CN112029887A - Gene, primer, kit and method for detecting fusarium solani carbendazim resistant strain - Google Patents

Abstract

The invention discloses a novel fusarium solani carbendazim resistance gene or gene fragment, a PCR primer pair and a kit for detecting fusarium solani carbendazim resistance strains, and a method for detecting the fusarium solani carbendazim resistance strains by using the gene or gene fragment, the primer pair and the kit.

Description

Gene, primer, kit and method for detecting fusarium solani carbendazim resistant strain

Technical Field

The invention belongs to the technical field of molecular biology, and particularly relates to a gene, a specific primer pair, a kit, a detection method and application for drug resistance of fusarium solani to carbendazim.

Background

Fusarium solani (Fusarium solani) is a worldwide distributed filamentous fungus belonging to Fusarium of Fukeotubeaceae of Aphyllophorales of Deuteromycotina. Fusarium solani can infect various crops, medicinal plants, flowers and trees such as wheat, rice, corn, soybean, peanut, pea, potato, sweet potato, hot pepper, celery, pepper, watermelon, strawberry, American ginseng, pseudo-ginseng, Chinese yam, ligusticum wallichii, lily, peony, agave, poplar and the like, and cause plant diseases such as root rot, stem rot, blight and the like. Once the plant is infected with a disease, if the prevention and treatment measures are not timely, the disease can be rapidly spread, and great economic loss is caused.

The disease caused by fusarium solani is mainly chemically controlled. The benzimidazole bactericide is a broad-spectrum bactericide developed in the later stage of the 60 th century, and comprises carbendazim, benomyl, thiophanate methyl and the like, and the two bactericides are converted into the carbendazim in organisms to play a role in sterilization. Benzimidazole fungicides are commonly used for foliar spray, seed treatment, soil treatment and the like, have control effects on diseases of various crops caused by fungi of. Because the acting sites of the medicaments are single, and the application frequency is high, a plurality of plant pathogenic fungi groups have drug-resistant strains after the medicaments are used for years, and the control effect of the medicaments is seriously influenced. In the 70's of the 20 th century, Botrytis cinerea (Botrytis cinerea), Cladonium arborescens (Cladobotryum dendrimers), brown rot (Monilinia fructicola), Tapesia yallundae, T acuformis and other plant pathogenic fungi have been found to be resistant to benzimidazole fungicides (Bollen & Scholten 1971; Mckay et al 1998; Ma et al 2003; Alberti et al 1999), and recently, Fusarium graminearum (F. graminearum), Fusarium graminearum (F. fujiki) have been reported to have found a carbendazim-resistant strain (Chen et al 2009; Chen et al 2014). Aiming at fusarium solani, Chinese researchers report that the resistance of sensitive strains to carbendazim is improved by 149.26 times after the sensitive strains are cultured for 7 generations through sub-lethal dose (Wangyong et al, 2002), and the fusarium solani is prompted to have higher drug resistance risk to carbendazim.

Detection and management of resistance to fusarium solani field populations relies on elucidation of the resistance mechanisms. Among plant pathogenic fungi, resistance mechanisms of p-benzimidazole bactericides such as Helminthosporium solani, Botrytis cinerea (B.cinerea), Cladosporium arborescens (C.dendrimers), brown rot fungi (M.fructicola), T.yallundae and T.acuformis mainly cause the 6 th, 50 th, 167 th, 198 th, 200 th and 240 th amino acid mutations of the gene codes by point mutation of beta 1-tubulin gene, so that the affinity of beta 1-tubulin and benzimidazole medicaments is reduced. However, the mechanism of the benzimidazole-resistant bactericide against fusarium solani is not clear at present. For fusarium solani, resistance genes and related mutations of benzimidazole bactericides are not reported so far, and molecular targets for resistance detection are lacked. The existing literature reports only that a beta-tubulin gene with higher similarity to other filamentous fungi beta 1-tubulin genes exists in fusarium solani, and the problems of whether other beta-tubulin genes exist, whether carbendazim resistance is related or not, how to detect and the like are not clear.

The traditional drug resistance detection method is to transfer the separated and purified pathogenic bacteria to a culture dish containing the drug, and identify drug-resistant strains by an IC50 method or a dose distinguishing method according to the inhibition degree of the drug on the growth of the pathogenic bacteria, wherein the time is generally 1-2 weeks, the consumed time is long, and the workload is large. The molecular detection technology established based on the resistant molecular target can quickly and accurately distinguish the sensitive and resistant strains of the bactericide within 1-2 days, and the resistance level of pathogenic bacteria to the medicament is determined.

In order to detect the drug resistance of the field to benzimidazole bactericides represented by carbendazim in the early period, monitor the development dynamic state of the drug resistance, provide early warning, guide and adjust the field disease control strategy in time, the method urgently needs to define the detection gene of the fusarium solani for resisting the carbendazim and establish a corresponding detection method.

Disclosure of Invention

The invention relates to an isolated fusarium solani beta 2-tubulin gene, and finds that mutation of a specific site of the fusarium solani beta 2-tubulin gene is related to carbendazim resistance, and a resistant strain to carbendazim can be identified by detecting point mutation of the fusarium solani beta 2-tubulin gene. Therefore, the technical problem to be solved by the invention is to provide a carbendazim resistance gene of fusarium solani, design a specific primer according to the resistance gene and establish a method for detecting the carbendazim resistance strain of fusarium solani. The method makes up the blank of the detection method of the fusarium solani carbendazim resistant strain, can be used for quickly detecting the fusarium solani carbendazim resistant strain, and has important significance for guiding the reasonable use of field pesticides and formulating a drug resistance treatment strategy.

In a first aspect, the present invention provides an isolated polynucleotide molecule or fragment thereof, said polynucleotide molecule having a nucleotide sequence selected from the group consisting of:

(a) 1, 2, 3, 4, 5 or 6;

(b) a nucleotide sequence which codes the amino acid sequence shown in SEQ ID NO. 7, or a nucleotide sequence which codes the amino acid sequence shown in SEQ ID NO. 7, wherein the 198 th position of the amino acid sequence is alanine or serine;

(c) a nucleotide sequence having at least 95% nucleotide sequence identity to at least one nucleotide sequence selected from the group consisting of SEQ ID NO 1, SEQ ID NO 2, SEQ ID NO 3, SEQ ID NO 4, SEQ ID NO 5 and SEQ ID NO 6, wherein said nucleotide sequence encodes a protein having β 2-tubulin activity;

(d) a nucleotide sequence encoding an amino acid sequence having at least 95% amino acid sequence identity to the amino acid sequence shown in SEQ ID No. 7, or to the amino acid sequence 198 alanine or serine of the amino acid sequence shown in SEQ ID No. 7, wherein said nucleotide sequence encodes a protein having β 2-tubulin activity;

(e) a nucleotide sequence having at least 95% nucleotide sequence identity to at least one nucleotide sequence selected from the group consisting of SEQ ID No. 1, SEQ ID No. 2, SEQ ID No. 3, SEQ ID No. 4, SEQ ID No. 5 and SEQ ID No. 6, wherein said nucleotide sequence encodes a protein having β 2-tubulin activity comprising an alanine or serine or glutamic acid at amino acid position 198;

(f) a nucleotide sequence having at least 95% nucleotide sequence identity to at least one nucleotide sequence selected from the group consisting of SEQ ID No. 1, SEQ ID No. 2 and SEQ ID No. 3, wherein said nucleotide sequence encodes a protein having β 2-tubulin activity comprising an alanine or serine at amino acid position 198;

(g) a nucleotide sequence having at least 95% nucleotide sequence identity to at least one nucleotide sequence selected from the group consisting of SEQ ID No. 4, SEQ ID No. 5 and SEQ ID No. 6, wherein said nucleotide sequence encodes a protein having β 2-tubulin activity comprising a glutamic acid at amino acid position 198; and

(h) a complement of at least one of the nucleotide sequences (a) - (g).

In some embodiments, the polynucleotide molecule encodes a β 2-tubulin gene in a Fusarium solani (Fusarium solani) carbendazim resistant strain, wherein the codon encoding amino acid 198 of the β 2-tubulin gene is GCG or TCG encoding alanine or serine.

In some embodiments, the polynucleotide molecule encodes a β 2-tubulin gene in a susceptible strain of Fusarium solani (Fusarium solani) carbendazim, the codon encoding amino acid 198 of the β 2-tubulin gene being a GAG encoding glutamate.

