CN112353809B - Pharmaceutical application of astragaloside IV compound - Google Patents

Abstract

The invention provides an application of an astragaloside IV compound or a pharmaceutical composition containing the astragaloside IV compound in preparing a medicament for resisting influenza B virus. The astragaloside AST not only has obvious inhibition effect on the proliferation of influenza B virus in MDCK cells, but also has no cytotoxic effect in a safe concentration range, has high safety, is expected to become a clinical anti-influenza B medicament, and has very wide application prospect.

Description

Pharmaceutical application of astragaloside IV compound

Technical Field

The invention relates to the technical field of medicines, in particular to a medicinal application of an astragaloside IV compound.

Background

Influenza is an acute respiratory disease caused by influenza virus, and has the characteristics of wide infected hosts, rapid spread, high pathogenic rate and the like. Influenza viruses are susceptible to influenza pandemics with mortality rates higher than seasonal influenza, posing a serious threat to the life health of humans and animals. Influenza a and influenza b are two different virus types that cause influenza. Influenza a viruses, in addition to infecting humans, are also widely present in animals, such as birds, pigs, horses, seals, as well as whales, minks, and the like. Influenza b viruses circulate mainly in the human body and cause seasonal influenza, which is often prevalent in winter and spring. Influenza a viruses are new subtypes generated after antigenic variation, often causing a pandemic worldwide. Influenza b virus antigens have relatively low variability, form variants only and do not have new subtypes, and often cause small epidemics in local outbreaks. The vaccine is a main strategy for preventing influenza, but the effective use of the vaccine is limited by the high variation of the influenza virus, the hysteresis of the development of the vaccine, the defect that different influenza strains cannot generate cross protection, and the like. Currently, clinically available anti-influenza virus drugs include M2 ion channel inhibitors (amantadine and rimantadine) and neuraminidase inhibitors (zanamivir, oseltamivir, and peramivir). M2 ion channel inhibitors have been 100% resistant to clinically prevalent strains due to their use over the years, and resistant strains of neuraminidase inhibitors are also increasing. The defects of vaccines and chemical drugs enable the prevention and treatment of influenza to be very difficult.

Therefore, the development of novel high-efficiency broad-spectrum anti-influenza virus medicaments for treating influenza viruses is urgently needed, and the history of treating influenza by Chinese herbal medicines in traditional Chinese medicine is long. The influenza belongs to the category of the temporal disease caused by wind-cold damaging the solar meridian of foot in traditional Chinese medicine. Modern in vitro experiments also confirm the antiviral effect of Chinese herbal medicines. The Chinese pharmacopoeia records that Astragalus (Radix Astragali) is Astragalus mongholicus (Fisch.) bge.var. mongholicus (Bge.) Hsiao of Leguminosae]Or Astragalus membranaceus [ Astragalus membranacea (Fisch.) Bge.]The dried root (2010) of the Chinese medicinal herb is a Chinese traditional rare Chinese medicinal material and has the effects of promoting urination, expelling toxin, tonifying qi, consolidating exterior, healing sore, promoting granulation, expelling pus and the like. Astragaloside IV is the main active substance of radix astragali and is used as the quality detection marker of radix astragali in pharmacopoeia. Astragaloside IV is lanosterol type tetracyclic triterpene saponin with molecular formula of C₁₄H₆₈O₁₄And a relative molecular mass of 784.97, white to pale yellow powder. Is easily soluble in methanol, ethanol and acetone, and is hardly soluble in weak polar organic solvents such as ethyl acetate and chloroform. A large number of researches show that the astragaloside IV has pharmacological effects of regulating immunity, protecting organs, resisting inflammation, resisting virus, reducing blood sugar, resisting aging, improving blood rheological property, etc.

Disclosure of Invention

The invention aims to solve the technical problem that a safe and effective anti-influenza B virus medicament is lacked at present, and is realized by the following technical scheme:

the first aspect of the invention provides the application of astragaloside or pharmaceutically acceptable salts thereof in preparing a medicament for resisting influenza B virus;

furthermore, the anti-influenza B virus has an inhibitory effect on the proliferation of the influenza B virus;

further, the structure of the astragaloside is shown as the following formula:

