral vector, direct DNA transformation, microinjection, conductance, Agrobacterium mediation, etc., and the transformed plants can be cultured into plants by tissue culture.

It is also an object of the present invention to provide a method for growing plants with reduced lodging resistance and low stalk and/or stalk strength.

The method provided by the invention is 1) or 2) or 3):

1) comprises the following steps: reducing the activity or content of protein in the target plant to obtain a transgenic plant;

2) comprises the following steps: inhibiting the expression of DNA molecules encoding the protein in the target plant to obtain a transgenic plant;

3) comprises the following steps: carrying out gene editing on a DNA molecule encoding the protein in a target plant to terminate the translation of the protein in advance to obtain a transgenic plant;

the transgenic plant has lower lodging resistance than the target plant;

or the thickness of the stem of the transgenic plant is less than that of the target plant;

or the stem strength of the transgenic plant is less than that of the target plant;

the protein CS1 is (1) or (2) or (3) as follows:

(1) a protein consisting of an amino acid sequence shown in sequence No. 253-1962 in the sequence table;

(2) a protein formed by adding a label at the tail end of an amino acid sequence shown in a sequence 2 in a sequence table;

(3) and (3) the protein which is derived from the protein (1) or (2) and has the same function, wherein the protein is obtained by substituting and/or deleting and/or adding one or more amino acid residues in the amino acid sequence shown in the (1) or (2).

In the above method, the reducing the activity or content of the protein in the target plant, the inhibiting the expression of the DNA molecule encoding the protein in the target plant, or the gene editing of the DNA molecule encoding the protein in the target plant is performed by: introducing the CRISPR/Cas9 system into the plant of interest;

the CRISPR/Cas9 system includes the following 1) or 2):

1) an sgRNA that is sgRNA1 or sgRNA 2;

the sgRNA1 targets at position 306-325 of the sequence 3,

the target point of the gRNA2 is the 306 nd-325 th site of the sequence 4;

2) a CRISPR/Cas9 vector expressing the sgRNA1 or the sgRNA 2.

The above plants are dicotyledonous plants or monocotyledonous plants.

The present inventors cloned the gene sequence of soybean CS1 by using a gene cloning method and studied the function thereof. The discovery shows that when the CS1 gene is over-expressed in the receptor cultivar Tianlong I, the plant shows the characters of high strain height, short plant height, enhanced lodging resistance and the like, and the plant over-expressing the soybean CS1 gene has high strain height, short stem strength and enhanced stalk strength compared with the wild type Tianlong I plant; after the CS1 gene is subjected to gene editing in the receptor cultivar Tianlong I, the plant presents a lodging shape with stolon growth at the stem base, and the plant with the gene knocked out of the soybean CS1 gene presents a lodging shape with stolon growth at the stem base. The soybean CS1 gene is involved in the biological process of regulating the height and lodging resistance of plants. Therefore, the invention provides the application of the soybean CS1 gene in regulating and controlling the height and lodging resistance of plants, and has good application prospect in the technical field of plant breeding.

Drawings

FIG. 1 is a diagram showing the results of functional verification of the CS1 gene; wherein:

a is G1 and G2, which indicate two sites for gene editing of CS1 gene, a homozygous mutant strain CS1-cr1 is obtained through the G1 site, and the site is subjected to deletion of a basic group G; obtaining a homozygous mutant strain cs1-cr2 through a g2 locus, wherein the locus is increased by a base T;

b is a field harvest phenotype chart of editing mutants CS1-cr1, CS1-cr2, CS1 overexpression strains CS1-OX-1, CS1-OX-2 and a control plant TL1, and the scale bar is 25 cm;

c is the measurement result of the plant hypocotyl thickness 46 days after the material in the graph B is sowed;

d is the measurement result of the plant hypocotyl stalk strength 46 days after the material in the graph B is sown;

e is the plant height of CS1 overexpression strains CS1-OX-1, CS1-OX-2 and a control plant TL 1;

f is the expression quantity of the CS1 gene in over-expression strains CS1-OX-1, CS1-OX-2 and a control plant TL1, wherein GmAcitn is an internal reference gene.

Detailed Description

The experimental procedures used in the following examples are all conventional procedures unless otherwise specified.

Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

The following examples are intended to illustrate the invention but are not intended to limit the scope of the invention. Modifications or substitutions to methods, procedures, or conditions of the invention may be made without departing from the spirit and scope of the invention.

Unless otherwise specified, experimental materials, reagents, instruments and the like used in the examples of the present invention are commercially available, and unless otherwise specified, technical means used in the examples are conventional means well known to those skilled in the art.

The nucleotide sequence of the soybean CS1 gene is 757-position 5886 of the sequence 1, and the coded amino acid sequence is 253-position 1962 of the sequence 2.

The overexpression vector p0641 is also called the vector pFGC5941 in the following examples; the vector pFGC5941 is described in the following documents: meng, Y, Y.Hou, H.Wang, R.Ji, B.Liu, J.Wen, L.Niu and H.Lin (2017), Targeted mutagenesis by CRISPR/Cas9 system in the model legue medical truncatala. plant Cell Rep 36(2): 371-.

The vector PA7 in the following examples is a vector obtained by inserting an e-YFP tag (1 st to 717 rd in SEQ ID NO: 1) between the BamH1 and EcoR1 cleavage sites of a PUC18 vector (from TAKARA, Cat. ID. D3218).

The william 82(Williams 82) soybean variety of the following examples is described in the following references: liu M F, Wang Y Q, Nie Z X, Gai J Y, Bhat J A, Kong J, ZHao T J (2020), Double mutation of two homologus genes YL1 and YL2 results in a leaf yellowing phenotype in soybean [ Glycine max (L.) Merr ] Plant Molecular Biology 103(4-5):527- & 543

The vector pU3 is described in the following examples in the following publications: shann, Q, Y.Wang, J.Li, Y.Zhang, K.Chen, Z.Liang, K.Zhang, J.Liu, J.J.xi, J.L.Qiu and C.Gao (2013), Targeted gene modification of crop plants using a CRISPR-Cas system. Nat Biotechnol 31(8): 686-688.

The CRISPR/Cas9 vector p0645, also known as pFGC5941-Cas9, described in the following documents in the following examples: meng, Y, Y.Hou, H.Wang, R.Ji, B.Liu, J.Wen, L.Niu and H.Lin (2017), Targeted mutagenesis by CRISPR/Cas9 system in the model legue medical truncatala. plant Cell Rep 36(2): 371-) -374; vector p0645 contains the CAS9 protein coding region, without the CAS9 protein binding region.

Example 1 construction of Soybean CS1 Gene-related vector

Construction of soybean CS1 gene overexpression vector

1. Design of synthetic primers

The primers used for amplifying the CDS sequence of the first part of CS1 and connected to the p0641 vector by using a Spe1 and BamH1 double enzyme cutting sites are as follows:

p0641-1-F: CGAGCCCGGGACTAGTATGGCTTCCTCAACCTCAAT (Spe1 cleavage site ACTAGT)

p0641-1-R: GTGGCGGTCCGGATCCTGTTTCAAGTCTTCTGTATC (BamH1 site GGATCC)

The primers used for amplifying the CDS sequence of the second part of CS1 and connected to the p0641 vector by using a single enzyme cutting site of BamH1 are as follows:

p0641-2-F: ACTTGAAACAGGATCCATCATATCAAGACACTTGGG (BamH1 site GGATCC)

p0641-2-R: GTGGCGGTCCGGATCCGTTTTTCGTAGACTCCACAT (BamH1 site GGATCC)

The primer for amplifying the e-YFP label and connecting the e-YFP label to the p0641 carrier by utilizing the Xhol single enzyme cutting site is as follows:

e-YFP-CS 1-F: AGCCACCATGCTCGAGATGGTGAGCAAGGGCGAGGA (Xhol cleavage site CTCGAG)

e-YFP-CS 1-R: TAGTCCCGGGCTCGAGCCCCGGTGGCGGTCCGGATCCCTTGTACAGCTCGTCCAT GC (Xhol cleavage site CTCGAG)

2. Ligation of overexpression vectors

Since the CDS sequence of the soybean CS1 gene is too large to be obtained by amplification through a common PCR process, the CDS sequence of the CS1 gene is synthesized by Hua Dai Biotech, Inc.

