CN112481233B

CN112481233B - Enzyme preparation for preparing citicoline and method for preparing citicoline through enzyme catalysis

Info

Publication number: CN112481233B
Application number: CN202011148184.8A
Authority: CN
Inventors: 范晓光; 胡晨龙; 宋雪静; 安俊侠; 谢希贤; 徐庆阳
Original assignee: Tianjin University of Science and Technology
Current assignee: Tianjin University of Science and Technology
Priority date: 2020-10-23
Filing date: 2020-10-23
Publication date: 2022-11-29
Anticipated expiration: 2040-10-23
Also published as: CN112481233A

Abstract

The invention relates to an enzyme preparation for preparing citicoline, which comprises the following preparation steps: constructing engineering bacteria Escherichia coli CKI-CCT to express choline kinase and phosphorylcholine cytidine transferase derived from Fusobacterium nucleatum; constructing engineering bacteria Escherichia coli PPK-UDK to express polyphosphate kinase derived from rhodobacter sphaeroides and cytidine kinase derived from thermus thermophilus; constructing engineering bacteria Escherichia coli CMK-NDK to express cytidine kinase and nucleoside diphosphate kinase derived from Escherichia coli; and (3) crushing enzyme-producing cells obtained by fermentation, centrifuging and collecting supernatant to obtain crude enzyme liquid. The invention reports that the phosphocholine cytidine transferase from fusobacterium nucleatum can be used for synthesizing citicoline for the first time, and the heterologous soluble expression quantity and the enzyme activity of the phosphocholine cytidine transferase from fusobacterium nucleatum are higher.

Description

Enzyme preparation for preparing citicoline and method for preparing citicoline through enzyme catalysis

Technical Field

The invention belongs to the technical field of compound biology, and particularly relates to an enzyme preparation for preparing citicoline and a method for preparing the citicoline through enzyme catalysis.

Background

Citicoline is an important precursor of lecithin synthesis in organisms. Citicoline was first developed by Wuta pharmaceutical industry, japan, under the trade name "Nicholin" (Nicolin), and it has been recorded in the Chinese pharmacopoeia as a cell metabolism improving agent. Citicoline is a nerve activator with the largest clinical dosage, can promote the biosynthesis of lecithin, recover the function of nerve tissues and improve the metabolism and circulation of brain, can be used for recovering the disturbance of consciousness caused by acute craniocerebral trauma and brain surgery, and can be used for the adjuvant treatment of Parkinson's syndrome and senile dementia. Citicoline is a precursor of lecithin biosynthesis and as brain function decreases, the lecithin content in brain tissue decreases significantly. Supplementing exogenous citicoline can activate the biosynthesis of lecithin, stimulate the excitation of brain stem network structure, raise reviving threshold, restore nerve tissue function, improve brain metabolism and nerve conduction and raise consciousness level of patient.

The existing preparation method of citicoline is mainly a chemical synthesis method. The general method is to condense cytidine-5' -phospho-morphine and choline phosphate hydrochloride in acetonitrile or pyridine to form citicoline. Among them, cytidine-5' -phospho-morpholine can be obtained by a process of dehydrating condensation of CMP and morpholine in DCC (Chemical and Pharmaceutical Bulletin,1971,19 (5): 1011-1016.) or by selective phosphorylation of cytidine (Journal of Chemical Research,2016,40 (6): 358-360.). However, the raw materials and condensing agents used in the above synthetic routes are expensive, and the reaction needs to be completed in toxic organic solvents, resulting in low synthesis yield of citicoline and high production cost.

Most of the domestic production in recent years is reported as biotransformation, various microorganisms are used as biocatalysts, and Cytidine transferase (CCT, EC 2.7.7.15) of choline phosphate in the microorganisms is used as substrates, so that Cytidine Triphosphate (CTP) and choline phosphate can be directly synthesized into citicoline. Zhanguyu et al (J.Med.Med., 1987,18 (6): 252-255.) biosynthesized citicoline using resting cells of Hansenula anomala as a biocatalyst using Cytidine Monophosphosphate (CMP) and phosphorylcholine; patent application No. 201210066604.7 reports the biosynthesis of CMP in a culture solution containing multiple microorganisms with simple raw materials of carbon and nitrogen sources and the cumulative production of citicoline. With the development of molecular biology technology, genetic engineering technology becomes a new means for improving citicoline-producing strains. Patent 201310167034.5 reports that CCT enzyme is heterologously expressed and immobilized by using escherichia coli engineering bacteria, and citicoline is biosynthesized by taking phosphorylcholine and CTP as raw materials; patent application No. 201510702581.8 reports biosynthesis of citicoline using orotic acid and phosphorylcholine using an engineered genetically engineered escherichia coli strain as biocatalyst. The GDN Tongxin et al (pharmaceutical biotechnology, 2018,25 (04): 294-298) improve the conversion rate and yield of citicoline by over-expressing CCT enzyme which is a key reaction enzyme in yeast, and take CMP and phosphorylcholine as raw materials to prepare citicoline by biotransformation, and the molar conversion rate can reach 73.1 percent after 7h of reaction.

In the aspect of biological method preparation of citicoline, a multienzyme catalytic system is mainly adopted abroad, and target products are obtained through different reaction ways. For example, in the commonly used CMP-glucose-Saccharomyces Cerevisiae (CGS) pathway, CMP and choline chloride (or phosphorylcholine) are used as substrates, the CMP and choline are converted into citicoline using permeabilized Saccharomyces cerevisiae cells (Journal of fermentation Technology,1974,52, 637-645), and ATP is continuously provided for the reaction via the glycolysis pathway (Bioresource Technology,2009,100 (20): 4848-4853). The maximum accumulation, molar yield, and reaction rate of the product reach 26.9mM, 82.3%, and 1.11mmol L, respectively ^-1 ﹒h ^-1 (Bioresource Technology,2010,101 (22): 8807-8813). In the orotate-glucose-ammonia producing corynebacterium-e.coli (OGCE) pathway, orotic acid and choline chloride are used as catalytic substrates, firstly, the orotic acid is converted into UTP by using the permeabilized corynebacterium ammoniagenes cells and the glucose is decomposed to generate ATP, and then the UTP and choline chloride are converted into citicoline by using recombinant e.coli over-expressing CTP Synthase (CTPs), phosphorylcholine cytidylyltransferase (CCT) and Choline Kinase (CKI), and the accumulation amount, molar yield and reaction rate of the product reach 21.6mM, 45.7% and 0.94mmol L respectively ^-1 ﹒h ^-1 (Journal of the Agricultural Chemical Society ofJapan,1997,61(6):956–959)。

The application is particularly provided in view of the problems of toxic reagents and low synthesis yield existing in the existing chemical method and the problems of overhigh raw material cost, low conversion rate and reaction rate and the like existing in the multi-enzyme catalysis method.

Disclosure of Invention

The invention aims to overcome the defects in the prior art and provides an enzyme preparation for preparing citicoline and a method for preparing the citicoline through enzyme catalysis.

The technical scheme adopted by the invention for solving the technical problem is as follows:

an enzyme preparation for preparing citicoline is prepared by the following steps:

firstly, constructing an engineering bacterium Escherichia coli CKI-CCT to express choline kinase and phosphorylcholine cytidine transferase derived from fusobacterium nucleatum, wherein the choline kinase can catalyze choline chloride to form phosphorylcholine, and the phosphorylcholine cytidine transferase can catalyze the phosphorylcholine and CTP to form citicoline; constructing engineering bacteria Escherichia coli PPK-UDK to express polyphosphate kinase derived from rhodobacter sphaeroides and cytidine kinase derived from thermus thermophilus, wherein the polyphosphate kinase can be used for catalyzing ATP regeneration, and the cytidine kinase can be used for catalyzing cytidine to form CMP; constructing engineering bacteria Escherichia coli CMK-NDK to express cytidine kinase and nucleoside diphosphate kinase derived from Escherichia coli, wherein the cytidine kinase can be used for catalyzing CMP to form CDP, and the nucleoside diphosphate kinase can be used for catalyzing CDP to form CTP;

secondly, crushing enzyme-producing cells obtained by fermentation, centrifuging at 13000rpm for 2min, and collecting supernatant to obtain crude enzyme solution, namely the enzyme preparation for preparing the citicoline.