further, the pharmaceutically acceptable salt is a salt prepared by reacting the astragaloside IV with a chemically acceptable acid or base; further, the chemically acceptable acid is an inorganic acid or an organic acid; further preferably, the inorganic acid is selected from any one or more of hydrochloric acid, sulfuric acid, nitric acid and hydrobromic acid; or further preferably, the organic acid is selected from any one or more of acetic acid, propionic acid, malonic acid, butyric acid, lactic acid, methanesulfonic acid, ethanesulfonic acid, benzenesulfonic acid, p-toluenesulfonic acid, maleic acid, benzoic acid, succinic acid, picric acid, tartaric acid, citric acid and fumaric acid;

further, the pharmaceutically acceptable salt is a salt prepared by reacting the astragaloside IV with a chemically acceptable alkali; further, the chemically acceptable base is an inorganic base or an organic base; further preferably, the inorganic base is selected from any one or more of sodium hydroxide, potassium hydroxide, calcium hydroxide, sodium carbonate, potassium carbonate, sodium bicarbonate and potassium bicarbonate; or further preferably, the organic base is selected from any one or more of trimethylamine, triethylamine and pyridine;

furthermore, the pharmaceutically acceptable salt can be any one or more of potassium salt, sodium salt, ammonium salt, calcium salt, pyridinium salt and choline salt;

the invention provides a pharmaceutical composition for resisting influenza B virus, which comprises astragaloside IV or pharmaceutically acceptable salt thereof and a pharmaceutically acceptable carrier, and application thereof in preparing a medicament for resisting influenza B virus;

further, the astragaloside or the pharmaceutically acceptable salt thereof in the pharmaceutical composition accounts for 0.01-90% of the pharmaceutical composition by mass; preferably, the astragaloside IV or the pharmaceutically acceptable salt thereof in the pharmaceutical composition accounts for 0.05-70% of the pharmaceutical composition by mass; further preferably, the astragaloside or the pharmaceutically acceptable salt thereof in the pharmaceutical composition accounts for 0.1-30% of the pharmaceutical composition by mass;

further, the pharmaceutically acceptable carrier comprises any one or more of diluent, lubricant, adhesive, disintegrant, stabilizer and solvent; further, the diluents of the present invention include, but are not limited to, starch, microcrystalline cellulose, sucrose, dextrin, lactose, powdered sugar, glucose, etc.; still further, the lubricants include, but are not limited to, magnesium stearate, stearic acid, sodium chloride, sodium oleate, sodium lauryl sulfate, poloxamers, and the like; still further, the binder includes, but is not limited to, water, ethanol, starch slurry, syrup, hydroxypropylmethyl cellulose, sodium carboxymethyl cellulose, sodium alginate, polyvinyl pyrrolidone, etc.; further, the disintegrant includes, but is not limited to, starch, sodium bicarbonate and/or citric acid, tartaric acid, low substituted hydroxypropylcellulose, and the like; further, the stabilizing agent includes, but is not limited to, polysaccharides such as acacia gum, agar, alginic acid, cellulose ethers, carboxymethyl chitin ester, and the like; still further, the solvent includes, but is not limited to, water, balanced salt solutions, and the like;

further, the pharmaceutically acceptable carrier may further include a flavoring agent or a sweetening agent;

further, the mode of administration of the astragaloside, a pharmaceutically acceptable salt thereof or a pharmaceutical composition comprising astragaloside or a pharmaceutically acceptable salt thereof is oral, systemic (e.g., transdermal, nasal inhalation or in the form of suppositories) or parenteral (e.g., intramuscular, intravenous or subcutaneous); the preferred mode of administration is oral;

further, the medicament dosage form is tablets, granules, capsules, patches, pills, semi-solids, sprays, aerosols or injections; further preferably, the pharmaceutical dosage form is a tablet, a pill, a granule or a capsule.

Drawings

FIG. 1 is a graph showing the results of determination of the cytotoxic effect of astragaloside by ATPLite in example 1 of the present invention;

FIG. 2 is a graph showing the results of the inhibition of influenza virus SH0218 by AST of example 2 of the present invention;

FIG. 3 is a graph showing the results of the AST of example 2 of the present invention on the dynamic inhibition of SH0218 strain proliferation;

FIG. 4 is a graph of the SH0218 strain inhibition effect of the fluorescent quantitative RT-PCR detection of example 2 of the present invention;

FIG. 5 shows TCID of example 2 of the present invention₅₀And (5) detecting a result graph.

