CN111748549B - Novel lysine decarboxylase mutants and uses thereof - Google Patents

Abstract

The invention discloses a novel lysine decarboxylase, the amino acid sequence of which is mutated from the sequence shown in SEQ ID NO. 1, and the mutation is carried out at one or more amino acid residue sites selected from the following group: 9 bits, 44 bits, 88 bits, 111 bits, 176 bits, and 230 bits. The activity of the lysine decarboxylase for catalyzing lysine to generate 1, 5-pentanediamine is obviously improved, so that the using amount of a catalyst can be reduced, and the production cost is finally reduced. The invention also provides an expression vector containing the coding sequence of the lysine decarboxylase, a host cell containing the lysine decarboxylase and an application and a production method of the lysine decarboxylase in producing 1, 5-pentanediamine.

Description

Novel lysine decarboxylase mutants and uses thereof

The application is a divisional application of an invention application with the application date of 2017, 5, 16 and the application number of 201710344705.9, and the invention name of the invention is 'novel lysine decarboxylase mutant and application thereof'.

Technical Field

The invention relates to the field of biotechnology. Specifically, the invention relates to high-activity lysine decarboxylase, an expression vector containing a lysine decarboxylase encoding gene, a genetically engineered bacterium capable of expressing the lysine decarboxylase, and applications of the lysine decarboxylase, the expression vector and the genetically engineered bacterium in production of 1, 5-pentanediamine.

Background

1, 5-Pentanediamine, also known as cadaverine, 1, 5-diaminopentane, Pentamethylene diamine and cadaverine toxin, are widely found in organismsThe nitrogenous base with biological activity is prepared by decarboxylation of lysine under the action of lysine decarboxylase (E.C.4.1.1.18), and the reaction is L-lysine + H ⁺ →CO ₂ +cadaverine。

1, 5-Pentanediamine has a wide variety of functions and uses. For example, in agriculture, 1, 5-pentanediamine can be used to regulate the senescence process of plants, promote the development of male and female stamens, improve the development of plant fruits, and increase the yield of fruits. In medicine, it can be used as a medicine for effectively treating dysentery, and is also an important medicine intermediate. Industrially, 1, 5-pentanediamine is an important chemical raw material; the 1, 5-pentanediamine and dibasic acid are polymerized to synthesize high-quality polymer material, namely novel nylon, and the biological manufacturing process of the 1, 5-pentanediamine which does not depend on petroleum raw materials may have subversive influence on the nylon industry.

Nylon 66 is produced by polymerizing hexamethylene diamine and adipic acid in a ratio of 1:1, and is one of two major varieties of nylon with nylon 6. Currently, hexanediamine or a synthetic precursor thereof, adiponitrile, is mainly imported domestically. The 1, 5-pentanediamine and the hexamethylene diamine are homologies, are very similar to the hexamethylene diamine in structure, can replace the hexamethylene diamine, and can be copolymerized with dibasic acid to synthesize nylon 5X (4, 6, 10, and the like) with practicability. The performance of the nylon 56 is comparable to that of the classical nylon 66, and the performance such as moisture absorption and drainage rate, air permeability, softness and the like is better, so that the nylon can be widely applied to fibers (clothes, tires, carpets and the like) and engineering plastics (electronic products, automobile parts and the like). Nylon 54, nylon 510 and other nylon products made of 1, 5-pentanediamine as a monomer have special material properties and potential application value.

Lysine decarboxylase catalyzes the decarboxylation of lysine to form 1, 5-pentanediamine, which is a key enzyme in the synthetic pathway of 1, 5-pentanediamine. Lysine decarboxylase is present in various microorganisms. At present, lysine decarboxylase genes have been cloned from bacteria such as Escherichia coli (E.coli), Hafnia alvei (Hafnia alvei), ruminant Oenomonas ruminants (Selenomonas ruminatum), Salmonella typhimurium (Salmonella typhimurium), and Edwardsiella ictaluri, respectively.

The latest studies have generally used CadA overexpressing E.coli to produce 1, 5-pentanediamine. U.S. Pat. No. 3,89543 to Oakomorphin, Japan, discloses the production of 1, 5-pentanediamine in a yield of 69g/L by adjusting pH with a dicarboxylic acid and converting lysine by a wild-type CadA enzyme that overexpresses E.coli in cells. Kjessah, Shanghai, in its patent CN102851307A, achieved the preparation of pentanediamine and downstream polymers by converting lysine by overexpression of the E.coli wild-type CadA enzyme in Hafnia alvei. The Japanese Ajinomoto EP3118312 discloses the CadA mutation sites Val3, Ala590 and Glu690 of Escherichia coli with improved heat stability. The US2015132808 patent of the japan mitsui chemical company protects a plurality of escherichia coli CadA mutants with increased activity, however, the activity of these CadA mutants is improved by less than 20%, and even the activity of most of the CadA mutants is improved by less than 10%, so the application value of these CadA mutants in actual production is very limited.

Lysine decarboxylase is used as a catalyst for catalyzing lysine to produce 1, 5-pentanediamine, the activity of the lysine decarboxylase is improved, the using amount of the catalyst can be reduced, or the reaction time can be shortened, so that the production cost is reduced, and the industrial production of the 1, 5-pentanediamine is greatly influenced, so that the improvement of the performance of the lysine decarboxylase is urgently needed in the field, and the industrial production of the 1, 5-pentanediamine is realized.

Disclosure of Invention

The invention aims to provide lysine decarboxylase with improved performance so as to realize the industrial production of 1, 5-pentanediamine.

In a first aspect, the present invention provides a lysine decarboxylase which is:

(a) the amino acid sequence is obtained by mutating the sequence shown in SEQ ID NO. 1, and the mutation is carried out at one or more amino acid residue positions selected from the following group: 9 bits, 44 bits, 88 bits, 111 bits, 176 bits, and 230 bits; wherein, the mutations at positions 9, 111, 176 and 230 can be selected from other 19 amino acids, the mutation at the amino acid residue at position 44 is Arg, and the mutation at the amino acid residue at position 88 is Ser;

or

(b) The lysine decarboxylase has 95 percent, preferably 98 percent and more preferably 99 percent of sequence identity with the amino acid sequence of (a) and has the function of the protein of (a), wherein, the amino acid residues corresponding to the 9 th, 44 th, 88 th, 111 th, 176 th and/or 230 th position of the amino acid sequence shown in SEQ ID NO. 1 are the same as those in the amino acid sequence of (a);

or

(c) The lysine decarboxylase is formed by adding or deleting 1-30, more preferably 1-10, still more preferably 1-6, most preferably 1-3 amino acid residues to or from the C-terminus and/or N-terminus of the amino acid sequence of (a), and has the function of the lysine decarboxylase of (a), wherein the amino acid residues corresponding to positions 9, 44, 88, 111, 176 and/or 230 of the amino acid sequence shown in SEQ ID NO:1 are the same as those in the amino acid sequence of (a).

In specific embodiments, the lysine decarboxylase amino acid sequence is mutated to the amino acid residues shown below at one or more positions selected from the group consisting of:

9 bits: arg, Lys, Gln, Asn;

44 bits: arg;

88 bits: ser;

111 bits: gly, Pro, Ala;

176 bits: val, Ile, Leu, Met, Phe, Ala;

230 bits: his, Asn, Gln, Lys, Arg

In specific embodiments, the amino acid sequence of the lysine decarboxylase has the amino acid residues shown below at one or more positions selected from the group consisting of:

9 bits: arg;

44 bits: arg;

88 bits: ser;

111 bits: gly;

176 bits: val;

230 bits: his.