Moreover, the specific preparation steps are as follows:

the method comprises the steps of expressing heterologous choline kinase and phosphorylcholine cytidine transferase coding genes in Escherichia coli E.coli BL21 (ACCC 11171) to construct a strain Escherichia coli CKI-CCT with choline kinase activity and phosphorylcholine cytidine transferase activity;

secondly, expressing heterologous polyphosphate kinase and cytidine kinase coding genes in Escherichia coli BL21 (ACCC 11171) to construct a strain Escherichia coli PPK-UDK with polyphosphate kinase and cytidine kinase activities;

thirdly, endogenous cytidylic acid kinase and diphosphokinase encoding genes are expressed in Escherichia coli E.coli BL21 (ACCC 11171), and a strain Escherichia coli CMK-NDK with cytidylic acid kinase and diphosphokinase activities is constructed;

fourth, the constructed recombinant strains Escherichia coli CKI-CCT, escherichia coli PPK-UDK and Escherichia coli CMK-NDK are respectively cultured in a culture medium, choline kinase, phosphorylcholine cytidyltransferase, polyphosphate kinase, cytidine kinase, diphosphate kinase and cytidylate kinase with high enzyme activity are induced to generate, and enzyme-producing cells are collected in a centrifugal mode;

fifthly, the enzyme-producing cells Escherichia coli CKI-CCT, escherichia coli PPK-UDK and Escherichia coli CMK-NDK obtained through culture in the fourth step are resuspended in a balance buffer solution and subjected to cell disruption, and the disrupted solution is centrifuged at 13000r/min for 20min to obtain supernatant, namely the crude enzyme solution.

In the first step, pET-Duet plasmids are used as vectors to over-express choline kinase and phosphorylcholine cytidine transferase genes in E.coli BL21, and a strain E.coli CKI-CCT with choline kinase activity and phosphorylcholine cytidine transferase activity is constructed; wherein the choline kinase coding gene is derived from Fusobacterium nucleatum (ATCC 25586), and amplification primers of the choline kinase coding gene are SEQ ID NO.1 and SEQ ID NO.2; the coding gene of the phosphorylcholine cytidine transferase is derived from Fusobacterium nucleatum (ATCC 25586), and amplification primers of the coding gene are SEQ ID NO.3 and SEQ ID NO.4; the nucleotide sequence of the plasmid pET-Duet is SEQ ID NO.13;

in the second step, pET-Duet plasmids are used as vectors to over-express polyphosphate kinase and cytidine kinase genes in E.coli BL21, and a strain E.coli PPK-UDK with the activity of polyphosphate kinase and cytidine kinase is constructed; wherein the polyphosphate kinase coding gene is derived from Rhodobacter sphaeroides (CGMCC 1.5028), and amplification primers of the polyphosphate kinase coding gene are SEQ ID NO.5 and SEQ ID NO.6; the cytidine kinase coding gene is derived from Thermus thermophilus (ATCC 27634), and amplification primers of the cytidine kinase coding gene are SEQ ID NO.7 and SEQ ID NO.8; the nucleotide sequence of the plasmid pET-Duet is SEQ ID NO.13;

in the step three, overexpression of cytidylic acid kinase and diphosphokinase genes in E.coli BL21 is carried out by taking pET-Duet plasmid as a vector, and a strain E.coli CMK-NDK with cytidylic acid kinase activity and diphosphokinase activity is constructed; wherein the gene encoding the cytidylic acid kinase is derived from Escherichia coli K12 (ATCC 10798), and amplification primers of the gene are SEQ ID NO.9 and SEQ ID NO.10; the diphosphate kinase coding gene is derived from Escherichia coli K12 (ATCC 10798), and amplification primers of the diphosphate kinase coding gene are SEQ ID NO.11 and SEQ ID NO.12; the nucleotide sequence of the plasmid pET-Duet is SEQ ID NO.13.

In the step four, the specific steps of culturing the recombinant strain in the culture medium are as follows:

(1) and (3) test tube slant culture: selecting 3-4 rings from a glycerol bacteria-protecting tube by using an inoculating ring, streaking and inoculating the ring in a slant culture medium with ampicillin resistance, culturing for 10-14h in an incubator at 37 ℃, and transferring for 1 generation;

(2) slant culture in eggplant-shaped bottles: selecting all thalli from a test tube slant culture medium by using an inoculating loop, streaking and inoculating the thalli into a eggplant-shaped bottle slant culture medium with ampicillin resistance, culturing for 10-14h in an incubator at 37 ℃, and transferring for 2 generations;

(3) inoculating all the bacteria in the eggplant-shaped bottle to a fermentation culture medium with ampicillin resistance, controlling the initial ventilation amount to be 2L/min, controlling the dissolved oxygen to be 20-40% (the dissolved oxygen of 0 percent is defined as the dissolved oxygen in a saturated sodium sulfite solution added with a small amount of copper sulfate, and the dissolved oxygen of 100 percent is defined as the dissolved oxygen in static air), controlling the pH to be 7.0 by automatically feeding ammonia water, and controlling the culture temperature to be 37 ℃;

(4) cultured to OD ₆₀₀ When the concentration is 12-14, adding IPTG (isopropyl-beta-D-thiogalactoside) with the final concentration of 0.1-0.3mM to induce and express the target protein, adjusting the induction temperature to 25-30 ℃, and carrying out induction culture for 6-8h to collect thalli;

(5) centrifuging at 8000r/min and 4 deg.C for 15min to collect thallus, taking physiological saline or PBS buffer solution, shaking, resuspending and cleaning thallus for 2 times, and centrifuging and storing in-80 deg.C refrigerator for use.

Moreover, the slant culture medium is: 5g/L glucose, 10g/L peptone, 5g/L yeast extract, 10g/L beef extract, 5g/L NaCl, 25g/L agar, pH 7.0-7.2, sterilizing at 121 deg.C for 20min;

the fermentation medium is as follows: 20g/L glucose, 5g/L yeast extract, 30g/L corn steep liquor, 5g/L NaCl, KH ₂ PO ₄ 1 g/L，MgSO ₄ 0.5 g/L，V _H 1mg/L, pH 6.5-7.2, wherein glucose is sterilized at 115 deg.C for 15min, and other components are sterilized at 121 deg.C for 20min.

Moreover, the ratio g of the cell wet weight usage of the three Escherichia coli CKI-CCT, escherichia coli PPK-UDK and Escherichia coli CMK-NDK to the balance buffer solution in the step FI: mL are in order 12: 50. 10:50 and 8:50;

alternatively, the equilibration buffer is 50mM Na ₂ HPO ₄ And/or 300mM NaCl, adjusted to pH8.0 with NaOH;

or the cell disruption method comprises ultrasonic disruption, freeze-thaw disruption, liquid nitrogen grinding disruption or high-pressure homogenate disruption,

the crushing conditions of the high-pressure homogenate crushing are as follows: at 4 ℃ and 800-1000bar.

Use of an enzyme preparation as described above for the preparation of citicoline.

The method for preparing the citicoline by using the enzyme preparation as the catalyst comprises the steps of mixing the enzyme preparation with choline chloride, magnesium chloride, sodium hexametaphosphate, ATP, cytidine and Tris-HCL buffer solution by using the enzyme preparation as the catalyst and using the choline chloride, the cytidine, the sodium hexametaphosphate and the ATP as substrates, carrying out enzyme catalytic reaction, controlling the temperature at 30 ℃ and the stirring speed at 300r/min, and synthesizing the citicoline by adding NaOH or HCL to maintain the pH value at 8.0 in the reaction process.

The concentration of choline chloride, magnesium chloride, sodium hexametaphosphate, cytidine, ATP, tris-HCL buffer, and sodium hexametaphosphate in the reaction system were 30mM, 60mM, 5mM, 8.0 mM, and 100mM, respectively.

Moreover, the detection method of citicoline in the obtained reaction solution comprises the following steps: inactivating the reaction solution in boiling water bath, centrifuging at 13000r/min for 2min, and collectingDiluting the supernatant to 1g/L with deionized water, and filtering with 0.22 μm sterile membrane to obtain liquid phase bottle for analysis; determining content of citicoline by high performance liquid chromatography, wherein the sample volume is 20 μ L, the chromatographic column is Sepax HP-SAX (4.6 × 250 mM), and the mobile phase is 50mM KH ₂ PO ₄ ，H ₃ PO ₄ Adjusting pH to 3.5, column temperature to 30 deg.C, flow rate to 1mL/min, detection wavelength to 254nm, and citicoline retention time to 6.5min.

The invention has the advantages and positive effects that:

1. the invention reports that the phosphorylcholine cytidine transferase from Fusobacterium nucleatum (ATCC 25586) can be used for synthesizing the citicoline for the first time. Compared with the phosphocholine cytidine transferase generally used in the existing reports and derived from saccharomyces cerevisiae, the heterologous soluble expression quantity and the enzyme activity of the phosphocholine cytidine transferase derived from fusobacterium nucleatum are higher.

2. The invention realizes the process of preparing the citicoline by taking the cytidine and the choline chloride as main raw materials by using a multi-enzyme catalytic system for the first time. Compared with CMP and phosphorylcholine commonly used in the existing reports, the raw material cost is lower and the raw material is easy to obtain.

