CN111909961B - CRISPR/Cas-mediated ATL cell gene editing vector and application thereof - Google Patents

Abstract

The invention discloses a CRISPR/Cas-mediated ATL cell gene editing vector, and belongs to the technical field of gene editing. The gene expression regulatory element of the gene editing vector contains a CD4 specific promoter and an ATL specific enhancer sequence, and the invention further discloses the application of the gene editing vector in a gene editing system. The vector can deliver a CRISPR/Cas gene editing system to an ATL cell in a targeted manner, can perform gene editing on an adult T lymphocyte leukemia type I virus (HTLV-1) gene sequence under the guidance of gRNA, can effectively inhibit viral protein expression of HTLV-1 and ATL cell proliferation, and has no obvious influence on HTLV-1 negative cells.

Description

CRISPR/Cas-mediated ATL cell gene editing vector and application thereof

Technical Field

The invention relates to the technical field of gene editing, in particular to a CRISPR/Cas-mediated gene editing vector targeting adult T lymphocyte leukemia cells and application thereof.

Background

Adult T-lymphocytic leukemia (ATL) is a malignancy caused by infection with adult T-lymphocytic leukemia type i virus (HTLV-1). Clinically, there are four main categories of expression based on ATL: acute, lymphoma, chronic and insidious. The first two types of ATL patients have acute onset of disease and short life cycle; the two latter types of ATL have better prognosis, and can effectively relieve the state of illness and prevent deterioration through symptomatic treatment. To date, there is no effective treatment for ATL or HTLV-1 related infectious diseases. At present, clinical treatment schemes aiming at the ATL mainly adopt chemotherapy methods, and meanwhile, treatment methods such as interferon therapy, immunotherapy, allogeneic bone marrow stem cell transplantation and the like are adopted. However, compared with other types of malignant proliferative diseases of the lymphatic system, the ATL has low sensitivity to common chemotherapeutic drugs, has unobvious inhibitory effect on antiviral drugs, and has high recurrence rate after treatment and extremely poor prognosis.

HTLV-1 virus remains latent in the host cell for life and is not recognized and eliminated efficiently. Therefore, the exploration of directly taking the HTLV-1 provirus in the host cell as a target spot and specifically carrying out gene editing, and the destruction and knockout of the latent virus genome is expected to become a breakthrough for overcoming the ATL caused by the virus infection. The CRISPR/Cas gene editing technology, the Zinc Finger Nuclease (ZFN) technology and the Transcription Activator Like Effector Nuclease (TALEN) technology are listed as three major gene editing technologies, wherein the CRISPR/Cas gene editing technology has the advantages that the design principle is simple, the operation is simple and convenient, the Cas nuclease can accurately cut a target sequence through the specific recognition of the gRNA and the like, and is rapidly favored by researchers.

The CRISPR-Cas system is a very powerful genome editing tool. In recent years, the CRISPR-Cas technology shows great potential in the field of gene therapy by targeting and correcting a gene mutation site through a Cas protein. However, off-target effects remain a challenge to be solved. In particular, in certain cases, nuclease activity of Cas proteins can be triggered by targeting an incompletely matched, off-target genomic site by guide rna (grna), and this problem is particularly acute when the mismatched site is distal to the PAM sequence, which greatly impacts the clinical application of CRISPR-Cas. To address the off-target effect of CRISPR-Cas, scientists have taken various strategies including generating a pair of juxtaposed single-stranded DNA nicks using Cas9 nickase mutants, fusing FokI nuclease domains using a pair of inactivated Cas, constructing the Ribosomes (RNPs) of Cas, and deleting the 5' end of the guide sequence, but these methods are more or less deficient. In addition, Cas adopted by the CRISPR/Cas system is all heterologous proteins from prokaryotes, and long-term high-level expression of the Cas mediated by a gene delivery vector brings toxicity risks to cells. CRISPR/Cas sustains gene editing activity in vivo, greatly increasing the risk of causing off-target effects. DNA Double Strand Breakpoints (DSBs) produced by off-target can cause genomic instability, resulting in chromosomal abnormalities such as chromosomal shifts, deletions, heteroploidy, and the like (Porteus M.H. Towards a new era in media: genomic biology,2015,16(1): 286). Gene editing experiments in adult mice have shown that the DSB generated by cleavage of the CRISPR/Cas9 system is mainly repaired by the non-homologous end joining (NHEJ) pathway, resulting in more gene defects and even in severe side reactions and death of the mice (Yang, et al. A dual AAV systems activation of the Cas9-mediated correction of a metabolic liver disease in newborn semiconductor. Nature Biotechnology,2016,34(3): 334-338.169). How to reduce the off-target effect generated by the CRISPR/Cas system is a difficult problem and a research hotspot for reducing the adverse effect of gene editing on organisms.