In specific embodiments, the amino acid sequence of the lysine decarboxylase is Arg at position 9, or Arg at position 44, or Ser at position 88, or Gly at position 111, or Val at position 176, or His at position 230.

In a second aspect, the present invention provides an expression vector comprising a sequence encoding a lysine decarboxylase as described in the first aspect of the invention.

In a third aspect, the present invention provides a host cell comprising an expression vector according to the second aspect of the invention or having integrated into its genome the coding sequence for a lysine decarboxylase according to the first aspect of the invention.

In a preferred embodiment, the host cell is a bacterium; more preferably, the host cell is escherichia coli (e.coli), Corynebacterium glutamicum (Corynebacterium glutamicum), Hafnia alvei (Hafnia alvei), or Bacillus subtilis (Bacillus subtilis); most preferably, the host cell is e.

In a fourth aspect, the present invention provides a method for producing 1, 5-pentanediamine, the method comprising:

(1) producing 1, 5-pentanediamine using the lysine decarboxylase of the first aspect of the invention or the host cell of the third aspect of the invention; and

(2) separating 1, 5-pentanediamine from the system in the step (1).

In a fifth aspect, the present invention provides a method for producing 1, 5-pentanediamine, the method comprising:

1, 5-pentanediamine is produced by using a lysine decarboxylase which has an amino acid sequence having 95%, preferably 98%, more preferably 99% sequence identity to the amino acid sequence shown in SEQ ID No. 1, and which has the lysine decarboxylase function of the protein shown in SEQ ID No. 1, and which has one or more amino acid residue mutations at amino acid residues corresponding to positions 9, 44, 88, 111, 176 and/or 230 of the amino acid sequence shown in SEQ ID No. 1;

wherein the yield of 1, 5-pentanediamine produced by the lysine decarboxylase is more than 1.7 times of that produced by the lysine decarboxylase with the amino acid sequence shown as SEQ ID NO. 1.

In a sixth aspect, the present invention provides the use of a lysine decarboxylase as described in the first aspect of the invention or an expression vector as described in the second aspect of the invention or a host cell as described in the third aspect of the invention for the production of 1, 5-pentanediamine.

It is to be understood that within the scope of the present invention, the above-described features of the present invention and those specifically described below (e.g., in the examples) may be combined with each other to form new or preferred embodiments. Not to be reiterated herein, but to the extent of space.

Detailed Description

The inventor has conducted extensive and intensive research, and unexpectedly found that a lysine decarboxylase mutant with significantly improved activity can be obtained by mutating a specific site of a wild-type lysine decarboxylase, so that a material basis is provided for developing excellent lysine decarboxylase and further producing 1, 5-pentanediamine. The present invention has been completed based on this finding.

Lysine decarboxylase

Lysine decarboxylase is a key enzyme in the synthetic pathway catalyzing the decarboxylation of lysine to form 1, 5-pentanediamine. Lysine decarboxylase is present in a wide variety of microorganisms including, but not limited to, Escherichia coli (Escherichia coli), Hafnia alvei (Hafnia alvei), Bacillus alkannis (Bacillus halodurans), Bacillus cereus (Bacillus cereus), Bacillus cadaveris (Bacillus cadeveris), Burkholderia (Burkholderia viretnamensis), Chromobacterium violaceum (Chromobacterium violacea), Vibrio cholerae (Vibrio cholerae), Streptomyces trichotomicus (Streptomyces polosus), and the like. At present, lysine decarboxylase genes have been cloned from bacteria such as Escherichia coli, Hafnia alvei, Oenomonas ruminants (Selenomonas ruminatum), Salmonella typhimurium (Salmonella typhimurium), and Edwardsiella ictaluri, respectively.

Although lysine decarboxylases can be obtained from a variety of different microbial sources, the characteristics of the various lysine decarboxylases vary significantly. The activity of mutants obtained by mutating different sites of these lysine decarboxylases from different sources is also significantly different. For example, patent application (US2015132808) of the japan mitsui chemical company discloses a plurality of escherichia coli CadA mutants, however, the activity of these CadA mutants is improved to a degree of less than 20%, and even the activity of most of the CadA mutants is improved to a degree of less than 10%. Therefore, the application value of these CadA mutants in actual production is very limited.

It is known to the person skilled in the art that if an enzyme is mutated in order to obtain a mutant with improved activity, it is crucial to find a site where the activity can be improved after the mutation. In the invention, a lysine decarboxylase mutant with obviously improved activity is obtained by mutating a specific site of escherichia coli-derived wild-type lysine decarboxylase (CadA) with an amino acid sequence shown as SEQ ID NO. 1.

In a specific embodiment, the lysine decarboxylase mutant obtained by mutation of one or more of the following sites of the amino acid sequence shown in SEQ ID NO. 1 by the inventor can obviously improve the yield of 1, 5-pentanediamine: 9 bits, 44 bits, 88 bits, 111 bits, 176 bits, or/and 230 bits.

As used herein, the terms "lysine decarboxylase" or "lysine decarboxylase of the present invention" or "enzyme of the present invention" have the same meaning and are used interchangeably herein, and refer to lysine decarboxylase which is obtained by mutation at one or more of the above-mentioned sites starting from the wild-type lysine decarboxylase having the amino acid sequence shown in SEQ ID NO:1, and has the activity of catalyzing the production of 1, 5-pentanediamine from lysine and the yield of 1, 5-pentanediamine is significantly improved.

In view of the teachings of the present invention and the prior art, it will also be apparent to those skilled in the art that the "lysine decarboxylase of the present invention" shall also include variants thereof having the same or similar function as the "lysine decarboxylase of the present invention" but with a slight difference in amino acid sequence from that of the lysine decarboxylase in the examples of the present invention. These variants include (but are not limited to): deletion, insertion and/or substitution of one or more (usually 1 to 30, preferably 1 to 10, more preferably 1 to 6, still more preferably 1 to 3, most preferably 1) amino acids, and addition of one or more (usually up to 30, preferably up to 10, more preferably up to 6 or 3) amino acids at the C-terminus and/or N-terminus. For example, it is well known to those skilled in the art that substitutions with amino acids of similar or analogous properties, e.g., isoleucine and leucine, do not alter the function of the resulting protein. As another example, the addition of one or several amino acids at the C-terminus and/or N-terminus, such as a 6-His tag added for ease of isolation, will not generally alter the function of the resulting protein.

It will also be understood by those skilled in the art that the "variant forms of the lysine decarboxylase of the invention" described herein do not include reversion to the wild-type lysine decarboxylase through mutation; in other words, the variant forms of lysine decarboxylase of the present invention are obtained by further mutation based on the lysine decarboxylase obtained in the examples of the present invention, but the amino acid residues corresponding to the positions 9, 44, 88, 111, 176 and/or 230 of the amino acid sequence shown in SEQ ID NO. 1 are the same as those of the amino acid sequence of the lysine decarboxylase obtained in the examples of the present invention.