In some embodiments, the present invention provides a fragment of the polynucleotide molecule having a nucleotide sequence selected from the group consisting of:

(a) a nucleotide sequence shown as SEQ ID NO 8, 9, 10, 11, 12 or 13;

(b) a nucleotide sequence having at least 95% nucleotide sequence identity to at least one nucleotide sequence selected from the group consisting of SEQ ID NO 8, SEQ ID NO 9, SEQ ID NO 10, SEQ ID NO 11, SEQ ID NO 12 and SEQ ID NO 13, wherein said nucleotide sequence encodes a protein having β 2-tubulin activity;

(c) a nucleotide sequence having at least 95% nucleotide sequence identity to at least one nucleotide sequence selected from the group consisting of SEQ ID No. 8, SEQ ID No. 9, SEQ ID No. 10, SEQ ID No. 11, SEQ ID No. 12 and SEQ ID No. 13, wherein said nucleotide sequence encodes a protein having β 2-tubulin activity comprising an alanine or serine or glutamic acid at a position corresponding to amino acid 198 of the full length sequence of β 2-tubulin;

(d) a nucleotide sequence having at least 95% nucleotide sequence identity to at least one nucleotide sequence selected from the group consisting of SEQ ID No. 8, SEQ ID No. 9 and SEQ ID No. 10, wherein said nucleotide sequence encodes a protein having β 2-tubulin activity comprising an alanine or serine at the amino acid position corresponding to amino acid position 198 of the full-length sequence of β 2-tubulin;

(e) a nucleotide sequence having at least 95% nucleotide sequence identity to at least one nucleotide sequence selected from the group consisting of SEQ ID No. 11, SEQ ID No. 12 and SEQ ID No. 13, wherein said nucleotide sequence encodes a protein having β 2-tubulin activity comprising a glutamic acid at the amino acid position corresponding to amino acid position 198 of the full-length sequence of β 2-tubulin; or

(f) A complement of at least one of the nucleotide sequences (a) - (e).

The invention separates the beta 2-tubulin gene from the fusarium solani for the first time, and verifies that whether the fusarium solani generates resistance to carbendazim or not can be judged by detecting the target gene beta 2-tubulin gene or the segment thereof in the fusarium solani, comparing the nucleotide sequence and/or analyzing the translated amino acid sequence.

In particular, the present invention found that if the codon corresponding to amino acid 198 of the β 2-tubulin gene is GCG or TCG encoding alanine or serine, the fusarium solani strain is shown to be a carbendazim resistant strain; if the codon corresponding to amino acid 198 of the beta 2-tubulin gene is GAG encoding glutamic acid, it is shown that the Fusarium solani strain is a sensitive strain of multiple bacteria. The fusarium solani generates drug resistance to carbendazim and is originated from point mutation of beta 2-tubulin gene Open Reading Frame (ORF), so that the 198 th amino acid of the code is changed.

The invention defines the carbendazim resistance molecular target of fusarium solani for the first time.

In a second aspect, the present invention provides an expression cassette comprising a promoter capable of expression in a host cell, said promoter being operably linked to the polynucleotide molecule of the first aspect.

In a third aspect, the invention provides a primer pair for detecting the polynucleotide molecule of the first aspect, preferably, the upstream primer of the primer pair is Bt2F2 or Bt2F3, and the downstream primer is Bt2R2 or Bt2R3, wherein the nucleotide sequences of Bt2F2, Bt2R2, Bt2F3 and Bt2R3 are respectively shown in SEQ ID NO: 14. SEQ ID NO: 15. SEQ ID NO: 16. SEQ ID NO: shown at 17.

As a further preferable scheme, the invention designs a PCR primer pair for detecting fusarium solani beta 2-tubulin gene aiming at the newly found fusarium solani beta 2-tubulin gene, and the nucleotide sequence of the primer pair is as follows:

(5) forward primer Bt2F 2: ATCTCCAAGATCCGTGAGGGTAAGT (SEQ ID NO: 14); and

reverse primer Bt2R 2: GAAACGCGACCGCGGAAGATG (SEQ ID NO: 15); or

(6) Forward primer Bt2F 3: CCGAGGGCTGTGATGCTCTC (SEQ ID NO: 16); and

reverse primer Bt2R 3: TGGCGGAGCAGGTGAGGTAAC (SEQ ID NO: 17); or

(7) Forward primer Bt2F 2: ATCTCCAAGATCCGTGAGGGTAAGT (SEQ ID NO: 14); and

reverse primer Bt2R 3: TGGCGGAGCAGGTGAGGTAAC (SEQ ID NO: 17); or

(8) Forward primer Bt2F 3: CCGAGGGCTGTGATGCTCTC (SEQ ID NO: 16); and

reverse primer Bt2R 2: GAAACGCGACCGCGGAAGATG (SEQ ID NO: 15).

In a fourth aspect, the invention provides a kit for detecting fusarium solani carbendazim resistant strains, the kit comprising the primer pair of the third aspect.

The primer pair combines any upstream primer with any downstream primer, can take fusarium solani total DNA as a template, performs specific PCR amplification on a beta 2-tubulin target gene, determines a target gene sequence through sequencing analysis, and then detects a codon corresponding to the 198 th amino acid of the beta 2-tubulin gene and a translated amino acid, and has the characteristics of specificity and accuracy. Preferably, the kit further comprises other reagents for performing PCR, which has the advantage of convenient use.

In a fifth aspect, the present invention provides a method for detecting fusarium solani carbendazim resistant strains, the method comprising the steps of:

the first step is as follows: extracting the genomic DNA of the fusarium solani strain;

the second step is that: carrying out PCR reaction by using the kit of the fourth aspect of the invention and the genomic DNA in the first step as a template to obtain an amplification product and sequencing the amplification product; and

the third step: analyzing the codon of the amplified product corresponding to the 198 th amino acid of the beta 2-tubulin gene and the translated amino acid so as to determine the resistance of the strain to the carbendazim.

If the codon corresponding to amino acid 198 of the β 2-tubulin gene is GCG or TCG encoding alanine or serine, the fusarium solani strain is shown to be a carbendazim resistant strain; if the codon corresponding to amino acid 198 of the beta 2-tubulin gene is GAG encoding glutamic acid, it is shown that the Fusarium solani strain is a sensitive strain of multiple bacteria. The fusarium solani generates drug resistance to carbendazim and is originated from point mutation of beta 2-tubulin gene Open Reading Frame (ORF), so that the 198 th amino acid of the code is changed.

In a preferred embodiment of the present invention, the reaction annealing temperature in the PCR amplification is 55 to 65 ℃.

In a sixth aspect, the invention provides the application of the polynucleotide molecule and the fragment thereof, the primer pair, the kit or the method in detecting fusarium solani carbendazim resistant strains.

At least 95% sequence identity refers to, for example, 96%, 97%, 98%, 99% or 100% sequence identity.

The invention has the following beneficial effects:

the invention discovers for the first time that fusarium solani simultaneously has beta 1-tubulin gene and beta 2-tubulin gene 2 beta-tubulin gene, carbendazim resistant strain beta 1-tubulin gene does not generate mutation, amino acid codon 198 of beta 2-tubulin gene coding generates mutation and is related to resistance of carbendazim, and then beta 2-tubulin gene is used as a target gene, PCR detection primers are designed, a method for detecting whether the beta 2-tubulin gene of the strain is mutated is established, and the resistance of the strain to the carbendazim can be rapidly and sensitively detected. In addition, the primer and the reagent for PCR amplification can be prepared into a kit, and the kit is convenient to use and has wide application value.

The primer pair or the kit has the characteristics of high sensitivity, simplicity, rapidness and high accuracy when used for detection, is particularly suitable for rapidly and sensitively detecting the drug resistance appearing in the early stage of the field or the development dynamic state of a drug resistance population, and has important significance for drug resistance dynamic monitoring and early warning, guiding the reasonable use of field pesticides and timely adopting a drug resistance treatment strategy.

Drawings

FIG. 1 shows the results of homology comparison of the beta 2-tubulin gene sequences of Fusarium solani carbendazim resistant strains 4006, 4022, 4023 and susceptible strains 3992, 3996, 4101;

FIG. 2 shows the β 2-tubulin gene fragment, the translated amino acid sequence and the mutation site of the resistant strain of Fusarium solani carbendazim susceptible strain 4101 in example 3;

FIG. 3 shows the results of detecting Fusarium solani carbendazim resistant strains using the primer pair Bt2F2/Bt2R2 in example 4;

FIG. 4 is the results of detecting Fusarium solani carbendazim resistant strains using primer pair Bt2F3/Bt2R3 in example 5;

FIG. 5 shows the results of comparison of nucleotide sequence homology of the beta 2-tubulin gene fragment amplified by 6 strains of Fusarium solani in example 6 using primer pair Bt2F2/Bt2R 3;

FIG. 6 is the results of detecting Fusarium solani carbendazim resistant strains using primer pair Bt2F2/Bt2R3 in example 6;

FIG. 7 shows the results of detecting Fusarium solani carbendazim resistant strains using the primer pair Bt2F3/Bt2R2 in example 7.

Detailed Description

The experimental procedures used in the following examples are all conventional procedures unless otherwise specified. Materials, reagents and the like used in the following examples are commercially available unless otherwise specified. The strains used in the examples below were collected from Shandong province, China, and all strains were identified to the corresponding species by morphological and molecular biological methods. The public is available from the molecular ecology research laboratory of the institute of medicinal plant, institute of medical and scientific institute of Chinese medicine.

Example 1 determination of sensitive susceptible strains of the American Ginseng root rot pathogen Fusarium solani

1. The strain is as follows: collecting American ginseng root rot disease roots from different areas of Shandong province in 2015-2016, and obtaining 15 fusarium solani strains through single spore separation;

2. the method comprises the following steps: a hypha growth rate method is adopted to respectively prepare the carbendazim drug-containing PDA plates with serial concentrations, and the final concentrations of the carbendazim are respectively 0.16mg/L, 0.8mg/L, 4mg/L, 20mg/L, 100mg/L and 500 mg/L. And (3) beating a test strain along the edge of a bacterial colony to obtain a bacterial cake with the diameter of 5mm, and inoculating the hypha downwards to the center of a PDA (personal digital assistant) plate containing the carbendazim with a series of concentrations. Each treatment was repeated 4 times and a blank control was run. After culturing for 5 days at 25 ℃, measuring the diameter (cm) of a bacterial colony by adopting a cross method, calculating the inhibition rate, converting the concentration of the medicament into a logarithmic value, performing regression analysis on the logarithmic value and the inhibition rate, and calculating the effective inhibition medium concentration EC 50;

resistance index (RF) ═ resistant strain EC 50/susceptible strain EC 50. The resistance index of the strain is more than 10, and the strain is judged to have resistance to carbendazim (populus, phytopathogen resistance molecular biology, scientific press, 2011).