Advantageous effects

The invention is proved by experiments that:

1. the astragaloside AST has obvious inhibition effect on influenza B virus, and the effect is particularly in vitro;

2. the inhibition rate of the astragaloside AST on the influenza B virus is positively correlated with the concentration of the astragaloside AST, when the concentration of the astragaloside is more than 60 mu g/ml, the effect of inhibiting the virus is effective, when the concentration of the astragaloside is more than 100 mu g/ml, the effect is optimal, when the concentration of the astragaloside is less than or equal to 100 mu g/ml, the astragaloside AST has no cytotoxic effect, and is safe and effective;

3. astragaloside AST has time dependence on the inhibition of influenza B virus.

The invention lays a solid material foundation for further developing the anti-influenza B virus medicine and has good application prospect.

Detailed Description

The present invention will be described in further detail with reference to the accompanying drawings and specific embodiments.

EXAMPLE 1 assay of Astragaloside IV (AST) for cytotoxicity determination

When the astragaloside AST acts on the MDCK cell for 72 hours according to the concentrations of 5 mu g/ml, 10 mu g/ml, 20 mu g/ml, 40 mu g/ml, 60 mu g/ml, 80 mu g/ml and 100 mu g/ml, the MDCK cell has partial rounding under a light mirror when the astragaloside AST concentration is 80 mu g/ml, but has no obvious toxicity, and obvious cell rounding appears when the astragaloside AST concentration is 100 mu g/ml, and the cytotoxicity is more obvious when the astragaloside AST concentration is higher than 100 mu g/ml, and obvious cell agglomeration phenomenon appears. The OD value of each well is determined by the MTT method, and the result shows that: the survival rate of MDCK cells is more than 93% at the concentration of 100. mu.g/ml, the survival rate is reduced to 30% at 200. mu.g/ml, and the cells have almost no activity when the survival rate exceeds 200. mu.g/ml (as shown in figure 1). This shows that the astragaloside AST has no obvious cytotoxicity to MDCK cells at the concentration of 100 mu g/mL or below, and can be used for pharmacodynamic tests.

Example 2 inhibition experiment of Astragaloside IV (abbreviated as AST) against influenza Virus

1. Medicaments and agents

Astragaloside IV with purity of 98% or more by HPLC, purchased from AMA Copoeia Reference (40mg), and dissolved in DMSO when in use; fetal Bovine Serum (FBS), tetramethylthiazole blue (MTT), Bovine Serum Albumin (BSA), and dimethyl sulfoxide (DMSO) were purchased from Sigma corporation, usa; trypsin-EDTA, penicillin, streptomycin solutions were purchased from Gibco; second antibody

488-labeled goat anti-mouse IgG (H + L) was purchased from Cell Signaling Technology; DAPI nuclear luminescent dye was purchased from bi yun tian bio ltd.

2. Viruses and cells

The collected throat swab specimen of the influenza sample case is subjected to nucleic acid and virus separation detection and typing, the HA gene and the NA gene of the selected 1 strain of the influenza B virus isolate SH0218 strain are amplified by a one-step RT-PCR method, the amplified product is purified and sequenced, and the strain is subjected to molecular characteristic analysis from nucleotide, amino acid and a molecular evolution layer by biological information software. The separated influenza B virus HA gene and NA gene cluster branch relations are basically consistent, belong to Victoria strain, are distributed in Victoria Clade 1A branch, and belong to Brisbane/60 strain. The Victoria strain is related to 2 antigen epitopes in total, 117 and 129 sites of 120-loop antigen epitope and 197 and 199 sites of 190-helix antigen epitope. The Victoria strain HA and NA antigen gene variation sites are continuously changed. Determination of Titer (TCID) by Canine Kidney continuous cell line (MDCK)₅₀). After amplification, the cells were stored at-80 ℃.

3. Main instrument and consumable

A multifunctional full-wavelength enzyme-labeled detector was purchased from Biotek corporation, usa; low temperature 4 ℃ centrifuge is available from germany and is available from Eppendorf; fluorescent inverted microscope was purchased from Zeiss, germany; HeraCell 150i carbon dioxide incubator from Thermo corporation, USA; biosafety cabinets were purchased from the Hot electric company. 96-well cell culture plates, cell cryopreservation tubes, cell culture flasks, EP tubes, centrifuge tubes, and the like were purchased from Corning, USA.

4. Preparation of common reagent

(1) Ca-free²⁺、Mg²⁺PBS buffer: collecting NaCl 4.00g, KCl 0.10g, and anhydrous Na₂HPO₄ 0.5075g、KH₂PO₄0.10g of the extract is dissolved in 500mL of double distilled water, evenly mixed and stirred, and the pH value is adjusted to 7.2 according to a pH test paper.