The term "corresponding to" as used herein has the meaning commonly understood by a person of ordinary skill in the art. Specifically, "corresponding to" refers to a position in a sequence corresponding to a specified position in the other sequence after aligning the two sequences by homology or sequence identity. Thus, if a 6-His tag is added to one end of the amino acid sequence of the lysine decarboxylase obtained in the examples of the present invention, the 176 th position corresponding to the amino acid sequence shown in SEQ ID NO. 1 in the resulting mutant may be 182 th position.

In a particular embodiment, the homology or sequence identity may be 95% or more, preferably 95% to 98%, most preferably 99% or more.

Methods for determining sequence homology or identity known to those of ordinary skill in the art include, but are not limited to: computer Molecular Biology (computerized Molecular Biology), Lesk, a.m. ed, oxford university press, new york, 1988; biological calculation: informatics and genomic items (Biocomputing: information and Genome Projects), Smith, D.W. eds, academic Press, New York, 1993; computer Analysis of Sequence Data (Computer Analysis of Sequence Data), first part, Griffin, a.m. and Griffin, h.g. eds, Humana Press, new jersey, 1994; sequence Analysis in Molecular Biology (Sequence Analysis in Molecular Biology), von Heinje, g., academic Press, 1987 and Sequence Analysis primers (Sequence Analysis Primer), Gribskov, m. and Devereux, j. eds M Stockton Press, New York, 1991 and Carllo, h. and Lipman, d.s., SIAM j.applied Math., 48:1073 (1988). The preferred method of determining identity is to obtain the greatest match between the sequences tested. Methods for determining identity are compiled in publicly available computer programs. Preferred computer program methods for determining identity between two sequences include, but are not limited to: the GCG program package (Devereux, J. et al, 1984), BLASTP, BLASTN, and FASTA (Altschul, S, F. et al, 1990). The BLASTX program is publicly available from NCBI and other sources (BLAST Manual, Altschul, S. et al, NCBI NLM NIH Bethesda, Md.20894; Altschul, S. et al, 1990). The well-known Smith Waterman algorithm can also be used to determine identity.

Variants of the polypeptides include: homologous sequences, conservative variants, allelic variants, natural mutants, induced mutants, proteins encoded by DNA that hybridizes under high or low stringency conditions with DNA encoding the lysine decarboxylase of the invention. The invention also includes other polypeptides, such as fusion proteins comprising a "lysine decarboxylase of the invention" or fragments thereof. In addition to almost full-length polypeptides, the invention also includes "lysine decarboxylase" active fragment. Typically, the fragment has at least about 20 contiguous amino acids, typically at least about 30 contiguous amino acids, preferably at least about 50 contiguous amino acids, more preferably at least about 80 contiguous amino acids, and most preferably at least about 100 contiguous amino acids of the amino acid sequence of the "lysine decarboxylase of the invention".

The invention also provides analogs of "lysine decarboxylase". These analogs may differ from the native "lysine decarboxylase of the invention" by amino acid sequence differences, by modifications that do not affect the sequence, or by both. These polypeptides include natural or induced genetic variants. Induced variants can be obtained by various techniques, such as random mutagenesis by irradiation or exposure to mutagens, site-directed mutagenesis, or other known molecular biological techniques. Analogs also include analogs having residues other than the natural L-amino acids (e.g., D-amino acids), as well as analogs having non-naturally occurring or synthetic amino acids (e.g., beta, gamma-amino acids). It is to be understood that the proteins of the present invention are not limited to the representative proteins exemplified above.

Modified (generally without altering primary structure) forms include: chemically derivatized forms of the polypeptide, such as acetylation or carboxylation, in vivo or in vitro. Modifications also include glycosylation. Modified forms also include sequences having phosphorylated amino acid residues (e.g., phosphotyrosine, phosphoserine, phosphothreonine). Also included are proteins that have been modified to increase their resistance to proteolysis or to optimize solubility.

In the present invention, a conservative variant polypeptide of "lysine decarboxylase" refers to a polypeptide in which at most 20, preferably at most 10, more preferably at most 5, and most preferably at most 3 amino acids are replaced by amino acids having similar or similar properties as compared to the amino acid sequence of lysine decarboxylase in the present embodiment, but the conservative variant polypeptide still has the same or similar activity as lysine decarboxylase in the present embodiment, i.e., the activity of catalyzing 1, 5-pentanediamine production from lysine, and the yield of 1, 5-pentanediamine is significantly improved.

Thus, in view of the teachings of the present invention and the prior art, one skilled in the art can generate conservatively variant mutants by making amino acid substitutions as shown, for example, in the following table.

Initial residue	Representative substituted residue	Preferred substituent residues
			Ala(A)	Val；Leu；Ile	Val
Arg(R)	Lys；Gln；Asn	Lys
			Asn(N)	Gln；His；Lys；Arg	Gln
Asp(D)	Glu	Glu
			Cys(C)	Ser	Ser
Gln(Q)	Asn	Asn
			Glu(E)	Asp	Asp
Gly(G)	Pro；Ala	Ala
			His(H)	Asn；Gln；Lys；Arg	Arg
Ile(I)	Leu；Val；Met；Ala；Phe	Leu
			Leu(L)	Ile；Val；Met；Ala；Phe	Ile
Lys(K)	Arg；Gln；Asn	Arg
			Met(M)	Leu；Phe；Ile	Leu
Phe(F)	Leu；Val；Ile；Ala；Tyr	Leu
			Pro(P)	Ala	Ala
Ser(S)	Thr	Thr
			Thr(T)	Ser	Ser
Trp(W)	Tyr；Phe	Tyr
			Tyr(Y)	Trp；Phe；Thr；Ser	Phe
Val(V)	Ile；Leu；Met；Phe；Ala	Leu

In view of this, in a specific embodiment, the amino acid sequence of the lysine decarboxylase of the present invention has the following amino acid residues at one or more positions selected from the group consisting of: 176 bits: val, Ile, Leu, Met, Phe, Ala; 111 bits: gly, Pro, Ala; 9 bits: arg, Lys, Gln, Asn; 230 bits: his, Asn, Gln, Lys, Arg; 44 bits: arg; 88 bits: and (6) Ser. In a preferred embodiment, the amino acid sequence of the lysine decarboxylase of the invention has the following amino acid residues at one or more positions selected from the group consisting of: 176 bits: val; 111 bits: gly; 9 bits: arg; and (5) 230 bits: his; 44 bits: arg; 88 bits: ser.

The protein of the present invention may be a recombinant protein, a natural protein, a synthetic protein, preferably a recombinant protein. The proteins of the invention may be naturally purified products, or chemically synthesized products, or produced using recombinant techniques from prokaryotic or eukaryotic hosts (e.g., bacteria, yeast, higher plant, insect, and mammalian cells). Depending on the host used in the recombinant production protocol, the protein of the invention may be glycosylated or may be non-glycosylated. The proteins of the invention may or may not also include an initial methionine residue.

