CN111690627B

CN111690627B - Endo-1, 3-fucoidan and application thereof

Info

Publication number: CN111690627B
Application number: CN202010465425.5A
Authority: CN
Inventors: 常耀光; 申晶晶; 薛长湖; 张玉莹; 梅轩伟; 陈广宁; 唐庆娟; 王玉明
Original assignee: Ocean University of China
Current assignee: Ocean University of China
Priority date: 2020-05-28
Filing date: 2020-05-28
Publication date: 2022-02-01
Anticipated expiration: 2040-05-28
Also published as: CN111690627A

Abstract

The invention relates to the technical field of biotechnology, and particularly relates to endo-1, 3-fucoidan and application thereof. The invention provides an endo-1, 3-fucoidan, the amino acid sequence of which is SEQ ID NO.1 and an enzyme which is derived from 1 and has the enzyme activity of 1 through substituting, deleting or adding one or more amino acids. The invention provides an enzyme with a novel sequence, and breaks through the key bottlenecks of efficient acquisition and practical application of endo-1, 3-fucoidan and large-scale preparation of fucosan low-molecular-weight polysaccharide and oligosaccharide.

Description

Endo-1, 3-fucoidan and application thereof

Technical Field

The invention relates to the technical field of biotechnology, and particularly relates to endo-1, 3-fucoidan and application thereof.

Background

Fucosan, also called fucosan sulfate, fucoidan, is an important marine food polysaccharide. Fucosan has abundant physiological regulation function and good biomaterial property, and has great application potential which is widely accepted. It is mainly composed of fucose and sulfate groups, and fucoidan can be classified into type I and type II according to the current classification. The I-type fucosan is composed of repeating unit structures formed by connecting fucose through

alpha

1,3 glycosidic bonds, and the structures are mainly distributed in brown algae of sea cucumber, sea urchin, laminariales and nebulales; the type II fucoidan is composed of repeating unit structures formed by alternatively connecting fucose through

alpha

1,3 and

alpha

1,4 glycosidic bonds, and the structures are mainly distributed in brown algae of Fucales.

Fucosan has large molecular weight, low absorption rate and bioavailability; the viscosity is high, the separation is difficult in the separation and purification process, and the product post-treatment is complicated, so that the product purity and the yield are low. The low molecular weight fucosan and oligosaccharide obtained by degrading the fucosan have the characteristics of small viscosity, good water solubility, high bioavailability and the like, are potential functional food factors, and show good application prospects in the food and medicine industries.

The method for obtaining the low molecular weight fucosan and the oligosaccharide by enzymatic degradation accords with the development trend of green clean production at present. Endo-1, 3-fucoidan is a fucoidan-degrading core tool enzyme that specifically cleaves the

α

1,3 glycosidic bond in fucoidan in an endo-mode. Previous researches have proved that the endo-1, 3-fucoidan can be used in the fields of fucosan structure analysis, fucooligosaccharide preparation and the like, but only two types of currently reported endo-1, 3-fucoidan, which are all wild-type fucoidan, are respectively derived from Wenyingzhuangiantucanthrica CZ1127^TAnd patent strain SI-0098. The wild enzyme can produce the endo-1, 3-fucoidan only under the induction of the fucosan substrate, the preparation cost of the enzyme is high, the purification difficulty is large, the total amount of the produced enzyme is low, the activity is low,it is difficult to apply to the large-scale production of low molecular weight fucosan and oligosaccharide. Molecular cloning can realize high-efficiency expression and mass acquisition of enzymes according to genes, and is an ideal strategy for solving the problems. The realization of the clone expression of the enzyme production sequence can provide a tool for degrading the fucosan by an enzyme method and provide a premise for the large-scale production and application of the low molecular weight fucosan and the oligosaccharide.

Disclosure of Invention

The technical problems to be solved by the invention are that the yield of the wild endo-1, 3-fucoidan is low, the activity is low, the purification difficulty is high, the enzyme producing strain can produce the enzyme under the induction of a fucoidan substrate, so that the preparation cost of the enzyme is high, and the large-scale production of low molecular weight fucoidan and oligosaccharide has no enzyme availability.