3. Results

The sensitivity result of 15 pathogenic bacteria to carbendazim shows that 12 strains have EC50 of 0.65-2.57mg/L to carbendazim and are sensitive strains of the carbendazim; the EC50 of the other 3 strains to carbendazim is more than 500mg/L, the strains are carbendazim resistant strains, the resistance index is more than 400 times, and the strains are carbendazim high-level resistant strains separated in the field (see table 1).

Sensitivity of Table 115 Fusarium solani to carbendazim

Example 2 comparative analysis of Gene sequences of Fusarium solani carbendazim sensitive Strain and resistant Strain beta 1-tubulin

1. The strain is as follows: 3 sensitive strains obtained by isolation in example 1 are numbered as 3996, 4036 and 4101; 3 carbendazim resistant strains, wherein the strain numbers are 4006, 4022 and 4023;

2. the method comprises the following steps:

1) template: respectively taking the genome DNA of the strains as templates;

2) PCR amplification and sequencing:

primer pairs Using Bt-1(AACATGCGTGAGATTGTAAGT)/Bt-2(TCTGGATGTTGTTGGGAATCC) reported by Wang et al (2014), the Bomeide reagent 2 XTaq PCR Master Mix was used, and the 30. mu.L reaction system included 1. mu.L template DNA (. about.30 ng), 15. mu.L PCR Mix, 1. mu.L of each primer (10. mu.M), 12. mu.L ddH₂And O, multiplying the reaction system according to the requirement of subsequent experiments. The reaction procedure is as follows: pre-denaturation at 94 ℃ for 5 min; 30s at 94 ℃, 30s at 58 ℃, 30s at 72 ℃ and 35 cycles; finally, extension was carried out at 72 ℃ for 5 min. The amplification product was sent to Beijing Tianyihui-Chi Biotech limited for sequencing.

3) Sequence analysis

The sequences were analyzed for alignment using DNAMAN6.0.3.99 software.

3. As a result:

the gene sequence fragment of fusarium solani-1300 bp beta 1-tubulin obtained by sequencing contains 5 exons and 4 introns, codes about 336 amino acids, and has homology of more than 99 percent with the amino acid sequence of filamentous fungi beta 1-tubulin such as fusarium granatum (F.fujikuroi, GenBank accession number: JQ026022), paecilomyces lilacinus (Purpureocillium lilacinum, GenBank accession number: XP-018180995.1) and Pochonia chlamydosporia (Pochonia chlamydospora oria, GenBank accession number: XP-018150106.1). The 336 amino acid sequences of the 3 carbendazim sensitive strains and the 3 resistant strains have 100 percent of consistency, and the codons 6, 50, 167, 198, 200 and 240 (Codon) are also completely the same (see Table 2), which indicates that the generation of the drug resistance of the fusarium solani to the carbendazim is not caused by the point mutation of the beta 1-tubulin gene.

TABLE 2 alignment of 6 amino acids and codons of the sensitive and resistant strains of multiple bacteria, beta 1-tubulin

Example 3 alignment analysis of Gene sequences of Fusarium solani carbendazim sensitive Strain and resistant Strain beta 2-tubulin

1. The strain is as follows: example 1 the obtained carbendazim sensitive strains 3992, 3996 and 4101 and the carbendazim resistant strains 4006, 4022 and 4023 are separated;

2. the method comprises the following steps:

1) template: the genomic DNA of the strains is respectively used as a template,

2) PCR amplification and sequencing

3) Sequence analysis

3. As a result:

through comparison with the whole genome of fusarium solani (GenBank: NGZQ01000001.1), the tested fusarium solani strain beta 2-tubulin gene sequence has the total length of 1700bp, contains 7 exons and 6 introns and encodes 449 amino acids. The homology of carbendazim resistant strain 4006(SEQ ID NO: 1), 4022(SEQ ID NO: 2) and 4023(SEQ ID NO: 3) with sensitive strains 3992(SEQ ID NO: 4), 3996(SEQ ID NO: 5), 4101(SEQ ID NO: 6). beta.2-tubulin gene sequences was 98.51% (see FIG. 1). The 198 th amino acid coded by the beta 2-tubulin gene of the sensitive strain is glutamic acid (E) (see a sequence shown in SEQ ID NO: 7), and the codon is GAG; the site of the resistant strain 4006 is mutated into alanine (A) (the 198 th amino acid sequence of the sequence shown in SEQ ID NO:7 is alanine (A)), and the codon is GCG; the resistant strains 4022, 4023 were mutated to serine (S) (the amino acid sequence at position 198 of the sequence shown in SEQ ID NO:7 is serine (S) and the codon is TCG, indicating that the resistance of Fusarium solani to carbendazim is related to the point mutation of the β 2-tubulin gene (see FIG. 2).

Example 4 detection of Fusarium solani carbendazim resistant strains with primer pair Bt2F2/Bt2R2

1. The strain is as follows: example 1 12 fusarium solani strains 3988, 3992, 3996, 4036, 4037, 4039, 4100, 4101, 4103, 4104, 4191, 4203 sensitive to carbendazim, and 3 resistant strains 4006, 4022, 4023 were isolated;

2. the method comprises the following steps:

1) template: the genomic DNA of the strains is respectively used as a template,

2) and (3) PCR amplification: carrying out PCR reaction by using a primer pair Bt2F2/Bt2R2(SEQ ID NO: 14/SEQ ID NO: 15), wherein the reaction system, the program and the sequencing method are the same as those of the example 2, and the annealing temperature is 60 ℃; 3) and (3) sequence alignment: same as in example 2.

3. As a result:

the designed primer pair Bt2F2/Bt2R2 can be used for successfully amplifying the fusarium solani target gene fragment, such as SEQ ID NO: 18 shows an amplified fragment of strain 4101, approximately 600bp in length, containing 3 exons and 2 introns. Analyzing the target gene fragment and the translated amino acid sequence, wherein codons of amino acid 198 coded by 12 carbendazim sensitive strains beta 2-tubulin are GAG and translated into glutamic acid (E), and in 3 resistant strains, the codons are mutated into GCG or TCG and translated into alanine (A) or serine (S) (see figure 3), which shows that the fusarium solani carbendazim resistant strains can be judged by detecting the gene sequence of the beta 2-tubulin and translating into the amino acid by using the designed primer pair Bt2F2/Bt2R 2.

Example 5 detection of Fusarium solani carbendazim resistant strains with primer pair Bt2F3/Bt2R3

1. The strain is as follows: example 1 12 fusarium solani strains 3988, 3992, 3996, 4036, 4037, 4039, 4100, 4101, 4103, 4104, 4191, 4203 sensitive to carbendazim, and 3 resistant strains 4006, 4022, 4023 were isolated;

2. the method comprises the following steps:

1) template: the genomic DNA of the strains is respectively used as a template,

2) and (3) PCR amplification: carrying out PCR reaction by using a primer pair Bt2F3/Bt2R3(SEQ ID NO: 16/SEQ ID NO: 17), wherein the reaction system, the program and the sequencing method are the same as those of the example 2, and the annealing temperature is 58 ℃; 3) sequence analysis: same as in example 2.

3. As a result:

the designed primer pair Bt2F3/Bt2R3 can be used for successfully amplifying the fusarium solani target gene fragment, such as SEQ ID NO: 19 shows an amplified fragment of 4101 strain, approximately 700bp in length, containing 3 exons and 2 introns. Analysis of target gene fragments and translated amino acid sequences, 12 carbendazim sensitive strains beta 2-tubulin encoded the 198 th amino acid codon GAG, translated into glutamic acid (E), and in resistant strains mutated to codon GCG or TCG, translated into alanine (E) or serine (E) (see FIG. 4), indicating that Fusarium solani carbendazim resistant strains can be determined by detecting the beta 2-tubulin gene sequence and translating into amino acid using the designed primer pair Bt2F3/Bt2R 3.

Example 6 detection of Fusarium solani carbendazim resistant strains using primer pair Bt2F2/Bt2R3

1. The strain is as follows: example 1 12 fusarium solani strains 3988, 3992, 3996, 4036, 4037, 4039, 4100, 4101, 4103, 4104, 4191, 4203 sensitive to carbendazim, and 3 resistant strains 4006, 4022, 4023 were isolated.

2. The method comprises the following steps:

1) template: the genomic DNA of the strains is respectively used as a template,

2) and (3) PCR amplification: PCR reaction was carried out using a primer pair Bt2F2/Bt2R3(SEQ ID NO: 14/SEQ ID NO: 17) with the same reaction system, procedure and sequencing method as in example 2, and an annealing temperature of 60 ℃. 3) And (3) sequence alignment: same as in example 2.