3. The invention solves the problems of low conversion rate and reaction rate of multi-enzyme catalysis, uses pET-Duet plasmid to carry out tandem expression on the enzyme for reaction, and optimizes the combination ratio, thereby simplifying the number of enzyme-producing strains. Under the optimal reaction conditions, the molar conversion rate of the citicoline to the cytidine reaches 91.5%, and the reaction rate reaches 4.58mmol ^-1 ﹒h ^-1 。

4. The enzyme preparation of the invention is used for synthesizing citicoline through multi-enzyme catalytic reaction, the reaction lasts for 6 hours, the molar yield of the citicoline is 27.4mM, and the molar conversion rate of substrate cytidine is 91.5%. Compared with the traditional production method, the method has the advantages of low raw material cost, mild reaction conditions, simplicity in operation, high conversion rate, high reaction speed and the like.

Drawings

FIG. 1 is a schematic representation of an enzyme-catalyzed reaction of the present invention;

FIG. 2 is a liquid chromatogram of citicoline in the multi-enzyme catalytic reaction solution of the present invention;

FIG. 3 is a liquid chromatogram of citicoline standard according to the present invention;

FIG. 4 is the electrophoresis chart of phosphocholine cytidyltransferase protein from Saccharomyces cerevisiae and Fusobacterium nucleatum of the present invention.

Detailed Description

The present invention is further illustrated by the following examples, which are intended to be illustrative, not limiting and are not intended to limit the scope of the invention.

The raw materials used in the invention are all conventional commercial products unless otherwise specified, the methods used in the invention are all conventional methods in the field if not specified, and the quality of each substance used in the invention is conventional quality.

An enzyme preparation for preparing citicoline is prepared through the following steps:

firstly, constructing an engineering bacterium Escherichia coli CKI-CCT to express choline kinase and phosphorylcholine cytidine transferase derived from fusobacterium nucleatum, wherein the choline kinase can catalyze choline chloride to form phosphorylcholine, and the phosphorylcholine cytidine transferase can catalyze the phosphorylcholine and CTP to form citicoline; engineering bacteria Escherichia coli PPK-UDK are constructed to express polyphosphate kinase derived from rhodobacter sphaeroides and cytidine kinase derived from thermus thermophilus, the polyphosphate kinase can be used for catalyzing ATP regeneration, and the cytidine kinase can be used for catalyzing cytidine to form CMP; constructing engineering bacteria Escherichia coli CMK-NDK to express cytidine kinase and nucleoside diphosphate kinase derived from Escherichia coli, wherein the cytidine kinase can be used for catalyzing CMP to form CDP, and the nucleoside diphosphate kinase can be used for catalyzing CDP to form CTP;

secondly, crushing the zymogenic cells obtained by fermentation, centrifuging at 13000rpm for 2min, and collecting supernatant to obtain crude enzyme liquid, namely the enzyme preparation for preparing the citicoline.

Preferably, the preparation method comprises the following steps:

the method comprises the steps of expressing heterologous choline kinase and phosphorylcholine cytidine transferase coding genes in Escherichia coli E.coli BL21 (ACCC 11171) to construct a bacterial strain Escherichia coli CKI-CCT with choline kinase activity and phosphorylcholine cytidine transferase activity;

expressing heterologous polyphosphate kinase and cytidine kinase coding genes in Escherichia coli BL21 (ACCC 11171) to construct a strain Escherichia coli PPK-UDK with polyphosphate kinase and cytidine kinase activities;

Preferably, in the step, pET-Duet plasmids are used as vectors to over-express choline kinase and phosphorylcholine cytidine transferase genes in E.coli BL21, and a strain E.coli CKI-CCT with choline kinase activity and phosphorylcholine cytidine transferase activity is constructed; wherein the choline kinase coding gene is derived from Fusobacterium nucleatum (ATCC 25586), and amplification primers of the choline kinase coding gene are SEQ ID NO.1 and SEQ ID NO.2; the coding gene of the phosphorylcholine cytidylyltransferase is derived from Fusobacterium nucleatum (ATCC 25586), and the amplification primers are SEQ ID NO.3 and SEQ ID NO.4; the nucleotide sequence of the plasmid pET-Duet is SEQ ID NO.13;

in the second step, pET-Duet plasmids are used as vectors to over-express polyphosphate kinase and cytidine kinase genes in E.coli BL21, and a strain E.coli PPK-UDK with the activity of the polyphosphate kinase and the cytidine kinase is constructed; wherein the polyphosphate kinase coding gene is derived from rhodobacter sphaeroides (CGMCC 1.5028), and amplification primers of the polyphosphate kinase coding gene are SEQ ID NO.5 and SEQ ID NO.6; the cytidine kinase coding gene is derived from Thermus thermophilus (ATCC 27634), and amplification primers of the cytidine kinase coding gene are SEQ ID NO.7 and SEQ ID NO.8; the nucleotide sequence of the plasmid pET-Duet is SEQ ID NO.13;

in the step three, overexpression of cytidylic acid kinase and diphosphokinase genes in E.coli BL21 is carried out by taking pET-Duet plasmid as a vector, and a strain E.coli CMK-NDK with cytidylic acid kinase activity and diphosphokinase activity is constructed; wherein the cytidylic acid kinase coding gene is derived from Escherichia coli K12 (ATCC 10798), and amplification primers of the cytidylic acid kinase coding gene are SEQ ID NO.9 and SEQ ID NO.10; the diphosphate kinase coding gene is derived from Escherichia coli K12 (ATCC 10798), and amplification primers of the diphosphate kinase coding gene are SEQ ID NO.11 and SEQ ID NO.12; the nucleotide sequence of the plasmid pET-Duet is SEQ ID NO.13.

Preferably, the specific steps of culturing the recombinant strain in the culture medium in the step four are as follows:

(1) slant culture in test tubes: selecting 3-4 rings from a glycerol-protected bacterium tube by using an inoculating ring, streaking and inoculating the ring in a slant culture medium with ampicillin resistance, culturing for 10-14h in an incubator at 37 ℃, and transferring for 1 generation;

(4) cultured to OD ₆₀₀ If the concentration is not less than 12-14, IPTG (isopropyl-beta-D-thiogalactoside) with the final concentration of 0.1-0.3mM is added to induce and express the target protein, and induction is regulatedInducing culture at 25-30 deg.C for 6-8h, and collecting thallus;

Preferably, the slant culture medium is: 5g/L glucose, 10g/L peptone, 5g/L yeast extract, 10g/L beef extract, 5g/L NaCl, 25g/L agar, pH 7.0-7.2, sterilizing at 121 deg.C for 20min;

Preferably, the ratio g of the cell wet weight usage of the three Escherichia coli CKI-CCT, escherichia coli PPK-UDK and Escherichia coli CMK-NDK to the balance buffer solution in the step FI: mL is 12: 50. 10:50 and 8:50;

alternatively, the equilibration buffer is 50mM Na ₂ HPO ₄ And/or 300mM NaCl, pH adjusted to 8.0 with NaOH;

The method for preparing the citicoline by using the enzyme preparation as the catalyst comprises the steps of mixing the enzyme preparation with choline chloride, cytidine, sodium hexametaphosphate and ATP as substrates, carrying out enzyme catalytic reaction, controlling the temperature at 30 ℃ and the stirring speed at 300r/min, and synthesizing the citicoline by feeding NaOH or HCL to maintain the pH value at 8.0 in the reaction process.

Preferably, the reaction system has a choline chloride concentration of 30mM, a magnesium chloride concentration of 60mM, a sodium hexametaphosphate concentration of 60mM, a cytidine concentration of 30mM, an ATP concentration of 5mM, a Tris-HCL buffer pH =8.0, and a concentration of 100mM.

Preferably, the detection method of citicoline in the obtained reaction solution comprises the following steps: inactivating reaction liquid in boiling water bath, centrifuging at 13000r/min for 2min, taking supernatant, diluting to 1g/L with deionized water, filtering with sterile membrane of 0.22 μm to liquid phase bottle for analysis; determining content of citicoline by high performance liquid chromatography, wherein the sample volume is 20 μ L, the chromatographic column is Sepax HP-SAX (4.6 × 250 mM), and the mobile phase is 50mM KH ₂ PO ₄ ，H ₃ PO ₄ Adjusting pH to 3.5, column temperature to 30 deg.C, flow rate to 1mL/min, detection wavelength to 254nm, and citicoline retention time to 6.5min.

As shown in fig. 1.

Specifically, the preparation and detection are as follows:

1. construction of Choline kinase and Phosphorylcholine Cytidine transferase Strain E

(1) A genome of Fusobacterium nucleatum (ATCC 25586) is used as a template, a pair of primers are designed according to a choline kinase gene licA sequence, and an licA gene fragment is obtained through amplification. The pair of primers contains cleavage sites EcoR I and Hind III, respectively (see appendix <1 >).