It will be understood by those skilled in the art that the "lysine decarboxylase" of the present invention also includes fragments, derivatives and analogs of the "lysine decarboxylase". As used herein, the terms "fragment," "derivative," and "analog" refer to a polypeptide that retains substantially the same biological function or activity as the "lysine decarboxylase" of the present invention. A polypeptide fragment, derivative or analogue of the invention may be (i) a polypeptide in which one or more conserved or non-conserved amino acid residues, preferably conserved amino acid residues, are substituted, and such substituted amino acid residues may or may not be encoded by the genetic code, or (ii) a polypeptide having a substituent group in one or more amino acid residues, or (iii) a polypeptide in which the mature polypeptide is fused to another compound, such as a compound that extends the half-life of the polypeptide, e.g. polyethylene glycol, or (iv) a polypeptide in which an additional amino acid sequence is fused to the sequence of the polypeptide (such as a leader or secretory sequence or a sequence used to purify the polypeptide or a proprotein sequence, or a fusion protein). Such fragments, derivatives and analogs are within the purview of those skilled in the art in view of the definitions herein.

In view of the prior art in this field and the teaching of the present invention, the active fragment of the lysine decarboxylase of the present invention can be obtained easily by those skilled in the art. For example, a biologically active fragment of "lysine decarboxylase" is defined herein as a fragment of "lysine decarboxylase" that still retains all or part of the function of the full-length "lysine decarboxylase". Typically, the biologically active fragment retains at least 50% of the activity of the full-length "lysine decarboxylase". Under more preferred conditions, the active fragment is capable of retaining 60%, 70%, 80%, 90%, 95%, 99%, or 100% of the activity of the full-length "lysine decarboxylase".

Based on the teaching of the present invention and the prior art, those skilled in the art can also understand that the lysine decarboxylase of the present invention can be prepared into other utilization forms such as immobilized enzyme.

The invention also provides polynucleotide sequences encoding the "lysine decarboxylase" of the invention or degenerate variants thereof, based on the lysine decarboxylase of the invention. The polynucleotide of the present invention may be in the form of DNA or RNA. The form of DNA includes cDNA, genomic DNA or artificially synthesized DNA. The DNA may be single-stranded or double-stranded. The DNA may be the coding strand or the non-coding strand. The sequence of the coding region encoding the mature polypeptide may be identical to the nucleotide sequence encoding lysine decarboxylase in the present embodiments or degenerate variants. As used herein, "degenerate variant" refers to a nucleic acid sequence encoding a lysine decarboxylase in the claims of the present invention, but differing from the nucleotide sequence encoding the lysine decarboxylase in the examples of the present invention.

In the present invention, the polynucleotide sequence encoding "lysine decarboxylase" may be inserted into a recombinant expression vector or genome. The term "recombinant expression vector" refers to a bacterial plasmid, bacteriophage, yeast plasmid, plant cell virus, mammalian cell virus, or other vector well known in the art. In general, any plasmid or vector can be used as long as it can replicate and is stable in the host. An important feature of expression vectors is that they generally contain an origin of replication, a promoter, a marker gene and translation control elements.

The skilled person can use well-known methods to construct expression vectors containing DNA sequences encoding "lysine decarboxylase" and appropriate transcription/translation control signals, including in vitro recombinant DNA techniques, DNA synthesis techniques, in vivo recombinant techniques, etc. The DNA sequence may be operably linked to a suitable promoter in an expression vector to direct mRNA synthesis. The expression vector also includes a ribosome binding site for translation initiation and a transcription terminator.

Furthermore, the expression vector preferably comprises one or more selectable marker genes to provide a phenotypic trait for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance and Green Fluorescent Protein (GFP) for eukaryotic cell culture, or kanamycin or ampicillin resistance for E.coli.

Vectors comprising the appropriate DNA sequences described above, together with appropriate promoter or control sequences, may be used to transform appropriate host cells to enable expression of the protein.

The host cells described herein include host cells comprising the above-described expression vectors or having integrated into their genome the coding sequence for the "lysine decarboxylase" of the present invention. The host cell or strain of the invention can efficiently express the novel lysine decarboxylase with high catalytic performance, thereby improving the level of producing the 1, 5-pentanediamine.

The host cell of the invention may be a prokaryotic cell, such as a bacterial cell; or lower eukaryotic cells, such as yeast cells. In particular embodiments, the strains include, but are not limited to: coli (e.coli), Corynebacterium glutamicum (Corynebacterium glutamicum), Hafnia alvei (Hafnia alvei), Bacillus subtilis (Bacillus subtilis). In a preferred embodiment, the strain is escherichia coli (e.coli).

Transformation of a host cell with recombinant DNA can be carried out using conventional techniques well known to those skilled in the art. When the host is prokaryotic, e.g., E.coli, competent cells capable of DNA uptake can be harvested after exponential growth phase using CaCl ₂ Methods, the steps used are well known in the art. Another method is to use MgCl ₂ . If desired, transformation can also be carried out by electroporation. When the host is a eukaryote, the following DNA transfection methods may be used: calcium phosphate coprecipitation, conventional mechanical methods such as microinjection, electroporation, liposome encapsulation, etc.

The obtained transformant can be cultured by a conventional method to express the polypeptide encoded by the gene of the present invention. The medium used in the culture may be selected from various conventional media depending on the host cell used. The culturing is performed under conditions suitable for the growth of the host cell. The recombinant polypeptide in the above method may be constitutively expressed or conditionally expressed, for example, when the host cell is grown to an appropriate cell density, the selected promoter is induced by an appropriate method (e.g., temperature shift or chemical induction), and the cells are cultured for an additional period of time.

The recombinant polypeptide in the above method may be expressed intracellularly or on the cell membrane, or secreted extracellularly. If necessary, the physical, chemical and other properties of the recombinant protein can be utilized for isolation and purification of the recombinant protein by various separation methods. These methods are well known to those skilled in the art. Examples of such methods include, but are not limited to: conventional renaturation treatment, treatment with a protein precipitant (such as salt precipitation), centrifugation, cell lysis by osmosis, sonication, high-pressure homogenization, ultracentrifugation, molecular sieve chromatography (such as gel filtration), adsorption chromatography, ion exchange chromatography, affinity chromatography, High Performance Liquid Chromatography (HPLC), and other various liquid chromatography techniques, and a combination thereof.

In view of the teachings of the present invention and the prior art, one of ordinary skill in the art will appreciate that the lysine decarboxylase of the present invention, and the coding sequences, expression vectors, and host cells thereof, can be used to catalyze the decarboxylation of lysine to produce 1, 5-pentanediamine.

On the basis, the invention also provides a method for catalyzing the decarboxylation of lysine to generate 1, 5-pentanediamine by using the lysine decarboxylase, the expression vector or the host cell. For example, in particular embodiments, 1, 5-pentanediamine can be produced by culturing a host cell comprising an expression vector of the invention or a host cell having integrated on its genome a coding sequence for a lysine decarboxylase of the invention, or catalyzing lysine production with a lysine decarboxylase of the invention; the resulting 1, 5-pentanediamine is then obtained from the catalytic system.

The lysine used for catalyzing the production of the 1, 5-pentanediamine can be produced by a host cell or added from outside.

The invention has the advantages that:

1. compared with lysine decarboxylase in the prior art, the lysine decarboxylase provided by the invention has the advantages that the activity of catalyzing lysine to generate 1, 5-pentanediamine is obviously improved, and the production intensity of the same catalyst is 1.7 times higher than that of wild-type lysine decarboxylase when catalyzing lysine to generate 1, 5-pentanediamine;

2. the lysine decarboxylase is used for industrial catalysis, so that the using amount of a catalyst can be effectively reduced or the catalytic reaction time can be shortened, the catalyst cost is reduced, the investment of fixed assets and the operation cost are reduced, or the productivity is improved, and the lysine decarboxylase has the cost advantage; and

3. the invention provides a new idea for further optimizing lysine decarboxylase, improving the stability of the lysine decarboxylase and promoting the industrialization of 1, 5-pentanediamine by a biological method.