The p0641 vector was used to construct an overexpression vector carrying the 35S promoter and NOS terminator DNA fragments. The vector was first cut by double digestion with Spe1 and BamH1, and the synthesized CS1 fragment was ligated. Because the CS1 fragment is too large to be connected to the vector at one time, a part of the sequence is firstly connected to the p0641 vector by using Spe1 and BamH1 to form a transition vector p0641-1, and then the BamH1 DNA fragment carried by the tail end of the first part of the fragment is used as a single enzyme cutting site to carry out vector connection on the second part of the target gene, so that the non-tagged intermediate vector p0641-2 is finally formed. Then, the intermediate vector p0641-2 is added with an e-YFP label at the N end, and finally, an overexpression vector e-YFP-CS1 containing the target fragment is formed.

The method comprises the following specific steps:

the nucleotide sequence of the CDS of the synthesized CS1 gene is a sequence 1 in a sequence table and is used for vector construction.

Taking the sequence 1 as a template, and carrying out PCR amplification by using p0641-1-F and p0641-1-R to obtain a 1861bp fragment 1;

PCR amplification was performed using p0641-2-F and p0641-2-R using sequence 1 as a template to give 3327bp fragment 2.

The carrier PA7 containing the e-YFP sequence is used as a template, and the e-YFP-CS1-F and the e-YFP-CS1-R are used for PCR amplification to obtain a 749bp fragment containing the e-YFP.

Carrying out double enzyme digestion on the p0641 vector and the 1861bp fragment 1 by using Spe1 and BamH1 to obtain an enzyme-digested vector fragment and an enzyme-digested fragment 1, and connecting the two fragments to obtain a transition vector p 0641-1;

then BamH1 is used for enzyme digestion of the excessive vector p0641-1 and the 3327bp fragment 2 to obtain an enzyme digested vector fragment and an enzyme digested fragment 2, and the two are connected to obtain an intermediate vector p 0641-2;

then Xhol single enzyme digestion intermediate vector p0641-2 is used for connecting the 749bp fragment containing the e-YFP with the enzyme digestion intermediate vector p0641-2 to obtain an overexpression vector e-YFP-CS1 containing a target fragment, wherein the e-YFP fragment is positioned at the N end of CS 1;

through sequencing, the overexpression vector e-YFP-CS1 is a vector obtained by replacing DNA molecules for coding the fusion protein e-YFP-CS1 between Xhol and BamH1 enzyme cutting sites of a p0641 vector, and expresses the fusion protein e-YFP-CS 1.

The amino acid sequence of the fusion protein e-YFP-CS1 is sequence 2, wherein the 1 st to 239 th positions of the sequence 2 are the e-YFP label, the 240 st and 252 nd positions are connecting peptides, and the 253 st and 1962 nd positions are CS1 proteins.

The nucleotide sequence of the DNA molecule for coding the fusion protein e-YFP-CS1 is sequence 1, wherein, the 1 st to 717 th sites of the sequence 1 are the e-YFP label coding gene, the 718 nd to 756 th sites are the connecting peptide coding gene, and the 757 th and 5886 th sites are the CS1 protein coding gene.

3. Preparation of recombinant Agrobacterium

1) Competent preparation of Agrobacterium

a) Activated agrobacterium tumefaciens EHA105 (beijing bayer died biotechnology limited, cat #: DE-NKY-0315) single colony, inoculate in 5ml without resisting LB liquid medium, shake culture overnight at 28 degrees C, 200 rpm;

b) adding 2ml of overnight cultured bacterial liquid into 50ml of LB liquid culture medium containing no antibiotics, shaking at 28 ℃ and 200rpm for 3-4 hours until OD600 is about 0.8;

c) centrifuging at 4000rpm for 5 minutes, and removing supernatant;

d) the cells were suspended in 50ml of 10% glycerol,

e) centrifuging at 4000rpm for 5 minutes, and removing supernatant;

f) adding 25mL of 10% glycerol to resuspend the thalli, and centrifuging for 5 minutes at 4000 rpm;

g) f is repeated once, the supernatant is removed, 2ml of 10% glycerol is added for suspension, and the suspension is dispensed into a 1.5ml centrifuge tube (100. mu.l/tube).

h) Immediately placing in liquid nitrogen for quick freezing, and placing at-80 deg.C for use.

2) Agrobacterium-induced electrotransformation

a) Add 2. mu.l of the overexpression vector e-YFP-CS1 to 100. mu.l of EHA105 competent cells, mix gently, ice-wash for 30min (negligible time);

b) sucking the plasmid and competent mixed solution into an electrode cup, and performing electric shock transformation;

c) immediately adding lml fresh non-resistant LB liquid culture medium, and gently shaking at 28 ℃ and 200rpm for 4 hours;

d) centrifuging the cultured bacterial liquid at 12000rpm for 10s, discarding part of supernatant, uniformly mixing the rest supernatant and the bacteria, spreading the mixture on an LB solid culture medium plate containing kanamycin, and performing dark culture at 28 ℃ for 2 days.

3) Positive detection of Agrobacterium

a) The well grown single colony of agrobacterium is picked up and put into a 1.5ml centrifuge tube, and the centrifuge tube is added with the LB culture medium of kanamycin for overnight culture.

b) PCR detection was performed simultaneously (primer 15644, sequence CACTATCCTTCGCAAGAC; CDSR2 with sequence GCCATGTTCCCGAACCGCCGACGTCC, obtaining e-YFP-CS1 recombinant vector 1020bp as positive), adding equal volume of 50% glycerol into the bacterial liquid with correct PCR detection, mixing, and storing at-80 ℃.

The obtained positive bacterium is a recombinant bacterium EHA105/e-YFP-CS 1.

Second, construction of soybean CS1 gene knockout vector

1. Preparation of knockout vectors

1) Target site design

The Cas9 protein is able to recognize the first 19 bases of NGG on a genomic exon and use it as an editing target site. According to the characteristics, the gene Glyma.19g186900 is designed by using http:// cbi.hzau.edu.cn/cgi-bin/CRISPR website to obtain the following target sites as shown in Table 1:

table 1 shows the target sites of the Glyma.19g186900 gene

2) PCR primer design amplification

a) The primer design is schematically as follows:

b) PCR amplification and vector construction:

the components for designing the CRISPR/Cas9 vector were amplified separately: firstly, U6 is amplified (PCR reaction system 1, product a); secondly, amplifying the target sequence + sgRNA (PCR reaction system 2, product b), and then respectively carrying out gel recovery on the product a and the product b; finally, amplifying the U6+ target sequence + sgRNA combined fragment (PCR reaction system 3, product c); and carrying out vector connection on the amplified fragments, and verifying the connected vector. The detailed experimental procedure is as follows.

The primer sequences required for this process are:

U6xbaIF：GGAAGCTTAGGCCTTCTAGAAAAATAAATGGTAAAATGTC

U6xbaIR：CAATCCATGTGGTGGCACAT

gRNAF：AATGTGCCACCACATGGATT+g1(g2) GTTTTAGAGCTAGAAATAGCAA，

wherein g1 and g2 are the sequences of the target site respectively,

if + g1, then the gRNAF is as follows: AATGTGCCACCACATGGATT GATTGTGCACTGGGCTGTCG GTTTTAGAGCTAGAAATAGCAA, respectively;

if + g2, then the gRNAF is as follows: AATGTGCCACCACATGGATT GACACTGCATGGTTGCTCAG GTTTTAGAGCTAGAAATAGCAA

sgRNA-XbaIR: GCTCGGCAACGCGTTCTAGAAAAAAAAGCACCGACTCGGT b-1) amplification of product a

PCR reaction System 1

The product a obtained by the amplification of the PCR reaction system 1 is the promoter U6.