(2) The objective fragment and pET-Duet vector plasmid (see appendix < 7) obtained in step (1) were digested simultaneously with the Takara restriction enzymes EcoR I and Hind III to obtain the objective gene with the same cohesive ends and pET-Duet linear fragment.

(3) And (3) respectively connecting the gene fragments obtained in the step (2) by using Takara T4DNA ligase to obtain a recombinant expression vector pET-Duet-licA.

(4) A gene amplification primer pair is designed by taking a Fusobacterium nucleatum (ATCC 25586) genome as a template according to a coding gene licC sequence of phosphorylcholine cytidyltransferase, and a target gene segment is obtained by amplification. The pair of primers contains the cleavage sites EcoRV and Xho I, respectively (see appendix <2 >).

(5) The recombinant expression vector pET-Duet-licA obtained in step (3) was double-digested with Takara restriction enzymes EcoR V and Xho I to obtain the target gene with the same cohesive ends and pET-Duet-licA linear fragment.

(6) The gene fragment obtained in step (4) was ligated using Takara T4DNA ligase to obtain a recombinant expression vector pET-Duet licA-licC.

(7) And (3) transforming the recombinant expression vector in the step (6) into E.coli BL21 (ACCC 11171) to obtain the strain E.coli CKI-CCT with choline kinase activity and phosphorylcholine cytidyltransferase activity.

2. Construction of polyphosphate kinase and cytidine kinase strain E

(1) A Rhodobacter sphaeroides (CGMCC 1.5028) genome is used as a template, a pair of gene amplification primers are designed according to a polyphosphate kinase coding gene ppk sequence, and a target gene fragment is obtained through amplification. The primers contain the restriction sites EcoR I and Hind III, respectively (see appendix < 3 >).

(2) The plasmid pET-Duet vector, which is the target fragment obtained in step (1), is digested simultaneously with restriction enzymes EcoR I and Hind III of Takara (see appendix < 7 >), to obtain the target gene with the same cohesive ends and linear pET-Duet fragments.

(3) And (3) connecting the gene fragments obtained in the step (2) by using Takara T4DNA ligase to obtain a recombinant expression vector pET-Duet-ppk.

(4) A genome of Thermus thermophilus (Thermus thermophilus, ATCC 27634) is used as a template, a pair of gene amplification primers are designed according to a sequence of a cytidine kinase coding gene udk, and a target gene fragment is obtained through amplification. The primers of the pair contain the restriction sites EcoRV and Xho I, respectively (see appendix < 4 >).

(5) The recombinant expression vector pET-Duet-ppk obtained in step (3) was double-digested with Takara restriction enzymes EcoR V and Xho I to obtain the target gene with the same cohesive ends and a linear fragment pET-Duet-ppk.

(6) The gene fragment obtained in step (4) was ligated using Takara T4DNA ligase to obtain a recombinant expression vector pET-Duet ppk-udk.

(7) And (3) transforming the recombinant expression vector in the step (6) into E.coli BL21 (ACCC 11171) to obtain a strain E.coli PPK-UDK with polyphosphate kinase activity and cytidine kinase activity.

3. Construction of Cytidylic acid kinase and diphosphokinase Strain E

(1) A gene amplification primer pair is designed by taking an Escherichia coli K12 (ATCC 10798) genome as a template according to a cytidylic acid kinase coding gene cmk sequence, and a target gene fragment is obtained by amplification. The pair of primers contains the cleavage sites EcoR I and Hind III, respectively (see appendix < 5 >).

(3) And (3) connecting the gene fragments obtained in the step (2) by using Takara T4DNA ligase to obtain a recombinant expression vector pET-Duet-cmk.

(4) A gene group of Escherichia coli (Escherichia coli K12, ATCC 10798) is used as a template, a pair of gene amplification primers are designed according to a gene ndk sequence encoding diphosphokinase, and a target gene fragment is obtained through amplification. The primers contain the restriction sites EcoRV and Xho I, respectively (see appendix < 6 >).

(5) The recombinant expression vector pET-Duet-cmk obtained in step (3) was double-digested with Takara restriction enzymes EcoR V and Xho I to obtain a target gene with the same cohesive ends and a linear fragment pET-Duet-cmk.

(6) The gene fragment obtained in step (4) was ligated using Takara T4DNA ligase to obtain a recombinant expression vector pET-Duet cmk-ndk.

(7) And (3) transforming the recombinant expression vector in the step (6) into E.coli BL21 (ACCC 11171) to obtain the strain E.coli CMK-NDK with the activity of the cytidylic acid kinase and the activity of the diphosphokinase.

4. Production of enzyme by fermentation of E.coli CKI-CCT, E.coli PPK-UDK and E.coli CMK-NDK strains and preparation of crude enzyme solution

(1) And (3) selecting 3-4 loops of the recombinant strains in the first, second and third steps from a glycerol bacteria-protecting tube by using an inoculating loop, streaking and inoculating the recombinant strains in a slant culture medium with corresponding plasmid resistance, culturing the strains in an incubator at 37 ℃ for 12 hours, and transferring the strains for 1 generation.

(2) All thalli are selected from a test tube slant culture medium by using an inoculating loop and are inoculated into an eggplant-shaped bottle slant culture medium with corresponding plasmid resistance by streaking, and the eggplant-shaped bottle slant culture medium is cultured for 12 hours in an incubator at 37 ℃ and is transferred for 2 generations.

(3) The entire strain in the eggplant-shaped flask was inoculated into a 5L fermenter containing 3L of a fermentation medium with the corresponding plasmid resistance. The initial aeration rate is 2L/min, the dissolved oxygen is controlled at 20% -40% (dissolved oxygen 0% is defined as the dissolved oxygen in saturated sodium sulfite solution with small amount of copper sulfate added, dissolved oxygen 100% is defined as the dissolved oxygen in still air), the pH is controlled at 7.0 by automatic feeding of ammonia water, and the culture temperature is 37 ℃.

(4) Cultured to OD ₆₀₀ And (5) when the concentration is not more than 13, adding IPTG (isopropyl-beta-D-thiogalactoside) with the final concentration of 0.2mM to induce and express the target protein, regulating the induction temperature to be 30 ℃, and performing induction culture for 8 hours to collect the thalli.

(5) Centrifuging at 8000r/min and 4 deg.C for 15min, collecting thallus, taking appropriate amount of physiological saline or PBS buffer solution, shaking, resuspending, cleaning thallus for 2 times, centrifuging, and storing in-80 deg.C refrigerator for use.

(6) 12g of Escherichia coli CKI-CCT wet cells, 10g of Escherichia coli PPK-UDK wet cells and 8g of Escherichia coli CMK-NDK wet cells were taken out from a-80 ℃ refrigerator and resuspended in 50mL of a balance buffer (50 mM Na) respectively ₂ HPO ₄ 300mM NaCl, pH8.0 with NaOH). After the heavy suspension is uniform, high-pressure homogenization is carried out to break cells, and the breaking conditions are as follows: centrifuging the crushed solution at 13000r/min for 20min at 4 ℃ under 1000bar, and taking supernatant, namely the crude enzyme solution.

5. Multi-enzyme catalytic synthesis of citicoline

(1) A reaction system was prepared such that the choline chloride concentration was 30mM, the magnesium sulfate concentration was 60mM, the sodium hexametaphosphate concentration was 60mM, the cytidine concentration was 30mM, the ATP concentration was 5mM, and the Tris-HCl buffer solution (pH 8.0) concentration was 100mM. Carrying out enzyme catalysis reaction in a 5L fermentation tank, controlling the temperature at 30 ℃ and the stirring speed at 300r/min. The pH value can be maintained at 8.0 by adding NaOH or HCL during the reaction.

6. Detection of citicoline in reaction solution

Inactivating reaction liquid with a proper volume in a boiling water bath, centrifuging at 13000r/min for 2min, taking supernate, diluting to 1g/L by deionized water, and filtering by using a sterile membrane of 0.22 mu m until a liquid bottle is ready for analysis. Determining cytidylic acid content by high performance liquid chromatography, wherein the sample volume is 20 μ L, the chromatographic column is Sepax HP-SAX (4.6 × 250 mM) chromatographic column, and the mobile phase is 50mM KH ₂ PO ₄ (H ₃ PO ₄ Adjusting pH to 3.5), the column temperature is 30 ℃, the flow rate is 1mL/min, and the detection wavelength is 254nm. The reaction conditions are shown in figure 2, figure 3 and table 1 by high performance liquid chromatography detection.