As HTLV-1 mainly infects human CD4+ T lymphocytes, the development of a method which can target a CRISPR/Cas system on HTLV-1 positive CD4+ T lymphocytes, not only can directionally knock out HTLV-1 latent in ATL cells, but also can reduce the risk of Cas off-target is a technical problem which needs to be solved urgently in the field.

Disclosure of Invention

In order to solve the problems in the prior art, the invention aims to provide a CRISPR/Cas-mediated ATL cell gene editing vector which can deliver a target gene to a target cell and control the expression of Cas nuclease at a transcription level, thereby improving the gene editing efficiency and overcoming the off-target risk generated by Cas expression.

In order to achieve the above object, the present invention provides the following technical solutions:

the invention provides a CRISPR/Cas-mediated ATL cell gene editing vector, and a gene delivery vector capable of efficiently carrying out gene editing on ATL cells is obtained through the optimized design of a Cas expression frame, and can be used for gene therapy or gene editing of the ATL cells.

The invention obtains the gene expression frame combination which can be specifically and highly expressed in ATL cells by screening the types and insertion positions of cis-acting elements such as a promoter, an enhancer and the like.

The promoter is a tissue-specific promoter for regulating the expression of CD4 genes in CD4 cells, and the enhancer is a tissue-specific enhancer for regulating the expression of CD4 genes in CD4 cells. Because ATL is developed by HTLV-1 infected CD4+ T cells, the invention selects a tissue-specific promoter and an enhancer for regulating the expression of CD4 gene in CD4 cells, constructs expression plasmids with different combination forms and verifies and screens the targeted expression effect, and expects to obtain a gene vector for regulating the specific expression of Cas nuclease in ATL cells.

Preferably, the sequence of the CD4+ promoter is as set forth in SEQ ID NO: 1 is shown.

Preferably, the enhancer comprises any one of LTR1, LTR2, LTR3 and CD4E, the sequence of the enhancer LTR1 is as set forth in SEQ ID NO: 2 is shown in the specification; the sequence of the enhancer LTR2 is shown in SEQ ID NO: 3 is shown in the specification; the sequence of the enhancer LTR3 is shown in SEQ ID NO: 4 is shown in the specification; the sequence of the enhancer CD4E is shown as SEQ ID NO: 5, respectively.

Preferably, the enhancer sequence is inserted 5' to the CD4+ promoter.

The invention also provides a genome editing system, which comprises the gene editing vector, and through targeted regulation and control of the specific expression of the Cas nuclease in the ATL cell, the directional knockout of HTLV-1 latent in the ATL cell is realized, and the off-target risk generated by Cas expression is reduced.

The invention also provides application of the gene editing vector in inhibiting viral protein expression of HTLV-1 and ATL cell proliferation, and ATL cells can be subjected to gene editing by using a CRISPR/Cas technology.

Compared with the prior art, the technical scheme of the invention has the following beneficial effects:

the invention provides a CRISPR/Cas-mediated ATL cell gene editing vector, and a gene delivery vector capable of stably and efficiently carrying out gene editing on an ATL cell is obtained through the optimized design of a Cas expression frame, and can be used for gene therapy or gene editing of the ATL cell. The gene editing vector can target a CRISPR/Cas system on HTLV-1 positive CD4+ T lymphocytes, can directionally knock out HTLV-1 latent in ATL cells, and can reduce off-target risk generated by Cas expression. The invention has important significance in the research of inhibiting the viral protein expression of HTLV-1 and the proliferation of ATL cells.