And recovering the product a by glue.

b-2) product b

PCR reaction system 2 (product b: target sequence + sgRNA)

And amplifying the PCR reaction system 2 to obtain a product b, namely a target 1 sequence + sgRNA or a target 2 sequence + sgRNA.

And recovering the product b by using glue.

b-3) product c

PCR reaction system 3 (product c: Glyma U6+ target sequence + sgRNA)

And performing gel recovery on the product c to obtain Glyma U6+ target 1 sequence + sgRNA and Glyma U6+ target 2 sequence + sgRNA.

The PCR reaction procedure for all the above reaction systems was as follows:

3) joining of fragments of interest

CAS9 vector linearization digestion reaction system: (vector p0645 contains the CAS9 protein coding region, no binding region for the CAS9 protein)

Preparing reaction liquid on ice according to the above enzyme digestion reaction system, mixing uniformly, carrying out water bath at 37 ℃ for 30min, and carrying out gel recovery on an enzyme digestion product after the enzyme digestion reaction is finished to obtain an enzyme digestion product fragment.

Vector ligation, use of

HD Cloning Kit (Clontech, 639650) ligase ligation reaction System:

the product c is Glyma U6+ target 1 sequence + sgRNA and Glyma U6+ target 2 sequence + sgRNA, respectively.

Preparing a reaction solution on ice according to the reaction system, uniformly mixing, and carrying out the following reactions: reaction procedure: and (3) obtaining the recombinant vector at 50 ℃ for 30 min.

The CRISPR/Cas9 vector containing 2 target binding regions is obtained.

After the sequencing is carried out, the sequence is determined,

the CRISPR/Cas9 vector 1 is a vector obtained by replacing Xbal enzyme digestion sites in a p0645 vector by Glyma U6+ target 1 sequence + sgRNA (sequence 3, the 1 st to 305 th sites in the sequence 3 are Glyma U6 promoter, the 306 st and 325 th sites are target binding regions, and the 326 st and 408 th sites are Cas9 protein binding regions); the vector expresses sgRNA1, and sgRNA1 is RNA encoded by the nucleotides indicated in 306-408 in sequence 3.

The CRISPR/Cas9 vector 2 is obtained by replacing Xbal enzyme digestion sites in a p0645 vector with Glyma U6+ target 2 sequence + sgRNA (sequence 4, positions 1-305 in the sequence 4 are Glyma U6 promoter, positions 306-325 are target binding region 2, and positions 326-408 are Cas9 protein binding region), and the vector expresses sgRNA2, and sgRNA2 is RNA encoded by nucleotides shown in positions 306-408 in the sequence 4.

2. Preparation of recombinant Agrobacterium

And respectively transferring the CRISPR/Cas9 vector 1 and the CRISPR/Cas9 vector 2 into agrobacterium EHA105 to obtain a recombinant agrobacterium EHA105/CRISPR/Cas9 vector 1 and a recombinant agrobacterium EHA105/CRISPR/Cas9 vector 2.

Example 2 acquisition of transgenic event Soybean plants

First, soybean genetic transformation

3 recombinant agrobacteria prepared in one and two of examples 1: the recombinant strain EHA105/e-YFP-CS1, the recombinant agrobacterium EHA105/CRISPR/Cas9 vector 1 and the recombinant agrobacterium EHA105/CRISPR/Cas9 vector 2 are respectively subjected to soybean genetic transformation, and the steps are as follows:

1) seed disinfection: the plump, healthy soybean (Tianlong No. I (TL1) with the approved code of Country bean 2008023; hereinafter referred to as wild-type soybean) seeds were picked. The beans were sterilized with chlorine from the reaction of 4ml concentrated hydrochloric acid and 100ml King flower disinfectant (Bleach). Sterilizing for 16-18h, and then placing in a super bacteria workbench to blow off chlorine.

2) Germination accelerating and bacterium shaking: seeds were soaked with sterile water overnight for pregermination and Agrobacterium used for transformation was shaken.

3) Cutting beans: cutting off the soaked beans in the next morning, removing part of germs, slightly scratching 3-5 times at the growing point, and placing the cut bean cotyledon in a triangular flask soaked with sterilized water. And (3) centrifuging (4000rpm for 10min) when the OD value of the agrobacterium reaches 0.6-0.8, and resuspending the centrifuged substrate by using a liquid co-culture medium, wherein the volume of the resuspended bacterial liquid is 30-40 ml. Pouring out the sterilized water in the triangular flask, and pouring the resuspended bacteria liquid for soaking for 30 min.

4) Co-culture: the soaked bean cotyledon is uniformly spread on a solid co-culture medium containing sterilized filter paper, sealed with an adhesive tape, and placed in a dark incubator at 26 ℃ for 3 days.

5) And (3) induction culture: cutting off the embryo grown after co-culture, only keeping 3-4mm, cleaning the cut explant by using sterile water and a liquid induction culture medium added with hormone, and washing away residual agrobacterium. Explants were inserted obliquely into solid induction medium and cultured for 30 days, during which 2 changes of induction medium were required.

6) And (3) elongation culture: explants with clumpy shoots were excised from the bean (at which point the bean had turned yellow and nutrients had been substantially depleted), scraped of black surfaces, and placed in elongation medium. Medium changes were performed every 10-15 days.

7) Rooting culture: cutting off long seedlings, and inserting the seedlings into a rooting medium for rooting culture. Generally, it takes about 30 days.

8) Transplanting: the rooted transformed plants are placed in pots with soil and given water or nutrient solution. Cover the greenhouse and culture. The lid was removed after one week.

The T0 generation EHA105/e-YFP-CS1 plant, the T0 generation EHA105/CRISPR/Cas9 vector 1 plant and the T0 generation EHA105/CRISPR/Cas9 vector 2 plant are obtained.

Identification of transgenic positive lines

1. Validation of overexpression lines

A small amount of fresh and tender leaves of 2 lines CS1-OX-1 and CS1-OX-2 of the EHA105/e-YFP-CS1 plant obtained from the T0 generation are taken respectively, RNA is extracted and is reversely transcribed into cDNA, and the expression level of the target gene CS1 is detected.

TL1 was used as a control.

The primer for checking the expression level of CS1 is CS-2F: GATTGTTTCCTCTCTCTGC, respectively; CS-2R: TTCTCTCCCTCTCTTCGT are provided.

The internal reference primer is Actin 11-F: ATCTTGACTGAGCGTGGTTATTCC, respectively; actin 11-R: GCTGGTCCTGGCTGTCTCC are provided.

As shown in FIG. 1F, it was found that the expression level of CS1 gene was increased in both of the T0-transgenic EHA105/e-YFP-CS1 plants CS1-OX-1 and CS1-OX-2, as compared with the transgenic receptor soybean TL 1.

At the same time, Basta is used for screening plant resistance.

2. Validation of knockout strains

And respectively transferring the two obtained plants (cs1-cr1) from the T0 generation to an EHA105/CRISPR/Cas9 vector 1 plant and (cs1-cr2) from the T0 generation to an EHA105/CRISPR/Cas9 vector 2 plant, taking a small amount of fresh and tender leaves, and extracting DNA for vector element detection.

Primers basta-F: ACAGATAAAGCCACGCACATT and basta-R: TCCGCAGCCATTAACGACTT, used for identifying whether contains Basta resistance gene and the PCR product size is 989 bp;

primer cas9-F was used: CAGCTCGTCCAAACCTAC and cas 9-R: CTGTGCCATCCATCTTCT, used for identifying whether the gene contains Cas9 and the size of the PCR product is 601 bp;

primers u6-F: GCGGTGTCATCTATGTTACTA and u 6-R: TTCAAGTTGATAACGGACTA, for identifying whether it contains the U6 promoter, and the PCR product size is 425 bp.

If the three conditions are detected, the positive T0 generation EHA105/CRISPR/Cas9 vector 1 plant and the positive T0 generation EHA105/CRISPR/Cas9 vector 2 plant are detected.