3. As a result:

the primer pair Bt2F2/Bt2R3 can be used for successfully amplifying the fusarium solani target gene fragment, such as SEQ ID NO:8, an amplified fragment of strain 4006 as set forth in SEQ ID NO:9, the amplified fragment of 4022 strain shown in SEQ ID NO:10, the amplified fragment of 4023 strain as set forth in SEQ ID NO:11, the amplified fragment of 3992 strain shown in SEQ ID NO:12, and the amplified fragment of the 3996 strain shown in SEQ ID NO:13, the amplified fragment of 4101 strain, approximately 600bp in length, contains 3 exons and 2 introns. The nucleotide sequence homology of the carbendazim resistant strains 4006, 4022 and 4023 and the amplified fragments of the sensitive strains 3992, 3996 and 4101 is more than 98.83% (see figure 5). The codon of the 198 th amino acid coded by 12 carbendazim sensitive strains beta 2-tubulin is GAG, translated into glutamic acid (E), and mutated into codon GCG or TCG in resistant strains, translated into alanine (E) or serine (E) (see figure 6), which shows that the designed primer pair Bt2F2/Bt2R3 and the kit can be used for detecting the fusarium solani carbendazim resistant strains.

Example 7 detection of Fusarium solani carbendazim drug-resistant strains using primer pair Bt2F3/Bt2R2

1. The strain is as follows: example 1 12 fusarium solani strains 3988, 3992, 3996, 4036, 4037, 4039, 4100, 4101, 4103, 4104, 4191, 4203 sensitive to carbendazim, and 3 resistant strains 4006, 4022, 4023 were isolated;

2. the method comprises the following steps:

1) template: the genomic DNA of the strains is respectively used as a template,

2) and (3) PCR amplification: carrying out PCR reaction by using a primer pair Bt2F3/Bt2R2(SEQ ID NO: 16/SEQ ID NO: 15), wherein the reaction system, the program and the sequencing method are the same as those of the example 2, and the annealing temperature is 60 ℃; 3) and (3) sequence alignment: same as in example 2.

3. As a result:

the primer pair Bt2F3/Bt2R2 can be used for successfully amplifying the fusarium solani target gene fragment, such as SEQ ID NO: 20 shows an amplified fragment of 4101 strain, approximately 700bp in length, containing 3 exons and 2 introns. The codon of the 198 th amino acid coded by 12 carbendazim sensitive strains beta 2-tubulin is GAG, is translated into glutamic acid (E), and is mutated into codon GCG or TCG in resistant strains, and is translated into alanine (E) or serine (E) (see figure 7), which shows that the designed primer pair Bt2F3/Bt2R2 and the kit can be used for detecting the resistant strains of fusarium solani to carbendazim.

And (4) conclusion:

it can be seen from the seven embodiments that the invention finds the beta 2-tubulin gene of the fusarium solani resistant to carbendazim, and two upstream primers and two downstream primers are designed and obtained aiming at the target gene to combine into four pairs of primer pairs, the kit adopting the primer pairs can carry out PCR amplification and sequence analysis on the target gene sequence, can be used for carrying out molecular identification on the fusarium solani resistant strain, quickly and sensitively detect the drug resistance appearing in the early stage of the field and detect the development dynamics of the drug resistance population, and provides support for field drug resistance prediction and forecast, reasonable pesticide use guidance and drug resistance treatment strategy formulation.

SEQUENCE LISTING

<110> institute of medicinal plants of academy of Chinese medical science

<120> gene, primer, kit and method for detecting fusarium solani carbendazim resistant strain