TABLE 1 results of the enzyme-catalyzed reaction

7. Comparison of Phosphorylcholine Cytidine transferase Activity from different sources

The primer (5 'was designed based on the gene sequence of phosphocholine cytidyltransferase derived from Saccharomyces cerevisiae S288c commonly used in the prior art'

ATGGGTCGCGGATCCGAATTCATGGCCAATCGACAACCG 3 'and 5'

CTCGAGTGCGGCCGCAAGCTTTTAGTTGGCGCTCTGCTTCTTC 3 '), a target gene is amplified from a Saccharomyces cerevisiae S288c genome, and the target gene is connected to pET-28a plasmid through enzyme digestion of 5' end EcoRI and 3' end Hind III to obtain a recombinant plasmid pET-28a-cct _sc . Transforming the recombinant plasmid into E.coli BL21 competent cells to obtain a recombinant strain E.coli BL21 pET-28a-cct _sc 。

A primer (5 ') was designed based on the gene sequence of phosphocholine cytidylyltransferase derived from Fusobacterium nucleatum ATCC25586 used in the present invention'

ATGGGTCGCGGATCCGAATTCGAATTCATGAACGTAACGCGA 3 'and 5'

CTCGAGTGCGGCCGCAAGCTTAAGCTTTTAGCTGCTGTGCAGTT 3 '), amplifying a target gene from a genome of Fusobacterium Nuclear ATCC25586, and connecting the target gene to a pET-28a plasmid through enzyme digestion of 5' end EcoRI and 3' end HindIII to obtain a recombinant plasmid pET-28a-licC _fn . Transforming the recombinant plasmid into E.coli BL21 competent cells to obtain a recombinant strain E.coli BL21 pET-28a-licC _fn 。

The recombinant strains constructed above were cultured, after IPTG induction for enzyme production, the cells were collected, the cells were disrupted to extract a crude enzyme solution, and the expression of the enzyme was determined by SDS-polyacrylamide gel electrophoresis, as shown in FIG. 4. Adding substrate to perform enzyme-catalyzed reaction to test the activity of phosphorylcholine cytidine transferase. The enzyme activity was measured under CTP 10mM, phosphorylcholine 10mM, ATP 10mM, magnesium sulfate 30mM, tris-HCl buffer (pH 8.0) 50mM, and crude enzyme solution (protein concentration) 50mg/L. The catalytic formation of 1. Mu.M citicoline per minute at 30 ℃ is defined as 1 unit of enzyme activity. The measurement results are shown in table 1.

TABLE 2 comparison of enzyme activities without the source of phosphorylcholine cytidylyltransferase

The experimental results show that the soluble expression of the phosphocholine cytidine transferase derived from Fusobacterium nucleatum ATCC25586 is better. The specific enzyme activity of the enzyme is 3.12 times of that of phosphorylcholine cytidine transferase from Saccharomyces cerevisiae S288 c.

Although the embodiments of the present invention have been disclosed for illustrative purposes, those skilled in the art will appreciate that: various substitutions, changes and modifications are possible without departing from the spirit and scope of the invention and the appended claims, and therefore the scope of the invention is not limited to the embodiments disclosed.

Appendix

(1) Choline kinase coding gene enzyme cutting site of fusobacterium nucleatum and amplification primer

5'CC GAATTC ATGAATGCAATAATAAT 3'EcoRI

5'GTG AAGCTT TTACTCCATATCTGTAAGAT 3'HindIII

Phosphocholine cytidine transferase coding gene restriction enzyme site of <2 > Fusobacterium nucleatum and amplification primer

5'CC GATATC ATGAATGCCATCATCAT 3'EcoR Ⅴ

5'GTG CTCGAG TTAGCTGCTGTGCAGTTCGA 3'Xho I

Polyphosphate kinase coding gene enzyme cutting site of < 3> rhodobacter sphaeroides and amplification primer

5'CC GAATTCATGGCCGAAGATCGTGCTAT 3'EcoR I

5'CGC AAGCTT TCAACCTTGACGCGGTTTAC 3'HindIII

Cytidine kinase coding gene enzyme cutting site of < 4 > Thermus thermophilus and amplification primer

5'CC GATATC GTGAGCGCCCCGAAACC 3'EcoR Ⅴ

5'GTG CTCGAG TTAGGCTGCGCCCATACGTG 3'Xho I

Enzyme cutting site and amplification primer of cytidine kinase coding gene of escherichia coli

5'CC GAATTC ATGACGGCAATTGCCCC 3'EcoR I

5'CGC AAGCTT TTATGCGAGAGCCAATTTCT 3'HindIII

Enzyme cutting site of diphosphate kinase coding gene of < 6 > escherichia coli and amplification primer

5'CC GATATC ATGGCTATTGAACGTAC 3'EcoR Ⅴ

5'GTG CTCGAG TTAACGGGTGCGCGGGCACA 3'Xho I

Plasmid pET-Duet of < 7 >

GGGGAATTGTGAGCGGATAACAATTCCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACCATGGGCAGCAGCCATCACCATCATCACCACAGCCAGGATCCGAATTCGAGCTCGGCGCGCCTGCAGGTCGACAAGCTTGCGGCCGCATAATGCTTAAGTCGAACAGAAAGTAATCGTATTGTACACGGCCGCATAATCGAAATTAATACGACTCACTATAGGGGAATTGTGAGCGGATAACAATTCCCCATCTTAGTATATTAGTTAAGTATAAGAAGGAGATATACATATGGCAGATCTCAATTGGATATCGGCCGGCCACGCGATCGCTGACGTCGGTACCCTCGAGTCTGGTAAAGAAACCGCTGCTGCGAAATTTGAACGCCAGCACATGGACTCGTCTACTAGCGCAGCTTAATTAACCTAGGCTGCTGCCACCGCTGAGCAATAACTAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTGCTGAAAGGAGGAACTATATCCGGATTGGCGAATGGGACGCGCCCTGTAGCGGCGCATTAAGCGCGGCGGGTGTGGTGGTTACGCGCAGCGTGACCGCTACACTTGCCAGCGCCCTAGCGCCCGCTCCTTTCGCTTTCTTCCCTTCCTTTCTCGCCACGTTCGCCGGCTTTCCCCGTCAAGCTCTAAATCGGGGGCTCCCTTTAGGGTTCCGATTTAGTGCTTTACGGCACCTCGACCCCAAAAAACTTGATTAGGGTGATGGTTCACGTAGTGGGCCATCGCCCTGATAGACGGTTTTTCGCCCTTTGACGTTGGAGTCCACGTTCTTTAATAGTGGACTCTTGTTCCAAACTGGAACAACACTCAACCCTATCTCGGTCTATTCTTTTGATTTATAAGGGATTTTGCCGATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAACAAAAATTTAACGCGAATTTTAACAAAATATTAACGTTTACAATTTCTGGCGGCACGATGGCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCAATCATGATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTCCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAGAGCGCCTGATGCGGTATTTTCTCCTTACGCATCTGTGCGGTATTTCACACCGCATATATGGTGCACTCTCAGTACAATCTGCTCTGATGCCGCATAGTTAAGCCAGTATACACTCCGCTATCGCTACGTGACTGGGTCATGGCTGCGCCCCGACACCCGCCAACACCCGCTGACGCGCCCTGACGGGCTTGTCTGCTCCCGGCATCCGCTTACAGACAAGCTGTGACCGTCTCCGGGAGCTGCATGTGTCAGAGGTTTTCACCGTCATCACCGAAACGCGCGAGGCAGCTGCGGTAAAGCTCATCAGCGTGGTCGTGAAGCGATTCACAGATGTCTGCCTGTTCATCCGCGTCCAGCTCGTTGAGTTTCTCCAGAAGCGTTAATGTCTGGCTTCTGATAAAGCGGGCCATGTTAAGGGCGGTTTTTTCCTGTTTGGTCACTGATGCCTCCGTGTAAGGGGGATTTCTGTTCATGGGGGTAATGATACCGATGAAACGAGAGAGGATGCTCACGATACGGGTTACTGATGATGAACATGCCCGGTTACTGGAACGTTGTGAGGGTAAACAACTGGCGGTATGGATGCGGCGGGACCAGAGAAAAATCACTCAGGGTCAATGCCAGCGCTTCGTTAATACAGATGTAGGTGTTCCACAGGGTAGCCAGCAGCATCCTGCGATGCAGATCCGGAACATAATGGTGCAGGGCGCTGACTTCCGCGTTTCCAGACTTTACGAAACACGGAAACCGAAGACCATTCATGTTGTTGCTCAGGTCGCAGACGTTTTGCAGCAGCAGTCGCTTCACGTTCGCTCGCGTATCGGTGATTCATTCTGCTAACCAGTAAGGCAACCCCGCCAGCCTAGCCGGGTCCTCAACGACAGGAGCACGATCATGCTAGTCATGCCCCGCGCCCACCGGAAGGAGCTGACTGGGTTGAAGGCTCTCAAGGGCATCGGTCGAGATCCCGGTGCCTAATGAGTGAGCTAACTTACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCCAGGGTGGTTTTTCTTTTCACCAGTGAGACGGGCAACAGCTGATTGCCCTTCACCGCCTGGCCCTGAGAGAGTTGCAGCAAGCGGTCCACGCTGGTTTGCCCCAGCAGGCGAAAATCCTGTTTGATGGTGGTTAACGGCGGGATATAACATGAGCTGTCTTCGGTATCGTCGTATCCCACTACCGAGATGTCCGCACCAACGCGCAGCCCGGACTCGGTAATGGCGCGCATTGCGCCCAGCGCCATCTGATCGTTGGCAACCAGCATCGCAGTGGGAACGATGCCCTCATTCAGCATTTGCATGGTTTGTTGAAAACCGGACATGGCACTCCAGTCGCCTTCCCGTTCCGCTATCGGCTGAATTTGATTGCGAGTGAGATATTTATGCCAGCCAGCCAGACGCAGACGCGCCGAGACAGAACTTAATGGGCCCGCTAACAGCGCGATTTGCTGGTGACCCAATGCGACCAGATGCTCCACGCCCAGTCGCGTACCGTCTTCATGGGAGAAAATAATACTGTTGATGGGTGTCTGGTCAGAGACATCAAGAAATAACGCCGGAACATTAGTGCAGGCAGCTTCCACAGCAATGGCATCCTGGTCATCCAGCGGATAGTTAATGATCAGCCCACTGACGCGTTGCGCGAGAAGATTGTGCACCGCCGCTTTACAGGCTTCGACGCCGCTTCGTTCTACCATCGACACCACCACGCTGGCACCCAGTTGATCGGCGCGAGATTTAATCGCCGCGACAATTTGCGACGGCGCGTGCAGGGCCAGACTGGAGGTGGCAACGCCAATCAGCAACGACTGTTTGCCCGCCAGTTGTTGTGCCACGCGGTTGGGAATGTAATTCAGCTCCGCCATCGCCGCTTCCACTTTTTCCCGCGTTTTCGCAGAAACGTGGCTGGCCTGGTTCACCACGCGGGAAACGGTCTGATAAGAGACACCGGCATACTCTGCGACATCGTATAACGTTACTGGTTTCACATTCACCACCCTGAATTGACTCTCTTCCGGGCGCTATCATGCCATACCGCGAAAGGTTTTGCGCCATTCGATGGTGTCCGGGATCTCGACGCTCTCCCTTATGCGACTCCTGCATTAGGAAGCAGCCCAGTAGTAGGTTGAGGCCGTTGAGCACCGCCGCCGCAAGGAATGGTGCATGCAAGGAGATGGCGCCCAACAGTCCCCCGGCCACGGGGCCTGCCACCATACCCACGCCGAAACAAGCGCTCATGAGCCCGAAGTGGCGAGCCCGATCTTCCCCATCGGTGATGTCGGCGATATAGGCGCCAGCAACCGCACCTGTGGCGCCGGTGATGCCGGCCACGATGCGTCCGGCGTAGAGGATCGAGATCGATCTCGATCCCGCGAAATTAATACGACTCACTATA。