The positive transfer EHA105/CRISPR/Cas9 vector 1 plant (cs1-cr1) and the positive transfer EHA105/CRISPR/Cas9 vector 2 plant (cs1-cr2) are respectively treated with primers 186900-3F: CTGCTAATGCTTATCTTGAGGC, 186900-3R: AATTTGTGTCTGCACAACGTG (detection of g1 target site) and 186900-4-1-F: TTGACAAAGGAGGAGGCAAG, 186900-4-1-R: CACACACAACACACACGAGAGA (detecting the g2 target site) were amplified to obtain PCR products, which were sent for sequencing. TL1 was used as a control.

As shown in FIG. 1A, it can be seen that, compared with the transformation receptor parent TL1, there is deletion of base G in the editing mutant CS1-cr1, and insertion of base T occurs in the editing mutant CS1-cr2, and both mutation types cause CS1 frame shift to be unable to translate protein.

The T0 generation plants are sown to obtain T2 generation plants.

Third, transgenic plant and gene editing plant field phenotype identification

1. Over-expression plant

And (3) sowing T2 generation strains of the transformation receptor parent TL1, the CS1-OX-1 and the CS1-OX-2 verified in the second step, detecting the diameter and the strength of the stalks when the strains are sowed for 46 days, and measuring the height of the strains when the strains are harvested. At least 8 strains were measured per strain.

The measurement of stem thickness and stalk strength was performed on the hypocotyls of plants sowed in the field for 46 days. The measuring method comprises the steps of randomly selecting 8 plants, measuring the hypocotyl diameter of the plants by using a digital vernier caliper, and ensuring the measured parts to be consistent as far as possible. Hypocotyl stalk strength was measured with a japanese AIKOH RZ push-pull. During measurement, the hypocotyl of the plant is inclined to form an angle of 45 degrees with the ground, and the numerical value displayed by the push-pull type instrument is the stalk strength of the hypocotyl of the plant.

As shown in FIGS. 1B-1E, it was found that the T2-generation strain of CS1-OX-1 or CS1-OX-2 had a phenotype of strain height shortening, stalk thickening, stalk strength increase, and lodging resistance increase, as compared with the wild-type TL 1.

2. CS1 gene editing plant

And (3) sowing T2 generation homozygous strains of the transformed receptor parent TL1 and the two verified gene editing plants cs1-cr1 and cs1-cr2, detecting the diameter and strength of the stalks when the strains are sowed for 46 days, and measuring the plant height when the strains are harvested. At least 8 strains were measured per strain.

The method for measuring the diameter and strength of the stalks is as above.

The results are shown in FIGS. 1B-1D, and it can be seen that T2 generation homozygous lines of CS1 knockout mutants CS1-cr1 and CS1-cr2 have thinner stalks, reduced stalk strength and stolon-growth phenotype at the stalk bases compared with wild type TL 1.

The above results show that gene editing of the CS1 gene produces lodging plants CS1-cr1 and CS1-cr2 with stolon growth at the stem base, and the plant has weakened stem strength and thinned stem thickness; over-expression of the CS1 gene results in dwarfing plants CS1-OX-1 and CS1-OX-2 with increased stalk strength and increased stalk thickness.

The invention uses molecular biology and genetic engineering technology to verify that the soybean CS1 gene is a gene for regulating and controlling plant height and lodging resistance for the first time. This provides a perfect idea for cultivating lodging-resistant dwarf-stem variety crops. Has good practical significance for improving the crop varieties.

Although the invention has been described in detail hereinabove by way of general description, specific embodiments and experiments, it will be apparent to those skilled in the art that many modifications and improvements can be made thereto based on the invention. It is therefore contemplated that modifications and improvements may be made without departing from the spirit of the invention, which is intended to be covered by the claims.

SEQUENCE LISTING

<110> Nanjing university of agriculture of the institute of crop science of Chinese academy of agricultural sciences