<130> RYP2010665.0

<160> 20

<170> PatentIn version 3.5

<210> 1

<211> 1723

<212> DNA

<213> Fusarium solani

<400> 1

atgcgcgaga ttgtgagctt gcctcctgtc cgttcttgct agaccgtctg tgtgctaatc 60

cagctctctt cgcctcgcag gttcacctcc aggtcggcca atgtgtacgt atttatctgc 120

ccctttccat ggtgccacct tcgtgtcgct ctgttgctaa cctcaccttc gcagggtaac 180

caagtcggct ctgccttctg gcagacgatt gcgggcgagc acggcctcga caccaacggc 240

gtgtaggcaa ccctctcgaa ccgaccgtct cgtcgtcctc ttctcacgct tcgaccaggt 300

acaacggaaa cgaccacgtc cagctggacc gtatcaatgt ctatttcaac gaggtacaca 360

cgacatcgcg tgacatgatc caacccaatc cgtgtctcgg tctctgaccg agcttcccac 420

aggcatccag caacaagtat gttccccgag ccgttctcgt cgacctggaa cccggcacca 480

tggacaccgt ccgctccggc ccctacggac agttcttccg acccgacaac ttcgtgtttg 540

gacaatcgag cgccggcaac aactgggcca agggccatta caccgagggt gctgagctgg 600

ttgaccaggt ccttgatgtc gttcgtcgtg aggccgaggg ctgtgatgct ctccagggct 660

tccagatctc tcactctctc ggtggtggta ccggatccgg catgggcacg cttctgatct 720

ccaagatccg tgagggtaag agcttaatca ttgacatgac gcgcagtttc gtctgctaat 780

cacctctcca gagttccccg atcgtatgat ggctaccttc agtgtcgccc cttcgcccaa 840

ggtgtccgac accgtcgttg agccctacaa cgccactctt tccgtccatc agctggtcga 900

aaactcggac tcgaccttct gtatcgataa cgaggctctg tacgagatct gcaagcgtac 960

tctcaagctg gccaaccctg cctacggtga tcttaaccac ctcgtttcca ccgtcatgtc 1020

tggcgtttcc acttctctgc gcttccccgg acagctcaac tccgacctgc gcaagatggc 1080

cgtcaacatg gtaagtctct atgcaactcg atcgatcaaa gatgcatatt gttgactgat 1140

ttccttttcc aggtcccctt ccctcgtctc catttcttca tggttggctt cgctcctctc 1200

actggccgtg gctcgcacgc cttcagcgcc gtctccgtcc ccgagctcac ccagcagctc 1260

ttcgatccca agaacatgat ggccggttcc gatttccgca acggccgtta cctcacctgc 1320

tcggccatct tccgcggacg cgtttccgcc aaggaggttg aggatcagat gcgcaacgtt 1380

cagcagaaga actctgctta cttcgttgag tggattccca acaacgttca gaccactctg 1440

tgctctgttc ctcccaaggg tctcaagatc tcgtccactt tcgtcggaaa ctcgactgct 1500

atccaggaga tcttcaagcg tgttggtgag cagttcaccg ccatgttccg tcgcaaggct 1560

ttcttgcatt ggtacactgg cgagggtatg gatgagatgg aattcaccga ggctgagtcc 1620

aacatgaacg atctcatctc ggagtaccag cagtaccagg aggccggcgt cgatgacgag 1680

gcctacgacg aggagtaccc ccaggaggag tatgctgagg agg 1723

<210> 2

<211> 1723

<212> DNA

<213> Fusarium solani

<400> 2

atgcgcgaga ttgtgagctt gcctcctgtc cgttcttgct agaccgtctg tgtgctaatc 60

cagctctctt cgcctcgcag gttcacctcc aggtcggcca atgtgtacgt atttatctgc 120

ccctttccat ggtgccacct tcgtgtcgct ctgttgctaa cctcaccttc gcagggtaac 180

caagtcggct ctgccttctg gcagacgatt gcgggcgagc acggcctcga caccaacggc 240

gtgtaggcaa ccctctcgaa ccgaccgtct cgtcgtcctc ttctcacgct tcgaccaggt 300

acaacggaaa cgaccacgtc cagctggacc gtatcaatgt ctatttcaac gaggtacaca 360

cgacatcgcg tgacatgatc caacccaatc cgtgtctcgg tctctgaccg agcttcccac 420

aggcatccag caacaagtat gttccccgag ccgttctcgt cgacctggaa cccggcacca 480

tggacaccgt ccgctccggc ccctacggac agttcttccg acccgacaac ttcgtgtttg 540

gacaatcgag cgccggcaac aactgggcca agggccatta caccgagggt gctgagctgg 600

ttgaccaggt ccttgatgtc gttcgtcgtg aggccgaggg ctgtgatgct ctccagggct 660

tccagatctc tcactctctc ggtggtggta ccggatccgg catgggcacg cttctgatct 720

ccaagatccg tgagggtaag agcttaatca ttgacatgac gcgcagtttc gtctgctaat 780

cacctctcca gagttccccg atcgtatgat ggctaccttc agtgtcgccc cttcgcccaa 840

ggtgtctgac accgtcgttg agccctacaa cgccactctt tccgtccatc agctggtcga 900

aaactcggac gcgaccttct gtatcgataa cgaggctctg tacgagatct gcaagcgtac 960

tctcaagctg gccaaccctg cctacggtga tcttaaccac ctcgtttcca ccgtcatgtc 1020

tggcgtttcc acttctctgc gcttccccgg acagctcaac tccgacctgc gcaagatggc 1080

cgtcaacatg gtaagtctct atgcaactcg atcgatcaaa gatgcatatt gttgactgat 1140

ttccttttcc aggtcccctt ccctcgtctc catttcttca tggttggctt cgctcctctc 1200

actggccgtg gctcgcacgc cttcagcgcc gtctccgtcc ccgagctcac ccagcagctc 1260

ttcgatccca agaacatgat ggccggttcc gatttccgca acggccgtta cctcacctgc 1320

tcggccatct tccgcggacg cgtttccgcc aaggaggttg aggatcagat gcgcaacgtt 1380

cagcagaaga actctgctta cttcgttgag tggattccca acaacgttca gaccactctg 1440

tgctctgttc ctcccaaggg tctcaagatc tcgtccactt tcgtcggaaa ctcgactgct 1500

atccaggaga tcttcaagcg tgttggtgag cagttcaccg ccatgttccg tcgcaaggct 1560

ttcttgcatt ggtacactgg cgagggtatg gatgagatgg aattcaccga ggctgagtcc 1620

aacatgaacg atctcatctc ggagtaccag cagtaccagg aggccggcgt cgatgacgag 1680

gcctacgacg aggagtaccc ccaggaggag tatgctgagg agg 1723

<210> 3

<211> 1723

<212> DNA

<213> Fusarium solani

<400> 3

atgcgcgaga ttgtgagctt gcctcctgtc cgttcttgct agaccgtctg tgtgctaatc 60

cagctctctt cgcctcgcag gttcacctcc aggtcggcca atgtgtacgt atttatctgc 120

ccctttccat ggtgccacct tcgtgtcgct ctgttgctaa cctcaccttc gcagggtaac 180

caagtcggct ctgccttctg gcagacgatt gcgggcgagc acggcctcga caccaacggc 240

gtgtaggcaa ccctctcgaa ccgaccgtct cgtcgtcctc ttctcacgct tcgaccaggt 300

acaacggaaa cgaccacgtc cagctggacc gtatcaatgt ctatttcaac gaggtacaca 360

cgacatcgcg tgacatgatc caacccaatc cgtgtctcgg tctctgaccg agcttcccac 420

aggcatccag caacaagtat gttccccgag ccgttctcgt cgacctggaa cccggcacca 480

tggacaccgt ccgctccggc ccctacggac agttcttccg acccgacaac ttcgtgtttg 540

gacaatcgag cgccggcaac aactgggcca agggccatta caccgagggt gctgagctgg 600

ttgaccaggt ccttgatgtc gttcgtcgtg aggccgaggg ctgtgatgct ctccagggct 660

tccagatctc tcactctctc ggtggtggta ccggatccgg catgggcacg cttctgatct 720

ccaagatccg tgagggtaag agcttaatca ttgacatgac gcgcagtttc gtctgctaat 780

cacctctcca gagttccccg atcgtatgat ggctaccttc agtgtcgccc cttcgcccaa 840

ggtgtctgac accgtcgttg agccctacaa cgccactctt tccgtccatc agctggtcga 900

aaactcggac gcgaccttct gtatcgataa cgaggctctg tacgagatct gcaagcgtac 960

tctcaagctg gccaaccctg cctacggtga tcttaaccac ctcgtttcca ccgtcatgtc 1020

tggcgtttcc acttctctgc gcttccccgg acagctcaac tccgacctgc gcaagatggc 1080

cgtcaacatg gtaagtctct atgcaactcg atcgatcaaa gatgcatatt gttgactgat 1140

ttccttttcc aggtcccctt ccctcgtctc catttcttca tggttggctt cgctcctctc 1200

actggccgtg gctcgcacgc cttcagcgcc gtctccgtcc ccgagctcac ccagcagctc 1260

ttcgatccca agaacatgat ggccggttcc gatttccgca acggccgtta cctcacctgc 1320

tcggccatct tccgcggacg cgtttccgcc aaggaggttg aggatcagat gcgcaacgtt 1380

cagcagaaga actctgctta cttcgttgag tggattccca acaacgttca gaccactctg 1440

tgctctgttc ctcccaaggg tctcaagatc tcgtccactt tcgtcggaaa ctcgactgct 1500

atccaggaga tcttcaagcg tgttggtgag cagttcaccg ccatgttccg tcgcaaggct 1560

ttcttgcatt ggtacactgg cgagggtatg gatgagatgg aattcaccga ggctgagtcc 1620

aacatgaacg atctcatctc ggagtaccag cagtaccagg aggccggcgt cgatgacgag 1680

gcctacgacg aggagtaccc ccaggaggag tatgctgagg agg 1723

<210> 4

<211> 1721

<212> DNA

<213> Fusarium solani

<400> 4

atgcgcgaga ttgtgagctt gccttccgtc tgttctttct agatcgtctg tgtgctaatc 60

aagttctctc cgcctcgcag gttcacctcc aggtcggcca atgtgtacgt acttatctgc 120

ccctttccat ggtgccacct ttgtttgtcg cgctgttgct aaccttcaca gggtaaccaa 180

gtcggttctg ccttctggca gacgattgcc ggcgagcacg gtctcgacac caacggcgtg 240

taggcatccc cctccaaccg atcgtctcgt ctcgtctcgt cgtccttttc tcacgcttcg 300

accaggtaca acggtaacga ccacgtccag ctggaccgta tcaatgtcta tttcaacgag 360

gtacacacga catcgcgtga catgatccaa cccattccgt gtctcggtct ctgatcgagc 420

ttcccatagg catccagcaa caagtatgtt ccccgagccg ttctcgtcga cttggaaccc 480

ggcaccatgg acaccgtccg ctccggtccc tacggacagt tcttccgacc cgacaacttt 540

gtgtttggac aatcgagcgc cggcaacaac tgggccaagg gccattacac cgagggtgct 600

gagctggttg accaggtcct tgatgtcgtt cgtcgtgagg ccgagggctg tgatgctctc 660

cagggcttcc agatctccca ctctctcggt ggtggtaccg gttccggcat gggcacgctt 720

ctgatctcca agatccgtga gggtaagagc tcaatcattg acatgacgcg tagtttcgtc 780

tactaatctc ctccccagag ttccccgatc gtatgatggc taccttcagt gtcgcccctt 840

cgcccaaggt gtccgatacc gtcgttgagc cctacaacgc tactctttcc gtccatcagc 900