The invention will be further illustrated with reference to the following specific examples. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention. Experimental procedures without specific conditions noted in the following examples, generally following conventional conditions such as Sambrook et al, molecular cloning: the conditions described in the Laboratory Manual (New York: Cold Spring Harbor Laboratory Press,1989), or according to the manufacturer's recommendations.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, the methods and materials described herein are preferred.

Example 1 construction of wild type strains of CadA

E.coli MG1655 (obtained from ATCC 700926, see Blattner FR et al, The complete genome sequence of Escherichia coli K-12.Science 277:1453-62(1997)) was cultured in LB medium (tryptone 10g/L, yeast powder 5g/L, sodium chloride 10g/L, pH 7.0) at 37 ℃ and 200rpm for 12-16h, after which cells were collected and genomic DNA was extracted using The Biomiga genome miniprep. Using Escherichia coli genome as template, cadA-F (shown as SEQ ID NO: 3) and cadA-R (shown as SEQ ID NO: 4) as primers, cadA gene (shown as SEQ ID NO: 2) was amplified, cloned into pET-21a (+) (purchased from NOVAGEN) through 5 'NdeI and 3' XhoI, pET21-cadA expression plasmid was obtained, and transformed into E.coli BL21(DE3), and E.coli BL21(DE3)/pET21-cadA wild-type engineering strain was obtained.

Example 2 acquisition of CadA mutant strains

Using Stratagene series

XL-II site-directed mutagenesis kit is characterized in that 6 pairs of primers (shown in Table 1) are respectively designed, constructed pET21-cadA wild-type plasmids are used as templates, 6 pairs of primers are respectively adopted for PCR amplification, histidine at the 9 th amino acid of cadA is mutated into arginine, lysine at the 44 th amino acid is mutated into arginine, threonine at the 88 th amino acid is mutated into serine, glutamic acid at the 111 th amino acid is mutated into glycine, methionine at the 176 th amino acid is mutated into valine, tyrosine at the 230 th amino acid is mutated into histidine, and plasmids of the obtained expression mutants are respectively named as pET21-H9R, pET21-K44R, pET21-T88S, pET21-E111G, pET21-M176V and pET 21-Y230H. The PCR reaction conditions are as follows: 5min at 95 ℃ for 25 cycles (30 s at 95 ℃, 30s at 50 ℃, 9mi at 68 ℃)n), 68 ℃ for 10 min. PCR amplification System (50. mu.L): mu.L of template, 2. mu.L of each of the upstream and downstream primers, 1. mu.L of dNTP mix, 5. mu.L of 10 XPyrobest Buffer, 38.5. mu.L of sterilized double distilled water, and 0.5. mu.L of Pyrobest DNA polymerase. The PCR product was purified and recovered using a gel recovery kit (purchased from Beijing Quanjin Biotechnology Ltd.). Transformants were sequenced by Kingonly corporation and plasmids with correct sequence were transformed into E.coli BL21(DE3) to obtain engineered strains of CadA mutants E.coli BL21(DE3)/pET21-H9R, E.coli BL21(DE3)/pET21-K44R, E.coli BL21(DE3)/pET21-T88S, E.coli BL21(DE3)/pET21-E111G, E.coli BL21(DE3)/pET21-M176V and E.coli BL21(DE3)/pET21-Y230H, respectively.

TABLE 1 primer sequences

Primer name	Sequence numbering	Primer sequence (5 '-3')
			H9R-F	SEQ ID NO:5	GCAATATTGAATCGCATGGGGGTTTATTTT
H9R-R	SEQ ID NO:6	AAAATAAACCCCCATGCGATTCAATATTGC
			K44R-F	SEQ ID NO:7	CGACCGTGACGACTTATTAAGACTGATCGAAAACAATGC
K44R-R	SEQ ID NO:8	GCATTGTTTTCGATCAGTCTTAATAAGTCGTCACGGTCG
			T88S-F	SEQ ID NO:9	CGTATTCCTCTCTCGATGTAAGCCTGAATG
T88S-R	SEQ ID NO:10	CATCGAGAGAGGAATACGTATTAGCGAACGC
			E111G-F	SEQ ID NO:11	GCGCTGGGTGCTGCTGGAGATATTGCTAATAAGATC
E111G-R	SEQ ID NO:12	GATCTTATTAGCAATATCTCCAGCAGCACCCAGCGC
			M176V-F	SEQ ID NO:13	GATTTCTTTGGTCCGAATACCGTGAAATCTGATATTTC
M176V-R	SEQ ID NO:14	GAAATATCAGATTTCACGGTATTCGGACCAAAGAAATC
			Y230H-F	SEQ ID NO:15	CTGCGAACAAAATTGTTGGTATGCACTCTGCTCCAGC
Y230H-R	SEQ ID NO:16	GCTGGAGCAGAGTGCATACCAACAATTTTGTTCGCAG
			cadA-R2	SEQ ID NO:17	TTACGCCAAGCTTTTTTTTGCTTTCTTCTTTCAATACC

Example 3 Pentanediamine production by CadA wild-type and mutant engineered strains

Culturing the engineering strain and expressing lysine decarboxylase: inoculating a proper amount of plate-activated lawn of each engineering bacterium into a 500ml seed bottle filled with 100ml of liquid LB culture medium (peptone 1%, yeast powder 0.5%, sodium chloride 1%, pH 7.0), adding 0.1g/L ampicillin, and performing shaking culture at 37 ℃ and 220rpm for 12 hours; adding 0.1g/L ampicillin into a 5L fermentation tank containing 2L thallus fermentation medium (glucose 30g/L, yeast powder 5g/L, ammonium chloride 8g/L, potassium dihydrogen phosphate 5g/L, magnesium sulfate heptahydrate 0.5g/L, and ferrous sulfate heptahydrate 0.2g/L) with fermentation temperature of 37 deg.C, stirring speed of 300-900 rpm, air flow of 1-4vvm, pH of 7.0 controlled by ammonia water solution during fermentation, glucose fed-in amount of about 10g/L, and OD of about 10g/L ₆₀₀ When the growth reaches 30, 0.1mM IPTG is supplemented to induce and express lysine decarboxylase for 3 h.

And (3) producing pentamethylene diamine: whole cell catalysis was carried out in a 5L fermentor, the substrate lysine hydrochloride concentration was about 450g/L, the coenzyme pyridoxal phosphate was 0.1mM, the amount of the engineering bacteria was about 3g/L of the dry cell weight, the stirring speed was controlled at 500rpm, the reaction temperature was 52 ℃, and the yield of pentanediamine in the solution, the content of residual lysine and the maximum lysine conversion rate after 4 hours of conversion were as shown in Table 2. Compared with wild type CadA, the yield of the H9R mutant is 2.80 times that of the wild type, and the maximum lysine conversion rate per dry weight of thallus is 2.90 times that of the wild type; the yield of the K44R mutant is 3.04 times of that of the wild type, and the maximum lysine conversion rate per dry weight of the thallus is 3.74 times of that of the wild type; the yield of the T88S mutant is 2.27 times of that of the wild type, and the maximum lysine conversion rate per dry weight of the thallus is 1.99 times of that of the wild type; the yield of the M176V mutant is 2.89 times of that of the wild type, and the maximum lysine conversion rate per dry weight of the bacterial cells is 3.86 times of that of the wild type; the yield of the Y230H mutant is 2.54 times of that of the wild type, and the maximum lysine conversion rate per dry cell weight is 2.43 times of that of the wild type; the yield of the E111G mutant was 2.85 times that of the wild type, and the maximum lysine conversion rate per dry cell weight was 3.20 times that of the wild type. Meanwhile, the lysine residue of all mutants is obviously reduced.