<120> soybean CS1 gene and application thereof

<160> 4

<170> PatentIn version 3.5

<210> 1

<211> 5886

<212> DNA

<213> Glycine max

<400> 1

atggtgagca agggcgagga gctgttcacc ggggtggtgc ccatcctggt cgagctggac 60

ggcgacgtaa acggccacaa gttcagcgtg tccggcgagg gcgagggcga tgccacctac 120

ggcaagctga ccctgaagtt catctgcacc accggcaagc tgcccgtgcc ctggcccacc 180

ctcgtgacca ccttcggcta cggcgtgcag tgcttcgccc gctaccccga ccacatgaag 240

cagcacgact tcttcaagtc cgccatgccc gaaggctacg tccaggagcg caccatcttc 300

ttcaaggacg acggcaacta caagacccgc gccgaggtga agttcgaggg cgacaccctg 360

gtgaaccgca tcgagctgaa gggcatcgac ttcaaggagg acggcaacat cctggggcac 420

aagctggagt acaactacaa cagccacaac gtctatatca tggccgacaa gcagaagaac 480

ggcatcaagg tgaacttcaa gatccgccac aacatcgagg acggcagcgt gcagctcgcc 540

gaccactacc agcagaacac ccccatcggc gacggccccg tgctgctgcc cgacaaccac 600

tacctgagct accagtccgc cctgagcaaa gaccccaacg agaagcgcga tcacatggtc 660

ctgctggagt tcgtgaccgc cgccgggatc actctcggca tggacgagct gtacaaggga 720

tccggaccgc caccggggct cgagcccggg actagtatgg cttcctcaac ctcaattccc 780

gcatccgaag ccgtgcaggt tctcctctcc ttgctcgccg atgacacttc ctccgtcaga 840

gaagcctcca tgtcctctct caaggacatt gccgcactga atcctcttct cgttctcgat 900

tgctgcgccg tcgtttcgcg cggtggacgt cggcggttcg ggaacatggc tggagttttc 960

caagtgatgg cgtttggagt tcgagctctc gacaaaaaag acgttgattc tgctttcatg 1020

gcgaagctcg ctaagattgc tacagctgag ttgatatcgt ctaaggaact aaattctgat 1080

tggcaacgag cagcaacaag cctacttgtt gcaataggct cacatttacc agatctcatg 1140

atggaagaaa tttatcttca tttatccggg gcaaattcag cattacagtc tatggttcaa 1200

atccttgcag aatttgcttc tactgatccc ttgcagttca ttccacactg gaaaggtgta 1260

ctttcacgaa ttttgccaat tcttggaaat gtgcgagaca tgcaccggcc aatttttgca 1320

aatgcattta agtgttggtg tcaagctgct tggcaatata gtatagattt cccttcacat 1380

tttccccaag atggtgatgt catgtcattt ctaaattctg cttttgagct tttgttgaga 1440

gtttgggcag cttcaagaga tttaaaggtt cgcgtggctt ctgtagaagc acttgggcag 1500

atggtaggtc tcataacacg aacacaattg aagactgccc taccaaggct tattcctaca 1560

atattggact tgtataaaaa ggaccaagat atagcttttc tggctacatg tagtctccac 1620

aatcttttaa atgcctcttt actgtctgaa agtggccctc ctatgcttga ttttgaggat 1680

ttgactcttg ttctatcaac acttctacct gtggtttctt tcaataatga cagcaaagac 1740

cagtcagatt tccctgtggg actgaagatg tataatgagg ttcagcattg ctttctgaca 1800

gttggcttgg tgtatccaga tgatttgttt ttgttccttg taaataaatg caggttgagg 1860

gaagaaccat tgacttttgg ttcactttgc attttgaagc atctcttgcc aaggctgtct 1920

gaagcttggc atagtaaaat acctctacta gtcgaagctg taaagtcctt gcttgaggag 1980

cagaatttag gtgttcgaaa ggcactttct gagttaatcg tggttatggc ttctcactgt 2040

tatttggttg gttcgtctgg agagttgttc attgaatatc ttgtacgcca ttgcgctata 2100

acagatcaaa atcggagtga tcttgagagc acaccaaata agagaataga gatgaaaatt 2160

ggtgcagtta ctcctggtga gttaagagca gtttgtgaga aaggtctcct tttggtaact 2220

attacgattc ctgaaatgga gcatattctt tggccttttc tgttgaggat gattattcca 2280

ttgacctaca ctggtgctgt ggccacggtg tgcaggtgta tctcagaatt gtggcggcat 2340

aggtcatata gcaatgatat gttgagtgag tgtaaaaccc gtcctgatat accatctgct 2400

gaggaacttc ttgcccgatt gttggtgctt ttgcacaatc ctctagcaag ggagcaattg 2460

gccacccaaa ttttgacagt cctatgtctt ttggcacctc tatttccaaa aaatatcaat 2520

ttgttttggc aagatgagat tccaaagatg aaggcatatg ttagtgatac agaagacttg 2580

aaacaggatc catcatatca agacacttgg gacgacatga taatcaattt tcttgcagaa 2640

tcattggatg tgatccaaga tgcagattgg gttatgtctc ttggaaatgt ttttgccaaa 2700

cattatgaac tttatgcatc tgatgatcaa cacactgcac ttcttcaccg gtgcttggga 2760

attctgcttc aaaaggttaa cgacagagct tatgtctgtg ataaaataga ttggatgtac 2820

aagcaagcaa acattgcaaa tccaacaaat agacttgggt tggcaaaagc aatgggattg 2880

gttgctgcat cacacttgga tacagtgtta gagaagctga aggatatttt agacaatgtt 2940

ggacaaagca tatttcagag gatactgtca ttgttctctg atagtttcag aacagaagag 3000

tctgatgaca tacatgctgc tttggcacta atgtatggat atgctgcaaa gtatgcccca 3060

tcaacagtta ttgaagccag aataaatgcc cttgttggca ccaacatgct ctctcggctt 3120

cttcatgtgc gtctccccaa agcaaagcaa gctgtcatca ccgcaattga tttactaggt 3180

aatgctgtca ttaatgctgc tgaaagtggc tcgccatttc cattgaaaag aagggaccaa 3240

ctgcttgatt atattttaac tttgatgggc cgggatgatg aagatggttt tgctgattac 3300

aatgatcttt tgcgtactca ggcccttgct ataagtgcct gcactacttt ggtctctgtg 3360

gaaccaaagc taacagttga aactagaagc catgtaatga aggctacgtt ggggttcttt 3420

gctataccaa atgatcctgt tgatgttgtc aatcccctta tagacaactt gattactctt 3480

ttatgtgcaa ttcttctcac tggtggagaa gatggaagaa gtcgagcaga gctgctaatg 3540

cttatcttga ggcaaattga tcaatttgtc tgttctcctg ttgagtatca gaggaaaaga 3600

ggctgtcttg ctgtccatga gatgcttcta aagtttcgga tgatttgtgt cagtgggtat 3660

tgtgcactgg gctgtcgtgg gagttgtgca cataacaagc aaatggaccg aactctatat 3720

gggaattttt caaagctgcc atctgcattt gtattaccaa gtcgagaagc tttgtgcttg 3780

ggtgataggg taataatgta tcttccacgt tgtgcagaca caaattctga agtcagaaaa 3840

atatcagcac aaattcttga tctactcttc agcatctctc tttcacttcc aagacctgct 3900

ggttcatcta tatctgctga agatatagaa ttgtcataca gcgcattatc ttctcttgag 3960

gatgttatag ccatattgag gaatgatact tcaattgatc catcagaagt tttcaacagg 4020

attgtttcct ctctctgcat tctgttgaca aaggaggagc tggttgctac actgcatggt 4080

tgctcagtgg ctatatgtga taagatcaag cagtcagctg aaggggctat tcaagctgtt 4140

gttgaatttg ttacgaagag agggagagaa ttgactgaga ttgatatctc aaggacaacc 4200

caatcattga tttctgccac tgtgcatgca actgacaaac atttgcgtgt ggaaactctt 4260

ggagctattt cttctttggc tgaaaacact agcccaagaa ctgtttttga tgaagtcctg 4320

gctgctgctg gaagggatac aatcacaaag gatatatcta ggttacgtgg gggatggcca 4380

atgcaggatg cattctatgc attttctcag cacatggtac tgtcagtttt gtttctagaa 4440

catgtgatat ctgttcttag ccagattcct atccttaaag gtgatgtgga gagacttgag 4500

gatagccagg ttgacagtca tacagaagat ggcaaactgc aagctgcaat ttttgctctt 4560

accgctttct tcagaggtgg gggaaaagtt ggaaaaaggg ccgttgaaca aaactatgct 4620

tctgttcttt ctgagcttac actgcaactt ggaagctgtc atggtttaac ctattctggt 4680

cagcatgaac cattgaggaa tcttcttact gcatttcagg cattctgtga atgcgttggt 4740

gacctagaga tgggcaagat tttagctaga gatggagaac tattggaaaa tgagaggtgg 4800

attagtctca ttggagacat agcaggctgc atatctataa agcgaccaaa agaggtacaa 4860

aatatttgtc tattttttca aaactcattg gatcgacccc agaaatatca aagggaagct 4920

gcagctgctg cattgtcaga atttgttcga tatagtggtg gacttggttc acttttggag 4980

caaatggttg aggttttatg tcggcatgta tcggatgagt cttcaactgt tcggcgatta 5040

tgtttgcgag gattagtaca gatcccattg attcatattc tgaagtatac ggctcaagtc 5100

ttgggtgtta tattagctct actagatgat ttagatgaat ctgtacaatt aactgctgta 5160

tcatgcttac tgatgattct caattcttca cctgatgatg cagttgagcc cattctgctt 5220