tggtcgaaaa ctcggatgag accttctgta tcgataacga ggctctgtac gagatctgca 960

agcgtactct caagctggcc aaccctgcct acggtgacct gaaccacctc gtttccaccg 1020

tcatgtctgg cgtttccact tctctgcgct tccccggaca gctcaactcc gacctgcgca 1080

agatggccgt caacatggta agccatgcaa ctcgattgac cagacatacg ttattgacat 1140

ccttctccag gtccccttcc ctcgtctcca tttcttcatg gttggcttcg ctcctctcac 1200

cggccgtggc tcgcacgcct tcagcgccgt ctccgtcccc gagctcactc agcagctctt 1260

cgaccccaag aacatgatgg ccggttccga tttccgcaac ggccgttacc tcacctgctc 1320

cgccatcttc cgcggtcgcg tttccgccaa ggaggttgag gatcagatgc gcaacgttca 1380

gcagaagaac tctgcctact tcgttgagtg gattcccaac aacgttcaga ccactctgtg 1440

ctctgttcct cccaagggtc tcaagatctc ttccactttc gtcggaaact cgactgctat 1500

ccaggagatc ttcaagcgtg ttggtgagca gttcaccgcc atgttccgtc gcaaggcttt 1560

cttgcattgg tatactggcg agggtatgga tgagatggaa ttcaccgagg ctgagtccaa 1620

catgaacgat ctcatctcgg agtaccagca gtaccaggag gctggcgtcg atgacgaggc 1680

ctacgacgag gagtaccccc aggaggagta tgctgaggag a 1721

<210> 5

<211> 1723

<212> DNA

<213> Fusarium solani

<400> 5

atgcgcgaga ttgtgagctt gcctcctgtc cgttcttgct agaccgtctg tgtgctaatc 60

cagctctctt cgcctcgcag gttcacctcc aggtcggcca atgtgtacgt atttatctgc 120

ccctttccat ggtgccacct tcgtgtcgct ctgttgctaa cctcaccttc gcagggtaac 180

caagtcggct ctgccttctg gcagacgatt gcgggcgagc acggcctcga caccaacggc 240

gtgtaggcaa ccctctcgaa ccgaccgtct cgtcgtcctc ttctcacgct tcgaccaggt 300

acaacggaaa cgaccacgtc cagctggacc gtatcaatgt ctatttcaac gaggtacaca 360

cgacatcgcg tgacatgatc caacccaatc cgtgtctcgg tctctgaccg agcttcccac 420

aggcatccag caacaagtat gttccccgag ccgttctcgt cgacctggaa cccggcacca 480

tggacaccgt ccgctccggc ccctacggac agttcttccg acccgacaac ttcgtgtttg 540

gacaatcgag cgccggcaac aactgggcca agggccatta caccgagggt gctgagctgg 600

ttgaccaggt ccttgatgtc gttcgtcgtg aggccgaggg ctgtgatgct ctccagggct 660

tccagatctc tcactctctc ggtggtggta ccggatccgg catgggcacg cttctgatct 720

ccaagatccg tgagggtaag agcttaatca ttgacatgac gcgcagtttc gtctgctaat 780

cacctctcca gagttccccg atcgtatgat ggctaccttc agtgtcgccc cttcgcccaa 840

ggtgtccgac accgtcgttg agccctacaa cgccactctt tccgtccatc agctggtcga 900

aaactcggac gagaccttct gtatcgataa cgaggctctg tacgagatct gcaagcgtac 960

tctcaagctg gccaaccctg cctacggtga tcttaaccac ctcgtttcca ccgtcatgtc 1020

tggcgtttcc acttctctgc gcttccccgg acagctcaac tccgacctgc gcaagatggc 1080

cgtcaacatg gtatgtctct atgcaactcg atcgatcaaa gatgcatatt gttgactgat 1140

ttccttttcc aggtcccctt ccctcgtctc catttcttca tggttggctt cgctcctctc 1200

actggccgcg gctcgcacgc cttcagcgcc gtctccgtcc ccgagctcac ccagcagctc 1260

ttcgatccca agaacatgat ggccggttcc gatttccgca acggccgtta cctcacctgc 1320

tcggccatct tccgcggacg cgtttccgcc aaggaggttg aggatcagat gcgcaacgtt 1380

cagcagaaga actctgctta cttcgttgag tggattccca acaacgttca gaccactctg 1440

tgctctgttc ctcccaaggg tctcaagatc tcgtccactt tcgtcggaaa ctcgactgct 1500

atccaggaga tcttcaagcg tgttggtgag cagttcaccg ccatgttccg tcgcaaggct 1560

ttcttgcatt ggtacactgg cgagggtatg gatgagatgg aattcaccga ggctgagtcc 1620

aacatgaacg atctcatctc ggagtaccag cagtaccagg aggccggcgt cgatgacgag 1680

gcctacgacg aggagtaccc ccaggaggag tatgctgagg agg 1723

<210> 6

<211> 1723

<212> DNA

<213> Fusarium solani

<400> 6

atgcgcgaga ttgtgagctt gcctcctgtc cgttcttgct agaccgtctg tgtgctaatc 60

cagctctctt cgcctcgcag gttcacctcc aggtcggcca atgtgtacgt atttatctgc 120

ccctttccat ggtgccacct tcgtgtcgct ctgttgctaa cctcaccttc gcagggtaac 180

caagtcggct ctgccttctg gcagacgatt gcgggcgagc acggcctcga caccaacggc 240

gtgtaggcaa ccctctcgaa ccgaccgtct cgtcgtcctc ttctcacgct tcgaccaggt 300

acaacggaaa cgaccacgtc cagctggacc gtatcaatgt ctatttcaac gaggtacaca 360

cgacatcgcg tgacatgatc caacccaatc cgtgtctcgg tctctgaccg agcttcccac 420

aggcatccag caacaagtat gttccccgag ccgttctcgt cgacctggaa cccggcacca 480

tggacaccgt ccgctccggc ccctacggac agttcttccg acccgacaac ttcgtgtttg 540

gacaatcgag cgccggcaac aactgggcca agggccatta caccgagggt gctgagctgg 600

ttgaccaggt ccttgatgtc gttcgtcgtg aggccgaggg ctgtgatgct ctccagggct 660

tccagatctc tcactctctc ggtggtggta ccggatccgg catgggcacg cttctgatct 720

ccaagatccg tgagggtaag agcttaatca ttgacatgac gcgcagtttc gtctgctaat 780

cacctctcca gagttccccg atcgtatgat ggctaccttc agtgtcgccc cttcgcccaa 840

ggtgtccgac accgtcgttg agccctacaa cgccactctt tccgtccatc agctggtcga 900

aaactcggac gagaccttct gtatcgataa cgaggctctg tacgagatct gcaagcgtac 960

tctcaagctg gccaaccctg cctacggtga tcttaaccac ctcgtttcca ccgtcatgtc 1020

tggcgtttcc acttctctgc gcttccccgg acagctcaac tccgacctgc gcaagatggc 1080

cgtcaacatg gtaagtctct atgcaactcg atcgatcaaa gatgcatatt gttgactgat 1140

ttccttttcc aggtcccctt ccctcgtctc catttcttca tggttggctt cgctcctctc 1200

actggccgtg gctcgcacgc cttcagcgcc gtctccgtcc ccgagctcac ccagcagctc 1260

ttcgatccca agaacatgat ggccggttcc gatttccgca acggccgtta cctcacctgc 1320

tcggccatct tccgcggacg cgtttccgcc aaggaggttg aggatcagat gcgcaacgtt 1380

cagcagaaga actctgctta cttcgttgag tggattccca acaacgttca gaccactctg 1440

tgctctgttc ctcccaaggg tctcaagatc tcgtccactt tcgtcggaaa ctcgactgct 1500

atccaggaga tcttcaagcg tgttggtgag cagttcaccg ccatgttccg tcgcaaggct 1560

ttcttgcatt ggtacactgg cgagggtatg gatgagatgg aattcaccga ggctgagtcc 1620

aacatgaacg atctcatctc ggagtaccag cagtaccagg aggccggcgt cgatgacgag 1680

gcctacgacg aggagtaccc ccaggaggag tatgctgagg agg 1723

<210> 7

<211> 449

<212> PRT

<213> Fusarium solani

<400> 7

Met Arg Glu Ile Val His Leu Gln Val Gly Gln Cys Gly Asn Gln Val

1 5 10 15

Gly Ser Ala Phe Trp Gln Thr Ile Ala Gly Glu His Gly Leu Asp Thr

20 25 30

Asn Gly Val Tyr Asn Gly Asn Asp His Val Gln Leu Asp Arg Ile Asn

35 40 45

Val Tyr Phe Asn Glu Ala Ser Ser Asn Lys Tyr Val Pro Arg Ala Val

50 55 60

Leu Val Asp Leu Glu Pro Gly Thr Met Asp Thr Val Arg Ser Gly Pro

65 70 75 80

Tyr Gly Gln Phe Phe Arg Pro Asp Asn Phe Val Phe Gly Gln Ser Ser

85 90 95

Ala Gly Asn Asn Trp Ala Lys Gly His Tyr Thr Glu Gly Ala Glu Leu

100 105 110

Val Asp Gln Val Leu Asp Val Val Arg Arg Glu Ala Glu Gly Cys Asp

115 120 125

Ala Leu Gln Gly Phe Gln Ile Ser His Ser Leu Gly Gly Gly Thr Gly

130 135 140

Ser Gly Met Gly Thr Leu Leu Ile Ser Lys Ile Arg Glu Glu Phe Pro

145 150 155 160

Asp Arg Met Met Ala Thr Phe Ser Val Ala Pro Ser Pro Lys Val Ser

165 170 175

Asp Thr Val Val Glu Pro Tyr Asn Ala Thr Leu Ser Val His Gln Leu

180 185 190

Val Glu Asn Ser Asp Glu Thr Phe Cys Ile Asp Asn Glu Ala Leu Tyr

195 200 205

Glu Ile Cys Lys Arg Thr Leu Lys Leu Ala Asn Pro Ala Tyr Gly Asp

210 215 220

Leu Asn His Leu Val Ser Thr Val Met Ser Gly Val Ser Thr Ser Leu

225 230 235 240

Arg Phe Pro Gly Gln Leu Asn Ser Asp Leu Arg Lys Met Ala Val Asn

245 250 255

Met Val Pro Phe Pro Arg Leu His Phe Phe Met Val Gly Phe Ala Pro

260 265 270

Leu Thr Gly Arg Gly Ser His Ala Phe Ser Ala Val Ser Val Pro Glu

275 280 285

Leu Thr Gln Gln Leu Phe Asp Pro Lys Asn Met Met Ala Gly Ser Asp

290 295 300

Phe Arg Asn Gly Arg Tyr Leu Thr Cys Ser Ala Ile Phe Arg Gly Arg

305 310 315 320

Val Ser Ala Lys Glu Val Glu Asp Gln Met Arg Asn Val Gln Gln Lys

325 330 335

Asn Ser Ala Tyr Phe Val Glu Trp Ile Pro Asn Asn Val Gln Thr Thr

340 345 350

Leu Cys Ser Val Pro Pro Lys Gly Leu Lys Ile Ser Ser Thr Phe Val

355 360 365

Gly Asn Ser Thr Ala Ile Gln Glu Ile Phe Lys Arg Val Gly Glu Gln

370 375 380

Phe Thr Ala Met Phe Arg Arg Lys Ala Phe Leu His Trp Tyr Thr Gly

385 390 395 400

Glu Gly Met Asp Glu Met Glu Phe Thr Glu Ala Glu Ser Asn Met Asn

405 410 415

Asp Leu Ile Ser Glu Tyr Gln Gln Tyr Gln Glu Ala Gly Val Asp Asp

420 425 430

Glu Ala Tyr Asp Glu Glu Tyr Pro Gln Glu Glu Tyr Ala Glu Glu Glu

435 440 445

Gln

<210> 8

<211> 611

<212> DNA

<213> Fusarium solani

<400> 8