TABLE 2 Pentanediamine yield and residual lysine content

Discussion:

the invention mutates the specific site of the wild lysine decarboxylase, the activity of the obtained lysine decarboxylase mutant is obviously improved, and the yield of the 1, 5-pentanediamine produced by the mutant is more than 2.2 times or even nearly three times that of the wild lysine decarboxylase.

Although some wild-type lysine decarboxylase mutants are disclosed in the prior art, for example, US2015132808 patent application discloses mutation of threonine (T) at position 88 to ARG, LYS and ASN. However, the yield of 1, 5-pentanediamine produced by lysine decarboxylase disclosed in the document is only improved by less than 20% compared with the wild-type lysine decarboxylase, and even most mutants are improved by less than 10% for producing 1, 5-pentanediamine. In addition, ARG, LYS and ASN are all basic amino acids, and do not belong to the same amino acids with threonine in wild type lysine decarboxylase, but the mutant of the invention carries out substitution of the same amino acids at position 88, namely threonine and serine are amino acids with side chains with hydroxyl, but the substitution of the same amino acids produces unexpected remarkable technical effect, the yield is 2.27 times of that of the wild type, and the maximum lysine conversion rate is 1.99 times of that of the wild type. In korean patent KR20170017341(a), it was reported that double mutations of F14C and K44C resulted in formation of a disulfide bond, failing to improve enzyme activity; however, on the basis of L7M/N8G double mutants capable of improving the activity by 24.4%, the activity of a combined mutant of L7M/N8G/F14C/K44C formed by simultaneously mutating F14C and K44C can be improved by 56.7%, namely K44C has to be combined with three mutants of L7M/N8G/F14C to have the effect. The yield of the K44R single-site mutation is 3.04 times of that of the wild type, and the maximum lysine conversion rate per dry weight of thallus is 3.74 times of that of the wild type, so that the unexpected technical effect is produced.

EXAMPLE 4 production of Pentanediamine by expression of an engineered Strain carrying His-tagged lysine decarboxylase

Using the same method as in example 1, using the E.coli genome as a template and cadA-F (shown in SEQ ID NO: 3) and cadA-R2 (shown in SEQ ID NO: 17) as primers, the cadA gene from which the TAA stop codon was removed was amplified, cloned into the vector pET-21a (+) (available from NOVAGEN) via 5 'NdeI and 3' XhoI, to obtain a pET21-cadAHis expression plasmid, which expressed cadA was tagged at the C-terminus with 6His, and then transformed into E.coli BL21(DE3) to obtain E.coli BL21(DE3)/pET21-cadAHis wild-type engineering strain. Then, by using the same method and primers as in example 2, using pET21-cadAHis plasmids as templates, respectively constructing M176V and Y230H mutant plasmids, respectively named pET21-M176VHis and pET21-Y230HHis expression plasmids, sequencing the plasmids by Jinzhi corporation, transforming the plasmids with correct sequences into E.coli BL21(DE3), respectively obtaining engineering strains E.coli BL21(DE3)/pET21-M176His and E.coli BL21(DE3)/pET21-Y230HHis of the cadA mutant.

The engineering strains E.coli BL21(DE3)/pET 21-cadHis, E.coli BL21(DE3)/pET21-M176VHis and E.coli BL21(DE3)/pET21-Y230HHis express enzymes through shaking flasks and catalyze and evaluate the performance of the engineering strains. The bacterial culture and enzyme expression of the engineering strain are as follows: inoculating 5 μ L of glycerol bacterial solution of each engineering bacterium into a 25ml black-capped bottle containing 5ml of liquid LB culture medium (peptone 1%, yeast powder 0.5%, sodium chloride 1%, pH 7.0), adding 0.1g/L ampicillin, and performing shake culture at 37 deg.C and 220rpm for 12 hr; 2% to a 250mL shake flask containing 30mL of a liquid LB medium (peptone 1%, yeast powder 0.5%, sodium chloride 1%, pH 7.0), 0.1g/L ampicillin was addedThe fermentation temperature of the mycin is 37 ℃, the stirring speed is 220rpm, and the OD is ₆₀₀ When the growth reaches 0.6, 0.1mM IPTG is supplemented to induce expression for 4 h. The production conditions of pentamethylene diamine are as follows: the whole-cell catalysis is carried out in a 250ml shake flask, the concentration of substrate lysine hydrochloride is about 25g/L, the concentration of coenzyme pyridoxal phosphate is 0.1mM, the dosage of engineering bacteria is about 0.2g/L of cell dry weight, the stirring speed is controlled to be 220rpm, the reaction temperature is 37 ℃, and after 4 hours of conversion, the yield of the pentanediamine in the solution and the content of the residual lysine are shown in Table 3. Compared with wild type CatA with His label, the yield of M176V mutant with His label is 2.67 times of that of wild type, the yield of Y230H mutant with His label is 2.00 times of that of wild type, and the lysine residue of the mutant with His label is obviously reduced.

TABLE 3 Pentanediamine yield and residual lysine content

The results show that the mutant can still keep the performance of improving the activity by carrying out partial sequence modification on the basis of the mutant for improving the activity of the lysine decarboxylase CadA.

Example 5 combinatorial mutation of lysine decarboxylase CadA and its pentanediamine production

The same method and primers as in example 2 were used to construct double and triple mutants one by one on the basis of single mutant. M176V/T88S and M176V/Y230H double-mutation expression plasmids are respectively constructed on the basis of the M176V mutant and are named as pET21-M176V/T88S and pET 21-M176V/Y230H. M176V/Y230H/H9R, M176V/Y230H/E111G and M176V/Y230H/K44R three mutants are respectively constructed on the basis of the M176V/Y230H mutant and are named as pET21-M176V/Y230H/H9R, pET21-M176V/Y230H/E111G and pET21-M176V/Y230H/K44R expression plasmids. The above plasmids were sequenced by Kingonly corporation, and plasmids with correct sequences were transformed into E.coli BL21(DE3) to obtain engineered strains of CadA mutant E.coli BL21(DE3)/pET21-M176V/T88S, E.coli BL21(DE3)/pET21-M176V/Y230H, E.coli BL21(DE3)/pET21-M176V/Y230H/H9R, E.coli BL21(DE3)/pET21-M176V/Y230H/E111G, and E.coli BL21(DE3)/pET 21-M176V/Y230H/K44R. All the engineering bacteria and wild type contrast adopt the same shake flask expression enzyme and catalysis embodiment of example 4 to evaluate the performance of the engineering bacteria, and the yield of the pentanediamine and the content of the residual lysine in the final solution are shown in table 4. Compared with wild type CadA, the yield of the M176V/T88S mutant is 2.3 times that of the wild type, the yield of the M176V/Y230H mutant is 1.7 times that of the wild type, the yield of the M176V/Y230H/H9R mutant is 2.3 times that of the wild type, the yield of the M176V/Y230H/E111G mutant is 2.7 times that of the wild type, the yield of the M176V/Y230H/K44R mutant is 3.3 times that of the wild type, and the lysine residue of the mutant is obviously reduced.