(2) DMEM basal medium: the double antibody of penicillin and streptomycin with the mass volume concentration of 5 percent is added into the DMEM culture solution.

(3) Chicken red blood cell suspension with mass volume concentration of 1 percent: isolated and avian influenza virus antibody negative healthy SPF-level cock heart blood is adopted, washed for 3 times by using sterilized PBS to remove blood plasma and leucocytes, prepared into erythrocyte suspension by using sterile PBS, the concentration of the erythrocyte suspension is 1 v/v%, and placed at 4 ℃ for refrigeration and preservation for later use.

5. Amplification of influenza strains

(1) Influenza virus chick embryo inoculation: properly diluting influenza virus with sterile physiological saline containing penicillin, selecting SPF (specific pathogen free) chick embryos with complete shape, clear blood vessels, obvious fetal movement and obvious chorioallantoic membrane development boundary, marking inoculation positions at the junctions of air chambers by using a lamp, avoiding the heads and blood vessels of the chick embryos, disinfecting the chick embryos with iodine and alcohol, perforating by using a perforator, slowly injecting 0.1mL of virus diluent into allantoic cavities of the chick embryos by using an injector, wherein each chick embryo is 0.1mL, paraffin sealing is finished after injection, and then placing the inoculated chick embryos in a constant temperature box with the temperature of 35 ℃ and the saturation humidity for 48 hours. Embryos were discontinued once every 12 hours and dead chick embryos were removed within 24 hours.

(2) Chick embryo allantoic fluid detoxification: the chick embryos are placed in a refrigerator at 4 ℃ overnight, disinfected and the eggshells discarded, the allantoic fluid is carefully aspirated, at 3000rpm, centrifuged for 20min, and the supernatant is left for storage.

(3) The HA method is used for measuring the hemagglutination titer: adding 25 mu L PBS into 2-12 holes of a 96-hole hemagglutination plate A-H line, adding the chick embryo allantoic fluid to be detected into the first hole of the A-H line, diluting by two times, mixing uniformly the mixture in the 11 th hole, removing 25 mu L liquid, taking the 12 th hole as a negative control group, adding 25 mu L of 1% chick erythrocyte suspension into each hole, adding the chick erythrocyte suspension from low concentration to high concentration, mixing uniformly, standing at room temperature for 30min, and observing the agglutination condition of the chick erythrocytes.

(4) Selecting clear allantoic fluid with hemagglutination titer greater than 1:256, mixing well, centrifuging at 1500rpm for 10min, selecting supernatant, packaging, marking, and freezing at-80 deg.C.

6. Virus inhibition experiment

MDCK cells are cultured, and when the number of the cells in each well is detected to be 104, a design group is a normal control group, an IBV infection group and an AST efficacy detection group (the concentration is 0-100 mu g/ml). The growth of each group of cells was observed daily using a biological inverted microscope and is described as follows: lesion < 25% is indicated by weak positive (±); 25% was shown (+) at 50%, 75% was shown (++), 100% was shown (++++), and the recording was continued until CPE of the virus control group cells became 75% to 100%, thiazole blue (MTT) was added to start staining of the live cells, and the absorbance value of each group of cells was measured 2 hours later using a microplate reader.

MDCK cells were cultured in culture flasks. Cells were harvested at various times of viral infection (12, 24, 48, 72, 96, 120h) and washed 3 times with Phosphate Buffered Saline (PBS) to remove virus from the supernatant that had not passed through the cells. Then freeze thawing the cells for 3 times, lysing the cells to obtain virus, and filtering out cell debris. The virus titer of each cell lysate group is detected, and whether the drug inhibits the virus propagation in the cells is observed.