atctccaaga tccgtgaggg taagagctta atcattgaca tgacgcgcag tttcgtctgc 60

taatcacctc tccagagttc cccgatcgta tgatggctac cttcagtgtc gccccttcgc 120

ccaaggtgtc cgacaccgtc gttgagccct acaacgccac tctttccgtc catcagctgg 180

tcgaaaactc ggactcgacc ttctgtatcg ataacgaggc tctgtacgag atctgcaagc 240

gtactctcaa gctggccaac cctgcctacg gtgatcttaa ccacctcgtt tccaccgtca 300

tgtctggcgt ttccacttct ctgcgcttcc ccggacagct caactccgac ctgcgcaaga 360

tggccgtcaa catggtaagt ctctatgcaa ctcgatcgat caaagatgca tattgttgac 420

tgatttcctt ttccaggtcc ccttccctcg tctccatttc ttcatggttg gcttcgctcc 480

tctcactggc cgtggctcgc acgccttcag cgccgtctcc gtccccgagc tcacccagca 540

gctcttcgat cccaagaaca tgatggccgg ttccgatttc cgcaacggcc gttacctcac 600

ctgctcggcc a 611

<210> 9

<211> 611

<212> DNA

<213> Fusarium solani

<400> 9

atctccaaga tccgtgaggg taagagctta atcattgaca tgacgcgcag tttcgtctgc 60

taatcacctc tccagagttc cccgatcgta tgatggctac cttcagtgtc gccccttcgc 120

ccaaggtgtc tgacaccgtc gttgagccct acaacgccac tctttccgtc catcagctgg 180

tcgaaaactc ggacgcgacc ttctgtatcg ataacgaggc tctgtacgag atctgcaagc 240

gtactctcaa gctggccaac cctgcctacg gtgatcttaa ccacctcgtt tccaccgtca 300

tgtctggcgt ttccacttct ctgcgcttcc ccggacagct caactccgac ctgcgcaaga 360

tggccgtcaa catggtaagt ctctatgcaa ctcgatcgat caaagatgca tattgttgac 420

tgatttcctt ttccaggtcc ccttccctcg tctccatttc ttcatggttg gcttcgctcc 480

tctcactggc cgtggctcgc acgccttcag cgccgtctcc gtccccgagc tcacccagca 540

gctcttcgat cccaagaaca tgatggccgg ttccgatttc cgcaacggcc gttacctcac 600

ctgctcggcc a 611

<210> 10

<211> 611

<212> DNA

<213> Fusarium solani

<400> 10

atctccaaga tccgtgaggg taagagctta atcattgaca tgacgcgcag tttcgtctgc 60

taatcacctc tccagagttc cccgatcgta tgatggctac cttcagtgtc gccccttcgc 120

ccaaggtgtc tgacaccgtc gttgagccct acaacgccac tctttccgtc catcagctgg 180

tcgaaaactc ggacgcgacc ttctgtatcg ataacgaggc tctgtacgag atctgcaagc 240

gtactctcaa gctggccaac cctgcctacg gtgatcttaa ccacctcgtt tccaccgtca 300

tgtctggcgt ttccacttct ctgcgcttcc ccggacagct caactccgac ctgcgcaaga 360

tggccgtcaa catggtaagt ctctatgcaa ctcgatcgat caaagatgca tattgttgac 420

tgatttcctt ttccaggtcc ccttccctcg tctccatttc ttcatggttg gcttcgctcc 480

tctcactggc cgtggctcgc acgccttcag cgccgtctcc gtccccgagc tcacccagca 540

gctcttcgat cccaagaaca tgatggccgg ttccgatttc cgcaacggcc gttacctcac 600

ctgctcggcc a 611

<210> 11

<211> 602

<212> DNA

<213> Fusarium solani

<400> 11

atctccaaga tccgtgaggg taagagctca atcattgaca tgacgcgtag tttcgtctac 60

taatctcctc cccagagttc cccgatcgta tgatggctac cttcagtgtc gccccttcgc 120

ccaaggtgtc cgataccgtc gttgagccct acaacgctac tctttccgtc catcagctgg 180

tcgaaaactc ggatgagacc ttctgtatcg ataacgaggc tctgtacgag atctgcaagc 240

gtactctcaa gctggccaac cctgcctacg gtgacctgaa ccacctcgtt tccaccgtca 300

tgtctggcgt ttccacttct ctgcgcttcc ccggacagct caactccgac ctgcgcaaga 360

tggccgtcaa catggtaagc catgcaactc gattgaccag acatacgtta ttgacatcct 420

tctccaggtc cccttccctc gtctccattt cttcatggtt ggcttcgctc ctctcaccgg 480

ccgtggctcg cacgccttca gcgccgtctc cgtccccgag ctcactcagc agctcttcga 540

ccccaagaac atgatggccg gttccgattt ccgcaacggc cgttacctca cctgctccgc 600

ca 602

<210> 12

<211> 611

<212> DNA

<213> Fusarium solani

<400> 12

atctccaaga tccgtgaggg taagagctta atcattgaca tgacgcgcag tttcgtctgc 60

taatcacctc tccagagttc cccgatcgta tgatggctac cttcagtgtc gccccttcgc 120

ccaaggtgtc cgacaccgtc gttgagccct acaacgccac tctttccgtc catcagctgg 180

tcgaaaactc ggacgagacc ttctgtatcg ataacgaggc tctgtacgag atctgcaagc 240

gtactctcaa gctggccaac cctgcctacg gtgatcttaa ccacctcgtt tccaccgtca 300

tgtctggcgt ttccacttct ctgcgcttcc ccggacagct caactccgac ctgcgcaaga 360

tggccgtcaa catggtatgt ctctatgcaa ctcgatcgat caaagatgca tattgttgac 420

tgatttcctt ttccaggtcc ccttccctcg tctccatttc ttcatggttg gcttcgctcc 480

tctcactggc cgcggctcgc acgccttcag cgccgtctcc gtccccgagc tcacccagca 540

gctcttcgat cccaagaaca tgatggccgg ttccgatttc cgcaacggcc gttacctcac 600

ctgctcggcc a 611

<210> 13

<211> 611

<212> DNA

<213> Fusarium solani

<400> 13

atctccaaga tccgtgaggg taagagctta atcattgaca tgacgcgcag tttcgtctgc 60

taatcacctc tccagagttc cccgatcgta tgatggctac cttcagtgtc gccccttcgc 120

ccaaggtgtc cgacaccgtc gttgagccct acaacgccac tctttccgtc catcagctgg 180

tcgaaaactc ggacgagacc ttctgtatcg ataacgaggc tctgtacgag atctgcaagc 240

gtactctcaa gctggccaac cctgcctacg gtgatcttaa ccacctcgtt tccaccgtca 300

tgtctggcgt ttccacttct ctgcgcttcc ccggacagct caactccgac ctgcgcaaga 360

tggccgtcaa catggtaagt ctctatgcaa ctcgatcgat caaagatgca tattgttgac 420

tgatttcctt ttccaggtcc ccttccctcg tctccatttc ttcatggttg gcttcgctcc 480

tctcactggc cgtggctcgc acgccttcag cgccgtctcc gtccccgagc tcacccagca 540

gctcttcgat cccaagaaca tgatggccgg ttccgatttc cgcaacggcc gttacctcac 600

ctgctcggcc a 611

<210> 14

<211> 25

<212> DNA

<213> Artificial Sequence

<220>

<223> Artificial Sequence

<400> 14

atctccaaga tccgtgaggg taagt 25

<210> 15

<211> 21

<212> DNA

<213> Artificial Sequence

<220>

<223> Artificial Sequence

<400> 15

gaaacgcgac cgcggaagat g 21

<210> 16

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Artificial Sequence

<400> 16

ccgagggctg tgatgctctc 20

<210> 17

<211> 21

<212> DNA

<213> Artificial Sequence

<220>

<223> Artificial Sequence

<400> 17

tggcggagca ggtgaggtaa c 21

<210> 18

<211> 630

<212> DNA

<213> Fusarium solani

<400> 18

atctccaaga tccgtgaggg taagagctta atcattgaca tgacgcgcag tttcgtctgc 60

taatcacctc tccagagttc cccgatcgta tgatggctac cttcagtgtc gccccttcgc 120

ccaaggtgtc cgacaccgtc gttgagccct acaacgccac tctttccgtc catcagctgg 180

tcgaaaactc ggacgagacc ttctgtatcg ataacgaggc tctgtacgag atctgcaagc 240

gtactctcaa gctggccaac cctgcctacg gtgatcttaa ccacctcgtt tccaccgtca 300

tgtctggcgt ttccacttct ctgcgcttcc ccggacagct caactccgac ctgcgcaaga 360

tggccgtcaa catggtaagt ctctatgcaa ctcgatcgat caaagatgca tattgttgac 420

tgatttcctt ttccaggtcc ccttccctcg tctccatttc ttcatggttg gcttcgctcc 480

tctcactggc cgtggctcgc acgccttcag cgccgtctcc gtccccgagc tcacccagca 540

gctcttcgat cccaagaaca tgatggccgg ttccgatttc cgcaacggcc gttacctcac 600

ctgctcggcc atcttccgcg gacgcgtttc 630

<210> 19

<211> 694

<212> DNA

<213> Fusarium solani

<400> 19

ccgagggctg tgatgctctc cagggcttcc agatctctca ctctctcggt ggtggtaccg 60

gatccggcat gggcacgctt ctgatctcca agatccgtga gggtaagagc ttaatcattg 120

acatgacgcg cagtttcgtc tgctaatcac ctctccagag ttccccgatc gtatgatggc 180

taccttcagt gtcgcccctt cgcccaaggt gtccgacacc gtcgttgagc cctacaacgc 240

cactctttcc gtccatcagc tggtcgaaaa ctcggacgag accttctgta tcgataacga 300

ggctctgtac gagatctgca agcgtactct caagctggcc aaccctgcct acggtgatct 360

taaccacctc gtttccaccg tcatgtctgg cgtttccact tctctgcgct tccccggaca 420

gctcaactcc gacctgcgca agatggccgt caacatggta agtctctatg caactcgatc 480

gatcaaagat gcatattgtt gactgatttc cttttccagg tccccttccc tcgtctccat 540

ttcttcatgg ttggcttcgc tcctctcact ggccgtggct cgcacgcctt cagcgccgtc 600

tccgtccccg agctcaccca gcagctcttc gatcccaaga acatgatggc cggttccgat 660

ttccgcaacg gccgttacct cacctgctcg gcca 694

<210> 20

<211> 713

<212> DNA

<213> Fusarium solani

<400> 20

ccgagggctg tgatgctctc cagggcttcc agatctctca ctctctcggt ggtggtaccg 60

gatccggcat gggcacgctt ctgatctcca agatccgtga gggtaagagc ttaatcattg 120

acatgacgcg cagtttcgtc tgctaatcac ctctccagag ttccccgatc gtatgatggc 180

taccttcagt gtcgcccctt cgcccaaggt gtccgacacc gtcgttgagc cctacaacgc 240

cactctttcc gtccatcagc tggtcgaaaa ctcggacgag accttctgta tcgataacga 300

ggctctgtac gagatctgca agcgtactct caagctggcc aaccctgcct acggtgatct 360

taaccacctc gtttccaccg tcatgtctgg cgtttccact tctctgcgct tccccggaca 420

gctcaactcc gacctgcgca agatggccgt caacatggta agtctctatg caactcgatc 480