TABLE 4 Pentanediamine yield and residual lysine content

The above results indicate that the combined mutant obtained by combining and mutating the lysine decarboxylase CadA activity-increasing mutant can maintain the activity-increasing performance 1.7 times or more higher than that of the wild type.

All documents mentioned in this application are incorporated by reference in this application as if each were individually incorporated by reference. Furthermore, it should be understood that various changes and modifications of the present invention can be made by those skilled in the art after reading the above teachings of the present invention, and these equivalents also fall within the scope of the present invention as defined by the appended claims.

Sequence listing

<110> institute of biotechnology for Tianjin industry of Chinese academy of sciences

<120> novel lysine decarboxylase mutant and use thereof

<130> P2020-1412

<160> 17

<170> SIPOSequenceListing 1.0

<210> 1

<211> 715

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 1

Met Asn Val Ile Ala Ile Leu Asn His Met Gly Val Tyr Phe Lys Glu

1 5 10 15

Glu Pro Ile Arg Glu Leu His Arg Ala Leu Glu Arg Leu Asn Phe Gln

20 25 30

Ile Val Tyr Pro Asn Asp Arg Asp Asp Leu Leu Lys Leu Ile Glu Asn

35 40 45

Asn Ala Arg Leu Cys Gly Val Ile Phe Asp Trp Asp Lys Tyr Asn Leu

50 55 60

Glu Leu Cys Glu Glu Ile Ser Lys Met Asn Glu Asn Leu Pro Leu Tyr

65 70 75 80

Ala Phe Ala Asn Thr Tyr Ser Thr Leu Asp Val Ser Leu Asn Asp Leu

85 90 95

Arg Leu Gln Ile Ser Phe Phe Glu Tyr Ala Leu Gly Ala Ala Glu Asp

100 105 110

Ile Ala Asn Lys Ile Lys Gln Thr Thr Asp Glu Tyr Ile Asn Thr Ile

115 120 125

Leu Pro Pro Leu Thr Lys Ala Leu Phe Lys Tyr Val Arg Glu Gly Lys

130 135 140

Tyr Thr Phe Cys Thr Pro Gly His Met Gly Gly Thr Ala Phe Gln Lys

145 150 155 160

Ser Pro Val Gly Ser Leu Phe Tyr Asp Phe Phe Gly Pro Asn Thr Met

165 170 175

Lys Ser Asp Ile Ser Ile Ser Val Ser Glu Leu Gly Ser Leu Leu Asp

180 185 190

His Ser Gly Pro His Lys Glu Ala Glu Gln Tyr Ile Ala Arg Val Phe

195 200 205

Asn Ala Asp Arg Ser Tyr Met Val Thr Asn Gly Thr Ser Thr Ala Asn

210 215 220

Lys Ile Val Gly Met Tyr Ser Ala Pro Ala Gly Ser Thr Ile Leu Ile

225 230 235 240

Asp Arg Asn Cys His Lys Ser Leu Thr His Leu Met Met Met Ser Asp

245 250 255

Val Thr Pro Ile Tyr Phe Arg Pro Thr Arg Asn Ala Tyr Gly Ile Leu

260 265 270

Gly Gly Ile Pro Gln Ser Glu Phe Gln His Ala Thr Ile Ala Lys Arg

275 280 285

Val Lys Glu Thr Pro Asn Ala Thr Trp Pro Val His Ala Val Ile Thr

290 295 300

Asn Ser Thr Tyr Asp Gly Leu Leu Tyr Asn Thr Asp Phe Ile Lys Lys

305 310 315 320

Thr Leu Asp Val Lys Ser Ile His Phe Asp Ser Ala Trp Val Pro Tyr

325 330 335

Thr Asn Phe Ser Pro Ile Tyr Glu Gly Lys Cys Gly Met Ser Gly Gly

340 345 350

Arg Val Glu Gly Lys Val Ile Tyr Glu Thr Gln Ser Thr His Lys Leu

355 360 365

Leu Ala Ala Phe Ser Gln Ala Ser Met Ile His Val Lys Gly Asp Val

370 375 380

Asn Glu Glu Thr Phe Asn Glu Ala Tyr Met Met His Thr Thr Thr Ser

385 390 395 400

Pro His Tyr Gly Ile Val Ala Ser Thr Glu Thr Ala Ala Ala Met Met

405 410 415

Lys Gly Asn Ala Gly Lys Arg Leu Ile Asn Gly Ser Ile Glu Arg Ala

420 425 430

Ile Lys Phe Arg Lys Glu Ile Lys Arg Leu Arg Thr Glu Ser Asp Gly

435 440 445

Trp Phe Phe Asp Val Trp Gln Pro Asp His Ile Asp Thr Thr Glu Cys

450 455 460

Trp Pro Leu Arg Ser Asp Ser Thr Trp His Gly Phe Lys Asn Ile Asp

465 470 475 480

Asn Glu His Met Tyr Leu Asp Pro Ile Lys Val Thr Leu Leu Thr Pro

485 490 495

Gly Met Glu Lys Asp Gly Thr Met Ser Asp Phe Gly Ile Pro Ala Ser

500 505 510

Ile Val Ala Lys Tyr Leu Asp Glu His Gly Ile Val Val Glu Lys Thr

515 520 525

Gly Pro Tyr Asn Leu Leu Phe Leu Phe Ser Ile Gly Ile Asp Lys Thr

530 535 540

Lys Ala Leu Ser Leu Leu Arg Ala Leu Thr Asp Phe Lys Arg Ala Phe

545 550 555 560

Asp Leu Asn Leu Arg Val Lys Asn Met Leu Pro Ser Leu Tyr Arg Glu

565 570 575

Asp Pro Glu Phe Tyr Glu Asn Met Arg Ile Gln Glu Leu Ala Gln Asn

580 585 590

Ile His Lys Leu Ile Val His His Asn Leu Pro Asp Leu Met Tyr Arg

595 600 605

Ala Phe Glu Val Leu Pro Thr Met Val Met Thr Pro Tyr Ala Ala Phe

610 615 620

Gln Lys Glu Leu His Gly Met Thr Glu Glu Val Tyr Leu Asp Glu Met

625 630 635 640

Val Gly Arg Ile Asn Ala Asn Met Ile Leu Pro Tyr Pro Pro Gly Val

645 650 655

Pro Leu Val Met Pro Gly Glu Met Ile Thr Glu Glu Ser Arg Pro Val

660 665 670

Leu Glu Phe Leu Gln Met Leu Cys Glu Ile Gly Ala His Tyr Pro Gly

675 680 685

Phe Glu Thr Asp Ile His Gly Ala Tyr Arg Gln Ala Asp Gly Arg Tyr

690 695 700

Thr Val Lys Val Leu Lys Glu Glu Ser Lys Lys

705 710 715

<210> 2

<211> 2148

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

atgaacgtta ttgcaatatt gaatcacatg ggggtttatt ttaaagaaga acccatccgt 60

gaacttcatc gcgcgcttga acgtctgaac ttccagattg tttacccgaa cgaccgtgac 120

gacttattaa aactgatcga aaacaatgcg cgtctgtgcg gcgttatttt tgactgggat 180

aaatataatc tcgagctgtg cgaagaaatt agcaaaatga acgagaacct gccgttgtac 240

gcgttcgcta atacgtattc cactctcgat gtaagcctga atgacctgcg tttacagatt 300

agcttctttg aatatgcgct gggtgctgct gaagatattg ctaataagat caagcagacc 360

actgacgaat atatcaacac tattctgcct ccgctgacta aagcactgtt taaatatgtt 420

cgtgaaggta aatatacttt ctgtactcct ggtcacatgg gcggtactgc attccagaaa 480

agcccggtag gtagcctgtt ctatgatttc tttggtccga ataccatgaa atctgatatt 540