To solve the above problems, the present invention is based on Wenyingzhuangiantucanavanilytica CZ1127^TA gene is obtained by discovering in the strain, the original nucleotide codes 408 amino acids, and the amino acid sequence is shown as SEQ ID NO. 1. The amino acids at positions 1-19 are predicted to be Signal peptide sequences by using Signal P software, and the theoretical molecular weight of the Signal peptide sequences is predicted to be 48kDa by using ExPASy software. The enzyme is found to have no similarity with the enzyme with the known sequence according to the sequence alignment, so the enzyme is an enzyme with novel sequence. Based on the gene, an endo-1, 3-fucosidase gene and application thereof are provided, so that key bottlenecks of efficient acquisition and practical application of endo-1, 3-fucosidase and large-scale preparation of fucosan low-molecular-weight polysaccharide and oligosaccharide are broken through.

In order to achieve the aim, the invention provides an endo-1, 3-fucoidan, the amino acid sequence of which is SEQ ID NO.1 and an enzyme which is obtained by substituting, deleting or adding one or more amino acids and has the enzymatic activity of 1 and is derived from 1.

SEQ ID NO.1：

MIPNIKKLIVLSLVVLASSCSTTKTHTNTSTIVKNEKIDFYVSDGSKFISQDFYPKFSWESTPEYAMFGNGASLLTPKEVEKIAAKTDFICIEKNHAYRTLEFAEIGAREEIKNFKAIKPEIKALYYFNSAYAWPFTSYNKNFKKNKIDDYPELKKFILVDKTTGELQHRNNTLCFDVLNPEFRTWWVKTVAQGVKDSGADGVFIDQMHGFVWLRSSQKEEVEKAMGEMMANLKAAIGTNKILLGNNASSVKDVFPAIDAAMFEHYNNKKLSKENLLKEWGDMLANAKAGKMSIFRIGVEAEKEEASQTLIKGSRGESLEELSKERLEYYQACFLIGAQPYSYFQYGWGWRLDTGPLVDYPELQKPLGAPKGAYKRLHENGWEFTREFEHASVWVDTEKKEAKIEWKK

The nucleotide sequence corresponding to the gene for coding the endo-1, 3-fucoidan is shown as SEQ ID NO. 2; and all genes which can be translated into SEQ ID NO. 1.

SEQ ID NO.2：

ATGATTCCAAATATTAAAAAGCTTATCGTTTTATCATTAGTTGTACTGGCTAGTTCTTGTAGTACAACAAAAACACACACCAATACTTCAACAATCGTTAAGAACGAGAAAATAGATTTTTATGTAAGTGATGGTAGTAAGTTCATTTCACAAGATTTTTACCCTAAGTTCAGTTGGGAATCCACACCAGAATATGCTATGTTTGGTAATGGAGCTAGCTTATTAACTCCTAAAGAAGTTGAAAAAATTGCTGCTAAAACAGATTTTATTTGTATTGAAAAAAATCATGCTTACAGAACTTTAGAATTTGCAGAAATTGGAGCTAGAGAAGAAATTAAAAACTTTAAAGCTATAAAGCCTGAGATAAAAGCTTTGTATTACTTTAACTCAGCTTATGCTTGGCCTTTTACATCATATAACAAGAATTTTAAGAAAAATAAAATAGATGATTATCCAGAGTTGAAGAAATTTATATTGGTAGATAAAACGACTGGAGAATTACAACATAGGAACAATACACTTTGTTTTGATGTATTAAACCCTGAGTTTAGAACTTGGTGGGTAAAAACAGTGGCACAAGGAGTAAAAGACTCTGGTGCTGATGGAGTTTTTATAGATCAAATGCATGGTTTTGTTTGGTTACGTAGTTCTCAAAAGGAGGAAGTTGAAAAAGCCATGGGTGAGATGATGGCAAACTTAAAAGCAGCAATAGGGACAAATAAAATATTATTAGGGAATAATGCCTCTAGCGTAAAAGATGTTTTTCCTGCGATTGATGCAGCTATGTTTGAACATTATAATAATAAAAAGTTAAGTAAAGAAAACCTTCTGAAAGAATGGGGAGATATGTTAGCAAATGCCAAAGCAGGTAAAATGTCTATTTTTAGAATAGGTGTGGAAGCTGAAAAAGAAGAGGCAAGTCAAACATTAATAAAAGGTTCAAGAGGGGAATCTCTTGAAGAATTGTCTAAAGAGCGATTAGAATATTACCAAGCATGTTTTTTAATAGGTGCGCAGCCTTATTCTTACTTCCAATATGGTTGGGGGTGGCGTTTAGATACTGGCCCATTGGTAGATTATCCTGAATTACAAAAACCACTTGGAGCTCCAAAGGGAGCATATAAGCGTTTACATGAAAACGGTTGGGAGTTTACTCGTGAATTTGAACATGCTTCGGTTTGGGTAGATACTGAAAAGAAAGAAGCGAAAATTGAATGGAAAAAGTAA