Drawings

FIG. 1 is a restriction enzyme digestion identification map of CD4+ cell specific expression plasmid, wherein Lane 1 is the plasmid before restriction enzyme digestion, Lane 2 is the plasmid after double restriction enzyme digestion, and Lane M is Mark;

FIG. 2 shows the transgene expression of plasmid pCAG-GFP and plasmid pCD4-GFP in negative Hela cells and positive Jurkat and MT-2 cells, respectively;

FIG. 3 is a schematic representation of a transgene expression cassette with an enhancer sequence inserted before the promoter;

fig. 4 is an SSA reporter detection system, (a) is an SSA reporter containing a target sequence, (b) is a gRNA-mediated CRISPR/Cas9 system in which the expression cassette of Cas9 is replaced with an ATL cell specific expression cassette;

FIG. 5 shows the expression of the viral protein p19 of HTLV-1 in control cells and cells of gRNA-R1 and gRNA-R2;

FIG. 6 shows the number of p 19-positive cells in the control group and the gRNA-R1 and gRNA-R2 groups;

FIG. 7 is a graph of the effect of plasmid pATL02, pATL03 and control on the proliferative activity of ATL-T tumor cells;

FIG. 8 shows the number of EdU staining positive cells in the control and pATL02, pATL03 plasmids, mediated by gRNA-R1;

FIG. 9 is the level of ATL cell-specific CRISPR/Cas9 gene editing system expressing Cas9 in ATL-T cells and HTLV-1 negative cells (Jurkat, Molt-4);

FIG. 10 shows the effect of the ATL cell-specific CRISPR/Cas9 gene editing system on the activity of HTLV-1 negative cells, (a) Jurkat cells, and (b) Molt-4 cells.

Detailed Description

The invention provides a CRISPR/Cas-mediated ATL cell gene editing vector, which comprises a CD4 specific promoter and an ATL specific enhancer, wherein the promoter is a CD4 specific promoter, and the specific sequence is shown as SEQ ID NO: 1 is shown in the specification; the enhancer comprises any one of LTR1, LTR2, LTR3 and CD4E, and the sequence of the enhancer LTR1 is shown in SEQ ID NO: 2 is shown in the specification; the sequence of the enhancer LTR2 is shown in SEQ ID NO: 3 is shown in the specification; the sequence of the enhancer LTR3 is shown in SEQ ID NO: 4 is shown in the specification; the sequence of the enhancer CD4E is shown as SEQ ID NO: 5, respectively.

In the specific implementation process of the invention, the reagent and each cell are prepared by adopting a conventional commercial product in the field; the CD 4-specific promoter and enhancer fragments were synthesized by GENEWIZ; a Green Fluorescent Protein (GFP) reporter plasmid was constructed and stored by the medical college of Huaqiao university, and the Luciferase gene was synthesized by GENEWIZ corporation.

The technical solution of the present invention will be clearly and completely described below with reference to the embodiments of the present invention. It is to be understood that the described embodiments are merely exemplary of the invention, and not restrictive of the full scope of the invention. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.

Example 1

In this example, a CD4+ cell-specific expression plasmid was designed based on the CD4+ promoter.

Since HTLV-1 mainly infects CD4+ T cells in humans, we first constructed a CD4+ cell-specific expression plasmid. On the basis of a Green Fluorescent Protein (GFP) report plasmid with a nonspecific promoter CAG as a promoter, the CAG is replaced by the promoter for regulating the expression of a CD4 gene, and a CD4+ cell-specific expression plasmid is obtained.

The human CD4+ promoter sequence used was: CTGATTAAGCCTGATTCTGCTTAACTTTTTCCCTTGACTTTGGCATTTTCACTTTGACATGTTCCCTGAGAGCCTGGGGGGTGGGGAACCAGCTCCAGCTGGTGACGTTTGGGGCCGGCCCAGGCCTAGGGTGTGGAGGAGCCTTGCCATCGGGCTTCCTGTCTCTCTTCATTTAAGCACGACTCTGCAGTAGGCCTGTACGGAAGTGTTACTTCTGCTCTAAAAGCTGCGGAATTGTACCCGCGGCCGATCC are provided.

Taking 24ng fragment containing CD4 specific promoter, mixing with 24ng linearized pCAG-GFP plasmid vector to prepare a homologous recombination reaction system, and using ddH₂O, complementing 10 mu L, and mixing with the competent cells; incubating in 42 deg.C metal bath for 45-90s, taking out, immediately placing on ice for 2-3min, adding 800-. After completion of the recovery, the cells were centrifuged at 4500rpm for 2min, the majority of the supernatant was discarded, and the remaining 100. mu.L of resuspended cells were plated. And (3) selecting a single colony, extracting a recombinant plasmid pCD4-GFP, carrying out enzyme digestion identification, wherein the size of an enzyme digestion fragment is consistent with that predicted, and the success of construction is proved (see figure 1).