7. Fluorescent quantitative PCR (polymerase chain reaction) determination of influenza B virus HA gene and cytokine mRNA expression level

MDCK cells in a logarithmic growth phase are obtained, 1mL (1 × 106 cells/well) is added into each well of a 12-well plate, culture solution is removed after cell monolayers grow to 90% of confluence degree, the cells are washed twice by PBS solution, SH0218 virus is added, the amount of the virus is 500 μ L/well, the cells are incubated for 1 hour at 4 ℃, virus supernatant is removed, PBS is washed twice, and astragaloside IV with the amount of 25 μ g/mL is added at 0h, 2h, 4h, 6h and 10h respectively, and the dose is 1 mL/well. Setting normal control group (no test drug and no test drug, respectively)Influenza virus) and virus control (no test drug), three replicates per test concentration were set. The cells were cultured at 37 ℃ until 10h after infection. After observing the pathological condition, repeatedly freezing and thawing the cell plate for three times at-80 ℃ and 4 ℃ to fully lyse the cells, so that the viruses in the cells are completely released into cell supernatants, and then collecting the supernatants of all the wells. The collected cell supernatant was subjected to total RNA extraction using the protocol recommended by the Total RNA Rapid extraction kit (Co.). After extracting RNA, carrying out reverse transcription immediately under a specific primer to synthesize a cDNA template, wherein an internal reference gene is selected from GAPDH, and HA gene copy number detected by Real-time qPCR; the expression of M mRNA was evaluated with respect to a normal control group. Positive and negative primer sequences of HA gene of influenza B virus Victoria linkage strain: FluB-HA-940-F AAATACGGTGGATTAAACAAAAGCAA (SEQ ID NO: 1); FluB-HA-1109-R CCAGCAATAG CTCCGAAGAAA (SEQ ID NO: 2); internal reference GAPDH gene positive and negative primer sequences: GAPDH-F: 5'-GCACCGTCAAGGCTGAGAAC-3' (SEQ ID NO: 3); GAPDH-R: 5'-TGGTGAAGACGCC AGTGGA-3' (SEQ ID NO: 4). The diluted virus suspension was added to 96-well plates at concentration levels of 8 replicates per gradient, 200 μ L per well. A positive control of untreated virus solution and a negative control of no virus plus only 200. mu.L of medium were set, respectively. 8 replicates each. The 96-well plate was placed at 37 ℃ in 5% CO₂In the incubator, cells and viruses were ligated for about 72 hours.

8. Calculation of Virus TCID before and after erythrocyte antigen agglutination assay (HA)₅₀

After infecting each group of virus solution for 72h, taking out the 96-well plate, sucking 50 μ L of suspension in the plate by using a discharging gun, adding the suspension into an erythrocyte agglutination reaction plate, and then quickly dripping 50 μ L of chicken erythrocyte suspension into each well by using the discharging gun. Incubate at room temperature for 30 min. Observation of HA results: the wells in which agglutination of erythrocytes occurred were positive, and the wells in which agglutination of erythrocytes did not occur were negative. The number of positive and negative wells was recorded. Virus suspension TCID₅₀And the Mv value (value of the inhibitory virus activity of the adjuvant) was calculated.

Mv value determination standard reference ISO18184-2014

9. Determination of results

The results were calculated according to the following formula and are reported in table 1.

TCID₅₀Calculating the formula:

distance ratio ═ (percentage above 50% agglutination-50%)/(percentage above 50% agglutination-percentage below 50% morbidity)

lgTCID₅₀Distance ratio x difference between log of dilutions + log of dilutions above 50% disease rate

Mv＝-lg(TCID_{50 (additive treatment group mean)}-TCID_{50 (mean of treatment group without addition of auxiliary)})

The criteria for determination are as follows:

3.0 Mv is more than or equal to 2.0: can be effectively inhibited; mv is more than or equal to 3.0: can completely inhibit

TABLE 1

Serial number	Sample numbering	lgTCID50Mean value	Mv	Determination of results
					1	Sample (I)	2.088	2.778	Can effectively inhibit
2	Negative control	4.03	0.836	Can not inhibit

10. As a result:

(1) inhibition of influenza B/SH/02/18 strain (SH0218) by AST

The inhibition effect of AST on SH0218 virus is detected by using AST of 5 mug/ml, 10 mug/ml, 20 mug/ml, 40 mug/ml, 60 mug/ml, 80 mug/ml and 100 mug/ml to act on MDCK cells in vitro and observing for 48h under the condition of not influencing the cell activity. As a result, it was found that: AST has obvious inhibition effect on SH0218, and at a high concentration of 80 mug/ml, the inhibition rate of SH0218 virus is 75%, while at 100 mug/ml AST, the inhibition rate of SH0218 virus is 97% (as shown in figure 2). AST has obvious virus inhibiting effect on SH0218 in cytolytic changes typical of MDCK cell formation.