The invention provides a preparation method of the endo-1, 3-fucoidan, which expresses enzymes in a heterologous way in systems such as escherichia coli, bacillus subtilis, pichia pastoris and the like, and can prepare a large amount of endo-1, 3-fucoidan through inducing enzyme production. The endo-1, 3-fucoidan enzyme can be successfully expressed in a heterologous way in systems such as escherichia coli, bacillus subtilis, pichia pastoris and the like to be used for mass production and preparation of target enzyme, has the highest expression activity in the pichia pastoris expression system, and can be effectively applied to the fields of chemical analysis, food industry and the like. The invention has the beneficial effects that:

(1) the endo-1, 3-fucosidase gene can realize the high-efficiency preparation of endo-1, 3-fucosidase in a cloning expression mode;

(2) the endo-1, 3-fucoidan can degrade fucoidan from various sources in an endo mode, and can rapidly degrade the fucoidan in a short time to generate fucoidan and oligosaccharide with different molecular weights of 400Da-2000kDa under the condition of controlling enzyme adding amount or reaction time;

drawings

FIG. 1: the nucleic acid electrophoresis pattern of the endo-1, 3-fucoidan encoding gene after PCR amplification;

FIG. 2: schematic diagram of the optimal reaction conditions of the endo-1, 3-fucoidan;

FIG. 3: schematic diagram of producing fucosan with different molecular weights by using endo-1, 3-fucoidan in controlled enzyme adding amount

FIG. 4: the endo-1, 3-fucoidan of the invention produces fucoidan with different molecular weights under the condition of controlling the reaction time;

FIG. 5: the endo-1, 3-fucoidan of the invention produces a schematic representation of fucoidan of different molecular weights under conditions of controlled substrate concentration.

Detailed Description

In order to make the objects, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the drawings in the embodiments of the present invention. It is to be understood that the embodiments described are only a few embodiments of the present invention, and not all embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.

Example 1: heterologous expression of endo-1, 3-fucoidan in E.coli

Culture of W.fucanicytica CZ1127 in 2216E Medium^TUntil the end of logarithm, extracting whole genome DNA, designing upstream and downstream primers according to target genes, performing PCR with the whole genome as a template at 94 ℃ for 5min, and performing 25 cycles of PCR at 94 ℃ for 30s, 50 ℃ for 30s, and 72 ℃ for 60 s. The PCR product is subjected to nucleic acid electrophoresis identification and tapping, recovered and purified to obtain an endo-1, 3-fucosidase gene fragment (as shown in figure 1). The plasmid pET-28a (+) and the obtained endo-1, 3-fucosidase gene fragment are subjected to double enzyme digestion by BamHI and XhoI at the same time, the enzyme digestion is carried out at 37 ℃ for 2h, then the nucleic acid electrophoresis verification is carried out, the target gene and the target plasmid are recovered by tapping, the recovered product is connected at 16 ℃ for 1h by DNA ligase, the connected product is transformed into DH5 alpha competent cells and cultured on a solid LB culture medium containing kanamycin resistance overnight, a plurality of transformants are picked up to an LB liquid culture medium containing kanamycin and cultured at 37 ℃ and 220rpm for 12h, and the transformants are subjected to PCR verification after the plasmids are extracted. The recombinant plasmid was sent to Shanghai Biotech company for sequencing, and the recombinant plasmid with the correct sequence was named pET-28a (+) -endo-1, 3-fucosanase. The recombinant plasmid with the correct sequencing is transformed into BL21(DE3) series competent cells or Rosetta competent cells to form a recombinant strain. Selecting a plurality of transformants in an LB culture medium containing kanamycin resistance, culturing at 37 ℃ and 220rpm for about 10h, extracting plasmids, performing PCR verification, and sending the recombinant plasmids to Shanghai Biotech company for sequence determination. The correctly sequenced strain is inoculated into LB culture medium containing kanamycin resistance, and when the strain is cultured at 37 ℃ until the OD600 value reaches 0.4, IPTG with the final concentration of 0.5mM is added, the induction temperature is 17 ℃, and the induction time is 12 h. And (3) centrifugally collecting thalli, washing the resuspended thalli by using a buffer solution, and carrying out ultrasonic disruption to obtain an intracellular enzyme solution, namely a crude enzyme solution containing the endo-1, 3-fucosidase.