And (3) respectively taking a CD4 negative cell Hela and a CD4 positive cell Jurkat and MT-2 to perform plasmid transfection, and comparing the transgene expression level of the constructed CD4+ cell specific expression plasmid. As can be seen, in the CD4 negative cell Hela, the transgene expression level of the CD4+ cell-specific expression plasmid pCD4-GFP is obviously lower than that of the pCAG-GFP plasmid. In both CD4 positive cells Jurkat and MT-2, although the transgene expression level was not high, there was no significant difference compared to the pCAG-GFP plasmid, suggesting that the CD4 specific promoter can mediate the expression of the transgene in CD4+ cells (see FIG. 2).

Example 2

In this example, based on any one of enhancers CRE, AP, LTR1, LTR2, LTR3, CD4E and SRE, design was continued on the basis of pCD4-GFP obtained in example 1 to obtain an ATL cell-specific expression plasmid.

CD4+ T cells gradually worsen after infecting HTLV-1 and can develop into ATL cells, and the ATL cells are possibly infected by the HTLV-1 due to the fact that the utilization of transcription factors is related to the expression level of cellular genes, and the types or the levels of the transcription factors are different from those of normal cells. In order to improve the transgene expression efficiency in ATL cells, the invention introduces a specific enhancer sequence in a gene expression frame to screen cis-elements which play an enhancing role in ATL cell specificity.

Selected enhancer sequences are shown in the table below.

TABLE 1 enhancer sequences

The sequence of the selected enhancer LTR1 is shown in SEQ ID NO: 2 is shown in the specification; the sequence of LTR2 is shown in SEQ ID NO: 3 is shown in the specification; the sequence of LTR3 is shown in SEQ ID NO: 4 is shown in the specification; the sequence of CD4E is shown in SEQ ID NO: 5 is shown in the specification; the sequence of CRE is shown as SEQ ID NO: 6 is shown in the specification; the sequence of AP is shown as SEQ ID NO: 7 is shown in the specification; the sequence of SRE is shown in SEQ ID NO: 8 is shown in the specification;

each enhancer sequence in Table 1 was inserted into the 5' end of the promoter of pCD4-GFP (see FIG. 3), specifically following the insertion of the aforementioned CD 4-specific promoter fragment into the pCAG-GFP plasmidSimilarly, the method comprises the following steps: respectively taking 24ng of fragments to be inserted containing enhancer sequences, mixing the fragments with 24ng of linearized pCD4-GFP plasmid vectors to prepare a homologous recombination reaction system, and using ddH₂O, complementing 10 mu L, and mixing with the competent cells; incubating in 42 deg.C metal bath for 45-90s, taking out, immediately placing on ice for 2-3min, adding 800-. After completion of the recovery, the cells were centrifuged at 4500rpm for 2min, the majority of the supernatant was discarded, and the remaining 100. mu.L of resuspended cells were plated. And selecting a single colony, extracting recombinant plasmid, sequencing and identifying to obtain 7 ATL cell specific expression plasmids.

The reconstructed 7 plasmids were transfected into ATL cells MT-1 and the level of transgene expression was varied compared to pCD4-GFP in example 1 (see Table 2). Through three times of repeated experiments (n ═ 3), the gene expression levels of the plasmids obtained after inserting the enhancers CRE, AP, LTR1, LTR2, LTR3, CD4E and SRE are respectively increased by 2.4 ± 0.6, 3.6 ± 0.5, 10.2 ± 0.9, 15.3 ± 2.3, 16.3 ± 3.2, 9.5 ± 1.5 and 4.2 ± 1.1 times compared with the pCD4-GFP in example 1, which shows that the transgene expression levels of the plasmids after inserting the enhancers are averagely increased, wherein the transgene expression levels of the plasmids obtained after inserting the enhancers LTR1, LTR2, LTR3 and CD4E are respectively increased by 10.2 ± 0.9, 15.3 ± 2.3, 16.3 ± 3.2 and 9.5 ± 1.5 times, which are obviously higher than the transgene expression levels of the plasmids of the other three enhancers.

Table 2 fold increase in transgene expression following insertion of enhancer sequence (n ═ 3)

Example 3

In this example, gene editing mediated by an ATL cell-specific expression cassette was verified.