Sequence listing

<110> Tianjin university of science and technology

<120> enzyme preparation for preparing citicoline and method for preparing citicoline by enzyme catalysis

<160> 13

<170> SIPOSequenceListing 1.0

<210> 1

<211> 25

<212> DNA

<213> Choline kinase coding gene restriction site of Fusobacterium nucleatum and amplification primer 1 (Unknown)

<400> 1

ccgaattcat gaatgcaata ataat 25

<210> 2

<211> 29

<212> DNA

<213> Choline kinase coding gene restriction site of Fusobacterium nucleatum and amplification primer 2 (Unknown)

<400> 2

gtgaagcttt tactccatat ctgtaagat 29

<210> 3

<211> 25

<212> DNA

<213> Choline Phosphorylcytidylyltransferase coding Gene restriction site of Fusobacterium nucleatum and amplification primer 1 (Unknown)

<400> 3

ccgatatcat gaatgccatc atcat 25

<210> 4

<211> 29

<212> DNA

<213> Choline Phosphorylcytidylyltransferase coding Gene restriction site of Fusobacterium nucleatum and amplification primer 2 (Unknown)

<400> 4

gtgctcgagt tagctgctgt gcagttcga 29

<210> 5

<211> 28

<212> DNA

<213> polyphosphoric acid kinase coding gene enzyme cutting site of rhodobacter sphaeroides and amplification primer 1 (Unknown)

<400> 5

ccgaattcat ggccgaagat cgtgctat 28

<210> 6

<211> 29

<212> DNA

<213> polyphosphoric acid kinase coding gene enzyme cutting site of rhodobacter sphaeroides and amplification primer 2 (Unknown)

<400> 6

cgcaagcttt caaccttgac gcggtttac 29

<210> 7

<211> 25

<212> DNA

<213> restriction site of Cytidine kinase-encoding gene of Thermus thermophilus and amplification primer 1 (Unknown)

<400> 7

ccgatatcgt gagcgccccg aaacc 25

<210> 8

<211> 29

<212> DNA

<213> restriction site of Cytidine kinase-encoding gene of Thermus thermophilus and amplification primer 2 (Unknown)

<400> 8

gtgctcgagt taggctgcgc ccatacgtg 29

<210> 9

<211> 25

<212> DNA

<213> restriction site of cytidylic acid kinase coding gene of Escherichia coli and amplification primer 1 (Unknown)

<400> 9

ccgaattcat gacggcaatt gcccc 25

<210> 10

<211> 29

<212> DNA

<213> restriction site of Cytoside kinase-encoding gene of E.coli and amplification primer 2 (Unknown)

<400> 10

cgcaagcttt tatgcgagag ccaatttct 29

<210> 11

<211> 25

<212> DNA

<213> digestion site of diphosphate kinase coding gene of E.coli and amplification primer 1 (Unknown)

<400> 11

ccgatatcat ggctattgaa cgtac 25

<210> 12

<211> 29

<212> DNA

<213> digestion site of diphosphate kinase coding gene of E.coli and amplification primer 2 (Unknown)

<400> 12

gtgctcgagt taacgggtgc gcgggcaca 29

<210> 13

<211> 5420

<212> DNA

<213> pET-Duet plasmid (Unknown)