Example 2: heterologous expression of endo-1, 3-fucoidan in Bacillus subtilis

Designing upstream and downstream primers, calling a target sequence by PCR, wherein the PCR process is the same as that of 1). Carrying out double enzyme digestion on the pMA5 vector and a target sequence by using HindIII and EcoRI at the same time, connecting the target gene subjected to enzyme digestion to the vector subjected to the same enzyme digestion, and transforming the constructed expression vector into a bacillus subtilis BS WB600 expression host. Positive recombinants were screened on kanamycin-resistant plates. The recombinant bacteria which are verified to be correct are inoculated into LB culture medium containing kanamycin resistance and cultured for 12h at the temperature of 37 ℃. Then, the cells were inoculated into LB medium containing kanamycin resistance in an amount of 1% and cultured at 37 ℃ for 16 hours. And (3) centrifugally collecting thalli, washing the resuspended thalli by using a buffer solution, and carrying out ultrasonic disruption to obtain an intracellular enzyme solution, namely a crude enzyme solution containing the endo-1, 3-fucosidase.

Example 3: heterologous expression of endo-1, 3-fucoidan in pichia pastoris

Designing upstream and downstream primers, calling a target sequence by PCR, wherein the PCR process is the same as that of 1). The pPIC9K vector and the target sequence were digested simultaneously with EcoRI and NotI, and the digested target gene was ligated to the pPIC9K vector. And (3) carrying out enzyme digestion on the constructed recombinant plasmid overnight by using SalI enzyme, then recovering, and carrying out electrophoresis detection on the linearized and non-linearized plasmids. The linearized intelligence was electrically transformed into GS115 competent cells, and single colonies were extracted for PCR validation. The single clone with correct sequencing and antibiotic screening is cultured in YPD liquid medium at 30 deg.c and 220rpm for 12 hr. Then inoculating into BMGY culture medium with pH6.0, culturing at 30 deg.C and 220rpm until OD600 is 5.0, centrifuging, adding BMMY culture medium with pH6.0, culturing, adding 0.5% methanol into enzyme for 12h, inducing expression at 29 deg.C and 220rpm for 72 h. Centrifuging and collecting the extracellular supernatant to obtain the crude enzyme solution.

Example 4: comparison of endo-1, 3-fucoidan Activity in various expression systems

mu.L of the enzyme solution diluted appropriately in example 1-example 3 was mixed with 50. mu.L of 2mg/mL fucosan solution, respectively, and reacted at 40 ℃ for 10min, followed by inactivation at 100 ℃ for 5 min. Also, 50. mu.L of an appropriately diluted inactivated enzyme solution was mixed with the fucosan solution and reacted under the same conditions as a control. And detecting the reducing sugar in the experimental group and the control group system by using a reducing sugar incremental method pHBH method, and calculating the enzyme activity of the endo-1, 3-fucoidan. The 1U activity is defined as the activity to generate 1. mu. mol of reducing sugars within 1 min. The activity of 1mL fermentation liquid under different expression systems detected by the pHBH method is shown in the following table:

from the results, the endo-1, 3-fucoidan can be successfully expressed in heterologous systems such as escherichia coli, bacillus subtilis, pichia pastoris and the like, and the expression activity in the pichia pastoris is highest. The pichia pastoris expression system can realize the extracellular expression of the recombinase, has low foreign protein content, simplifies the subsequent separation and purification operation of the recombinase, and is beneficial to the development and production of health products, foods and medicines.

Example 5: enzymatic Properties of endo-1, 3-fucoidan

In order to obtain the optimum reaction conditions of the endo-1, 3-fucoidan, the temperature, pH and the like were studied.