The experiments show that the astragaloside AST has obvious inhibition effect on the influenza B virus in vitro, the inhibition rate is in positive correlation with the concentration of the astragaloside AST, when the concentration of the astragaloside is 100 mu g/ml, the cell morphology of the astragaloside group is more complete and is close to the normal cell morphology compared with that of a DMSO group, and the MDCK cell morphology of the DMSO group of a control group is different in size, partially vacuole is formed, uneven distribution and partially concentrated. In the astragaloside group, the inhibition effect on SH0218 is started when the concentration of astragaloside AST reaches 20 mu g/ml, and the inhibition effect on SH0218 is hardly seen when the concentration of AST is lower than 20 mu g/ml.

(2) Dynamic inhibition of AST on influenza B/SH/02/18 strain

Three AST with different concentrations of 20 mug/ml, 60 mug/ml and 100 mug/ml are used for acting on MDCK cells in vitro, different infection time points such as 4h, 8h and 12h are respectively detected, and the inhibition effect of the AST on B/SH/02/18(SH0218) virus is respectively detected. As a result, it was found that: when AST with the concentration of 100 mu g/ml is infected by 1mol SH0218 strain for 8 hours, the AST already starts to have obvious inhibiting effect on the SH0218 strain, and the titer of virus of the SH0218 strain in the supernatant is obviously reduced, so thatControl 8.34X 10⁵TCID₅₀Reduction to a mean of 20 TCID/mL₅₀/mL(P<0.01), whereas 60. mu.g/ml AST, at 8h, the SH0218 strain has a virus titer which decreases to 178TCID₅₀/mL(P<0.01) (as shown in FIG. 3), the inhibitory effect was not substantially changed at 12h, while the AST at 20. mu.g/ml exhibited a slight decrease in viral titer but still increased (FIG. 3).

The experiments show that the inhibition effect of the astragaloside AST on the SH0218 strain needs time dependence, the inhibition effect is shown only when 8 hours are needed, a time basis is provided for measuring cell factors in later experiments and dynamically observing the inhibition condition of the AST on the SH0218 strain, the astragaloside AST is used as a traditional Chinese medicine astragalus extract, the effect is relatively mild, the dependence on time is still needed even if a certain inhibition effect is achieved, the biological safety is also suggested to be relatively reliable, and a good basis is provided for clinical development of medicinal materials.

Correspondingly, SH0218 strain is used for AST, and Real-time qPCR is used for identifying the relative increase ratio of the HA gene for virus proliferation, and as can be seen from figure 4, under the action of 100 mu g/ml AST, the relative ratio of the HA gene and beta-actin of the virus is reduced to 38.6 times from the original 358.0 times (P is less than 0.01). Under 60 mug/ml AST, the relative ratio of the HA gene of the virus to the beta-actin is reduced from 358.0 times to 76.2 times (P < 0.01). These show that the medicament has obvious inhibiting effect on SH0218 strain virus in vitro infection, certainly has close relation with time, 12h is the time point when different AST concentrations are different, so the selection of the experimental time can be based on the time point, and blindness is avoided.

After 12hpi, MDCK cells infected by SH0218 strain are collected under the action of different concentrations of AST, and the result of detection by using NP antibody shows that the AST with the concentration of 60 mu g/ml and 100 mu g/ml has obvious inhibiting effect on virus. This shows that the medicine has obvious therapeutic action on SH0218 strain virus in vitro cell culture, and the effective concentration of AST is 60 mug/ml, the optimum concentration is 100 mug/ml (as shown in figure 5), when it exceeds 100 mug/ml, the toxic side effect of AST is greater than its therapeutic action. Therefore, the in-vitro anti-SH 0218 strain effect of the AST and the optimal anti-SH 0218 strain concentration of the AST are proved, and a proper concentration range is provided for further research.

The above-mentioned embodiments only express the embodiments of the present invention, and the description thereof is more specific and detailed, but not construed as limiting the scope of the present invention. It should be noted that, for a person skilled in the art, several variations and modifications can be made without departing from the inventive concept, which falls within the scope of the present invention. Therefore, the protection scope of the present patent shall be subject to the appended claims.