tccatttcag tatctgaact gggttctctg ctggatcaca gtggtccaca caaagaagca 600

gaacagtata tcgctcgcgt ctttaacgca gaccgcagct acatggtgac caacggtact 660

tccactgcga acaaaattgt tggtatgtac tctgctccag caggcagcac cattctgatt 720

gaccgtaact gccacaaatc gctgacccac ctgatgatga tgagcgatgt tacgccaatc 780

tatttccgcc cgacccgtaa cgcttacggt attcttggtg gtatcccaca gagtgaattc 840

cagcacgcta ccattgctaa gcgcgtgaaa gaaacaccaa acgcaacctg gccggtacat 900

gctgtaatta ccaactctac ctatgatggt ctgctgtaca acaccgactt catcaagaaa 960

acactggatg tgaaatccat ccactttgac tccgcgtggg tgccttacac caacttctca 1020

ccgatttacg aaggtaaatg cggtatgagc ggtggccgtg tagaagggaa agtgatttac 1080

gaaacccagt ccactcacaa actgctggcg gcgttctctc aggcttccat gatccacgtt 1140

aaaggtgacg taaacgaaga aacctttaac gaagcctaca tgatgcacac caccacttct 1200

ccgcactacg gtatcgtggc gtccactgaa accgctgcgg cgatgatgaa aggcaatgca 1260

ggtaagcgtc tgatcaacgg ttctattgaa cgtgcgatca aattccgtaa agagatcaaa 1320

cgtctgagaa cggaatctga tggctggttc tttgatgtat ggcagccgga tcatatcgat 1380

acgactgaat gctggccgct gcgttctgac agcacctggc acggcttcaa aaacatcgat 1440

aacgagcaca tgtatcttga cccgatcaaa gtcaccctgc tgactccggg gatggaaaaa 1500

gacggcacca tgagcgactt tggtattccg gccagcatcg tggcgaaata cctcgacgaa 1560

catggcatcg ttgttgagaa aaccggtccg tataacctgc tgttcctgtt cagcatcggt 1620

atcgataaga ccaaagcact gagcctgctg cgtgctctga ctgactttaa acgtgcgttc 1680

gacctgaacc tgcgtgtgaa aaacatgctg ccgtctctgt atcgtgaaga tcctgaattc 1740

tatgaaaaca tgcgtattca ggaactggct cagaatatcc acaaactgat tgttcaccac 1800

aatctgccgg atctgatgta tcgcgcattt gaagtgctgc cgacgatggt aatgactccg 1860

tatgctgcat tccagaaaga gctgcacggt atgaccgaag aagtttacct cgacgaaatg 1920

gtaggtcgta ttaacgccaa tatgatcctt ccgtacccgc cgggagttcc tctggtaatg 1980

ccgggtgaaa tgatcaccga agaaagccgt ccggttctgg agttcctgca gatgctgtgt 2040

gaaatcggcg ctcactatcc gggctttgaa accgatattc acggtgcata ccgtcaggct 2100

gatggccgct ataccgttaa ggtattgaaa gaagaaagca aaaaataa 2148

<210> 3

<211> 36

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

gcatcccata tgaacgttat tgcaatattg aatcac 36

<210> 4

<211> 38

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

ttacgccaag cttttttttg ctttcttctt tcaatacc 38

<210> 5

<211> 30

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

gcaatattga atcgcatggg ggtttatttt 30

<210> 6

<211> 30

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

aaaataaacc cccatgcgat tcaatattgc 30

<210> 7

<211> 39

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

cgaccgtgac gacttattaa gactgatcga aaacaatgc 39

<210> 8

<211> 39

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

gcattgtttt cgatcagtct taataagtcg tcacggtcg 39

<210> 9

<211> 30

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

cgtattcctc tctcgatgta agcctgaatg 30

<210> 10

<211> 31

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

catcgagaga ggaatacgta ttagcgaacg c 31

<210> 11

<211> 36

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

gcgctgggtg ctgctggaga tattgctaat aagatc 36

<210> 12

<211> 36

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

gatcttatta gcaatatctc cagcagcacc cagcgc 36

<210> 13

<211> 38

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

gatttctttg gtccgaatac cgtgaaatct gatatttc 38

<210> 14

<211> 38

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

gaaatatcag atttcacggt attcggacca aagaaatc 38

<210> 15

<211> 37

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

ctgcgaacaa aattgttggt atgcactctg ctccagc 37

<210> 16

<211> 37

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 16

gctggagcag agtgcatacc aacaattttg ttcgcag 37

<210> 17

<211> 35

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 17

cgccaagctt ttttttgctt tcttctttca atacc 35

Claims (8)

1. A lysine decarboxylase which has the amino acid sequence shown in SEQ ID NO. 1, wherein the amino acid residue at the position 44 is mutated into Arg.

2. An expression vector comprising the coding sequence for lysine decarboxylase of claim 1.

3. A host cell comprising the expression vector of claim 2 or having integrated into its genome the coding sequence for lysine decarboxylase of claim 1, and which is a bacterium.

4. The host cell of claim 3, wherein the host cell is E.coli (E.coli)E. coli) Corynebacterium glutamicum (C.) (Corynebacterium glutamicum) Hafnia alvei: (Hafnia alvei) Or Bacillus subtilis (A), (B)Bacillus subtilis)。

5.The host cell of claim 4, wherein the host cell is E.coli (E.coli)E. coli)。

6. A method of producing 1, 5-pentanediamine, the method comprising:

(1) producing 1, 5-pentanediamine using the lysine decarboxylase of claim 1 or the host cell of any one of claims 3-5; and

(2) separating 1, 5-pentanediamine from the system in the step (1).

7. A method of producing 1, 5-pentanediamine, the method comprising:

1, 5-pentanediamine is produced by using a lysine decarboxylase which has an amino acid sequence shown in SEQ ID NO. 1 but in which the amino acid residue at position 44 is mutated to Arg;

wherein the yield of 1, 5-pentanediamine produced by the lysine decarboxylase is more than 1.7 times of that produced by the lysine decarboxylase shown in SEQ ID NO. 1.

8. Use of the lysine decarboxylase as defined in claim 1 or the expression vector as defined in claim 2 or the host cell as defined in any one of claims 3 to 5 for the production of 1, 5-pentanediamine.