1) Optimum reaction temperature and temperature stability

The recombinant enzyme solution obtained from Escherichia coli of example 1 was diluted appropriately and mixed with a fucosan substrate solution of pH 8.0 and 2mg/mL, and reacted at 15, 20, 25, 30, 35, 40, 45, 50, 55, and 60 ℃ for 10min, after inactivation, the activity was measured by the pHBH method using a reducing sugar increment detection method, and the specific enzyme activity was calculated, and the result is shown in FIG. 2A, in which the optimum reaction temperature was 40 ℃. After a proper amount of enzyme is placed at 4 ℃, 25 ℃, 30 ℃ and 40 ℃ for 0, 1, 2, 4, 6, 16 and 24 hours, a certain amount of enzyme is taken to be mixed with a substrate solution for measuring the activity, the activity when the enzyme is placed at 4 ℃ for 0 hour is 100%, and the result is expressed by residual enzyme activity (figure 2B), and the result shows that the enzyme can be stably placed at least for 1d (the residual enzyme activity is more than 80%) at 4 ℃, 25 ℃ and 30 ℃.

2) Reaction pH and pH stability

Using the recombinant enzyme solution obtained from Escherichia coli of example 1, an appropriate amount of 2mg/mL fucosan substrate solution prepared with buffers of different pH values (pH 4.0, pH 4.5, pH 5.0, pH 5.5, pH6.0, pH6.5, pH7.0, sodium dihydrogen phosphate-disodium hydrogen phosphate buffers of pH6.5, pH7.0, pH 7.5, pH 8.0, pH 8.5, pH 9.0, sodium carbonate-sodium bicarbonate buffers of pH 9.0, pH 9.5, pH 10.0, pH 10.5, pH 11.0) was mixed so that the reaction was carried out at different pH values for 10min, and after inactivation, the activity was measured by the pHBH method and the specific enzyme activity was calculated, as shown in FIG. 2C, indicating that endo-1, 3-fucoidan was active under the condition of pH 6.5-10.5; the optimum reaction pH value is 8.0. And (3) placing a proper amount of enzyme at the pH value for 1h, adjusting the pH value to 8.0, mixing with a substrate, and carrying out enzyme activity determination. The enzyme activity with the highest activity is recorded as 100%, and the rest enzyme activities are all expressed as residual enzyme activities (figure 2D), and the result shows that the enzyme can be kept stable (the enzyme activity residue is more than 80%) at the pH of 6.5-10.0, which indicates that the enzyme has a wider pH stable range.

3) Effect of Metal ions and organic reagents on endo-1, 3-fucoidan

Organic reagents and metal ions are added in the enzymolysis reaction, then the relative residual enzyme activity is calculated, and the result is detailed in the following table. Hg is a mercury vapor²⁺、Pb³⁺、Cr³⁺、Al³⁺Can partially inhibit enzyme activity; SDS has the strongest inhibitory effect on the recombinase.

Example 6: degradation capability of endo-1, 3-fucoidan on various fucoidans

50 mu L of recombinase analyzed by an appropriately diluted escherichia coli expression system is mixed with 50 mu L of fucosan solution from 2mg/mL acaudina molpadioides, American ginseng, apostichopus japonicus, Mexican ginseng, thelenota ananas and Turkish ginseng to react for 10min at 40 ℃, and then inactivated for 5min at 100 ℃. Also, 50. mu.L of the inactivated enzyme solution diluted appropriately was mixed with each type of the fucosan solution and reacted under the same conditions as a control. The reducing sugar in the experimental group and the control group system was detected by using the pHBH method, and the enzyme activity of the endo-1, 3-fucoidan was calculated, and the results are shown in the following table, and the enzyme activity was defined as in example 4. The results show that the endo-1, 3-fucoidan in the invention at least has degradation capability on the fucoidan from six sources in the research, can produce various low molecular weight fucoidans and oligosaccharides with different structures, and is used for the research on the structure analysis and the structure-effect relationship of the fucoidan.

Example 7: fucosan with different molecular weights can be prepared by controlling the enzyme adding amount

0.001U, 0.01U, 0.05U, 0.1U, 0.2U, 0.5U and 1U of the recombinant enzyme obtained from the E.coli system in example 1 were added to 100mg (2 mg/mL) of a fucosan solution having a pH of 8.0, and 500. mu.L of the recombinant enzyme was inactivated after 1 hour reaction at 40 ℃. A gel column Shodex Ohpak LB-806M was used to connect a differential detector and a multi-angle laser light scattering detector (HPSEC-MALLS method) to monitor the molecular weight of fucosan, and the mobile phase was pH 7.4, 0.15M NaCl containing 10mM PBS, and the flow rate was 0.5 mL/min. The results of molecular weight detection are shown in FIG. 3, with the increase of enzyme adding amount, fucoidan and oligosaccharide with different molecular weights of 400Da-2000kDa can be obtained within 1 h.