<400> 13

ggggaattgt gagcggataa caattcccct ctagaaataa ttttgtttaa ctttaagaag 60

gagatatacc atgggcagca gccatcacca tcatcaccac agccaggatc cgaattcgag 120

ctcggcgcgc ctgcaggtcg acaagcttgc ggccgcataa tgcttaagtc gaacagaaag 180

taatcgtatt gtacacggcc gcataatcga aattaatacg actcactata ggggaattgt 240

gagcggataa caattcccca tcttagtata ttagttaagt ataagaagga gatatacata 300

tggcagatct caattggata tcggccggcc acgcgatcgc tgacgtcggt accctcgagt 360

ctggtaaaga aaccgctgct gcgaaatttg aacgccagca catggactcg tctactagcg 420

cagcttaatt aacctaggct gctgccaccg ctgagcaata actagcataa ccccttgggg 480

cctctaaacg ggtcttgagg ggttttttgc tgaaaggagg aactatatcc ggattggcga 540

atgggacgcg ccctgtagcg gcgcattaag cgcggcgggt gtggtggtta cgcgcagcgt 600

gaccgctaca cttgccagcg ccctagcgcc cgctcctttc gctttcttcc cttcctttct 660

cgccacgttc gccggctttc cccgtcaagc tctaaatcgg gggctccctt tagggttccg 720

atttagtgct ttacggcacc tcgaccccaa aaaacttgat tagggtgatg gttcacgtag 780

tgggccatcg ccctgataga cggtttttcg ccctttgacg ttggagtcca cgttctttaa 840

tagtggactc ttgttccaaa ctggaacaac actcaaccct atctcggtct attcttttga 900

tttataaggg attttgccga tttcggccta ttggttaaaa aatgagctga tttaacaaaa 960

atttaacgcg aattttaaca aaatattaac gtttacaatt tctggcggca cgatggcatg 1020

agattatcaa aaaggatctt cacctagatc cttttaaatt aaaaatgaag ttttaaatca 1080

atctaaagta tatatgagta aacttggtct gacagttacc aatgcttaat cagtgaggca 1140

cctatctcag cgatctgtct atttcgttca tccatagttg cctgactccc cgtcgtgtag 1200

ataactacga tacgggaggg cttaccatct ggccccagtg ctgcaatgat accgcgagac 1260

ccacgctcac cggctccaga tttatcagca ataaaccagc cagccggaag ggccgagcgc 1320

agaagtggtc ctgcaacttt atccgcctcc atccagtcta ttaattgttg ccgggaagct 1380

agagtaagta gttcgccagt taatagtttg cgcaacgttg ttgccattgc tacaggcatc 1440

gtggtgtcac gctcgtcgtt tggtatggct tcattcagct ccggttccca acgatcaagg 1500

cgagttacat gatcccccat gttgtgcaaa aaagcggtta gctccttcgg tcctccgatc 1560

gttgtcagaa gtaagttggc cgcagtgtta tcactcatgg ttatggcagc actgcataat 1620

tctcttactg tcatgccatc cgtaagatgc ttttctgtga ctggtgagta ctcaaccaag 1680

tcattctgag aatagtgtat gcggcgaccg agttgctctt gcccggcgtc aatacgggat 1740

aataccgcgc cacatagcag aactttaaaa gtgctcatca ttggaaaacg ttcttcgggg 1800

cgaaaactct caaggatctt accgctgttg agatccagtt cgatgtaacc cactcgtgca 1860

cccaactgat cttcagcatc ttttactttc accagcgttt ctgggtgagc aaaaacagga 1920

aggcaaaatg ccgcaaaaaa gggaataagg gcgacacgga aatgttgaat actcatactc 1980

ttcctttttc aatcatgatt gaagcattta tcagggttat tgtctcatga gcggatacat 2040

atttgaatgt atttagaaaa ataaacaaat aggtcatgac caaaatccct taacgtgagt 2100

tttcgttcca ctgagcgtca gaccccgtag aaaagatcaa aggatcttct tgagatcctt 2160

tttttctgcg cgtaatctgc tgcttgcaaa caaaaaaacc accgctacca gcggtggttt 2220

gtttgccgga tcaagagcta ccaactcttt ttccgaaggt aactggcttc agcagagcgc 2280

agataccaaa tactgtcctt ctagtgtagc cgtagttagg ccaccacttc aagaactctg 2340

tagcaccgcc tacatacctc gctctgctaa tcctgttacc agtggctgct gccagtggcg 2400

ataagtcgtg tcttaccggg ttggactcaa gacgatagtt accggataag gcgcagcggt 2460

cgggctgaac ggggggttcg tgcacacagc ccagcttgga gcgaacgacc tacaccgaac 2520

tgagatacct acagcgtgag ctatgagaaa gcgccacgct tcccgaaggg agaaaggcgg 2580

acaggtatcc ggtaagcggc agggtcggaa caggagagcg cacgagggag cttccagggg 2640

gaaacgcctg gtatctttat agtcctgtcg ggtttcgcca cctctgactt gagcgtcgat 2700

ttttgtgatg ctcgtcaggg gggcggagcc tatggaaaaa cgccagcaac gcggcctttt 2760

tacggttcct ggccttttgc tggccttttg ctcacatgtt ctttcctgcg ttatcccctg 2820

attctgtgga taaccgtatt accgcctttg agtgagctga taccgctcgc cgcagccgaa 2880

cgaccgagcg cagcgagtca gtgagcgagg aagcggaaga gcgcctgatg cggtattttc 2940

tccttacgca tctgtgcggt atttcacacc gcatatatgg tgcactctca gtacaatctg 3000

ctctgatgcc gcatagttaa gccagtatac actccgctat cgctacgtga ctgggtcatg 3060

gctgcgcccc gacacccgcc aacacccgct gacgcgccct gacgggcttg tctgctcccg 3120

gcatccgctt acagacaagc tgtgaccgtc tccgggagct gcatgtgtca gaggttttca 3180

ccgtcatcac cgaaacgcgc gaggcagctg cggtaaagct catcagcgtg gtcgtgaagc 3240

gattcacaga tgtctgcctg ttcatccgcg tccagctcgt tgagtttctc cagaagcgtt 3300

aatgtctggc ttctgataaa gcgggccatg ttaagggcgg ttttttcctg tttggtcact 3360

gatgcctccg tgtaaggggg atttctgttc atgggggtaa tgataccgat gaaacgagag 3420

aggatgctca cgatacgggt tactgatgat gaacatgccc ggttactgga acgttgtgag 3480

ggtaaacaac tggcggtatg gatgcggcgg gaccagagaa aaatcactca gggtcaatgc 3540

cagcgcttcg ttaatacaga tgtaggtgtt ccacagggta gccagcagca tcctgcgatg 3600

cagatccgga acataatggt gcagggcgct gacttccgcg tttccagact ttacgaaaca 3660

cggaaaccga agaccattca tgttgttgct caggtcgcag acgttttgca gcagcagtcg 3720

cttcacgttc gctcgcgtat cggtgattca ttctgctaac cagtaaggca accccgccag 3780

cctagccggg tcctcaacga caggagcacg atcatgctag tcatgccccg cgcccaccgg 3840

aaggagctga ctgggttgaa ggctctcaag ggcatcggtc gagatcccgg tgcctaatga 3900

gtgagctaac ttacattaat tgcgttgcgc tcactgcccg ctttccagtc gggaaacctg 3960

tcgtgccagc tgcattaatg aatcggccaa cgcgcgggga gaggcggttt gcgtattggg 4020

cgccagggtg gtttttcttt tcaccagtga gacgggcaac agctgattgc ccttcaccgc 4080

ctggccctga gagagttgca gcaagcggtc cacgctggtt tgccccagca ggcgaaaatc 4140

ctgtttgatg gtggttaacg gcgggatata acatgagctg tcttcggtat cgtcgtatcc 4200

cactaccgag atgtccgcac caacgcgcag cccggactcg gtaatggcgc gcattgcgcc 4260

cagcgccatc tgatcgttgg caaccagcat cgcagtggga acgatgccct cattcagcat 4320

ttgcatggtt tgttgaaaac cggacatggc actccagtcg ccttcccgtt ccgctatcgg 4380

ctgaatttga ttgcgagtga gatatttatg ccagccagcc agacgcagac gcgccgagac 4440

agaacttaat gggcccgcta acagcgcgat ttgctggtga cccaatgcga ccagatgctc 4500

cacgcccagt cgcgtaccgt cttcatggga gaaaataata ctgttgatgg gtgtctggtc 4560

agagacatca agaaataacg ccggaacatt agtgcaggca gcttccacag caatggcatc 4620

ctggtcatcc agcggatagt taatgatcag cccactgacg cgttgcgcga gaagattgtg 4680

caccgccgct ttacaggctt cgacgccgct tcgttctacc atcgacacca ccacgctggc 4740

acccagttga tcggcgcgag atttaatcgc cgcgacaatt tgcgacggcg cgtgcagggc 4800

cagactggag gtggcaacgc caatcagcaa cgactgtttg cccgccagtt gttgtgccac 4860

gcggttggga atgtaattca gctccgccat cgccgcttcc actttttccc gcgttttcgc 4920

agaaacgtgg ctggcctggt tcaccacgcg ggaaacggtc tgataagaga caccggcata 4980

ctctgcgaca tcgtataacg ttactggttt cacattcacc accctgaatt gactctcttc 5040

cgggcgctat catgccatac cgcgaaaggt tttgcgccat tcgatggtgt ccgggatctc 5100

gacgctctcc cttatgcgac tcctgcatta ggaagcagcc cagtagtagg ttgaggccgt 5160

tgagcaccgc cgccgcaagg aatggtgcat gcaaggagat ggcgcccaac agtcccccgg 5220

ccacggggcc tgccaccata cccacgccga aacaagcgct catgagcccg aagtggcgag 5280

cccgatcttc cccatcggtg atgtcggcga tataggcgcc agcaaccgca cctgtggcgc 5340

cggtgatgcc ggccacgatg cgtccggcgt agaggatcga gatcgatctc gatcccgcga 5400

aattaatacg actcactata 5420

Claims

1. An enzyme preparation for preparing citicoline, which is characterized in that: the preparation steps are as follows:

firstly, engineering bacteria are constructedEscherichia coli CKI-CCT expresses choline kinase and phosphorylcholine cytidine transferase derived from fusobacterium nucleatum, the choline kinase can catalyze choline chloride to form phosphorylcholine, and the phosphorylcholine cytidine transferase can catalyze phosphorylcholine and CTP to form citicoline; construction of engineering bacteriaEscherichia coli PPK-UDK expresses polyphosphate kinase derived from rhodobacter sphaeroides and cytidine kinase derived from thermus thermophilus, wherein the polyphosphate kinase can be used for catalyzing ATP regeneration, and the cytidine kinase can be used for catalyzing cytidine to form CMP; construction of engineering bacteriaEscherichia coli CMK-NDK expresses cytidine kinase and diphosphonucleotide kinase derived from escherichia coli, the cytidine kinase can be used for catalyzing CMP to form CDP, and the diphosphonucleotide kinase can be used for catalyzing CDP to form CTP;

secondly, crushing enzyme-producing cells obtained by fermentation, centrifuging at 13000rpm for 2min, and collecting supernatant to obtain a crude enzyme solution, namely the enzyme preparation for preparing the citicoline;

the preparation method comprises the following specific steps:

in Escherichia coliE. coliBL21 expresses heterologously choline kinase and phosphorylcholine cytidine transferase coding genes to construct bacterial strain with choline kinase activity and phosphorylcholine cytidine transferase activityEscherichia coli CKI-CCT；