aatctttcaa tacggcttcg aaatcttcaa acaagcatga atgcaaagat gcgagccact 5280

tcttttgcag tatttggggc gctaagcaaa tatggaattg gggtactaag tgaggcattt 5340

gtcgagcagg tacatgctgc tgttcctcgc ctggtcttgc atcttcatga tgaagatttt 5400

agtgtccgat tagcctgtcg gaataccctg aaacaagttt gcccattgat ggaaattgaa 5460

ggaatgcttg ctgtactaaa cacacacagt ttcctttctg atcatcgaag tgattatgag 5520

gactttctcc gagacattgc aaagcaattt actcagcatc ttccctctag agttgatagt 5580

tatatggcat caacagtaca ggcttttgac gcaccatggc ccataattca ggcaaatgct 5640

atatacttct gcagcagcat gctttctcta tctgacaatc agcatatttt agctgtttat 5700

cattcacagg tcttcggtat gctggtggga aaattgagtc gatcacctga tgctgttgtt 5760

agagcaacaa gttctgctgc tctgggcttg ttgctgaaat cctcccattt atgctcatgg 5820

agagctgttg aactcgatcg gttagaatca acatcacgga accatgatgt ggagtctacg 5880

aaaaac 5886

<210> 2

<211> 1962

<212> PRT

<213> Glycine max

<400> 2

Met Val Ser Lys Gly Glu Glu Leu Phe Thr Gly Val Val Pro Ile Leu

1 5 10 15

Val Glu Leu Asp Gly Asp Val Asn Gly His Lys Phe Ser Val Ser Gly

20 25 30

Glu Gly Glu Gly Asp Ala Thr Tyr Gly Lys Leu Thr Leu Lys Phe Ile

35 40 45

Cys Thr Thr Gly Lys Leu Pro Val Pro Trp Pro Thr Leu Val Thr Thr

50 55 60

Phe Gly Tyr Gly Val Gln Cys Phe Ala Arg Tyr Pro Asp His Met Lys

65 70 75 80

Gln His Asp Phe Phe Lys Ser Ala Met Pro Glu Gly Tyr Val Gln Glu

85 90 95

Arg Thr Ile Phe Phe Lys Asp Asp Gly Asn Tyr Lys Thr Arg Ala Glu

100 105 110

Val Lys Phe Glu Gly Asp Thr Leu Val Asn Arg Ile Glu Leu Lys Gly

115 120 125

Ile Asp Phe Lys Glu Asp Gly Asn Ile Leu Gly His Lys Leu Glu Tyr

130 135 140

Asn Tyr Asn Ser His Asn Val Tyr Ile Met Ala Asp Lys Gln Lys Asn

145 150 155 160

Gly Ile Lys Val Asn Phe Lys Ile Arg His Asn Ile Glu Asp Gly Ser

165 170 175

Val Gln Leu Ala Asp His Tyr Gln Gln Asn Thr Pro Ile Gly Asp Gly

180 185 190

Pro Val Leu Leu Pro Asp Asn His Tyr Leu Ser Tyr Gln Ser Ala Leu

195 200 205

Ser Lys Asp Pro Asn Glu Lys Arg Asp His Met Val Leu Leu Glu Phe

210 215 220

Val Thr Ala Ala Gly Ile Thr Leu Gly Met Asp Glu Leu Tyr Lys Gly

225 230 235 240

Ser Gly Pro Pro Pro Gly Leu Glu Pro Gly Thr Ser Met Ala Ser Ser

245 250 255

Thr Ser Ile Pro Ala Ser Glu Ala Val Gln Val Leu Leu Ser Leu Leu

260 265 270

Ala Asp Asp Thr Ser Ser Val Arg Glu Ala Ser Met Ser Ser Leu Lys

275 280 285

Asp Ile Ala Ala Leu Asn Pro Leu Leu Val Leu Asp Cys Cys Ala Val

290 295 300

Val Ser Arg Gly Gly Arg Arg Arg Phe Gly Asn Met Ala Gly Val Phe

305 310 315 320

Gln Val Met Ala Phe Gly Val Arg Ala Leu Asp Lys Lys Asp Val Asp

325 330 335

Ser Ala Phe Met Ala Lys Leu Ala Lys Ile Ala Thr Ala Glu Leu Ile

340 345 350

Ser Ser Lys Glu Leu Asn Ser Asp Trp Gln Arg Ala Ala Thr Ser Leu

355 360 365

Leu Val Ala Ile Gly Ser His Leu Pro Asp Leu Met Met Glu Glu Ile

370 375 380

Tyr Leu His Leu Ser Gly Ala Asn Ser Ala Leu Gln Ser Met Val Gln

385 390 395 400

Ile Leu Ala Glu Phe Ala Ser Thr Asp Pro Leu Gln Phe Ile Pro His

405 410 415

Trp Lys Gly Val Leu Ser Arg Ile Leu Pro Ile Leu Gly Asn Val Arg

420 425 430

Asp Met His Arg Pro Ile Phe Ala Asn Ala Phe Lys Cys Trp Cys Gln

435 440 445

Ala Ala Trp Gln Tyr Ser Ile Asp Phe Pro Ser His Phe Pro Gln Asp

450 455 460

Gly Asp Val Met Ser Phe Leu Asn Ser Ala Phe Glu Leu Leu Leu Arg

465 470 475 480

Val Trp Ala Ala Ser Arg Asp Leu Lys Val Arg Val Ala Ser Val Glu

485 490 495

Ala Leu Gly Gln Met Val Gly Leu Ile Thr Arg Thr Gln Leu Lys Thr

500 505 510

Ala Leu Pro Arg Leu Ile Pro Thr Ile Leu Asp Leu Tyr Lys Lys Asp

515 520 525

Gln Asp Ile Ala Phe Leu Ala Thr Cys Ser Leu His Asn Leu Leu Asn

530 535 540

Ala Ser Leu Leu Ser Glu Ser Gly Pro Pro Met Leu Asp Phe Glu Asp

545 550 555 560

Leu Thr Leu Val Leu Ser Thr Leu Leu Pro Val Val Ser Phe Asn Asn

565 570 575

Asp Ser Lys Asp Gln Ser Asp Phe Pro Val Gly Leu Lys Met Tyr Asn

580 585 590

Glu Val Gln His Cys Phe Leu Thr Val Gly Leu Val Tyr Pro Asp Asp

595 600 605

Leu Phe Leu Phe Leu Val Asn Lys Cys Arg Leu Arg Glu Glu Pro Leu

610 615 620

Thr Phe Gly Ser Leu Cys Ile Leu Lys His Leu Leu Pro Arg Leu Ser

625 630 635 640

Glu Ala Trp His Ser Lys Ile Pro Leu Leu Val Glu Ala Val Lys Ser

645 650 655

Leu Leu Glu Glu Gln Asn Leu Gly Val Arg Lys Ala Leu Ser Glu Leu

660 665 670

Ile Val Val Met Ala Ser His Cys Tyr Leu Val Gly Ser Ser Gly Glu

675 680 685

Leu Phe Ile Glu Tyr Leu Val Arg His Cys Ala Ile Thr Asp Gln Asn

690 695 700

Arg Ser Asp Leu Glu Ser Thr Pro Asn Lys Arg Ile Glu Met Lys Ile

705 710 715 720

Gly Ala Val Thr Pro Gly Glu Leu Arg Ala Val Cys Glu Lys Gly Leu

725 730 735

Leu Leu Val Thr Ile Thr Ile Pro Glu Met Glu His Ile Leu Trp Pro

740 745 750

Phe Leu Leu Arg Met Ile Ile Pro Leu Thr Tyr Thr Gly Ala Val Ala

755 760 765

Thr Val Cys Arg Cys Ile Ser Glu Leu Trp Arg His Arg Ser Tyr Ser

770 775 780

Asn Asp Met Leu Ser Glu Cys Lys Thr Arg Pro Asp Ile Pro Ser Ala

785 790 795 800

Glu Glu Leu Leu Ala Arg Leu Leu Val Leu Leu His Asn Pro Leu Ala

805 810 815

Arg Glu Gln Leu Ala Thr Gln Ile Leu Thr Val Leu Cys Leu Leu Ala

820 825 830

Pro Leu Phe Pro Lys Asn Ile Asn Leu Phe Trp Gln Asp Glu Ile Pro

835 840 845

Lys Met Lys Ala Tyr Val Ser Asp Thr Glu Asp Leu Lys Gln Asp Pro

850 855 860

Ser Tyr Gln Asp Thr Trp Asp Asp Met Ile Ile Asn Phe Leu Ala Glu

865 870 875 880

Ser Leu Asp Val Ile Gln Asp Ala Asp Trp Val Met Ser Leu Gly Asn

885 890 895

Val Phe Ala Lys His Tyr Glu Leu Tyr Ala Ser Asp Asp Gln His Thr

900 905 910

Ala Leu Leu His Arg Cys Leu Gly Ile Leu Leu Gln Lys Val Asn Asp

915 920 925

Arg Ala Tyr Val Cys Asp Lys Ile Asp Trp Met Tyr Lys Gln Ala Asn

930 935 940

Ile Ala Asn Pro Thr Asn Arg Leu Gly Leu Ala Lys Ala Met Gly Leu

945 950 955 960

Val Ala Ala Ser His Leu Asp Thr Val Leu Glu Lys Leu Lys Asp Ile

965 970 975

Leu Asp Asn Val Gly Gln Ser Ile Phe Gln Arg Ile Leu Ser Leu Phe

980 985 990

Ser Asp Ser Phe Arg Thr Glu Glu Ser Asp Asp Ile His Ala Ala Leu

995 1000 1005

Ala Leu Met Tyr Gly Tyr Ala Ala Lys Tyr Ala Pro Ser Thr Val

1010 1015 1020

Ile Glu Ala Arg Ile Asn Ala Leu Val Gly Thr Asn Met Leu Ser

1025 1030 1035

Arg Leu Leu His Val Arg Leu Pro Lys Ala Lys Gln Ala Val Ile

1040 1045 1050

Thr Ala Ile Asp Leu Leu Gly Asn Ala Val Ile Asn Ala Ala Glu

1055 1060 1065

Ser Gly Ser Pro Phe Pro Leu Lys Arg Arg Asp Gln Leu Leu Asp

1070 1075 1080

Tyr Ile Leu Thr Leu Met Gly Arg Asp Asp Glu Asp Gly Phe Ala

1085 1090 1095

Asp Tyr Asn Asp Leu Leu Arg Thr Gln Ala Leu Ala Ile Ser Ala

1100 1105 1110

Cys Thr Thr Leu Val Ser Val Glu Pro Lys Leu Thr Val Glu Thr