Example 8: fucoidan with different molecular weights can be prepared by controlling the reaction time

0.1U of the recombinase obtained from the Escherichia coli system in example 1 was added to 100mg (2 mg/mL) of a fucosan solution having a pH of 8.0, and 500. mu.L of the recombinase was inactivated after reaction at 40 ℃ for 5min, 10min, 20min, 30min, 40min, 50min, and 60min, respectively. The molecular weight of fucosan was monitored by the HPSEC-MALLS method described above, and the mobile phase conditions were the same as in example 7. The results of molecular weight detection are shown in FIG. 4, with the increase of enzyme adding amount, fucoidan and oligosaccharide with different molecular weights of 600Da-2000kDa can be obtained within 1 h.

Example 9: fucoidan with different molecular weights can be prepared by controlling the concentration of the substrate

0.1U of the recombinant enzyme obtained in the E.coli system of example 1 was added to a solution of 100mg (concentration: 0.1mg/mL, 0.2mg/mL, 0.5mg/mL, 1.0mg/mL, 2.0mg/mL, 3.0mg/mL, 5.0mg/mL) of fucosan at pH 8.0, and then reacted at 40 ℃ for 1 hour, followed by inactivation of 500. mu.L of the recombinant enzyme. The molecular weight of fucosan was monitored by the HPSEC-MALLS method described above, and the mobile phase conditions were the same as in example 7. The results of molecular weight detection are shown in FIG. 5, with the increase of enzyme adding amount, fucoidan and oligosaccharide with different molecular weights of 600Da-2000kDa can be obtained within 1 h.

In the general examples 7-9, fucoidan and oligosaccharide with different molecular weights of 400-2000kDa can be prepared by controlling the amount of enzyme, reaction time or substrate concentration. The fucoidan with different molecular weights lays a foundation for research on the structure-effect relationship of the fucoidan.

Finally, it should be noted that the above embodiments describe specific embodiments of the present invention, but do not limit the present invention; it will be understood by those skilled in the art that these are by way of example only and that the scope of the invention is defined by the appended claims. All changes, modifications and equivalents may be resorted to, falling within the scope of the invention.