(1) Editing efficiency of SSA (single strand conformation amplification) report vector detection CRISPR (clustered regularly interspaced short palindromic repeats) system

In the SSA reporter gene detection system, the Luciferase gene cannot be normally expressed due to the insertion of an unrelated sequence. If an irrelevant sequence (target sequence) is subjected to specific knockout through a gRNA mediated CRISPR/Cas9 system, a complete Luciferase expression sequence can be formed, and then Luciferase activity is expressed (see figure 4). The editing efficiency of the CRISPR system can be evaluated by testing the expression level of luciferase.

The enhancer (SEQ ID NO: 2-5) and the promoter sequence (SEQ ID NO: 1) in the ATL cell specific expression frame are used for replacing the CMV promoter of the CRISPR/Cas9 expression plasmid, and 4 kinds of ATL cell specific CRISPR/Cas9 expression plasmids are obtained.

An SSA reporter gene vector (SSA-Luc) and an ATL cell specific CRISPR/Cas9 expression plasmid are co-transfected into ATL-T cells (ATL patient tumor cells), and a Renilla luciferase expression vector plasmid is used as a reference.

Taking five 1.5mLEP tubes containing 1mL OPTI-MEM culture medium, respectively adding 9 μ g of the 4 ATL cell specific plasmids and the reference plasmid into the EP tube, respectively adding 25 μ L Lipofectamine 3000, and reversing and mixing; standing at room temperature for 3min, uniformly dripping the mixed solution on the edge of an ATL-T cell culture dish, and uniformly shaking the culture dish to uniformly distribute the mixed solution in a culture medium.

ATL-T cells are collected after 48h of transfection, centrifuged at 1000rpm to remove supernatant, the cells are lysed, and Luciferase assay reagent is added to determine the expression level. The results (see table 3) show that the gene editing efficiency of the pATL01 plasmid is 62 ± 5%, the gene editing efficiency of the pATL02 plasmid is 67 ± 3%, the gene editing efficiency of the pATL03 plasmid is 56 ± 6%, and the gene editing efficiency of the pATL01 plasmid is 63 ± 3%, which indicates that 4 ATL cell-specific expression plasmids can effectively induce the SSA reporter gene detection system to express luciferase, and indicates that 4 ATL cells can express Cas9 and can effectively edit target sequences.

Table 3 gene editing efficiency of four ATL cell-specific expression plasmids (n ═ 3)

(2) Gene editing in ATL cells

In the HLTV-1 whole gene sequence, two end target sequences were selected and the corresponding gRNAs were designed (see Table 4).

TABLE 4 target sequences of gRNAs

The sequence of the selected target sequence gRNA-R1 is shown in SEQ ID NO: 9, the sequence of gRNA-R2 is shown in SEQ ID NO: shown at 10.

The gRNA-R1 and gRNA-R2 coding sequences were inserted into the corresponding positions of ATL cell-specific CRISPR/Cas9 expression plasmid pATL01 (promoter SEQ ID NO: 1, enhancer SEQ ID NO: 2), and ATL-T cells were transfected according to the same method as in example 3 (1).

The expression change of the HTLV-1 virus specific protein p19 is detected by an immunofluorescence method. The results (see fig. 5 and fig. 6) show that compared with the control cells (the introduced gRNA has no discrimination on the HTLV-1 genome, but stably expresses Cas9 intracellularly), the viral protein p19 expression of HTLV-1 of the cells of both gRNA-R1 and gRNA-R2 groups is obviously inhibited, and the number of p19 positive cells is obviously reduced, which indicates that the gene editing system can effectively inhibit the expression of the HTLV-1 viral gene and reduce the viral toxicity.

And detecting the proliferation activity of the CRISPR/Cas9 system on the ATL-T tumor cells by adopting an EdU staining method. The ATL cell-specific CRISPR/Cas9 expression plasmids used were pATL02 (promoter SEQ ID NO: 1, enhancer SEQ ID NO: 3) and pATL03 (promoter SEQ ID NO: 1, enhancer SEQ ID NO: 4). The results (see fig. 7 and fig. 8) show that the CRISPR/Cas9 expression plasmids constructed by two enhancers can effectively inhibit the proliferation of ATL-T by gene editing under the mediation of gRNAR 1.

Example 4

In this example, the cytotoxicity of the ATL cell-specific CRISPR/Cas9 gene editing system was examined.