SEQUENCE LISTING

<110> fifth people hospital in Shanghai City

<120> pharmaceutical application of astragaloside IV compound

<130> 2020

<160> 4

<170> PatentIn version 3.3

<210> 1

<211> 26

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 1

aaatacggtg gattaaacaa aagcaa 26

<210> 2

<211> 21

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 2

ccagcaatag ctccgaagaa a 21

<210> 3

<211> 20

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 3

gcaccgtcaa ggctgagaac 20

<210> 4

<211> 19

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 4

tggtgaagac gccagtgga 19

Claims (24)

1. The application of the astragaloside or the pharmaceutically acceptable salts thereof as the only active component in the preparation of the anti-influenza B virus medicine is characterized in that the structure of the astragaloside is shown as the following formula:

2. the use according to claim 1, wherein said anti-influenza B virus is an inhibitor of the proliferation of influenza B virus.

3. Use according to claim 1 or 2, characterized in that said pharmaceutically acceptable salt is a salt obtained by reacting said astragaloside with a chemically acceptable acid or base.

4. Use according to claim 3, characterized in that the chemically acceptable acid is an inorganic or organic acid.

5. The use according to claim 4, wherein the inorganic acid is selected from any one or more of hydrochloric acid, sulfuric acid, nitric acid and hydrobromic acid.

6. The use according to claim 4, wherein the organic acid is selected from any one or more of acetic acid, propionic acid, malonic acid, butyric acid, lactic acid, methanesulfonic acid, ethanesulfonic acid, benzenesulfonic acid, p-toluenesulfonic acid, maleic acid, benzoic acid, succinic acid, picric acid, tartaric acid, citric acid and fumaric acid.

7. Use according to claim 3, characterized in that the chemically acceptable base is an inorganic or organic base.

8. The use according to claim 7, wherein the inorganic base is selected from any one or more of sodium hydroxide, potassium hydroxide, calcium hydroxide, sodium carbonate, potassium carbonate, sodium bicarbonate and potassium bicarbonate.

9. The use according to claim 7, wherein the organic base is selected from one or more of trimethylamine, triethylamine and pyridine.

10. The use according to claim 3, wherein the pharmaceutically acceptable salt is selected from any one or more of potassium salt, sodium salt, ammonium salt, calcium salt, pyridinium salt and choline salt.

11. The application of a pharmaceutical composition in preparing anti-influenza B virus drugs is characterized in that the pharmaceutical composition consists of astragaloside IV or pharmaceutically acceptable salts thereof and pharmaceutically acceptable carriers; wherein the structure of the astragaloside IV is shown as the following formula:

12. the use according to claim 11, wherein the astragaloside or a pharmaceutically acceptable salt thereof in the pharmaceutical composition accounts for 0.01-90% of the pharmaceutical composition by mass.

13. The use according to claim 12, wherein the astragaloside IV or a pharmaceutically acceptable salt thereof in the pharmaceutical composition accounts for 0.05-70% of the pharmaceutical composition by mass.

14. The use according to claim 13, wherein the astragaloside IV or a pharmaceutically acceptable salt thereof in the pharmaceutical composition accounts for 0.1-30% of the pharmaceutical composition by mass.

15. The use according to claim 11, wherein the pharmaceutically acceptable carrier is selected from any one or more of diluents, lubricants, binders, disintegrants, stabilizers and solvents.

16. The use according to claim 15, wherein the diluent is selected from any one or more of starch, microcrystalline cellulose, sucrose, dextrin, lactose, powdered sugar, and glucose.

17. The use according to claim 15, wherein the lubricant is selected from any one or more of magnesium stearate, stearic acid, sodium chloride, sodium oleate, sodium lauryl sulfate, and poloxamer.

18. The use according to claim 15, wherein the binder is selected from any one or more of water, ethanol, starch slurry, syrup, hydroxypropyl methylcellulose, sodium carboxymethylcellulose, sodium alginate, and polyvinylpyrrolidone.

19. Use according to claim 15, characterized in that the disintegrant comprises starch, sodium bicarbonate or citric acid, tartaric acid and/or low-substituted hydroxypropylcellulose.

20. Use according to claim 15, wherein the stabilizer comprises acacia gum, agar, alginic acid, cellulose ether and/or carboxymethyl chitin ester.

21. Use according to claim 15, wherein the solvent comprises water and/or a balanced salt solution.

22. The use of claim 11, wherein the pharmaceutically acceptable carrier further comprises a flavoring or sweetening agent.

23. Use according to claim 11, wherein the pharmaceutical composition is administered orally or systemically.

24. Use according to claim 11, wherein the pharmaceutical dosage form is a tablet, granule, capsule, patch, pill, semi-solid, spray, aerosol or injection.

Images