In Escherichia coliE. coliBL21 expresses heterogenous polyphosphate kinase and cytidine kinase coding genes to construct a strain with polyphosphate kinase and cytidine kinase activityEscherichia coli PPK-UDK；

In Escherichia coliE. coliBL21 expresses endogenous gene encoding cytidylic acid kinase and diphosphokinase to construct strain with cytidylic acid kinase and diphosphokinase activityEscherichia coli CMK-NDK；

The recombinant strain constructed above is usedEscherichia coli CKI-CCT、Escherichia coli PPK-UDK andEscherichia coli respectively culturing CMK-NDK in a culture medium, inducing to generate choline kinase with high enzyme activity, phosphorylcholine cytidine transferase, polyphosphate kinase, cytidine kinase, diphosphate kinase and cytidylic acid kinase, and centrifuging to collect enzyme-producing cells;

will be described in detail

Cultured enzyme-producing cellsEscherichia coli CKI-CCT、Escherichia coli PPK-UDK andEscherichia coli suspending CMK-NDK in a balance buffer solution, carrying out cell disruption, centrifuging the disruption solution for 20min at 13000r/min, and taking supernatant, namely crude enzyme solution;

said step (c) is

In which pET-Duet plasmid is used as a vectorE. coli Over-expressing choline kinase and phosphorylcholine cytidyltransferase genes in BL21 to construct a strain with choline kinase activity and phosphorylcholine cytidyltransferase activityE. coli CKI-CCT; wherein the choline kinase coding gene is derived from fusobacterium nucleatum, and amplification primers of the choline kinase coding gene are SEQ ID NO.1 and SEQ ID NO.2; the coding gene of the phosphorylcholine cytidylyltransferase is derived from fusobacterium nucleatum, and the amplification primers are SEQ ID NO.3 and SEQ ID NO.4; the nucleotide sequence of the plasmid pET-Duet is SEQ ID NO.13;

said step (c) is

In which pET-Duet plasmid is used as vectorE. coli Overexpression of polyphosphate kinase and cytidine kinase genes in BL21 to construct bacterial strain with polyphosphate kinase and cytidine kinase activitiesE. coli PPK-UDK; wherein, the polyphosphate kinase coding gene is derived from rhodobacter sphaeroides, and the amplification primers are SEQ ID NO.5 and SEQ ID NO.6; the cytidine kinase coding gene is derived from thermus thermophilus, and amplification primers of the cytidine kinase coding gene are SEQ ID NO.7 and SEQ ID NO.8; the nucleotide sequence of the plasmid pET-Duet is SEQ ID NO.13;

said step (c) is

In which pET-Duet plasmid is used as vectorE. coli Overexpression of cytidylic acid kinase and diphosphokinase genes in BL21, and construction of strain with cytidylic acid kinase activity and diphosphokinase activityE. coli CMK-NDK; wherein, the cytidylic acid kinase coding gene is derived from escherichia coli, and amplification primers of the cytidylic acid kinase coding gene are SEQ ID NO.9 and SEQ ID NO.10; the diphosphokineThe enzyme coding gene is derived from escherichia coli, and amplification primers of the enzyme coding gene are SEQ ID NO.11 and SEQ ID NO.12; the nucleotide sequence of the plasmid pET-Duet is SEQ ID NO.13.

2. The enzyme preparation for producing citicoline according to claim 1, wherein: said step (c) is

The specific steps of culturing the medium recombinant strain in the culture medium are as follows:

(2) and (3) eggplant-shaped bottle slant culture: selecting all thalli from a test tube slant culture medium by using an inoculating loop, streaking and inoculating the thalli into an eggplant-shaped bottle slant culture medium with ampicillin resistance, culturing for 10-14h in an incubator at 37 ℃, and transferring for 2 generations;

(3) inoculating all the bacteria in the eggplant-shaped bottle to a fermentation culture medium with ampicillin resistance, controlling the initial ventilation amount to be 2L/min and the dissolved oxygen to be 20-40%, controlling the pH to be 7.0 by automatically feeding ammonia water, and controlling the culture temperature to be 37 ℃;

(4) cultured to OD ₆₀₀ When the concentration is not less than 12-14, adding IPTG (isopropyl thiogalactoside) with the final concentration of 0.1-0.3mM to induce and express the target protein, adjusting the induction temperature to 25-30 ℃, and performing induced culture for 6-8h to collect thalli;

(5) centrifuging at 8000r/min and 4 deg.C for 15min, collecting thallus, taking physiological saline or PBS buffer solution, shaking, resuspending and cleaning thallus for 2 times, centrifuging, and storing in-80 deg.C refrigerator for use.

3. The enzyme preparation for producing citicoline according to claim 2, wherein: the slant culture medium is as follows: 5g/L of glucose, 10g/L of peptone, 5g/L of yeast extract, 10g/L of beef extract, 5g/L of NaCl, 25g/L of agar, pH 7.0-7.2, and sterilizing at 121 ℃ for 20min;

the fermentation medium comprises: glucose 20g/L, yeast extractFetching 5g/L, corn steep liquor 30g/L, naCl 5g/L, KH ₂ PO ₄ 1 g /L，MgSO ₄ 0.5 g /L，V _H 1mg/L, pH 6.5-7.2, wherein glucose is sterilized at 115 deg.C for 15min, and other components are sterilized at 121 deg.C for 20min.

4. The enzyme preparation for producing citicoline according to any one of claims 1 to 3, wherein: said step (c) is

Three kinds of colibacillusEscherichia coli CKI-CCT、Escherichia coli PPK-UDK andEscherichia coli the ratio g of the cell wet weight amount of CMK-NDK to the equilibration buffer: mL are in order 12: 50. 10:50 and 8:50;

alternatively, the equilibration buffer is 50mM Na ₂ HPO ₄ And/or 300mM NaCl, pH adjusted to 8.0 with NaOH; or the cell disruption method comprises ultrasonic disruption, freeze-thaw disruption, liquid nitrogen grinding disruption or high-pressure homogenate disruption, wherein the disruption conditions of the high-pressure homogenate disruption are as follows: 4. 800-1000bar at deg.C.

5. Use of an enzyme preparation according to any one of claims 1 to 4 for the preparation of citicoline.

6. Process for the catalytic preparation of citicoline using an enzyme preparation according to any of claims 1 to 4, characterized in that: the method comprises the steps of taking an enzyme preparation as a catalyst, taking choline chloride, cytidine, sodium hexametaphosphate and ATP as substrates, mixing the enzyme preparation with choline chloride, magnesium chloride, sodium hexametaphosphate, ATP, cytidine and Tris-HCL buffer solution, carrying out enzyme catalytic reaction, controlling the temperature at 30 ℃, controlling the stirring speed at 300r/min, and synthesizing the citicoline by feeding NaOH or HCL to maintain the pH value at 8.0 in the reaction process.

7. The method for preparing citicoline catalyzed by enzyme preparation according to claim 6, wherein: the concentration of choline chloride in the reaction system was 30mM, the concentration of magnesium chloride was 60mM, the concentration of sodium hexametaphosphate was 60mM, the concentration of cytidine was 30mM, the concentration of ATP was 5mM, the pH =8.0 of Tris-HCl buffer, and the concentration was 100mM.

8. The method for preparing citicoline catalyzed by enzyme preparation according to claim 6 or 7, wherein: the detection method of citicoline in the obtained reaction liquid comprises the following steps: inactivating reaction liquid in boiling water bath, centrifuging at 13000r/min for 2min, taking supernatant, diluting to 1g/L with deionized water, filtering with sterile membrane of 0.22 μm to liquid phase bottle for analysis; determining content of citicoline by high performance liquid chromatography, wherein the sample volume is 20 μ L, the chromatographic column is Sepax HP-SAX (4.6 × 250 mM), and the mobile phase is 50mM KH ₂ PO ₄ ，H ₃ PO ₄ Adjusting pH to 3.5, column temperature to 30 deg.C, flow rate to 1mL/min, detection wavelength to 254nm, and citicoline retention time to 6.5min.