Two HTLV-1 negative cell strains of Jurkat and Molt-4 are selected for carrying out cytotoxicity experiments to verify that the gRNA-mediated CRISPR/Cas9 system can effectively inhibit the proliferation of HTLV-1 virus in ATL cells and cannot influence the proliferation of normal cells (HTLV-1 negative cells).

Through Western blotting experiment, the expression of the ATL cell-specific CRISPR/Cas9 expression plasmid pATL01 (the promoter is SEQ ID NO: 1, and the enhancer is SEQ ID NO: 2) mediated Cas9 is detected, and the result (shown in figure 9) shows that the expression of Cas9 in an HTLV-1 negative cell strain is obviously lower than that of an HTLV-1 positive cell, which indicates that the ATL cell-specific CRISPR/Cas9 expression plasmid can realize targeted expression.

The Jurkat cell is transfected by an ATL cell-specific CRISPR/Cas9 expression plasmid pATL03 (the promoter is SEQ ID NO: 1, and the enhancer is SEQ ID NO: 4), and the Molt-4 cell is transfected by an ATL cell-specific CRISPR/Cas9 expression plasmid pATL04 (the promoter is SEQ ID NO: 1, and the enhancer is SEQ ID NO: 5). The results (see fig. 10) show that the CRISPR/Cas9 system does not affect the normal growth of Jurkat and Molt-4 cells, thereby excluding the toxicity of the system to HTLV-1 negative cells, indicating that the ATL cell-specific CRISPR/Cas9 expression plasmid has no effect on the growth and proliferation of HTLV-1 negative cells, and proving that the system has excellent targeted gene editing effect on HTLV-1 positive cells.

The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.

Sequence listing

<110> university of Chinese

<120> CRISPR/Cas-mediated ATL cell gene editing vector and application thereof

<160> 10

<170> SIPOSequenceListing 1.0

<210> 1

<211> 253

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

ctgattaagc ctgattctgc ttaacttttt cccttgactt tggcattttc actttgacat 60

gttccctgag agcctggggg gtggggaacc agctccagct ggtgacgttt ggggccggcc 120

caggcctagg gtgtggagga gccttgccat cgggcttcct gtctctcttc atttaagcac 180

gactctgcag taggcctgta cggaagtgtt acttctgctc taaaagctgc ggaattgtac 240

ccgcggccga tcc 253

<210> 2

<211> 33

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

cctcctaagg ctctgacgtc tcccccccac ctc 33

<210> 3

<211> 33

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

cctccttagg ccctgacgtg tccccttcac ctc 33

<210> 4

<211> 33

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

cctcctcagg cgttgacgac aacccctcac ctc 33

<210> 5

<211> 300

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

tgttggggtt caaatttgag ccccagctgt tagccctctg caaagaaaaa aaaaaaaaaa 60

aaagaacaaa gggcctagat ttcccttctg agccccaccc taagatgaag cctcttcttt 120

caagggagtg gggttggggt ggaggcggat cctgtcagct ttgctctctc tgtggctggc 180

agtttctcca aagggtaaca ggtgtcagct ggctgagcct aggctgaacc ctgagacatg 240

ctacctctgt cttctcatgg ctggaggcag cctttgtaag tcacagaaag tagctgaggg 300

<210> 6

<211> 28

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

agcttggtga cgcggatccg gtgacgca 28

<210> 7

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

agcttgctca ggatcctgac tca 23

<210> 8

<211> 28

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

agctaccata ttaggatcca tattaggt 28

<210> 9

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

gactcaaccg gcgtggatgg 20

<210> 10

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

agaacgcgac tcaaccggcg 20

Claims (5)

1. A CRISPR/Cas mediated ATL cell gene editing vector is characterized in that regulatory elements of the vector contain CD4 specific promoter and ATL specific enhancer sequences; the ATL specific enhancer sequence is SEQ ID NO: 2 to SEQ ID NO: 5.

2. The gene editing vector of claim 1, wherein the sequence of the CD 4-specific promoter is SEQ ID NO: 1.

3. the gene editing vector of any one of claims 1-2, wherein the gene editing vector targets a gene editing element to a T-lymphocyte leukemia type i virus positive cell, specifically expressing a Cas nuclease.

4. A transformant containing the gene editing vector according to any one of claims 1 to 3.

5. Use of a gene editing vector according to any one of claims 1 to 3 in the preparation of a medicament for the treatment of ATL.

Images