1115 1120 1125

Arg Ser His Val Met Lys Ala Thr Leu Gly Phe Phe Ala Ile Pro

1130 1135 1140

Asn Asp Pro Val Asp Val Val Asn Pro Leu Ile Asp Asn Leu Ile

1145 1150 1155

Thr Leu Leu Cys Ala Ile Leu Leu Thr Gly Gly Glu Asp Gly Arg

1160 1165 1170

Ser Arg Ala Glu Leu Leu Met Leu Ile Leu Arg Gln Ile Asp Gln

1175 1180 1185

Phe Val Cys Ser Pro Val Glu Tyr Gln Arg Lys Arg Gly Cys Leu

1190 1195 1200

Ala Val His Glu Met Leu Leu Lys Phe Arg Met Ile Cys Val Ser

1205 1210 1215

Gly Tyr Cys Ala Leu Gly Cys Arg Gly Ser Cys Ala His Asn Lys

1220 1225 1230

Gln Met Asp Arg Thr Leu Tyr Gly Asn Phe Ser Lys Leu Pro Ser

1235 1240 1245

Ala Phe Val Leu Pro Ser Arg Glu Ala Leu Cys Leu Gly Asp Arg

1250 1255 1260

Val Ile Met Tyr Leu Pro Arg Cys Ala Asp Thr Asn Ser Glu Val

1265 1270 1275

Arg Lys Ile Ser Ala Gln Ile Leu Asp Leu Leu Phe Ser Ile Ser

1280 1285 1290

Leu Ser Leu Pro Arg Pro Ala Gly Ser Ser Ile Ser Ala Glu Asp

1295 1300 1305

Ile Glu Leu Ser Tyr Ser Ala Leu Ser Ser Leu Glu Asp Val Ile

1310 1315 1320

Ala Ile Leu Arg Asn Asp Thr Ser Ile Asp Pro Ser Glu Val Phe

1325 1330 1335

Asn Arg Ile Val Ser Ser Leu Cys Ile Leu Leu Thr Lys Glu Glu

1340 1345 1350

Leu Val Ala Thr Leu His Gly Cys Ser Val Ala Ile Cys Asp Lys

1355 1360 1365

Ile Lys Gln Ser Ala Glu Gly Ala Ile Gln Ala Val Val Glu Phe

1370 1375 1380

Val Thr Lys Arg Gly Arg Glu Leu Thr Glu Ile Asp Ile Ser Arg

1385 1390 1395

Thr Thr Gln Ser Leu Ile Ser Ala Thr Val His Ala Thr Asp Lys

1400 1405 1410

His Leu Arg Val Glu Thr Leu Gly Ala Ile Ser Ser Leu Ala Glu

1415 1420 1425

Asn Thr Ser Pro Arg Thr Val Phe Asp Glu Val Leu Ala Ala Ala

1430 1435 1440

Gly Arg Asp Thr Ile Thr Lys Asp Ile Ser Arg Leu Arg Gly Gly

1445 1450 1455

Trp Pro Met Gln Asp Ala Phe Tyr Ala Phe Ser Gln His Met Val

1460 1465 1470

Leu Ser Val Leu Phe Leu Glu His Val Ile Ser Val Leu Ser Gln

1475 1480 1485

Ile Pro Ile Leu Lys Gly Asp Val Glu Arg Leu Glu Asp Ser Gln

1490 1495 1500

Val Asp Ser His Thr Glu Asp Gly Lys Leu Gln Ala Ala Ile Phe

1505 1510 1515

Ala Leu Thr Ala Phe Phe Arg Gly Gly Gly Lys Val Gly Lys Arg

1520 1525 1530

Ala Val Glu Gln Asn Tyr Ala Ser Val Leu Ser Glu Leu Thr Leu

1535 1540 1545

Gln Leu Gly Ser Cys His Gly Leu Thr Tyr Ser Gly Gln His Glu

1550 1555 1560

Pro Leu Arg Asn Leu Leu Thr Ala Phe Gln Ala Phe Cys Glu Cys

1565 1570 1575

Val Gly Asp Leu Glu Met Gly Lys Ile Leu Ala Arg Asp Gly Glu

1580 1585 1590

Leu Leu Glu Asn Glu Arg Trp Ile Ser Leu Ile Gly Asp Ile Ala

1595 1600 1605

Gly Cys Ile Ser Ile Lys Arg Pro Lys Glu Val Gln Asn Ile Cys

1610 1615 1620

Leu Phe Phe Gln Asn Ser Leu Asp Arg Pro Gln Lys Tyr Gln Arg

1625 1630 1635

Glu Ala Ala Ala Ala Ala Leu Ser Glu Phe Val Arg Tyr Ser Gly

1640 1645 1650

Gly Leu Gly Ser Leu Leu Glu Gln Met Val Glu Val Leu Cys Arg

1655 1660 1665

His Val Ser Asp Glu Ser Ser Thr Val Arg Arg Leu Cys Leu Arg

1670 1675 1680

Gly Leu Val Gln Ile Pro Leu Ile His Ile Leu Lys Tyr Thr Ala

1685 1690 1695

Gln Val Leu Gly Val Ile Leu Ala Leu Leu Asp Asp Leu Asp Glu

1700 1705 1710

Ser Val Gln Leu Thr Ala Val Ser Cys Leu Leu Met Ile Leu Asn

1715 1720 1725

Ser Ser Pro Asp Asp Ala Val Glu Pro Ile Leu Leu Asn Leu Ser

1730 1735 1740

Ile Arg Leu Arg Asn Leu Gln Thr Ser Met Asn Ala Lys Met Arg

1745 1750 1755

Ala Thr Ser Phe Ala Val Phe Gly Ala Leu Ser Lys Tyr Gly Ile

1760 1765 1770

Gly Val Leu Ser Glu Ala Phe Val Glu Gln Val His Ala Ala Val

1775 1780 1785

Pro Arg Leu Val Leu His Leu His Asp Glu Asp Phe Ser Val Arg

1790 1795 1800

Leu Ala Cys Arg Asn Thr Leu Lys Gln Val Cys Pro Leu Met Glu

1805 1810 1815

Ile Glu Gly Met Leu Ala Val Leu Asn Thr His Ser Phe Leu Ser

1820 1825 1830

Asp His Arg Ser Asp Tyr Glu Asp Phe Leu Arg Asp Ile Ala Lys

1835 1840 1845

Gln Phe Thr Gln His Leu Pro Ser Arg Val Asp Ser Tyr Met Ala

1850 1855 1860

Ser Thr Val Gln Ala Phe Asp Ala Pro Trp Pro Ile Ile Gln Ala

1865 1870 1875

Asn Ala Ile Tyr Phe Cys Ser Ser Met Leu Ser Leu Ser Asp Asn

1880 1885 1890

Gln His Ile Leu Ala Val Tyr His Ser Gln Val Phe Gly Met Leu

1895 1900 1905

Val Gly Lys Leu Ser Arg Ser Pro Asp Ala Val Val Arg Ala Thr

1910 1915 1920

Ser Ser Ala Ala Leu Gly Leu Leu Leu Lys Ser Ser His Leu Cys

1925 1930 1935

Ser Trp Arg Ala Val Glu Leu Asp Arg Leu Glu Ser Thr Ser Arg

1940 1945 1950

Asn His Asp Val Glu Ser Thr Lys Asn

1955 1960

<210> 3

<211> 408

<212> DNA

<213> Artificial sequence

<400> 3

aaaataaatg gtaaaatgtc aaatcaaaac taggctgcag tatgcagagc agagtcatga 60

tgatactact tactacaccg attcttgtgt gcagaaaaat atgttaaaat aattgaatct 120

ttctctagcc aaatttgaca acaatgtaca ccgttcatat tgagagacga tgcttcttgt 180

ttgctttcgg tggaagctgc atatactcaa cattactcct tcagcgagtt ttccaactga 240

gtcccacatt gcccagacct aacacggtat tcttgtttat aatgaaatgt gccaccacat 300

ggattgattg tgcactgggc tgtcggtttt agagctagaa atagcaagtt aaaataaggc 360

tagtccgtta tcaacttgaa aaagtggcac cgagtcggtg cttttttt 408

<210> 4

<211> 408

<212> DNA

<213> Artificial sequence

<400> 4

aaaataaatg gtaaaatgtc aaatcaaaac taggctgcag tatgcagagc agagtcatga 60

tgatactact tactacaccg attcttgtgt gcagaaaaat atgttaaaat aattgaatct 120

ttctctagcc aaatttgaca acaatgtaca ccgttcatat tgagagacga tgcttcttgt 180

ttgctttcgg tggaagctgc atatactcaa cattactcct tcagcgagtt ttccaactga 240

gtcccacatt gcccagacct aacacggtat tcttgtttat aatgaaatgt gccaccacat 300

ggattgacac tgcatggttg ctcaggtttt agagctagaa atagcaagtt aaaataaggc 360

tagtccgtta tcaacttgaa aaagtggcac cgagtcggtg cttttttt 408

Claims (10)

1. The use of any one of the following 1) to 3) in a following a to e;

1) protein CS 1;

2) a nucleic acid molecule encoding protein CS 1;

3) a recombinant vector, expression cassette or recombinant bacterium comprising a nucleic acid molecule encoding protein CS 1;

the protein CS1 is (1) or (2) or (3) as follows:

(1) a protein consisting of an amino acid sequence shown in sequence No. 253-1962 in the sequence table;

(2) a protein formed by adding a label at the tail end of an amino acid sequence shown in a sequence 2 in a sequence table;

(3) protein which is derived from the amino acid sequence shown in the (1) or (2) through substitution and/or deletion and/or addition of one or more amino acid residues and has the same function;

a) regulating and controlling the lodging resistance of the plant;

b) regulating and controlling the plant height of the plant;

c) regulating and controlling the thickness of plant stems;

d) regulating and controlling the strength of the plant stalks;