gatcaaagat gcatattgtt gactgatttc cttttccagg tccccttccc tcgtctccat 540

ttcttcatgg ttggcttcgc tcctctcact ggccgtggct cgcacgcctt cagcgccgtc 600

tccgtccccg agctcaccca gcagctcttc gatcccaaga acatgatggc cggttccgat 660

ttccgcaacg gccgttacct cacctgctcg gccatcttcc gcggacgcgt ttc 713

Claims (10)

1. An isolated polynucleotide molecule or fragment thereof, said polynucleotide molecule having a nucleotide sequence selected from the group consisting of:

(a) 1, 2, 3, 4, 5 or 6;

(b) a nucleotide sequence which codes the amino acid sequence shown in SEQ ID NO. 7, or a nucleotide sequence which codes the amino acid sequence shown in SEQ ID NO. 7, wherein the 198 th position of the amino acid sequence is alanine or serine;

(c) a nucleotide sequence having at least 95% nucleotide sequence identity to at least one nucleotide sequence selected from the group consisting of SEQ ID NO 1, SEQ ID NO 2, SEQ ID NO 3, SEQ ID NO 4, SEQ ID NO 5 and SEQ ID NO 6, wherein said nucleotide sequence encodes a protein having β 2-tubulin activity;

(d) a nucleotide sequence encoding an amino acid sequence having at least 95% amino acid sequence identity to the amino acid sequence shown in SEQ ID No. 7, or to the amino acid sequence 198 alanine or serine of the amino acid sequence shown in SEQ ID No. 7, wherein said nucleotide sequence encodes a protein having β 2-tubulin activity;

(e) a nucleotide sequence having at least 95% nucleotide sequence identity to at least one nucleotide sequence selected from the group consisting of SEQ ID No. 1, SEQ ID No. 2, SEQ ID No. 3, SEQ ID No. 4, SEQ ID No. 5 and SEQ ID No. 6, wherein said nucleotide sequence encodes a protein having β 2-tubulin activity comprising an alanine or serine or glutamic acid at amino acid position 198;

(f) a nucleotide sequence having at least 95% nucleotide sequence identity to at least one nucleotide sequence selected from the group consisting of SEQ ID No. 1, SEQ ID No. 2 and SEQ ID No. 3, wherein said nucleotide sequence encodes a protein having β 2-tubulin activity comprising an alanine or serine at amino acid position 198;

(g) a nucleotide sequence having at least 95% nucleotide sequence identity to at least one nucleotide sequence selected from the group consisting of SEQ ID No. 4, SEQ ID No. 5 and SEQ ID No. 6, wherein said nucleotide sequence encodes a protein having β 2-tubulin activity comprising a glutamic acid at amino acid position 198; and

(h) a complement of at least one of the nucleotide sequences (a) - (g).

2. The isolated polynucleotide molecule or fragment thereof of claim 1, wherein said polynucleotide molecule encodes a β 2-tubulin gene in a Fusarium solani (Fusarium solani) carbendazim resistant strain, said β 2-tubulin gene encoding amino acid 198 at a codon that is GCG or TCG encoding alanine or serine.

3. The isolated polynucleotide molecule or fragment thereof of claim 1, wherein said polynucleotide molecule encodes the β 2-tubulin gene of a susceptible strain of Fusarium solani (Fusarium solani) carbendazim, wherein the codon encoding amino acid 198 of said β 2-tubulin gene is a GAG encoding glutamic acid.

4. The isolated polynucleotide molecule or fragment thereof of claim 1, said fragment having a nucleotide sequence selected from the group consisting of:

(a) a nucleotide sequence shown as SEQ ID NO 8, 9, 10, 11, 12 or 13;

(b) a nucleotide sequence having at least 95% nucleotide sequence identity to at least one nucleotide sequence selected from the group consisting of SEQ ID NO 8, SEQ ID NO 9, SEQ ID NO 10, SEQ ID NO 11, SEQ ID NO 12 and SEQ ID NO 13, wherein said nucleotide sequence encodes a protein having β 2-tubulin activity;

(c) a nucleotide sequence having at least 95% nucleotide sequence identity to at least one nucleotide sequence selected from the group consisting of SEQ ID No. 8, SEQ ID No. 9, SEQ ID No. 10, SEQ ID No. 11, SEQ ID No. 12 and SEQ ID No. 13, wherein said nucleotide sequence encodes a protein having β 2-tubulin activity comprising an alanine or serine or glutamic acid at a position corresponding to amino acid 198 of the full length sequence of β 2-tubulin;

(d) a nucleotide sequence having at least 95% nucleotide sequence identity to at least one nucleotide sequence selected from the group consisting of SEQ ID No. 8, SEQ ID No. 9 and SEQ ID No. 10, wherein said nucleotide sequence encodes a protein having β 2-tubulin activity comprising an alanine or serine at the amino acid position corresponding to amino acid position 198 of the full-length sequence of β 2-tubulin;

(e) a nucleotide sequence having at least 95% nucleotide sequence identity to at least one nucleotide sequence selected from the group consisting of SEQ ID No. 11, SEQ ID No. 12 and SEQ ID No. 13, wherein said nucleotide sequence encodes a protein having β 2-tubulin activity comprising a glutamic acid at the amino acid position corresponding to amino acid position 198 of the full-length sequence of β 2-tubulin; and

(f) a complement of at least one of the nucleotide sequences (a) - (e).

5. An expression cassette comprising a promoter capable of expression in a host cell, said promoter operably linked to the polynucleotide molecule of any one of claims 1-4.

6. A primer pair for detecting the polynucleotide molecule of any one of claims 1 to 4, preferably, the upstream primer of the primer pair is Bt2F2 or Bt2F3, and the downstream primer is Bt2R2 or Bt2R3, wherein the nucleotide sequences of Bt2F2, Bt2R2, Bt2F3 and Bt2R3 are respectively shown as SEQ ID NO: 14. SEQ ID NO: 15. SEQ ID NO: 16. SEQ ID NO: shown at 17.

7. The primer pair according to claim 6, having the following nucleotide sequence:

(1) forward primer Bt2F 2: ATCTCCAAGATCCGTGAGGGTAAGT (SEQ ID NO: 14); and

reverse primer Bt2R 2: GAAACGCGACCGCGGAAGATG (SEQ ID NO: 15); or

(2) Forward primer Bt2F 3: CCGAGGGCTGTGATGCTCTC (SEQ ID NO: 16); and

reverse primer Bt2R 3: TGGCGGAGCAGGTGAGGTAAC (SEQ ID NO: 17); or

(3) Forward primer Bt2F 2: ATCTCCAAGATCCGTGAGGGTAAGT (SEQ ID NO: 14); and

reverse primer Bt2R 3: TGGCGGAGCAGGTGAGGTAAC (SEQ ID NO: 17); or

(4) Forward primer Bt2F 3: CCGAGGGCTGTGATGCTCTC (SEQ ID NO: 16); and

reverse primer Bt2R 2: GAAACGCGACCGCGGAAGATG (SEQ ID NO: 15).

8. A kit for detecting fusarium solani carbendazim resistant strains, the kit comprising the primer pair of claim 6 or 7.

9. A method for detecting fusarium solani carbendazim resistant strains, the method comprising the steps of:

(1) extracting the genomic DNA of the fusarium solani strain;

(2) performing PCR reaction by using the kit of claim 8 and the genomic DNA obtained in the first step as a template to obtain an amplification product and sequencing the amplification product; and

(3) analyzing the codon of the amplified product corresponding to the 198 th amino acid of the beta 2-tubulin gene and the translated amino acid so as to determine the resistance of the strain to the carbendazim, wherein if the codon corresponding to the 198 th amino acid of the beta 2-tubulin gene is GCG or TCG encoding alanine or serine, the fusarium solani strain is shown to be a carbendazim resistant strain; if the codon corresponding to amino acid 198 of the beta 2-tubulin gene is GAG encoding glutamic acid, it is shown that the Fusarium solani strain is a sensitive strain of multiple bacteria.

10. Use of the polynucleotide molecule of any one of claims 1 to 4 and fragments thereof, the expression cassette of claim 5, the primer pair of claim 6 or 7, the kit of claim 8 for the detection of fusarium solani resistant strains.

Images