Sequence listing

<110> China oceanic university

<120> endo-1, 3-fucoidan and application thereof

<130> China oceanic university

<140> 1

<141> 2020-05-20

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 408

<212> PRT

<213> Wenyingzhuangia fucanilytica CZ1127T

<400> 1

Met Ile Pro Asn Ile Lys Lys Leu Ile Val Leu Ser Leu Val Val Leu

1 5 10 15

Ala Ser Ser Cys Ser Thr Thr Lys Thr His Thr Asn Thr Ser Thr Ile

20 25 30

Val Lys Asn Glu Lys Ile Asp Phe Tyr Val Ser Asp Gly Ser Lys Phe

35 40 45

Ile Ser Gln Asp Phe Tyr Pro Lys Phe Ser Trp Glu Ser Thr Pro Glu

50 55 60

Tyr Ala Met Phe Gly Asn Gly Ala Ser Leu Leu Thr Pro Lys Glu Val

65 70 75 80

Glu Lys Ile Ala Ala Lys Thr Asp Phe Ile Cys Ile Glu Lys Asn His

85 90 95

Ala Tyr Arg Thr Leu Glu Phe Ala Glu Ile Gly Ala Arg Glu Glu Ile

100 105 110

Lys Asn Phe Lys Ala Ile Lys Pro Glu Ile Lys Ala Leu Tyr Tyr Phe

115 120 125

Asn Ser Ala Tyr Ala Trp Pro Phe Thr Ser Tyr Asn Lys Asn Phe Lys

130 135 140

Lys Asn Lys Ile Asp Asp Tyr Pro Glu Leu Lys Lys Phe Ile Leu Val

145 150 155 160

Asp Lys Thr Thr Gly Glu Leu Gln His Arg Asn Asn Thr Leu Cys Phe

165 170 175

Asp Val Leu Asn Pro Glu Phe Arg Thr Trp Trp Val Lys Thr Val Ala

180 185 190

Gln Gly Val Lys Asp Ser Gly Ala Asp Gly Val Phe Ile Asp Gln Met

195 200 205

His Gly Phe Val Trp Leu Arg Ser Ser Gln Lys Glu Glu Val Glu Lys

210 215 220

Ala Met Gly Glu Met Met Ala Asn Leu Lys Ala Ala Ile Gly Thr Asn

225 230 235 240

Lys Ile Leu Leu Gly Asn Asn Ala Ser Ser Val Lys Asp Val Phe Pro

245 250 255

Ala Ile Asp Ala Ala Met Phe Glu His Tyr Asn Asn Lys Lys Leu Ser

260 265 270

Lys Glu Asn Leu Leu Lys Glu Trp Gly Asp Met Leu Ala Asn Ala Lys

275 280 285

Ala Gly Lys Met Ser Ile Phe Arg Ile Gly Val Glu Ala Glu Lys Glu

290 295 300

Glu Ala Ser Gln Thr Leu Ile Lys Gly Ser Arg Gly Glu Ser Leu Glu

305 310 315 320

Glu Leu Ser Lys Glu Arg Leu Glu Tyr Tyr Gln Ala Cys Phe Leu Ile

325 330 335

Gly Ala Gln Pro Tyr Ser Tyr Phe Gln Tyr Gly Trp Gly Trp Arg Leu

340 345 350

Asp Thr Gly Pro Leu Val Asp Tyr Pro Glu Leu Gln Lys Pro Leu Gly

355 360 365

Ala Pro Lys Gly Ala Tyr Lys Arg Leu His Glu Asn Gly Trp Glu Phe

370 375 380

Thr Arg Glu Phe Glu His Ala Ser Val Trp Val Asp Thr Glu Lys Lys

385 390 395 400

Glu Ala Lys Ile Glu Trp Lys Lys

405

<210> 2

<211> 1227

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

atgattccaa atattaaaaa gcttatcgtt ttatcattag ttgtactggc tagttcttgt 60

agtacaacaa aaacacacac caatacttca acaatcgtta agaacgagaa aatagatttt 120

tatgtaagtg atggtagtaa gttcatttca caagattttt accctaagtt cagttgggaa 180

tccacaccag aatatgctat gtttggtaat ggagctagct tattaactcc taaagaagtt 240

gaaaaaattg ctgctaaaac agattttatt tgtattgaaa aaaatcatgc ttacagaact 300

ttagaatttg cagaaattgg agctagagaa gaaattaaaa actttaaagc tataaagcct 360

gagataaaag ctttgtatta ctttaactca gcttatgctt ggccttttac atcatataac 420

aagaatttta agaaaaataa aatagatgat tatccagagt tgaagaaatt tatattggta 480

gataaaacga ctggagaatt acaacatagg aacaatacac tttgttttga tgtattaaac 540

cctgagttta gaacttggtg ggtaaaaaca gtggcacaag gagtaaaaga ctctggtgct 600

gatggagttt ttatagatca aatgcatggt tttgtttggt tacgtagttc tcaaaaggag 660

gaagttgaaa aagccatggg tgagatgatg gcaaacttaa aagcagcaat agggacaaat 720

aaaatattat tagggaataa tgcctctagc gtaaaagatg tttttcctgc gattgatgca 780

gctatgtttg aacattataa taataaaaag ttaagtaaag aaaaccttct gaaagaatgg 840

ggagatatgt tagcaaatgc caaagcaggt aaaatgtcta tttttagaat aggtgtggaa 900

gctgaaaaag aagaggcaag tcaaacatta ataaaaggtt caagagggga atctcttgaa 960

gaattgtcta aagagcgatt agaatattac caagcatgtt ttttaatagg tgcgcagcct 1020

tattcttact tccaatatgg ttgggggtgg cgtttagata ctggcccatt ggtagattat 1080

cctgaattac aaaaaccact tggagctcca aagggagcat ataagcgttt acatgaaaac 1140

ggttgggagt ttactcgtga atttgaacat gcttcggttt gggtagatac tgaaaagaaa 1200

gaagcgaaaa ttgaatggaa aaagtaa 1227

Claims

1. An application of endo-1, 3-fucoidan in degrading fucosan, wherein the amino acid sequence of the endo-1, 3-fucoidan is SEQ ID number 1.