e) and (4) improving the plant germplasm resources.

2. Use according to claim 1, characterized in that:

the protein CS1 is a protein consisting of an amino acid sequence shown in a sequence 2 in a sequence table.

3. Use according to claim 1 or 2, characterized in that:

the nucleic acid molecule encoding the protein CS1 is a DNA molecule of any one of the following 1) to 4):

1) the coding region is a DNA molecule shown in the 757-5886 th site of the sequence 1 in the sequence table;

2) the coding region is a DNA molecule shown as a sequence 1 in a sequence table;

3) DNA molecules which hybridize under stringent conditions with the DNA sequences defined in 1) or 2) and which code for proteins having the same function;

4) a DNA molecule having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% homology to the DNA sequence defined in 1) or 2) and encoding a protein having the same function.

4. Use of the substance according to any one of claims 1-3 for cultivating plants with improved lodging resistance, low stalk, thick stalk and/or high stalk strength.

5. Use of a substance which reduces the activity or content of protein CS1 in any one of the following 1) to 5);

or, the use of a substance which inhibits the expression of a nucleic acid molecule encoding said protein CS1 in any one of 1) to 5) below;

1) the lodging resistance of the plants is reduced;

2) the thickness of the plant stalks is reduced;

3) the strength of the plant stem is reduced;

4) cultivating plants with low fine stalk and/or stalk strength;

5) cultivating lodging-resistant and reduction-reducing plants;

the protein CS1 is (1) or (2) or (3) as follows:

(1) a protein consisting of an amino acid sequence shown in sequence No. 253-1962 in the sequence table;

(2) a protein formed by adding a label at the tail end of an amino acid sequence shown in a sequence 2 in a sequence table;

(3) and (3) the protein which is derived from the protein (1) or (2) and has the same function, wherein the protein is obtained by substituting and/or deleting and/or adding one or more amino acid residues in the amino acid sequence shown in the (1) or (2).

6. Use according to claim 5, characterized in that: the substance is a CRISPR/Cas9 system;

the CRISPR/Cas9 system includes the following 1) or 2):

1) an sgRNA that is sgRNA1 or sgRNA 2;

the sgRNA1 targets at position 306-325 of the sequence 3,

the sgRNA2 targets at position 306-325 of the sequence 4;

2) a CRISPR/Cas9 vector expressing the sgRNA1 or the sgRNA 2.

7. A method for breeding transgenic plants with high lodging resistance, low stalk, thick stalk and/or stalk strength, which comprises the following steps 1) or 2):

1) the method comprises the following steps: improving the content and/or activity of protein CS1 in the target plant to obtain a transgenic plant;

2) the method comprises the following steps: improving the expression of a nucleic acid molecule of the encoding protein CS1 in a target plant to obtain a transgenic plant;

the lodging resistance of the transgenic plant is higher than that of the target plant;

or, the transgenic plant has a lower plant height than the plant of interest;

or the thickness of the stem of the transgenic plant is higher than that of the target plant;

or the stem strength of the transgenic plant is higher than that of the target plant;

the protein CS1 is (1) or (2) or (3) as follows:

(1) a protein consisting of an amino acid sequence shown in the 253-th and 1962 sites of the sequence 2 in the sequence table;

(2) a protein formed by adding a label at the tail end of an amino acid sequence shown in the 1 st-1962 nd site of a sequence 2 in a sequence table;

(3) and (2) the protein which is derived from the protein (1) or (2) and has the same function by substituting and/or deleting and/or adding one or more amino acid residues in the amino acid sequence shown in the 253-friendly 1962 position of the sequence 2 in the sequence table.

8. The method of claim 7, wherein:

the method for improving the content and/or activity of the protein CS1 in the target plant or improving the expression of the nucleic acid molecule for encoding the protein CS1 in the target plant is to introduce the nucleic acid molecule for encoding the protein CS1 into the target plant.

9. A method for growing plants with reduced lodging resistance and low stalk and/or stalk strength, as 1) or 2) or 3) as follows:

1) comprises the following steps: reducing the activity or content of protein in the target plant to obtain a transgenic plant;

2) comprises the following steps: inhibiting the expression of DNA molecules encoding the protein in the target plant to obtain a transgenic plant;

3) comprises the following steps: carrying out gene editing on a DNA molecule encoding the protein in a target plant to terminate the translation of the protein in advance to obtain a transgenic plant;

the transgenic plant has lower lodging resistance than the target plant;

or the thickness of the stem of the transgenic plant is less than that of the target plant;

or the stem strength of the transgenic plant is less than that of the target plant;

the protein CS1 is (1) or (2) or (3) as follows:

(1) a protein consisting of an amino acid sequence shown in sequence No. 253-1962 in the sequence table;

(2) a protein formed by adding a label at the tail end of an amino acid sequence shown in a sequence 2 in a sequence table;

(3) and (3) the protein which is derived from the protein (1) or (2) and has the same function, wherein the protein is obtained by substituting and/or deleting and/or adding one or more amino acid residues in the amino acid sequence shown in the (1) or (2).

10. The method of claim 9, wherein:

said reducing the activity or content of said protein in a plant of interest, said inhibiting the expression of a DNA molecule encoding said protein in a plant of interest, or said genetically editing a DNA molecule encoding said protein in a plant of interest is effected by: introducing the CRISPR/Cas9 system into the plant of interest;

the CRISPR/Cas9 system includes the following 1) or 2):

1) an sgRNA that is sgRNA1 or sgRNA 2;

the sgRNA1 targets at position 306-325 of the sequence 3,

the target point of the gRNA2 is the 306 nd-325 th site of the sequence 4;

2) a CRISPR/Cas9 vector expressing the sgRNA1 or the sgRNA 2.

Images